nature structural & molecular biology: doi:10.1038/nsmb€¦ · structures are based on the f....

Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073

Supplementary Figure 1

Predicted secondary structures of the ZTP riboswitches.

(a) Halothermothrix orenii, (b) Klebsiella pneumoniae, (c) Paenibacillus sp. HGF5, (d) Spirochaeta thermophila, (e) Thermobispora bispora, (f)

Thermosinus carboxydivorans, (g) Thermobacillus composti, and (h) F. ulcerans + 102-nt linker from environmental sample 3278. Secondary

structures are based on the F. ulcerans secondary structure as seen in the crystal structure. Additional helices predicted to form at the 5´ end of the

RNA are labeled “P0”, and the insertion domain helix of T. bispora is labeled “P5”.



Crystallization of F. ulcerans ZTP riboswitch.

(a) Image of ZTP riboswitch crystals growing from a polyethylene glycol precipitate, as described in methods. Bar denotes 100 m. (b) Denaturing

polyacrylamide gel of a single riboswitch crystal. Lanes 1–3: riboswitch RNA control: 2.5, 1.25, and 0.625 g purified RNA. Lanes 4–6: sequential

crystal wash solutions. Lane 7: riboswitch crystal. (c) Density-modified 2|Fo|-|Fc| SAD map (blue mesh) used for initial model building, contoured at

2 .



Conservation of ZTP riboswitch and mapping onto the F. ulcerans riboswitch.

(a) Conservation/covariation data published by Breaker and coworkers (Kim, P. B. et al, Mol Cell, 57, 317-28, 2015) mapped onto the sequence and

secondary structure of the F. ulcerans riboswitch. Red nucleotides are more than 97% conserved, blue nucleotides are more than 90% conserved, and

gray nucleotides are more than 75% conserved. (b) Cartoon view of the same conservation data mapped onto the crystallographic model. Coloring is

the same as in A, except black residues (not conserved) are shown in white.



Small-angle X-ray scattering (SAXS) analysis of ZTP riboswitches.


(a) Size-exclusion chromatography traces for the F. ulcerans, H. orenii, and T. carboxydivorans pfl RNAs. (b)

Denaturing and native polyacrylamide gels of pooled and concentrated monomer fractions, visualized by

staining with ethidium bromide. Lane 1: H. orenii. Lane 2: F. ulcerans. Lane 3: T. carboxydivorans. (c) SAXS

data for the F. ulcerans, H. orenii, and T. carboxydivorans RNAs in the presence (red) and absence (black) of

ZMP. Arrow indicates the presence of aggregation in the T. carboxydivorans samples without ZMP. (d) Kratky

plot for the F. ulcerans riboswitch in the presence (black) and absence (red) of ZMP. (e) Cartoon view of the

crystal contact interface formed between two RNA dimers (left) and overall view of the tetramer in the crystal

(right). (f) Normalized size-exclusion chromatography traces of purified monomeric (left) and dimeric (right)

fractions of the F. ulcerans riboswitch prior to isothermal titration calorimetry (ITC) measurements (black) and

after ITC measurements (red).



Representative isothermal calorimetry titration experiments and single-round transcription experiments of F. ulcerans ZTP riboswitch linker variant

RNAs.

(a) 20 M wild-type ZTP riboswitch titrated with 200 M ZMP. (b) 50 M +10 A linker variant titrated with 1 mM ZMP. (c) 50 M +20 A linker

variant titrated with 1 mM ZMP. (d) 50 M +env3278 linker variant titrated with 1 mM ZMP. (e) 40 M ZTP riboswitch lacking the pseudoknot

(55-75) with 40 M 59–75 added in trans titrated with 800 M ZMP. (f) 40 M ZTP riboswitch 55-75 titrated with 800 M ZMP. (g)

Representative transcription termination experiment of F. ulcerans ZTP riboswitch linker variants. Lanes 1–3: wild-type template in the presence of

0, 100, and 1000 M ZMP. Lanes 4–6: +10A linker template in the presence of 0, 100, and 1000 M ZMP. Lanes 7–9: +20A linker template in the

presence of 0, 100, and 1000 M ZMP. Lanes 10–12: +env3268 linker template in the presence of 0, 100, and 1000 M ZMP. Bands corresponding

to full-length (F) and terminated (T) transcription products are indicated.


