new primers for the class actinobacteria : application to ......ampliﬁcation of actinobacterial...

Environmental Microbiology (2003)

5

(10), 828–841 doi:10.1046/j.1462-2920.2003.00483.x

© 2003 Society for Applied Microbiology and Blackwell Publishing Ltd

Blackwell Science, LtdOxford, UKEMIEnvironmental Microbiology1462-2920Blackwell Publishing Ltd, 20035

10828841

Original Article

PCR primers for the class ActinobacteriaJ. E. M. Stach

et al

.

Received 4 April, 2003; accepted 22 May, 2003. *For correspon-dence. E-mail [email protected]; Tel. (

+

44) 1227 823336; Fax(

+

44) 1227 763912.

New primers for the class

Actinobacteria

: application to marine and terrestrial environments

James E. M. Stach,

1

* Luis A. Maldonado,

2

Alan C. Ward,

2

Michael Goodfellow

2

and Alan T. Bull

1

1

Research School of Biosciences, University of Kent, Canterbury, Kent CT2 7NJ, UK.

2

School of Biology, University of Newcastle, Newcastle upon Tyne NE1 7RU, UK.

Summary

In this study, we redesigned and evaluated primers forthe class

Actinobacteria

.

In silico

testing showed thatthe primers had a perfect match with 82% of generain the class

Actinobacteria

, representing a 26–213%improvement over previously reported primers. Only4% of genera that displayed mismatches did so in theterminal three bases of the 3

¢¢¢¢

end, which is mostcritical for polymerase chain reaction success. Theprimers, designated S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19, amplified an

ªªªª

640 bp stretch of the16S rRNA gene from all actinobacteria tested (except

Rubrobacter radiotolerans

) up to an annealing tem-perature of 72

∞∞∞∞

C. An Actinobacteria AmplificationResource (http://microbe2.ncl.ac.uk/MMB/AAR.htm)was generated to provide a visual guide to aid theamplification of actinobacterial 16S rDNA. Applicationof the primers to DNA extracted from marine and ter-restrial samples revealed the presence of actinobac-teria that have not been described previously. The useof 16S rDNA similarity and DNA–DNA pairing correla-tions showed that almost every actinomycete clonerepresented either a new species or a novel genus.The results of this study reinforce the proposition thatcurrent culture-based techniques drastically underes-timate the diversity of

Actinobacteria

in the environ-ment and highlight the need to evaluate taxon-specific primers regularly in line with improvementsin databases holding 16S rDNA sequences.

Introduction

The class

Actinobacteria

encompasses bacteria that arediverse with respect to their biochemistry, morphology andrelationship to oxygen, but have DNA rich in guanine plus

cytosine and form a distinct phyletic line in the 16S rDNAtree (Embley and Stackebrandt, 1994; Stackebrandt

et al

.,1997). Members of the taxon are of interest primarilybecause of their importance in agriculture, ecology, indus-try and medicine (McNeill and Brown, 1994; Strohl, 2003).Actinobacteria are widely distributed in terrestrial(McVeigh

et al

., 1996; Heuer

et al

., 1997; Hayakawa

et al

.,2000), freshwater (Goodfellow

et al

., 1990; Wohl andMcArthur, 1998) and marine (Goodfellow and Haynes,1984; Takizawa

et al

., 1993; Colquhoun

et al

., 1998) hab-itats where they are involved in the turnover of organicmatter (McCarthy, 1987; Schrempf, 2001) and xenobioticcompounds (Kastner

et al

., 1994; Bunch, 1998; De Schr-ijver and De Mot, 1999). Some actinobacteria are seriouspathogens of animals, including humans, and plants(Locci, 1994; McNeill and Brown, 1994; Trujillo andGoodfellow, 2003), whereas others form nitrogen-fixingassociations with non-leguminous plants (Benson andSilvester, 1993).

Currently, actinobacteria, especially spore-forming act-inomycetes, represent the most economically and bio-technologically valuable prokaryotes, producing over halfthe bioactive compounds present in the Antibiotic Litera-ture Database (Lazzarini

et al

., 2000), notably antibiotics(Lazzarini

et al

., 2000; Strohl, 2003), antitumour agents(Zheng

et al

., 2000; Dieter

et al

., 2003), enzymes(Peczynska-Czoch and Mordarski, 1988; Oldfield

et al

.,1998) and enzyme inhibitors and immunomodifiers(Umezawa, 1988). However, the rediscovery rate of bio-active compounds from microorganisms currently in cul-ture has been estimated to be 95% (Fenical

et al

., 1999).In order to isolate novel actinobacteria for biotechnology,we need first to understand their ecology, which encom-passes diversity, species richness and distribution. Molec-ular techniques overcome culture bias and can be usedto investigate actinobacterial ecology; this approach hasbeen used to detect actinobacteria in environmental sam-ples where corresponding culture-based procedures havebeen unsuccessful (Relman

et al

., 1992; Heuer

et al

.,1997; Rheims

et al

., 1999), and has highlighted novelactinobacterial lineages (McVeigh

et al

., 1996; Rheims

et al

., 1996; 1999; Rheims and Stackebrandt, 1999; Lude-mann and Conrad, 2000). In contrast, there are instanceswhere actinobacteria have been isolated from environ-mental samples but have not been detected in clone librar-ies generated from the same sample (Felske

et al

., 1997;Li

et al

., 1999). Actinobacteria-specific/biased primers

http://microbe2.ncl.ac.uk/MMB/AAR.htm

PCR primers for the class

Actinobacteria 829

© 2003 Society for Applied Microbiology and Blackwell Publishing Ltd,

Environmental Microbiology

,

5

, 828–841

have been designed to increase the likelihood of detectingactinobacterial 16S rDNA in community DNA extractedfrom environmental samples (McVeigh

et al

., 1996; Heuer

et al

., 1997; Ludemann and Conrad, 2000). To this end,McVeigh

et al

. (1996) found that 46 out of 53 clones gen-erated from amplified DNA of community DNA extractedfrom a temperate forest soil were actinobacterial in origin.When the same primers were used to amplify 16S rDNAfrom a rhizosphere soil, only 2% of the clones were ofactinobacterial origin (Macrae

et al

., 2001). Amplificationof 16S rDNA from environmental samples has shown thatprimers specific for actinobacteria have had a successrate of between 2% and 87% (McVeigh

et al

., 1996;Ludemann and Conrad, 2000; Peters

et al

., 2000; Macrae

et al

., 2001).The utility of actinobacteria-specific primers is defined

by both their specificity (i.e. minimal hybridization to non-target DNA) and their coverage (i.e. how many membersof the class

Actinobacteria

are amplified by the primers).These properties are directly influenced by the quality andquantity of sequences used to design the primers, e.g. ifthree actinobacterial sequences are used, primers willhave high specificity but low coverage. Secondly, primersdesigned from alignments dominated by specific generaor species will be biased towards those species and havereduced coverage. The rapid growth in the number of 16SrDNA sequences available in the Ribosomal DatabaseProject (RDP; Maidak

et al

., 2001) serves as a warningto evaluate regularly and, if necessary, redesign primers;when the first sets of actinobacteria-specific primerswere designed (McVeigh

et al

., 1996; Heuer

et al

., 1997),the RDP contained

ª

250 actinobacterial 16S rDNAsequences (McVeigh

et al

., 1996; Maidak

et al

., 2001).Presently, the RDP contains

ª

2300 actinobacterialsequences (Maidak

et al

., 2001), while the forthcomingrelease will comprise 7500 sequences (Cole

et al

., 2003).Clearly, primers designed from a small set of sequenceswill no longer reflect the diversity of those currentlypresent in the databases and, therefore, an evaluation ofactinobacteria-specific primers is warranted.

The aims of this study were to: (i) design actinobacteria-

specific primers based on an alignment of an equal fre-quency of 16S rRNA genes from all genera; (ii) evaluateand compare the newly designed primers

in silico

; (iii) testprimer specificity on a comprehensive library of actinobac-teria and non-actinobacteria type strains; (iv) evaluate the

in situ

specificity of the primers in terrestrial and marineenvironments; and (v) produce an Actinobacteria Amplifi-cation Resource that will allow investigators to adjust theprimer set in order to amplify members of specific actino-bacterial genera.

The actinobacteria primers designed in this study gavea 26–213% increase in the coverage of actinobacteriaover corresponding primers and allowed the detection ofmany novel actinobacterial lineages that have been unde-tected previously (McVeigh

et al

., 1996; Heuer

et al

.,1997; Ludemann and Conrad, 2000). It is apparent fromthese results that actinobacterial diversity based ondetected or cultivated species is underestimated by atleast an order of magnitude.

