natural transformation of the filamentous cyanobacterium ...14 of the filamentous cyanobacterium...

Title: Natural transformation of the filamentous cyanobacterium Phormidium 1

lacuna 2

Running title: Natural transformation of Phormidium lacuna 3

Authors: Fabian Nies, Marion Mielke, Janko Pochert, Tilman Lamparter 4

Affiliation: Botanical Institute, Karlsruhe Institute of Technology (KIT), Fritz Haber Weg 4, 76131 5

Karlsruhe, Germany 6

Corresponding author: Tilman Lamparter, e-mail [email protected] 7

8

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted December 10, 2019. ; https://doi.org/10.1101/870006doi: bioRxiv preprint

https://doi.org/10.1101/870006

Abstract 9

Research for biotechnological applications of cyanobacteria focuses on synthetic pathways and 10

bioreactor design, while little effort is devoted to introduce new, promising organisms in the field. 11

Applications are most often based on recombinant work, and the establishment of transformation 12

can be a risky, time-consuming procedure. In this work we demonstrate the natural transformation 13

of the filamentous cyanobacterium Phormidium lacuna and insertion of a selection marker into the 14

genome by homologous integration. This is the first example for natural transformation of a member 15

of the order Oscillatoriales. We found that Phormidium lacuna is polyploid, each cell has about 20-16

100 chromosomes. Transformed filaments were resistant against up to 15 mg/ml of kanamycin, and 17

the high resistance feature allowed for rapid segregation into all chromosomes. Formerly, natural 18

transformation in cyanobacteria has been considered a rare and exclusive feature of a few unicellular 19

species. Our finding suggests that natural competence is more distributed among cyanobacteria than 20

previously thought. This is supported by bioinformatic analyses which show that all protein factors 21

for natural transformation are present in the majority of the analyzed cyanobacteria. 22

23


https://doi.org/10.1101/870006

Introduction 24

Biotechnology oriented research with cyanobacteria ranges from the production of low-cost material 25

like bulk chemicals or biofuels (1) to high-value compounds like pharmaceutics (2). Advancements in 26

cyanobacterial biotechnology are based on continued optimization of photobioreactors, the 27

introduction and improvement of metabolic pathways by recombinant DNA technology, and the 28

search for suitable organisms (3, 4). The establishment of protocols for gene transfer can be 29

challenging for new cyanobacteria, because of barriers like extracellular materials and nucleases 30

(reviewed in (5)). There are three common methods for gene transfer into cyanobacteria: 31

electroporation, conjugation, and natural transformation (NT). For NT, cells have to be in a 32

physiological state, termed natural competence, in which the recipient cell is able to actively 33

transport DNA into the cytoplasm. Protocols for NT are generally simple and straight forward (6, 7), 34

but only few naturally competent cyanobacteria (NCC) are known: diverse Synechococcus (8, 9) and 35

Synechocystis (10, 11) strains, Microcystis aeruginosa PCC 7806 (12) and Thermosynechococcus 36

elongatus BP-1 (13). These cyanobacteria have a unicellular lifestyle, and NT was frequently 37

described as a unique feature of few unicellular cyanobacteria (6, 14, 15). We also found one report 38

about NT of the filamentous cyanobacterium Nostoc muscorum (16), but are not aware of other 39

filamentous cyanobacteria. 40

Natural transformation in bacteria is dependent on pil proteins of type IV pili. Furthermore, the 41

competence proteins ComEA, ComEC, and ComF as well as the DNA processing protein DprA and the 42

DNA recombination and repair protein RecA are essential (17-19). For the cyanobacterium 43