Supplementary Table 1. Sequences of ZTP riboswitch plasmids

Species Genbank Code Sense/ Antisense

Genbank Sequence, nts RNA Sequence

Fusobacterium ulcerans ACDH02000027.1 antisense 25274–25200

UAUCAGUUAUAUGACUGACGGAACGUGGAAUUAACCACAUGAAGUAUAACGAUGACAAUGCCGACCGUCUGG

GCG

Thermosinus carboxydivorans NZ_AAWL01000017.1 antisense 16389–16319

GGAUACAGGACUGGCGGAUUAGUGGAAGCAACCACGUGGACUGUAUCCGAAGAAAAGCCGACCGCCUGGGC

Halothermothrix orenii NC_011899.1 antisense 2532890–

2532811

GGUCAUACGACUGGCGGUAUUAUAUGGAAUUAACCAUAGGGGAGUAUGACCGAUACUGGAAUAGCCGACCGC

CUGGGCAG

Paenibacillus sp. HGF5 NZ_AEXS01000185.1 antisense 10126–10053

GUUUAUGUGUGACUGGCGUAGCAUGGGGAACCAUGAGGGAGCACAUGGAUGACAACGGCCGUACGCCUGGGC

AG

Spirochaeta thermophila NC_014484.1 antisense 218946–

218848

CCCCUGCACUUCCCGCGAUAAUGGGACGACGACUGGCGCCCUCCGAGGCGGAAUCGACCGCCGGGGAGUCUUUUCCUCACCUGUCGCGCG

CCUGGGCAG

Thermobacillus composti NZ_AGFE01000009.1 antisense 140265–

140191

GUCCGAUGUGACUGGCGACGUUAAGUGGGGAACCACGGUGGAGCAUCGGACGAUAUUGGCCGGUCGCCUGGG

CAA

Thermobispora bispora NC_014165.1 antisense 2607860–

2607750

CCGAUAGAGUGAUGGGGCACGCGACUGGCGCUUGACGUGCCGCCGGCACGUCAAAAGGUGGGGCACCACCGGGGAGCGAAUCCGCGGAGGCCGUGCGCCUGGGUCGCC

GCG

Klebsiella pneumoniae NC_011283.1 sense 2593719–

2593786

ACCAUGUGACUGGCGCUGAAGACAGAAUACUGUCGGGGAGCAUGGUCGACGUCGCCGCGCGCCUGGGC

F. ulcerans +insert env3278 - - -

UAUCAGUUAUAUGACUGACGGAACGUGGAAUUAACCACAUGAAGUAUAACAAGGUGACAGAUCCAAAAAUUGCACCGCAGAUAGGGCGAU ACAUCACAGAUGUACCGCAGAUAAGGCGAUGCUUCAGAGAAGCACCGCAGGGUGCCGACCGUCUGGGCG


Supplementary Table 2. Isothermal calorimetry measurements of ZTP riboswitch species and mutants

RNA KD, nM G, kcal mol-1 H, kcal mol-1 T S, kcal mol-1

Fusobacterium ulcerans 487 ± 142 -9.14 ± 0.46 -17.1 ± 1.92 -8.15 ± 2.03

Thermobacillus composti 935 ± 320 -8.57 ± 0.21 -20.5 ± 7.1 -11.9 ± 6.8

Klebsiella pneumoniae N.B. N.B. N.B. N.B.

Thermosinus carboxydivorans 2370 ± 480 -7.77 ± 0.19 -5.69 ± 0.79 2.08 ± 0.98

Halothermothrix orenii 110 ± 26 -9.89 ± 0.15 -19.8 ± 3.2 -9.87 ± 3.0

Paenibacillus sp. HGF5 N.B. N.B. N.B. N.B.

Thermobispora bispora 1020 ± 150 -8.49 ± 0.12 -13.9 ± 2.6 -5.38 ± 2.7

Spirochaeta thermophila N.B. N.B. N.B. N.B.

29-34 U1A N.B. N.B. N.B. N.B. 29-34 GAAA N.B. N.B. N.B. N.B. 29-34 UCUG N.B. N.B. N.B. N.B.

U16A N.B. N.B. N.B. N.B. U16C N.B. N.B. N.B. N.B.

G17C C69G N.B. N.B. N.B. N.B. G17A C69U N.B. N.B. N.B. N.B.

A29U 27100 ± 5200 -6.49 ± 0.11 -3.93 ± 0.68 2.56 ± 0.80 A33G 603 ± 5 -8.83 ± 0.01 -15.6 ± 0.23 -6.78 ± 0.23 A33U 2080 ± 640 -8.08 ± 0.19 -8.37 ± 0.49 -0.29 ± 0.30 A34G 50200 ± 2700 -6.10 ± 0.03 -6.38 ± 0.96 -0.28 ± 0.99 A34U 33500 ± 3100 -6.35 ± 0.06 -8.16 ± 0.92 -1.81 ± 0.86 U40A 6910 ± 6100 -7.48 ± 0.64 -3.02 ± 1.7 4.45 ± 2.4 U40C 6990 ± 1500 -7.32 ± 0.13 -5.00 ± 0.23 2.32 ± 0.37 G63A N.B. N.B. N.B. N.B. G63U N.B. N.B. N.B. N.B. U70A N.B. N.B. N.B. N.B. U70C N.B. N.B. N.B. N.B. G71A N.B. N.B. N.B. N.B. G71U N.B. N.B. N.B. N.B.

+10A linker 2990 ± 330 -7.84 ± 0.07 -18.3 ± 0.03 -10.4 ± 0.04 +20A linker 4740 ± 370 -7.56 ± 0.05 -20.2 ± 0.35 -12.6 ± 0.30

+env3278 linker 9700 ± 2200 -7.13 ± 0.13 -7.91 ± 0.69 -0.78 ± 0.83 55-75 N.B. N.B. N.B. N.B.

55-75 + 59-75 intrans 14200 ± 3200 -6.89 ± 0.15 -18.2 ± 4.7 -11.3 ± 4.8


Supplementary Table 3. PCR primers for transcription termination templates

Primer name Plasmid(s) amplified Primer sequence

Transcription template forward

primer

Wild-type F. ulcerans,F. ulcerans +10A, F.

ulcerans +20A, F.ulcerans +env3268

AAACCAAATAAGAAATTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATGTAGTAAGGAGGTTGTATGGAAGATATCAGTTATATGA

CTGACG*

Transcription template reverse

primer

Wild-type F. ulcerans,F. ulcerans +10A, F.

ulcerans +20A

TCAACAATTATATTTGATATTTTTTTATTATCTTTTCCTAAAAAAATGTATAAAAAAAACCGACAATCTAGGCTTGTTCGCCCAGACGGT

CGGCATTGa

Transcription template +Env3268

linker reverse primer F. ulcerans +env3268

TCAACAATTATATTTGATATTTTTTTATTATCTTTTCCTAAAAAAATGTATAAAAAAAACCGACAATCTAGGCTTGTTCGCCCAGACGGT

CGGCACCCa

a Underlined sequence is the portion of primer complementary to the F. ulcerans plasmid.


nature structural & molecular biology: doi:10.1038/nsmb€¦ · structures are based on the f....

Documents