Results

Testing of primers

in silico

The theoretical specificities of primers S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19 were tested by submissionto the

CHECK

_

PROBE

algorithm of the RDP, using defaultparameters and allowing zero mismatches. Previouslydescribed actinobacteria-specific primers were also sub-mitted for comparison. The sequence, target position and

CHECK

_

PROBE

results for each of the primers are given inTable 1. Primer S-C-Act-0235-a-S-20 displayed a 26%increase in the number of perfect actinobacteria matchesover primer ACT283F, and displayed a 213% increaseover primer F243. Primer S-C-Act-0878-a-A-19 gave an18% increase over primer ACT1360R and 13% overprimer AB1165r. Primers S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19 amplify the V3 to V5 regions of the 16SrRNA gene (Brosius

et al

., 1981). Representatives of 168genera were used in the alignment, and only 18% of theseshowed one or more mismatches with primer S-C-Act-

Table 1.

Comparison of actinomycete-specific primers.

Primer

a

Sequence (5

¢Æ

3

¢

)Identicalmatches

b

Percentageactinomtycetes

b

Identical actinomycetematches Reference

AB1165r ACCTTCCTCCGAGTTRAC 2013 99.5 2003 Ludemann and Conrad (2000)ACT1360R CTGATCTGCGATTACTAGCGACTCC 1731 99.7 1725 McVeigh

et al

. (1996)ACT283F GGGTAGCCGGCCUGAGAGGG 2632 88.3 2324 McVeigh

et al

. (1996)F243 GGATGAGCCCGCGGCCTA 836 100 836 Heuer

et al

. (1997)S-C-Act-235-a-S-20 CGCGGCCTATCAGCTTGTTG 2646 99.7 2639 This studyS-C-Act-878-a-A-19 CCGTACTCCCCAGGCGGGG 2321 87 2019 This study

a.

E. coli

numbering (Brosius

et al

., 1981).

b.

Information obtained using the

PROBE

_

MATCH

function of the RDP including sequences posted as unaligned by the RDP.

830

J. E. M. Stach

et al.

© 2003 Society for Applied Microbiology and Blackwell Publishing Ltd,

Environmental Microbiology

,

5

, 828–841

0235-a-S-20; only 4% displayed mismatches in the termi-nal three bases of the 3

¢

end that is most crucial topolymerase chain reaction (PCR) success (Sommer andTautz, 1989).

Testing of primers with pure cultures and environmental templates

Optimal primer annealing conditions for the new primerset were investigated by gradient PCR using DNA from10 type strains (see Table 2); the gradient was made overan annealing temperature range of 68–72

∞

C. All 10 typestrains yielded amplicons of the predicted size over theentire gradient. A gradient PCR approach was alsoapplied to the 14 non-actinomycete type strains over a50–65

∞

C range; none of these organisms gave amplifica-tion products. Further testing of the actinobacteria typestrain library was made with the two-step amplificationprotocol described above, thus enabling a positive identi-fication of actinobacteria in under 1.5 h. All 147 actinobac-teria tested yielded an amplicon of the predicted sizeexcept the type strain

Rubrobacter radiotolerans

; the fail-ure of the primers to amplify 16S rDNA from this organismwas expected (see Fig. 1). DNA extracted from environ-mental sources contains co-extracted contaminants thataffect both PCR specificity and efficiency (Stach

et al

.,2001); hence, a ‘touchdown’ protocol was implemented toamplify DNA extracted from the marine sediments andsoils. All environmental DNA samples gave a single ampl-icon of the predicted size using this protocol.

Screening and phylogenetic analysis of clones

One hundred clones were generated from environmentalDNA and, using a novel rapid clone screening method,were dereplicated to 85 in 50 h. An example of the single-strand conformation polymorphism (SSCP) dereplicationof 25 clones generated from marine sediment D is shownin Fig. 2. Phylogenetic analysis was continued with thedereplicated clones. Clones were assigned codes basedon the sample site and position in the microtitre plate.Code ASb10, for example, indicates that the clone wasisolated from the Alston soil sample and that it is archivedin row B, well 10 of the microtitre plate. Dereplicatedclones (20 Alston soil; 15 Canterbury soil; 13 sediment A;and 33 sediment D) were sequenced directly to obtain atleast 500 bp of information from the V3 to V5 region of16S rDNA, and the returned sequences were subject tochimera analysis. Twelve out of 85 clones (14%) werefound to be chimeras using the methods described below.The remaining 73 clones were subjected to phylogeneticanalysis (Fig. 3).

Fifty-five of the 73 clones belonged to the class

Actino-bacteria

based on analysis of 615 sequence positions.

Fourteen clones belonged to the recently described bac-terial phylum

Gemmatimonadetes

(Zhang

et al

., 2003).The remaining four clones belonged to the phylum

Planctomycetes

.Clones within the class

Actinobacteria

were phylogen-etically diverse, representing the suborders

Corynebac-terineae

and

Frankineae

and the families

Actinosyn-nemataceae

,

Micrococcaceae

,

Micromonosporaceae

,

Nocardioidaceae

and

Pseudonocardiaceae

. The majority(64%) of actinobacterial clones belonged to the subclass

Acidimicrobidae

. The average pairwise similarity of all act-inobacterial clones was 87%. Comparison of 16S rRNAgene similarity using the region amplified by primers S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19 and the whole16S rRNA gene for a large number of actinobacteriashowed that 16S rDNA similarities assessed from theamplified region were conservative by

ª

0.7%.

Discussion

The primary aim of this study was to improve the detectionand identification of actinobacteria, either those in cultureor those represented in 16S rDNA clone libraries derivedfrom DNA extracted from environmental samples.Although it was not our intention to estimate the full extentof actinobacterial diversity in any of the environmentalsamples, an unexpectedly high diversity was observed inrelatively small clone libraries. We used only one 16SrRNA gene sequence from each actinobacteria genus inthe initial alignments to prevent specific genera that werewell represented in sequence databases from biasing theprimer design. This strategy simplified the identification ofregions in the 16S rRNA gene conserved in the class

Actinobacteria

. Previous examples of actinobacteria-specific primers (McVeigh

et al

., 1996; Heuer et al., 1997;Ludemann and Conrad, 2000) were designed using dif-ferent strategies. In silico testing confirmed the utility ofour approach as the S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19 primers showed a distinct (26–213%)improvement in the number of exact actinobacteriamatches when compared with previous primers.

The Actinobacteria Amplification Resource (AAR;Fig. 1) provides a visual tool that allows researchers toadjust the S-C-Act-0235-a-S-20 primer in order to pro-vide a better match for actinobacteria that initially do notshow a perfect match (such as Rubrobacter sp.). It isunlikely that the adjustment of the primer will be neces-sary for members of genera showing two or fewer mis-matches, especially when these are not located withinthe terminal three bases of the 3¢ end (Sommer andTautz, 1989). The AAR can also be used to designdegenerate primers although such primers can pro-duce artifacts in clone libraries as a result of primerexhaustion (McVeigh et al., 1996). The fact that primers

PCR primers for the class Actinobacteria 831

© 2003 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 5, 828–841

Table 2. Strains tested using primers S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19.

Species Strain code Species Strain code

Actinobacteria: Nonomuraea rubra DSM 43768T

Acrocarpospora corrugata IFO 13972T Nonomuraea spiralis DSM 43555T

Acrocarpospora macrocephala IFO 16266T Nonomuraea turkmeniaca DSM 43926T

Acrocarpospora pleiomorpha IFO 16267T Planobispora longispora DSM 43041T

Actinomadura latina DSM 43382T Planomonospora venezuelensis DSM 43178T

Actinomadura longicatena DSM 44361T Prauserella rugosa DSM 43194T

Actinomadura madurae DSM 43067T Pseudonocardia autotrophica DSM 43088‘Actinomadura malachitica’ DSM 43462 Pseudonocardia thermophila DSM 43027Actinomadura nitritigenes DSM 44137T Pseudonocardia sp. UN 1088Actinomadura pelletieri DSM 43383T Rhodococcus equia DSM 20307T

Actinomadura spadix DSM 43459T Rhodococcus erythropolis DSM 43066T

Amycolatopsis japonica KCTC 9817T Rhodococcus globerulus DSM 43954T

Amycolatopsis fastidiosa KCTC 9155T Rhodococcus pyridinovorans DSM 44555T

Amycolatopsis lactamduransa UN AT3 Rhodococcus rhodnii DSM 43336T

Amycolatopsis sulphurea KCTC 9428 Rhodococcus rhodochrous DSM 43241T

Frankia sp.a DSM 44251 Rhodococcus wratislaviensis UN 805Frankia sp. DSM 44263 Rhodococcus zopfii DSM 44108T