Synechocystis sp. PCC 6803 , comEA, comF, pilA1, pilB1, pilD, pilM, pilN, pilO, pilQ, and pilT1 knockout 44

mutants are deficient in NT (20-23). Although in a recent survey, homologs of these and other 45

competence related genes were found in most cyanobacterial genomes (24) there is so far no 46

experimental evidence for NT in a novel species since more than a decade. 47

Most cyanobacteria possess multiple chromosomes per cell (25-29). After transformation, 48

homologous recombination results in the integration into one chromosome. Segregation into the 49


https://doi.org/10.1101/870006

other chromosomes can be achieved by selection on increasing antibiotic concentrations. Until 50

complete segregation is achieved, the transformants may be unstable and the integrated sequences 51

can be lost again under nonselective conditions (30, 31). 52

In this work we established an NT protocol for Phormidium lacuna, a filamentous cyanobacterium of 53

the order Oscillatoriales, a species isolated and characterized by our workgroup as a promising 54

candidate for biotechnological applications (32). This is to our knowledge the first transformation 55

protocol for the genus Phormidium and the first report of NT for the order Oscillatoriales. 56

Phormidium lacuna was transformed by the integration of the kanamycin (Kn) resistance cassette 57

(kanR) into the genome via homologous recombination. Clones were selected by Kn resistance and 58

integration into genome was validated by PCR. During clone validation it was found that Phormidium 59

lacuna is polyploid. This was confirmed by a DAPI fluorescence assay. By comprehensive BLAST 60

analysis based on sequences of essential proteins for natural transformation (natural transformation 61

factors, NTFs) we predict that a large fraction of cyanobacteria might be naturally transformable. 62

63

Methods 64

Plasmids for transformation 65

For transformation studies, we constructed plasmids with a Phormidium lacuna sequence sc_7_37 66

(position 37 in DNA scaffold 7) that is interrupted in the middle by a kanamycin resistance cassette. A 67

1138 bp and a 2167 bp product were generated by PCR using Q5 polymerase (NEB, Ipswich, MA, 68

USA) and HE10DO DNA as template. The primer pairs were t256: CGTGCGAGACTCAACCCAAAC / 69

t257: GAAACCTGATCGAACCGTTTTAC for the short sequence and F114: TTGTTCGAGGCAGTTGCG / 70

F115: TGACAATGGGGTGGAGGG for the long sequence. The sequences were integrated into pGEM-T 71

(Madison, WI, Promega, USA). The Phormidium lacuna sc_7_37 sequence encodes for a putative 72

hydrogenase (WP_087706519); the sequence of the strain used in the present study, HE10DO, is 73


https://doi.org/10.1101/870006

identical with Phormidium lacuna HE10JO for which the genome sequence is established (32). pGEM-74

T plasmids are not propagated in cyanobacteria due to incompatible origin of replication (33). 75

The kanamycin resistance cassette kanR was PCR amplified from pUC4K (34) using the primer pair 76

GG1: CAACAAGAAGACGGAACCTAGGCACCCCAGGCTTTACAC / GG2: 77

CAACAAGAAGACGCAAACTTTGCTTTGCCACGGAACGG. The plasmid with the long sc_7_37 insert was 78

amplified with the primers GG3: CAACAAGAAGACCCGTTTGCGAGGCTAAAGGC / GG: 4 79

CAACAAGAAGACACGGTTCCCACTCCCAAAGC. The resulting plasmid pFN_7_37_2k_kanRn was 80

generated by the type IIS restriction enzyme BbsI and T4 DNA ligase (both NEB, USA). Another 81

version of kanR with slightly different 5´ and 3´UTR was generated by PCR using the primer pair F13: 82

CAACAATCTAGACTCGTATGTTGTGTGGAATTG / F14: CAACAAGCTAGCCAAGTCAGCGTAATGCTCTG. This 83

cassette was inserted in the plasmids with the long and the short homologous sc_7_37 sequence. 84

Plasmids were amplified with the primer pair F5: CAACAAGCTAGCGTTTGCGAGGCTAAAGGCG / F6: 85

CAACAATCTAGAGGTTCCCACTCCCAAAGC and DNA sequences digested with XbaI and BmtI (NEB, 86