Gordonia aichiensis DSM 43978T Rubrobacter radiotolerans DSM 5868Gordonia alkanivoransa DSM 44369T Saccharomonospora caesia DSM 43068Gordonia bronchialis DSM 43247T Saccharothrix australiensis DSM 43800T

Gordonia desulphuricans DSM 44462T Saccharothrix espanaensis DSM 44229T

Gordonia hydrophobica DSM 44015T Saccharothrix sp. UN 1253Gordonia sinesedis DSM 44455T Spirillospora albida UN JC202Kitasatospora azatica DSM 41650T Streptomyces afghaniensis ISP 5228T

Kitasatospora cystarginea DSM 41680T Streptomyces azureus ISP 5106T

Kitasatospora griseola DSM 43859T Streptomyces bellus ISP 5185T

Kitasatospora phosalacinea DSM 43860T Streptomyces bicolor ISP 5140Kitasatospora setae DSM 43861T Streptomyces chartreusis ISP 5085T

Kutzneria viridogrisea DSM 43850T Streptomyces cinnabarinus ISP 5467T

Kutzneria sp. UN CR5 Streptomyces coeruleorubidus ISP 5145T

Lentzea sp. UN AUS10 Streptomyces cyaneusa ISP 5108T

Microbispora chromogenes DSM 43165 Streptomyces fumanus ISP 5154T

Microbispora rosea DSM 43839T Streptomyces griseorubiginosus ISP 5469T

Micrococcus luteus DSM 20030T Streptomyces hawaiiensis ISP 5042T

Micromonospora aurantiaca DSM 43813T Streptomyces iakyrus ISP 5482T

Micromonospora brunnea ATCC 27334T Streptomyces indigocolor ISP 5432Micromonospora carbonacea ATCC 27114T Streptomyces longisporus ISP 5166T

Micromonospora chalceaa DSM 43026T Streptomyces luteogriseus ISP 5483T

Micromonospora inositola DSM 43819T Streptomyces malaysiensis DSM 41697T

Micromonospora olivasterosporaa DSM 43868T Streptomyces mirabilis DSM 40553T

Microtetraspora fusca DSM 43841T Streptomyces neyagawaensis ISP 5588T

Microtetraspora glauca ATCC 23057T Streptomyces pallidus ISP 5531Microtetraspora niveoalba DSM 43174T Streptomyces pseudovenezuelae ISP 5212T

Mycobacterium fortuitum DSM 46621T Streptomyces purpurascens ISP 5310T

Mycobacterium senegalensea DSM 43656T Streptomyces roseoviolaceus ISP 5277T

Mycobacterium sp. UN 1254 ‘Streptomyces sudanensis’ UN A1Nocardia abscessus IMMIB D-1592T ‘Streptomyces sudanensis’ UN A4Nocardia africanaa DSM 44491T ‘Streptomyces sudanensis’ UN A9Nocardia africana DSM 44500 Streptomyces violatus ISP 5205T

Nocardia asteroides ATCC 19247T Streptomyces violatus ISP 5209Nocardia asteroides UN 97 Streptomyces violochromogenes ISP 5207Nocardia asteroides UN 1135 Streptomyces yatensis DSM 41771T

Nocardia brasiliensis ATCC 19296T Streptomyces sp. UN E38Nocardia brevicatena DSM 43024T Streptomyces sp. UN I26Nocardia carnea DSM 43397T Streptomyces sp. UN I27Nocardia cerradoensis UN 1301T Streptomyces sp. UN I28Nocardia corynebacteroides DSM 20151T Streptosporangium album DSM 43023T

Nocardia crassostreae ATCC 700418T Streptosporangium fragile IFO 14311T

Nocardia cummidelens DSM 44490T Streptosporangium non-diastaticum DSM 43848T

Nocardia farcinica UN 1066 Streptosporangium pseudovulgare DSM 43181T

Nocardia farcinica ATCC 3318T Streptosporangium roseum DSM 43021T

Nocardia flavorosea JCM 3332T Streptosporangium vulgare DSM 43802T

Nocardia fluminea DSM 44489T Tsukamurella paurometabola DSM 20162T

Nocardia nova ATCC 33726T Williamsia muralea DSM 44343T

Nocardia otitidiscaviarum DSM 43242T

Nocardia paucivorans DSM 44386T Non-Actinobacteria:Nocardia pseudobrasiliensis ATCC 51512T Acetobacter aceti NCIMB 6656Nocardia pseudobrasiliensis UN 1234 Agrobacterium tumefaciens DSM 30150Nocardia soli DSM 44488T Azorhizobium caulinodans ATTC 43989T

832 J. E. M. Stach et al.


S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19 gave anactinobacteria-specific amplicon at an annealing temper-ature of 72∞C facilitates their use as a diagnostic tool, asa two-step PCR protocol can be used to confirm rapidlythe presence of actinobacteria in environmental samplesor to confirm the identity of actinobacteria tentativelyassigned to specific taxa.

The SSCP clone screening protocol developed forthis study greatly reduces the time required to generatedereplicated 16S rRNA gene clone libraries. Traditionalapproaches to screening 16S rDNA clone libraries haverelied on restriction fragment length polymorphism (RFLP)using primers specific for the cloning vector. However, asthe amplified gene may be inserted in either direction, twopossible RFLP profiles may be generated as restrictionsites are not symmetrically distributed across the 16SrRNA gene (Marchesi and Weightman, 2000). This prob-lem may be overcome using modified primers (Marchesiand Weightman, 2000) or restriction enzymes that cleavein the cloning site of the vector (Vergin et al., 2001).Clones grouped by RFLP have been reported to show 52–99% similarity (Dunbar et al., 1999), although levels of79–100% can be achieved using a second round of RFLP(Vergin et al., 2001). The SSCP procedure can detect asingle basepair difference in 300 (Lee et al., 1996); hence,two dissimilar clones are unlikely to be grouped togetherusing this method. A further advantage of SSCP is that itis straightforward to identify PCR products that have beengenerated from more than one template (see Fig. 2, sam-ples SDb02 and SDb07); hence, it is possible to omitstreak purification of transformants before dereplication. It

is also reported that SSCP screening of 16S rDNA givesresults that show a high degree of congruence with whole-organism dereplication techniques such as pyrolysis massspectrometry (Brandao et al., 2002). Screening time wasgreatly reduced in the present study as a specific primerset was used that does not amplify Escherichia coli 16SrRNA genes. The present protocol is easily adapted foruse with other primer sets, although amplicons >600 bpshould be the subject of restriction digestion before SSCPanalysis.

It is evident that the strategy used to design the primerswas successful as 76% of clones fell within the actino-mycete line of descent. The non-actinobacterial clonesbelonging to the Gemmatimonadetes and Plancto-mycetes are unsurprising; the type strain Gemmatimonasaurantiaca displays one nucleotide mismatch in each ofthe new primers (the 16S rRNA gene sequence of G.aurantiaca was unavailable at the time of primer design),and planctomycete clone OM190 shows two mismatcheswith primer S-C-Act-0235-a-S-20 and one mismatch withprimer S-C-Act-0878-a-A-19, neither of which are in theterminal three bases of the 3¢ end.

Environmental contaminants can affect both the effi-ciency and the specificity of PCR (Stach et al., 2001) and,therefore, targets that do not exactly match the primersequences may be amplified. To overcome this drawback,it may be possible to find a restriction site within theamplified region of the Gemmatimonadetes and Plancto-mycetes that is absent in the Actinobacteria, allowing theremoval of non-target 16S rDNA. Alternatively, a nestedPCR protocol could be used with an external primer that

Nocardia transvalensis DSM 43405T Azotobacter vinelandi DSM 2289T

Nocardia uniformis DSM 43136T Bacillus cereus DSM 31T

Nocardia vaccinii DSM 43285T Bacillus polymyxa DSM 36T

Nocardia sp. UN J121 Clostridium sporogenes NCIMB 10196Nocardia sp. UN 1275 Lactobacillus plantarum ATTC 8014Nonomuraea africana DSM 43748T Neptunomonas naphthovorans ATTC 700637T

‘Nonomuraea asiatica’ UN A299 Pediococcus pentosaceus DSM 20336T

Nonomuraea fastidiosa DSM 43674T Pseudomonas putida ATTC 17453Nonomuraea flexuosa DSM 43186T Sphingomonas yanoikuyae ATTC 51230T

Nonomuraea helvata DSM 43142T Staphylococcus aureus NCIMB 10819Nonomuraea polychroma DSM 43925T Streptococcus cremoris ATTC 11603Nonomuraea pusilla DSM 43357T

Nonomuraea recticatena DSM 43937T

Nonomuraea roseola DSM 43551Nonomuraea roseoviolacea DSM 43144T

Species Strain code Species Strain code

Table 2. cont.

a. Strains used for PCR optimization.‘ ’, not validated.T, type strain.ATCC, American Type Culture Collection, Manassas, VA, USA; DSM, Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH,Mascheroder Weg, Braunschweig, Germany; IFO, Institute of Fermentation, Osaka, Japan; ISP, International Streptomyces Project (strains fromNRRL collection, Northern Regional Reference Laboratory, Peoria, USA); IMMIB, Institute of Medical Microbiology and Immunology of theUniversity of Bonn, Germany; KCTC, Korean Collection for Type Cultures, Yusong, Republic of Korea; and UN, Collection of the University ofNewcastle, Newcastle upon Tyne, UK.



Fig. 1. Actinobacteria Amplification Resource. A neighbour-joining tree showing phylogenetic relationships of genera within the class Actino-bacteria. Genera in blue display a perfect match with primer S-C-Act-0235-a-S-20, those in green a perfect match with primer S-C-Act-0235-a-S-20 and primer F243 (Heuer et al., 1997), and those in red genera that mismatch with primer S-C-Act-0235-a-S-20. Letters and numbers in parenthesis indicate the adjust-ments that need to be made to primer S-C-Act-0235-a-S-20 to provide a perfect match (e.g. 8ÆC indicates that base 8 in the S-C-Act-0235-a-S-20 primer should be changed from a T to a C). Changes are colour coded to indicate the frequency with which the base change was observed within members of the genera: black, conserved mismatch; green, mismatch found in <25% of species within the genus; blue, mis-match found in 25–66% of species; red, mis-match in 66–77% of species. Genera enclosed in quotation marks have not been validated; asterisks indicate genera present in the TAXON-

OMY server of GenBank that no longer have any standing in prokaryotic nomenclature (type strain transferred to another genus).



does not amplify non-target 16S rDNA. We have used theAAR to design such a strategy; semi-nested PCR usingprimer S-C-Act-0235-a-S-20 and primer ACT1360R in thefirst round followed by primer S-C-Act-0235-a-S-20 andprimer S-C-Act-0878-a-A-19 in the second round resultedin 99% of 167 clones being of actinobacterial origin,including members of the genera Rhodococcus andStreptomyces not observed in this study; the remaining1% of clones were most closely related to unculturedrepresentatives in the phylum Gemmatimonadetes(J. E. M. Stach, unpublished).

The actinobacterial clones were distributed throughoutthe class Actinobacteria, showing that the primers areappropriate for the detection of actinobacterial diversity. Itseems likely that this diversity is genuine as comprehen-sive methods were used for chimera detection. However,it should be noted that chimera detection using theCHIMERA_CHECK algorithm might be limited by the lack ofcultured representatives in many of the actinobacteriaclusters.

Using conservative estimates, it can be predicted thatclone pairs Sab04 and Sde01, Asb04 and Asc01 (Acidimi-crobidae) and CSc10 and Csa01 (Micromonosporaceae)represent species of novel genera. Similarly, clone Asb07(Frankineae) represents a novel Blastococcus species;Asa04 (Frankineae) a novel Sporichthya species; Asa07

(Micrococcaceae) an Arthrobacter species; CSb01(Pseudonocardiaceae) a novel Pseudonocardia species;Sda10 (Corynebacterineae) a novel Williamsia species;and CSc07 and SAa11 novel Mycobacterium species. Theremaining clones (76%) can be considered as either novelspecies or genera with no closely related culturedrepresentatives.

McVeigh et al. (1996) designed actinomycete-specificprimers and applied them to DNA extracted from a tem-perate forest soil to produce an actinomycete 16S rDNAclone library. Their study revealed three distinct actino-mycete groups comprising new actinomycete species thatrepresented several new genera. In the present study, wedetected approximately 10 times the number of novel gen-era in a similar-sized library. Furthermore, when primersS-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19 wereapplied to a relative low-diversity, actinomycete-rich sam-ple (smear cheese surface microbiota), species weredetected that matched the diversity expected from culture-based studies (Brennan et al., 2002). In contrast, theapplication of primers F243 and R513 (Heuer et al., 1997)resulted in the detection of only Arthrobacter species (N.Bora and A. Ward, personal communication), thus provid-ing clear evidence of the reduction in bias and improve-ment in species coverage of primers designed in thisstudy.

Fig. 2. Single-strand conformation polymor-phism dereplication of 25 clones from Norwe-gian marine sediment D (Raunefjorden) clones generated using the S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19 primers. Dereplication was achieved by product–moment UPGMA clus-ter analysis; similarities (r-values) are expressed as percentages.



Fig. 3. Phylogenetic relationship of the partial 16S rDNA gene sequences generated in this study (for tree construction, see Experimental procedures). Tree shows the class Actinobacteria and the phyla Gemmatimonadetes and Planctomycetes. The scale bar represents the number of changes per base position. Bootstrap values are shown at 60–80% (indicated by the filled circle) and at 80–100% (indicated by the open circle).



The prediction that 76% of the clones represent newgenera is conservative as actual correlations betweenDNA similarity and 16S rDNA homology show that no twoorganisms with <99% 16S rDNA homology showed >70%DNA similarity (Stackebrandt and Goebel, 1994). The act-inobacterial clones, on average, showed between 86%and 93% homology with either their closest cultured rep-resentative or an uncultivated clone; Amycolatopsis andRhodococcus strains, which represent different subordersin the class Actinobacteria, share ª88% 16S rRNA genehomology.

It is worth noting that microvariation artifacts can beintroduced into clone libraries when amplifying membersof closely related species. Such artifacts are caused byPCR-introduced errors, the formation of chimeric mole-cules and heteroduplex formation (Speksnijder et al.,2001). However, it is unlikely that the diversity reportedhere is greatly influenced by such artifacts as a high-fidelity DNA polymerase was used to generate the clonelibrary, the PCR cycle number was kept low (25 cycles),and clone sequences were subjected to comprehensivechimera analysis. Microvariation artifacts are reported togive a 0.2–1.4% sequence difference between parent andaberrant sequences (Speksnijder et al., 2001); the closelyrelated sequences in the present investigation showed amuch higher level of divergence, hence it is unlikely thatthe majority of clones are PCR artifacts. However, confir-mation of the existence of novel species should be con-firmed using either isolation or stringent probing methods.

The high degree of novel actinobacteria detected in theenvironmental samples is significant. A survey of the Anti-biotic Literature Database indicates that, of the 23 000bioactive microbial products held, 57.8% are produced bymembers of the class Actinobacteria (Lazzarini et al.,2000). It is evident from the present study that more than50 novel species/genera were detected in the small clonelibrary (73 clones) derived from four different environ-ments. It is reasonable to conclude that such new lineagesmay represent taxa that will produce novel bioactive com-pounds, as they share a common history (McVeigh et al.,1996; Ward and Goodfellow, 2003). Clearly, the diversityof Actinobacteria greatly exceeds that predicted by thosealready in culture and highlights the great biotechnological

value in continuing efforts to isolate members of novelactinomycete genera. The primers reported here will facil-itate the isolation of members of such genera by allowingbioprospecting of habitats before isolation efforts, followedby their use to monitor the efficacy of new isolationstrategies.

Experimental procedures

Bacteria and environmental samples

The bacteria used to determine primer specificity are listedin Table 2. Non-actinobacteria were grown in nutrient broth(Oxoid), Frankia strains in DPM medium (DSM medium 737;http://www.dsmz.de) and R. radiotolerans in tryptone soyabroth (DSM medium 535). All other actinobacteria weregrown in glucose yeast extract broth.