Ipswitch, MA, USA) and ligated. The resulting plasmids are termed pFN_7_37_kanR and 87

pFN_7_37_2k_kanR plasmids for transformation were purified using Macherey Nagel (Düren, 88

Germany) midi-prep plasmid purification kit. 89

90

Cultivation of Phormidium lacuna 91

Phormidium lacuna strains HE10DO and HE10JO were cultivated at 23 °C in f/2 salt water medium 92

(35, 36) or in f/2+ (in which nitrate and phosphate are 10x increased) under permanent illumination 93

(30 µmol m-2 s-1 white light from fluorescent tubes Lumilux-DeLuxe L 18/954, Osram, Munich, 94

Germany) and continuous shaking (70 rpm). For agar plates, f/2 medium without Na2SiO3 and with 95

1.5% Bacto Agar (BD Diagnostics, Franklin Lakes, NJ, USA) were used. 96

97

Transformation 98


https://doi.org/10.1101/870006

For transformation, Phormidium lacuna HE10DO (32) were cultivated in 100 ml f/2 medium to an 99

optical density OD750 nm of 0.25 - 0.35. The cell suspension was homogenized using an Ultraturrax 100

(Silent Crusher M. Heidolph, Schwabach, Germany) with the dispersion tool 18F at 10,000 rpm for 3 101

min. The cell suspension was centrifuged at 6000 g and 4°C for 15 min. After each centrifugation 102

step, the supernatant was removed. Cells were resuspended in 20 ml water (4 °C) and centrifuged 103

again. This washing step was repeated. The cells were finally suspended in the residual liquid, 104

transferred into 1.5 ml tubes and centrifuged again at 6000 g at 4°C for 15 min. Cells were finally 105

suspended in 1 ml supernatant. Portions of 100 µl were mixed with 3-30 µg DNA in 10 µl water, 106

transferred into 10 ml f/2 medium and cultivated for 2 d. Cells were again centrifuged, resuspended 107

in 1 ml medium and transferred to f/2 agar plates with 0, 70 and 120 µg/ml Kn. Resistant lines were 108

selected after 10 -28 d. Transgenic cells were cultivated on increasing Kn concentrations in f/2+ 109

suspension culture until complete segregation was achieved. Electroporation experiments were 110

performed with both strains HE10DO and HE10JO, whereas natural transformation was performed 111

with the strain HE10DO only. 112

113

Validation of transformants 114

To test for homologous integration, ca. 10 mg cell samples were homogenized and lysed 115

mechanically by micropestle and subjected to PCR with Taq Polymerase (NEB, USA). The following 116

primers were used: F25: GGTCTAGGTGAGGCAATCC / F28: ACCTGATTTGTTTATATCTGACGC for 117

pFN_7_37_kanR transformants and F120: GGGTAGCCTAGACTCATCC / F121: 118

ATGCGGAAGTGACTGAGG for pFN_7_37_2k_kanR and pFN_7_37_2k_kanRn transformants. All 119

primers bind only in the Phormidium lacuna genome, upstream or downstream of the integration 120

site. 121

122

Bioinformatics 123

Protein sequences of the NTFs of Synechocystis sp. PCC 6803 were obtained from the NCBI data base. 124

NTF sequences of 6 naturally competent cyanobacteria (NCC) were identified by the offline NCBI tool 125


https://doi.org/10.1101/870006

BLAST+ (version: 2.7.1, (37)) based on the annotated NTFs of Synechocystis sp. PCC 6803. All NTFs 126

identified in this way were used in a BLAST query against all cyanobacterial sequences of the NCBI 127

non-redundant database (August 2018). Bit score as indicator of homology was processed by a 128

minimum homology quotient method: For each homolog, the bit score of each alignment was 129

divided the by smallest bit score of the respective NCC pairs. This value is given in Table 3. 130

131

Chromosome copy number 132

Phormidium lacuna liquid cultures were homogenized by an Ultraturrax for 3 min at 10,000 rpm. To 133

determine the cell concentration, the total length of all filaments in a given volume of a counting 134

chamber was estimated (about 50 filaments for each sample) and divided by the average cell length 135