DNA extraction and purification

A list of the environmental soil and marine sediment samplesis given in Table 3. Genomic DNA was extracted from thestrains using a DNeasy kit according to the manufacturer’sprotocol (Qiagen). Microbial DNA from the environmentalsamples was extracted using a method modified from thatof Saano and Lindstrom (1995): 1 g (dry weight) of soil/sediment sample was added to 2.5 ml of extraction buffer(120 mM Na2HPO4, pH 8.0, 1% SDS), lysozyme andachromopeptidase were added to final concentrations of5 mg ml-1 and 0.5 mg ml-1 respectively. Samples were incu-bated for 1 h at 37∞C with occasional shaking. Proteinase K(100 mg ml-1) was added and incubation continued (1 h,37∞C). The salt concentration of the preparation was raisedby the addition of 450 ml of 5 M NaCl before the addition of375 ml of 10% CTAB (CTAB in 0.7 M NaCl), and sampleswere mixed by gentle vortexing and incubated for 20 min at65∞C. An equal volume of chloroform was added to the prep-aration, which was vortexed and transferred to a 15 mlpolypropylene tube containing Phase Lock Gel™ (Eppen-dorf). The samples were centrifuged (15 min, 9000 g, 4∞C),and the aqueous phase was mixed with an equal volume ofisopropanol and incubated for 1 h at 20∞C. Nucleic acidswere precipitated by centrifugation (20 min, 16 000 g, 4∞C),washed with ice-cold 70% ethanol and dissolved in 200 ml ofdoubled-distilled water. DNA was subject to two rounds ofpurification using a Wizard DNA clean-up column, accordingto the manufacturer’s instructions (Promega).

Table 3. Terrestrial soils and marine sediments used as sources of environmental DNA.

Sample Description Location

AS Alston soil with history of metal contamination NY740470a

CS UKC campus soil from rhizosphere of Betula pendula, top 5–10 cm TR140597a

SA Norwegian fjord marine sediment A, By Fjorden, 316 m deep, top 10 cm N60∞23.798 E5∞13.296SD Norwegian fjord marine sediment D, Raunefjorden, 187 m deep, top 10 cm N60∞16.512 E5∞11.043

a. UK Ordnance Survey grid reference.

http://www.dsmz.de



Primers

Primers were designed to be diagnostic for actinobacterial16S rDNA. In order to prevent primer bias in favour of mem-bers of genera with multiple 16S rRNA gene sequenceentries in the available databases, one sequence for eachgenus in the class Actinobacteria was downloaded from theTAXONOMY server of GenBank (Wheeler et al., 2002). Thegenera and species used are shown in Table 4 together withGenBank accession numbers. Sequences were alignedusing the CLUSTAL W algorithm (Thompson et al., 1994) avail-able in the MEGALIGN program (DNASTAR). Sequences werechosen on the basis of length and sequence quality, and werechecked using the SEQUENCE_MATCH algorithm availablethrough the RDP (Maidak et al., 2001). Conserved regionswithin the alignment were tested for their actinobacteria-spe-cific primer potential in silico by submission to theCHECK_PROBE algorithm of the RDP. Two regions showing ahigh degree of actinobacteria specificity were selected assites to which primers were raised. The primers were namedaccording to the conventions proposed by the Oligonucle-otide Database Project (Alm et al., 1996) and are S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19, where C indicatesthe class Actinobacteria (Stackebrandt et al., 1997).

Actinobacteria Amplification Resource

The 16S rDNA sequences of the strains listed in Table 4 wereuploaded to the CLUSTAL X interface and aligned to generatea guide dendrogram from which a final alignment was made(Thompson et al., 1997). All calculations were made usingthe programs available in the phylogeny inference packagePHYLIP (Felsenstein, 1993). A distance matrix was con-structed from the alignment using the DNADIST program. Thephylogenetic tree was produced using the neighbour-joiningmethod from the NEIGHBOR program with the Jukes–Cantorcorrection parameter. Bootstrap analysis was conductedusing the SEQBOOT and CONSENSE programs with 100 resa-mplings. The CHECK_PROBE results for primers S-C-Act-0235-a-S-20 and F243 (Heuer et al., 1997) were used to interro-gate the actinomycete tree to determine which genera dis-played perfect matches (the F243 primer was chosen as it ismost commonly cited in the literature). Those actinobacterianot showing perfect matches were investigated further byaligning all available 16S rDNA sequences for the relevantgenus from the TAXONOMY server of GenBank (Wheeler et al.,2002) and determining the position and frequency of themismatches. The Actinobacteria Amplification Resource(AAR) is given in Fig. 1 and is accessible via the internet(http://microbe2.ncl.ac.uk/MMB/AAR.htm)

PCR amplification and cloning

PCR was performed in a 96-well gradient DNA thermal cycler(Techne). The annealing temperature of primers S-F-Act-0254-a-S-20 and S-F-Act-0894-a-A-19 was investigated overa 60–72∞C gradient. PCR amplification of cultured actinobac-teria and environmental DNA was made using the Failsafe™PCR system (Epicentre) using buffer B in a final volume of50 ml. Ten picomol of each primer was added, contaminatingDNA was removed by the addition of 1 U of DNase I (Epi-

centre) and incubation at 37∞C for 15 min, followed by DNaseI inactivation at 95∞C for 3 min. For cultured actinobacteria,DNA (ª 50 ng) was added, after DNase I treatment, and PCRwas done using a two-step protocol: initial denaturation at95∞C for 4 min, followed by 35 cycles of 95∞C for 30 s and70∞C for 1 min. Amplification of environmental DNA was doneusing a ‘touchdown’ protocol (Roux, 1995), which consistedof an initial denaturation at 95∞C for 4 min, followed by dena-turation at 95∞C for 45 s, annealing at 72∞C for 45 s andextension at 72∞C for 1 min; 10 cycles in which the annealingtemperature was decreased by 0.5∞C per cycle from thepreceding cycle; and then 15 cycles of 95∞C for 45 s, 68∞Cfor 45 s and 72∞C for 1 min, with the last cycle followed by a5 min extension at 72∞C. PCR products were separated on2% agarose gels stained with ethidium bromide (Sambrooket al., 1989). PCR products were purified using MinElutePCR purification columns according to the manufacturer’sinstructions (Qiagen). Purified DNA was blunt-end ligated tothe plasmid vector pETBlue-1 and used to transform NovaB-lue competent cells using a Perfectly Blunt® cloning kitaccording to the manufacturer’s protocol (Novagen).

Single-strand conformation polymorphism screening of clone libraries

Dereplicated clone libraries were generated using a novelrapid screening approach adapted from Vergin et al. (2001).Positive transformants were identified by blue/white selectionand inoculated into 0.2 ml PCR strip-tubes (Eppendorf) con-taining 10 ml of 1/10th LB broth (Sambrook et al., 1989). Fivemicrolitres of the cell suspension was used to inoculate 5 mlof LB broth containing 50 mg ml-1 carbenicillin, and the cul-tures were incubated for 16 h at 37∞C. Forty-five microlitresof a PCR mixture (see above) was added to the tubes con-taining the remaining 5 ml of cell suspension, and PCR wascarried out as above. Amplicons from positive clones weredereplicated by SSCP analysis (Stach and Burns, 2002).Clones containing unique inserts were identified usingGELCOMPAR software (version 4.0; Applied Maths) with therolling-disk background subtraction method. Similarity matri-ces were calculated using the pairwise Pearson’s product–moment correlation coefficient (r-value) (Häne et al., 1993).Cluster analyses of similarity matrices were made using theunweighted pair group method with arithmetic averages(UPGMA). Clones were archived in 96-well plates in dimethylsulphoxide/LB and stored at -80∞C (Vergin et al., 2001).Plasmids containing unique inserts were extracted using aMiniPrep kit according to the manufacturer’s instructions(Qiagen). Sequencing was conducted commercially (Qiagen)using the S-C-Act-0235-a-S-20 primer.

Phylogenetic analysis

Clone sequences were analysed using the CHIMERA_CHECK

algorithm of the RDP. In addition, secondary structure predic-tion (http://www.genebee.msu.su/services/rna2_reduced.html)and partial treeing methods were conducted on suspected chi-meras. Non-chimeric sequences were submitted to the BLAST

function of GenBank (Altschul et al., 1990) and theSEQUENCE_MATCH program of the RDP to identify closelyrelated reference sequences. The phylogenetic position of the

http://microbe2.ncl.ac.uk/MMB/AAR.htm

http://www.genebee.msu.su/services/rna2_reduced.html



Table 4. Sequences used in primer design and Actinobacteria Amplification Resource.

Species Taxonomya Accession Species Taxonomya Accession

Acidimicrobium ferrooxidans Acidimicrobiales U75647 Mobiluncus curtisii Actinomycineae X53186Acidothermus cellulolyticus Frankineae X70635 Modestobacter multiseptatus Frankineae Y18646Acrocarpospora pleiomorpha Streptosporangineae AB025318 Mycetocola lacteus Micrococcineae AB012648Actinoalloteichus cyanogriseus Pseudonocardineae AB006178 Mycobacterium aurum Corynebacterineae M29588Actinobaculum schaalii Actinomycineae Y10773 Nesterenkonia halobia Micrococcineae Y13857Actinobispora aurantiaca* Actinobacteridae AF056707 Nocardia carnea Corynebacterineae Z36929Actinocorallia herbida Actinobacteridae D85473 Nocardioides fulvus Propionibacterineae AF005017Actinokineospora riparia Pseudonocardineae X76953 Nocardiopsis tropica Streptosporangineae AF105971Actinomadura citrea Streptosporangineae U49001 Nonomuraea latina Streptosporangineae AF277197Actinomyces canis Actinomycineae AJ243891 ‘Nostocoida limicola’ Micrococcineae X85212Actinoplanes cyaneus Micromonosporineae X93186 Oerskovia turbata* Micrococcineae X79454Actinopolymorpha singapurensis Corynebacterineaeb AF237815 Olsenella profusa Coriobacteriales AF292374Actinopolyspora halophila Pseudonocardineae X54287 Ornithinicoccus hortensis Micrococcineae Y17869Actinosynnema mirum Pseudonocardineae X84447 Ornithinimicrobium humiphilum Micrococcineae AJ277650Aeromicrobium fastidiosum Propionibacterineae Z78209 ‘Parvopolyspora pallida’ Corynebacterineaeb AB006157Agrevia bicolorata Micrococcineae AF159363 Pilimelia anulata Micromonosporineae X93189Agrococcus jenensis Micrococcineae X92492 Pimelobacter simplex* Propionibacterineaeb U81990Agromyces fucosus Micrococcineae D45061 Planobispora longispora Streptosporangineae D85494Amycolata nitrificans* Pseudonocardineae X55609 Planomonospora sp. IM-7023 Streptosporangineae AF131477Amycolatopsis alba Pseudonocardineae AF051340 Planopolyspora crispa* Micromonosporineae AB024701Arcanobacterium pyogenes Actinomycineae X79225 Planotetraspora mira Streptosporangineae D85496Arthrobacter albus Micrococcineae AJ243421 Prauserella rugosa Pseudonocardineae AF051342Asiosporangium albidum* Pseudonocardineae AB006176 ‘Prauseria hordei’ Pseudonocardineae Y07680Atopobium vaginae Coriobacteriaceae AF325325 Promicromonospora citrea Micrococcineae X83808Aureobacterium resistens* Micrococcineae Y14699 Propionibacterium avidum Propionibacterineae AJ003055Bacterium TH3 Acidimicrobidae M79434 Propioniferax innocua Propionibacterineae AF227165Beutenbergia cavernosa Micrococcineae Y18378 Pseudonocardia alni Pseudonocardineae Y08535Bifidobacterium cunniculi Bifidobacteriaceae M58734 Rarobacter incanus Micrococcineae AB056129Blastococcus aggregatus Frankineae L40614 Rathayibacter carexis Micrococcineae AF159364Bogoriella caseolytica Micrococcineae Y09911 Renibacterium salmoninarum Micrococcineae AF180950Brachybacterium faecium Micrococcineae X91032 Rhodococcus rhodnii Corynebacterineae X80623‘Brachystreptospora xinjiangensis’ Streptosporangineae AF251709 Rothia dentocariosa Micrococcineae M59055Brevibacterium avium Micrococcineae Y17962 Rubrobacter radiotolerans Rubrobacterales X98372Catellatospora tsunoense Micromonosporineae X93200 Saccharomonospora cyanea Pseudonocardineae Z38018Catenuloplanes japonicus Micromonosporineae X93201 Saccharopolyspora flava Pseudonocardineae AF154128‘Cathayosporangium alboflavum’ Streptosporangineaec AB006158 Saccharothrix violacea Pseudonocardineae AJ242634Cellulomonas biazotea Micrococcineae X83802 ‘Saccharothrixopsis albidus’ Pseudonocardineae AF183956Cellulosimicrobium cellulans Micrococcineae AB023355 Salana multivorans Micrococcineae AJ400627Clavibacter sp. P297-02 Micrococcineae AJ310417 Sanguibacter suarezii Micrococcineae X79541‘Clavisporangium rectum’ Streptosporangineae AB062380 ‘Sarraceniospora aurea’ Actinobacteridaec AB006177Collinsella aerofaciens Coriobacteriales AJ245920 Sebekia benihana* Streptosporangineae AB006156Coriobacterium glomerans Coriobacteriales X79048 Skermania piniformis Corynebacterineae Z35435Corynebacterium auris Corynebacterineae X81873 Slackia exigua Coriobacteriales AF101240Couchioplanes caeruleus Micromonosporineae X93202 Sphaerobacter thermophilus Sphaerobacterales X53210Crossiella cryophila Pseudonocardineae AF114806 Spirilliplanes yamanashiensis Micromonosporineae D63912Cryobacterium psychrophilum Micrococcineae D45058 Spirillospora rubra Streptosporangineae AF163123Cryptosporangium arvum Frankineae D85465 Sporichthya polymorpha Frankineae X72377Curtobacterium citreum Micrococcineae X77436 Stomatococcus mucilaginosus* Micrococcineae X95483Dactylosporangium fulvum Micromonosporineae X93192 Streptoalloteichus hindustanus Pseudonocardineae D85497Demetria terragena Micrococcineae Y14152 Streptomonospora salina Streptosporangineae AF178988Denitrobacterium detoxificans Coriobacteriales AF079507 Streptomyces sp. SNG9 Streptomycineae AF295602Dermabacter hominis Micrococcineae X91034 Streptomycoides glaucoflavus* Streptomycineaeb AB006155Dermacoccus nishinomiyaensis Micrococcineae X87757 Streptosporangium roseum Streptosporangineae U48996Dermatophilus chelonae Micrococcineae AJ243919 Subtercola boreus Micrococcineae AF224722Detolaasinbacter shiratae* Micrococcineae AB012647 Symbiobacterium thermophilum Actinomycetalesd AB004913Dietzia maris Corynebacterineae Y08311 Terrabacter tumescens Micrococcineae X83812Eggerthella lenta Coriobacteriales AF292375 Terracoccus luteus Micrococcineae Y11928Excellospora viridilutea* Streptosporangineae D86943 Tessaracoccus bendigoniensis Propionibacterineae AF038504‘Ferromicrobium acidophilum’ Acidimicrobialesc AF251436 Tetrasphaera japonica Micrococcineae AF125092Frankia sp. Cea5.1 Frankineae U72718 Thermobifida alba Streptosporangineae AF002260Friedmanniella antarctica Propionibacterineae Z78206 Thermobispora bispora Pseudonocardineae U83912Frigoribacterium sp. 277 Micrococcineae AF157478 Thermocrispum agreste Pseudonocardineae X79183Gardnerella vaginalis Bifidobacteriaceae M58744 Thermomonospora curvata Streptosporangineae AF002262Geodermatophilus obscurus Frankineae X92357 ‘Trichotomospora caesia’ Streptomycineae AB006154Georgenia muralis Micrococcineaec X94155 Tropheryma whippelii Micrococcineaed AF251035Glycomyces tenuis Glycomycineae D85482 Tsukamurella spumae Corynebacterineae Z37150Gordonia sputi Corynebacterineae X92484 Turicella otitidis Bifidobacterialesb X73976Herbidospora cretacea Streptosporangineae D85485 Verrucosispora gifhornensis Micromonosporineae Y15523Hongia koreensis Propionibacterineae Y09159 Virgosporangium aurantiacum Micromonosporineae AB006169



a. As defined by Stackebrandt et al. (1997) and as designated within the TAXONOMY server of GenBank (Wheeler et al., 2002).b. Probable misclassification; deduced from BLAST and RDP sequence matches and from phylogenetic analysis (Fig. 1).c. Putative assignment based on BLAST and RDP sequence matches and from phylogenetic analysis (Fig. 1).d. Order.‘ ’, genus not validated, hence has no standing in nomenclature.*Genera that no longer exist (type strain transferred to another genus) but are present in databases.

cloned 16S rDNA was determined using the CLUSTAL X andPHYLIP programs as above. Percentage similarities of knownand cloned 16S rDNA sequences were calculated using theSIMILARITY_MATRIX algorithm of the RDP. To assess whether16S rDNA similarities based on the region amplified by the S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19 primers werereflective of the similarities across the entire 16S rRNA gene,matrices were constructed for 50 of the actinobacteria used toconstruct the primer alignment using both the region amplifiedby the primer set and the full 16S rDNA. Differences in per-centage similarity were calculated and averaged over theentire data set using EXCEL 2000 (Microsoft). Nucleotidesequences of the clones generated in this study have beendeposited alphanumerically in the GenBank database underthe accession numbers: AY124381 to AY124459.