(4 µm). Cells were quantitatively disrupted using an Aminco French pressure cell (Thermo Fischer, 136

Waltham, MA, USA). A fluorescence excitation spectrum from 300 to 400 nm was recorded at 490 137

nm emission. Thereafter, DAPI was added to a final concentration of 100 ng/ml. The fluorescence 138

spectrum was measured again. After addition of 5 µl DNase (75 Kunitz) the fluorescence decreased 139

over 2 h. The difference of peak values before and after DNA digestion was taken as measure for 140

DNA concentration. As a reference, calf thymus DNA at various concentrations was dissolved in the 141

same medium and the exact concentrations determined by A260 nm. The same fluorescence recordings 142

were performed as with Phormidium lacuna DNA. Final values were corrected by GC contents of both 143

species, since GC does not induce DAPI fluorescence (38). A genome size of 3.5 Mio bp from genome 144

sequencing was taken for Phormidium lacuna (32). 145

146

Results 147

We initially established a transformation protocol for Phormidium lacuna by electroporation that was 148

based on protocols for related filamentous cyanobacteria (39-42). For integration into cyanobacterial 149

DNA we used homologous recombination, which works at high efficiency in cyanobacteria (43) and 150

other bacteria. In the transformation vectors, the homologous sequence “sc_7_37” was interrupted 151


https://doi.org/10.1101/870006

by a kanR resistance cassette. With these vectors, we obtained Kn resistant lines in about 40% of 152

trials. During electroporation studies, we isolated a resistant line from a control experiment in which 153

cells were incubated with DNA, but no electroporation pulse was given. The transformation protocol 154

could be optimized (Table 2 and methods) so that in almost all transformation assays, DNA was 155

integrated in Phormidium lacuna cells. Fig. 1 shows examples for filaments on selection medium at 156

different time points after transformation. 157

During our studies, we used plasmids pFN_7_37_kanR and pFN_7_37_2k_kanR(n) (Fig. 2 A and 158

methods) that differ by the length of the homologous sequence; the kanR resistance cassette is 159

flanked by ca. 500 bp or 1000 bp homologous sequences on each side, respectively. In a comparison 160

of electroporation and NT that were performed under similar conditions (Table 1 and methods 161

section), the success rate was always higher for NT as compared to electroporation (Table 2). When 162

the pFN_7_37_2k_kanR(n) vectors was used , 15 out of 16 NT transformation trials were successful, 163

i.e. resulted in the isolation of resistant lines that could be confirmed by PCR (see below). In the 164

electroporation experiments, only 44 % transformation trials were successful. We assume that the 165

deleterious effect of the electric pulse overrides the positive effect that the pulse might have on DNA 166

incorporation into the cells. For Synechocystis sp. PCC 6803 it was observed that longer flanking 167

sequences are beneficial for the homologous recombination into the genome (44). For Phormidium 168

lacuna, we found no significant difference of transformation success between 500 bp and 1000 bp 169

flanking sequences (Table 2). The length of the insert can also be critical for integration into the 170

genome. In further transformation experiments we used inserts up to a length of 4241 bp. These 171

could also be integrated into the genome of Phormidium lacuna, although with lower transformation 172

efficiencies. It should be noted that the electroporation experiments were performed with both 173

strains HE10JO and HE10DO, whereas natural transformation experiments were only performed with 174

HE10DO. 175

176


https://doi.org/10.1101/870006

We found that transformants with the kanR cassette were resistant against very high Kn 177

concentrations. Transformed lines could be routinely cultivated up to at least 15 mg/ml Kn (Fig. 2). In 178

50 mg/ml Kn, transformants remained green for few days but did not survive the first week. The 179

upper limit for Kn resistance is thus around 20-40 mg/ml. Escherichia coli DH5α and Synechocystis sp. 180