Acknowledgements

We thank Professor Gjert Knutsen and the crew of the F/FHans Brattström for collection of the Norwegian marine sed-iments, and an anonymous reviewer for valuable commentson the manuscript, especially for assistance in chimera anal-ysis and introducing us to the new bacterial phylum Gemma-timonadetes. This work was supported by the UK NaturalEnvironment Research Council (grants NER/T/S/2000/00614and NER/T/S/2000/00616).

References

Alm, E.W., Oerther, D.B., Larsen, N., Stahl, D.A., and Raskin,L. (1996) The oligonucleotide probe database. Appl Envi-ron Microbiol 62: 3557–3559.

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman,D.J. (1990) Basic local alignment search tool. J Mol Biol215: 403–410.

Benson, D.R., and Silvester, W.B. (1993) Biology of Frankiastrains, actinomycete symbionts of actinorhizal plants.Microbiol Rev 57: 293–319.

Brandao, P.F.B., Clapp, J.P., and Bull, A.T. (2002) Discrim-ination and taxonomy of geographically diverse strains ofnitrile-metabolizing actinomycetes using chemometric andmolecular sequencing techniques. Environ Microbiol 4:262–276.

Brennan, N.M., Ward, A.C., Beresford, T.P., Fox, P.F., Good-fellow, M., and Cogan, T.M. (2002) Biodiversity of the bac-terial flora on the surface of a smear cheese. Appl EnvironMicrobiol 68: 820–830.

Brosius, J., Dull, T.J., Sleeter, D.D., and Noller, H.F. (1981)Gene organisation and primary structure of ribosomal RNAoperon from Escherichia coli. J Mol Biol 148: 107–127.

Bunch, A.W. (1998) Biotransformation of nitriles by rhodo-cocci. Antonie van Leeuwenhoek 74: 89–97.

Cole, J.R., Chai, B., Marsh, T.L., Farris, R.J., Wang, Q.,Kulam, S.A., et al. (2003) The Ribosomal Database Project

Intrasporangium calvum Micrococcineae D85486 Williamsia murale Corynebacterineae Y17384Janibacter terrae Micrococcineae AF176948Jonesia denitrificans Micrococcineae X78420Kibdelosporangium aridum Pseudonocardineae X53191Kineococcus aurantiacus Frankineae X77958Kineosporia aurantiaca Frankineae AF095336Kitasatospora setae Streptomycineae AB022868Knoellia sinensis Micrococcineae AJ294413Kocuria rosea Micrococcineae X87756‘Koreamonospora kribbensis’ Actinomycetalesd AB049939‘Krassilnikovia flexuosa’ Streptosporangineae AY039253Kribbella flavida Propionibacterineae AF005020Kutzneria viridogrisea Pseudonocardineae U58530Kytococcus sedentarius Micrococcineae X87755Lechevalieria aerocolonigenes Pseudonocardineae AF174436Leifsonia poae Micrococcineae AF116342Lentzea koreensis Pseudonocardineae Y09158Leucobacter komagatae Micrococcineae D45063Luteococcus japonicus Propionibacterineae Z78208Marmoricola aurantiacus Propionibacterineae Y18629Microbacterium terrae Micrococcineae Y17238Microbispora bispora Streptosporangineae U58524Micrococcus lylae Micrococcineae X80750Microlunatus sp. str. Y-73 Propionibacterineae D50065Micromonospora globosa Micromonosporineae X92600Micropruina glycogenica Propionibacterineae AB012607Microsphaera multipartita Frankineae X08541Microtetraspora fusca Streptosporangineae U48973‘Candidatus Microthrix parvicella’ Acidimicrobialesc X89560

Species Taxonomya Accession Species Taxonomya Accession

Table 4. cont.



(RDP-II): previewing a new autoaligner that allows regularupdates and the new prokaryotic taxonomy. Nucleic AcidsRes 31: 442–443.

Colquhoun, J.A., Heald, S.C., Li, L., Tamaoka, J., Kato, C.,Horikoshi, K., and Bull, A.T. (1998) Taxonomy andbiotransformation activities of some deep-sea actino-mycetes. Extremophiles 2: 269–277.

De Schrijver, A., and De Mot, R. (1999) Degradation of pes-ticides by actinomycetes. Crit Rev Microbiol 25: 85–119.

Dieter, A., Hamm, A., Fiedler, H.-P., Goodfellow, M., Müller,W.E.G., Brun, R., et al. (2003) Pyrocoll, an antibiotic, anti-parasitic and antitumor compound produced by a novelalkalophilic Streptomyces strain. J Antibiotics (in press).

Dunbar, J.S., Takala, S., Barns, S.M., Davis, J.A., and Kuske,C.R. (1999) Levels of bacterial community diversity in fourarid soils compared by cultivation and 16S rRNA genecloning. Appl Environ Microbiol 65: 1662–1669.

Embley, T.M., and Stackebrandt, E. (1994) The molecularphylogeny and systematics of the actinomycetes. AnnuRev Microbiol 48: 257–289.

Felsenstein, J. (1993) phylip Phylogeny Inference Package,Version 3.5.1. Seattle, WA: Department of Genetics, Uni-versity of Washington.

Felske, A., Rheims, H., Wolterink, A., Stackebrandt, E., andAkkermans, A.D.L. (1997) Ribosome analysis revealsprominent activity of an uncultured member of the classActinobacteria. grassland soils. Microbiology 143: 2983–2989.

Fenical, W., Baden, D., Burg, M., de Goyet, C.V., Grimes,J.D., Katz, M., et al. (1999) Marine-derived pharmaceuti-cals and related bioactive compounds. In From Monsoonsto Microbes: Understanding the Ocean’s Role in HumanHealth. Fenical, W. (ed.). Washington, DC: National Acad-emies Press, pp. 71–86.

Goodfellow, M., and Haynes, J.A. (1984) Actinomycetes inmarine sediments. In Biochemical and Biomedical Aspectsof Actinomycetes. Oritz-Oritz, L., Bojalil, L.F., and Yakoleff,V. (eds). London: Academic Press, pp. 453–472.

Goodfellow, M., Stanton, L.J., Simpson, K.E., and Minnikin,D.E. (1990) Numerical and chemical classification of Acti-noplanes and some related actinomycetes. J Gen Micro-biol 136: 19–36.

Häne, B.G., Jäger, K., and Drexler, H.G. (1993) The Pearsonproduct-moment correlation coefficient is better suited forthe identification of DNA fingerprint profiles than bandmatching algorithms. Electrophoresis 14: 967–972.

Hayakawa, M., Otoguro, M., Takeuchi, T., Yamazaki, T., andIimura, Y. (2000) Application of a method incorporatingdifferential centrifugation for selective isolation of motileactinomycetes in soil and plant litter. Antonie van Leeu-wenhoek 78: 171–185.

Heuer, H., Krsek, M., Baker, P., Smalla, K., and Wellington,E.M.H. (1997) Analysis of actinomycete communities byspecific amplification of genes encoding 16S rRNA andgel-electrophoretic separation in denaturing gradients.Appl Environ Microbiol 63: 3233–3241.

Kastner, M., Breuerjammali, M., and Mahro, B. (1994) Enu-meration and characterization of the soil microflora fromhydrocarbon-contaminated soil sites able to mineralizepolycyclic aromatic-hydrocarbons (PAH). Appl MicrobiolBiotechnol 41: 267–273.

Lazzarini, A., Cavaletti, L., Toppo, G., and Marinelli, F. (2000)Rare genera of actinomycetes as potential producers ofnew antibiotics. Antonie van Leeuwenhoek 78: 399–405.

Lee, D.-H., Zo, Y.-G., and Kim, S.-J. (1996) Nonradioactivemethod to study genetic profiles of natural bacterialcommunities by PCR-single-strand-conformation polymor-phism. Appl Environ Microbiol 62: 3122–3120.

Li, L.N., Kato, C., and Horikoshi, K. (1999) Bacterial diversityin deep-sea sediments from different depths. BiodiversConserv 8: 659–677.

Locci, R. (1994) Actinomycetes as plant pathogens. Eur JPlant Pathol 100: 179–200.

Ludemann, H., and Conrad, R. (2000) Molecular retrieval oflarge 16S rRNA gene fragments from an Italian rice paddysoil affiliated with the class Actinobacteria. Syst ApplMicrobiol 23: 582–584.