PCC 6803 cells, transformed with the same kanR, were resistant up to ca. 200 µg/ml and ca. 500 181

µg/ml Kn, respectively. In an extensive literature survey we found a report about an environmental 182

Enterococcus strain that was resistant up to 2 mg/ml Kn (45), but no report about higher Kn 183

resistance. Thus, transformed Phormidium lacuna has probably the strongest Kn resistance reported 184

so far. 185

We wanted to integrate the resistance cassette into a neutral site in order to allow expression of 186

additional introduced genes in future experiments. The selected homologous sequence codes for a 187

hydrogenase homolog (WP_087706519). Cyanobacterial hydrogenases are oxygen sensitive (46) and 188

should not be active under our standard growth conditions with continuous illumination. Indeed, the 189

transformants did not display an observable phenotype. 190

The integration into the genome was validated by PCR. Figure 3 shows results from a transformation 191

with pFN_7_37_KanR. The used primers bind to regions in the genome of Phormidium lacuna just 192

upstream or downstream of the insertion site, respectively. In wild type extracts, an expected short 193

PCR product of 1200 bp was detected (Fig. 3). Lines T1a and T1b are from filaments that had been 194

cultivated in liquid medium with 1000 µg / ml kanamycin for 4 weeks after transformation and the 195

expected long PCR product with 2600 bp was detected. In T2a and T2b, which are from filaments that 196

were cultivated for 9 d in liquid culture with 250 µg/ml Kn, both the 1200 bp and the 2600 bp PCR 197

products were present. Such a “partial integration” is known from transformations of other 198

cyanobacteria where it results from the polyploid character of these cells (25). In our Phormidium 199

lacuna transformation experiments, the pattern of partial integration during early selection and 200

complete integration after prolonged selection was observed in 8 independent experiments. In order 201

to find out whether Phormidium lacuna cells are also polyploid, we estimated the number of 202


https://doi.org/10.1101/870006

chromosome copies by a DAPI based fluorescence assay. In single experiments, the estimated values 203

of chromosome copies varied between ca. 20 and ca. 120. Phormidium lacuna has thus multiple 204

chromosome copies per cell. We assume that the large variations are not only due to methodological 205

variations, since in control measurements with calf thymus DNA the variations were much smaller. 206

Although cultivation was performed under standardized conditions, yet unknown factors must affect 207

the chromosome copy number of whole samples. However, when the Phormidium lacuna data were 208

plotted against cell densities (Fig. 3), values at lower densities i.e. shorter time of propagation, 209

correlated with higher numbers of chromosome copies; at higher OD, the copy numbers were 210

around 20. Thus, there is an influence of growth phase on the chromosome copy number in 211

Phormidium lacuna, which has also been reported for Synechocystis sp. PCC 6803 (24, 28). 212

We also studied by PCR how the Kn concentration in the medium affects the segregation of kanR in 213

the genome (Fig. 4). After transformation and selection of a resistant line and one cultivation cycle in 214

suspension culture with 100 µg/ml Kn, the filaments were divided and cultured at 0, 100, 980 and 215

8300 µg/ml in suspension culture with subcultivation every 7 d for 4 weeks. After the first 216

subcultivation, two PCR bands were observed in all cultures, indicating that Kn resistance was 217

integrated in a part of the chromosomes but not in all (Fig. 4 a). Without antibiotic pressure, the 218

2600 bp PCR product decreased transiently and increased again after the 4th subcultivation, and the 219

1200 bp wild type PCR product was present through all subcultivations. In the 100 µg/ml Kn samples, 220

the wild type band was diminished after the third subcultivation and almost, but not completely, lost 221

after the 4th subcultivation. The results were similar for the selection on 980 µg/ml Kn. With 8300 222