McCarthy, A.J. (1987) Lignocellulose-degrading actino-mycetes. FEMS Microbiol Rev 46: 145–163.

McNeill, M.M., and Brown, J.M. (1994) The medically impor-tant aerobic actinomycetes – epidemiology and microbiol-ogy. Clin Microbiol Rev 7: 357–417.

Macrae, A., Lucon, C.M.M., Rimmer, D.L., and O’Donnell,A.G. (2001) Sampling DNA from the rhizosphere of Bras-sica napus to investigate rhizobacterial community struc-ture. Plant Soil 233: 223–230.

McVeigh, H.P., Munro, J., and Embley, T.M. (1996) Molecularevidence for the presence of novel actinomycete lineagesin a temperate forest soil. J Ind Microbiol 17: 197–204.

Maidak, B.L., Cole, J.R., Lilburn, T.G., Parker, C.T., Saxman,P.R., Farris, R.J., et al. (2001) The RDP-II (RibosomalDatabase Project). Nucleic Acids Res 29: 173–174.

Marchesi, J.R., and Weightman, A.J. (2000) Modified primersfacilitate rapid screening of 16S rRNA gene libraries. Bio-techniques 29: 48–50.

Oldfield, C., Wood, N.T., Gilbert, S.C., Murray, F.D., andFaure, F.R. (1998) Desulphurisation of benzothiopheneand dibenzothiophene by actinomycete organisms belong-ing to the genus Rhodococcus, and related taxa. Antonievan Leeuwenhoek 74: 119–132.

Peczynska-Czoch, W., and Mordarski, M. (1988) Actino-mycete enzymes. In Actinomycetes in Biotechnology.Goodfellow, M., Williams, S.T., and Mordarski, M. (eds).London: Academic Press, pp. 219–283.

Peters, S., Koschinsky, S., Schwieger, F., and Tebbe, C.C.(2000) Succession of microbial communities duringhot composting as detected by PCR-single-strand-conformation polymorphism-based genetic profiles ofsmall-subunit rRNA genes. Appl Environ Microbiol 66:930–936.

Relman, D.A., Schmidt, T.M., Macdermott, R.P., and Falkow,S. (1992) Identification of the uncultured bacillus of Whip-ples disease. N Engl J Med 327: 293–301.

Rheims, H., and Stackebrandt, E. (1999) Application ofnested polymerase chain reaction for the detection of asyet uncultured organisms of the class Actinobacteria. envi-ronmental samples. Environ Microbiol 1: 137–143.

Rheims, H., Sproer, C., Rainey, F.A., and Stackebrandt, E.(1996) Molecular biological evidence for the occurrence ofuncultured members of the actinomycete line of descent indifferent environments and geographical locations. Micro-biology 142: 2863–2870.



Rheims, H., Felske, A., Seufert, S., and Stackebrandt, E.(1999) Molecular monitoring of an uncultured group of theclass Actinobacteria. two terrestrial environments. J Micro-biol Methods 36: 65–75.

Roux, K.H. (1995) Optimization and troubleshooting in PCR.In PCR Primer: a Laboratory Manual. Dieffenbach, C.W.,and Dveksler, G.S. (eds). Plainview, NY: Cold Spring Har-bor Laboratory Press, pp. 53–62.

Saano, A., and Lindstrom, K. (1995) Small scale extractionof DNA from soil with spun column cleanup. In MolecularMicrobial Ecology Manual. Akkermans, A.D.L., Van Elsas,J.D., and De Bruijn, F.J. (eds). Dordrecht, The Nether-lands: Kluwer Academic Publishers, pp. 1–6.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecu-lar Cloning: a Laboratory Manual, 2nd edn. Cold SpringHarbor, NY: Cold Spring Harbor Laboratory Press.

Schrempf, H. (2001) Recognition and degradation of chitin bystreptomycetes. Antonie van Leeuwenhoek 79: 285–289.

Sommer, R., and Tautz, D. (1989) Minimal homology require-ments for PCR primers. Nucleic Acids Res 17: 6749.

Speksnijder, A., Kowalchuk, G.A., De Jong, S., Kline, E.,Stephen, J.R., and Laanbroek, H.J. (2001) Microvariationartifacts introduced by PCR and cloning of closely related16S rRNA gene sequences. Appl Environ Microbiol 67:469–472.

Stach, J.E.M., and Burns, R.G. (2002) Enrichment versusbiofilm culture: a functional and phylogenetic comparisonof polycyclic aromatic hydrocarbon-degrading microbialcommunities. Environ Microbiol 4: 169–182.

Stach, J.E.M., Bathe, S., Clapp, J.P., and Burns, R.G. (2001)PCR-SSCP comparison of 16S rDNA sequence diversityin soil DNA obtained using different isolation and purifica-tion methods. FEMS Microbiol Ecol 36: 139–151.

Stackebrandt, E., and Goebel, B.M. (1994) Taxonomic note:a place for DNA–DNA reassociation and 16S rRNAsequence analysis in the present species definition in bac-teriology. Int J Syst Bacteriol 44: 846–849.

Stackebrandt, E., Rainey, F.A., and Ward-Rainey, N.L. (1997)Proposal for a new hierarchic classification system, Actino-bacteria classis nov. Int J Syst Bacteriol 47: 479–491.

Strohl, W.B. (2003) Antimicrobials. In Microbial Diversity andBioprospecting. Bull, A.T. (ed.). Washington, DC: Ameri-can Society for Microbiology Press, Chapter 31.

Takizawa, M., Colwell, R.R., and Hill, R.T. (1993) Isolationand diversity of actinomycetes in the Chesapeake Bay.Appl Environ Microbiol 59: 997–1002.

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994)Clustal-W – improving the sensitivity of progressive multi-ple sequence alignment through sequence weighting,position-specific gap penalties and weight matrix choice.Nucleic Acids Res 22: 4673–4680.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F.,and Higgins, D.G. (1997) The CLUSTAL_X windows inter-face: flexible strategies for multiple sequence alignmentaided by quality analysis tools. Nucleic Acids Res 25:4876–4882.

Trujillo, M.E., and Goodfellow, M. (2003) Numerical pheneticclassification of clinically significant sporoactinomycetesand related organisms. Antonie van Leeuwenhoek 84:39–68.

Umezawa, H. (1988) Low molecular weight enzyme inhibitorsand immunomodifiers. In Actinomycetes in Biotechnology.Goodfellow, M., Williams, S.T., and Mordarski, M. (eds).London: Academic Press, pp. 285–325.

Vergin, K.L., Rappe, M.S., and Giovannoni, S.J. (2001)Streamlined method to analyze 16S rRNA gene clonelibraries. Biotechniques 30: 938–943.

Ward, A.C., and Goodfellow, M. (2003) Phylogeny and func-tionality – taxonomy as a roadmap to genes. In MicrobialDiversity and Bioprospecting. Bull, A.T. (ed.). Washington,DC: American Society for Microbiology Press, Chapter28.

Wheeler, D.L., Church, D.M., Lash, A.E., Leipe, D.D., Mad-den, T.L., Pontius, J.U., et al. (2002) Database resourcesof the National Center for Biotechnology Information: 2002update. Nucleic Acids Res 30: 13–16.

Wohl, D.L., and McArthur, J.V. (1998) Actinomycete-floraassociated with submersed freshwater macrophytes.FEMS Microbiol Ecol 26: 135–140.

Zhang, H., Sekiguchi, Y., Hanada, S., Hugenholtz, P., Kim,H., Kamagata, Y., and Nakamura, K. (2003) Gemmati-monas aurantiaca gen. nov., sp. nov., a Gram-negativeaerobic polyphosphate-accumulating microorganism, thefirst cultured representative of the new bacterial phylumGemmatimonadetes phy. nov. Int J Syst Bacteriol (inpress).

Zheng, Z.H., Zeng, W., Huang, Y.J., Yang, Z.Y., Li, J., Cai,H.R., and Su, W.J. (2000) Detection of antitumor and anti-microbial activities in marine organism associated actino-mycetes isolated from the Taiwan Strait, China. FEMSMicrobiol Lett 188: 87–91.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页文献云下载图书馆入口外文数据库大全疑难文献辅助工具

http://www.xuebalib.com/cloud/

http://www.xuebalib.com/

http://www.xuebalib.com/cloud/


http://www.xuebalib.com/vip.html

http://www.xuebalib.com/db.php

http://www.xuebalib.com/zixun/2014-08-15/44.html


new primers for the class actinobacteria : application to ......ampliﬁcation of actinobacterial...

Documents