µg/ml Kn, the wild type band disappeared almost completely already after the 2nd subcultivation and 223

was apparently lost after the 3rd and 4th subcultivations. Thus, high concentrations of Kn result in 224

rapid segregation of kanR into all chromosomes. The high Kn resistance of Phormidium lacuna 225

transformants could therefore provide an advantage for fast segregation of the selection marker in 226

comparison to other cyanobacteria (47). 227


https://doi.org/10.1101/870006

Phormidium lacuna HE10DO is the first representative of the order Oscillatoriales for which a NT 228

protocol was established. According to mutant studies with Synechocystis sp. PCC 6803, proteins of 229

the type IV pili PilA1, PilB1, PilD, PilM, PilN, PilO, PilQ, PilT1 and the DNA receptor ComEA and ComF 230

are NTFs, i.e. required for NT (20-23). Other NTFs that are essential for NT in general (but loss of NT 231

has not been demonstrated in cyanobacteria) are ComEC, DprA and RecA (19). A functional type IV 232

pilus in combination with this set of expressed non-pili proteins is probably not only crucial but also 233

sufficient for NT. We can therefore assume that the probability for NT is high if a species has 234

functional homologs of all proteins. In order to get an overview about the distribution of these 235

proteins in selected cyanobacteria, we first identified NTF BLAST homologs in the naturally 236

competent cyanobacteria (NCC), Synechocystis sp. PCC 6803, Synechococcus elongatus PCC 7942, 237

Synechococcus sp. PCC 7002, Thermosynechococcus elongatus BP-1, Microcystis aeruginosa PCC 7806 238

and, Phormidium lacuna HE10JO (8-13). The strains Phormidium lacuna HE10JO and HE10DO are very 239

similar and the genomic data for HE10JO is considered also relevant for the strain HE10DO (31). This 240

set of proteins is used to define a range of similarity to decide whether other homologs are 241

functional or not. We BLASTed all NTFs of all NCCs against the genomes of selected other 242

cyanobacteria. In order to normalize each target, the highest bit-score (out of 6) was divided by the 243

lowest bit-score among the 6 NCCs (i.e. the most unrelated NTF pair among NCCs). If the quotient is 244

>= 1, we regard the target protein as functional homolog, because it is then within the range of NCC. 245

If all NTF homologs of a species have values >= 1, the chances are high that NT is possible. Among 30 246

cyanobacterial species for which no NT is reported, 19 have quotients >=1 for all 13 NTF homologs 247

and are thus promising candidates for NT. Among them are 14 filamentous cyanobacteria including 248

two members of the genera Arthrospira / Spirulina and Trichodesmium with high economic impact. 249

For other species the quotient for one or more NTFs is below 1, yet all essential genes for NT seem to 250

be present in the genome but in lower homology to the NCC. These organisms may also be naturally 251

transformable but it may be less likely due to the homology based prediction. Quotients ≤ 0.2 are 252

considered as indicative for random hits during the BLAST search. Therefore, the 5 species that have 253

at least one quotient ≤ 0.2 are regarded as critical for NT. 254


https://doi.org/10.1101/870006

Discussion 255

Even though natural competence is known for several single celled cyanobacterial species and one 256

filamentous cyanobacterium, Nostoc muscorum (16), this mechanism was considered as rare trait 257

among cyanobacteria (6, 14, 15). The finding of natural competence in Phormidium lacuna, the first 258

example for the order Oscillatoriales, was therefore unexpected and surprising. Since now a new 259

order of cyanobacteria is addressed, we assume that natural competence is broadly distributed 260

among cyanobacteria. Our bioinformatic studies on the distribution of NTF homologs among 30 261

species, which are intended to be a representative selection of the cyanobacterial phylum, supports 262

this hypothesis: functional homologs of all NTFs are present in at least 19 species. Thus, NT seems to 263

be a widely distributed physiological function in cyanobacteria and could contribute more to 264

evolutionary adaptations than previously suggested. It might play a major role in horizontal gene 265

transfer, genetic recombination, and DNA repair in this phylum. Natural transformation is easy and 266

uncomplicated and a more widespread use would be a benefit for basic and applied research in the 267

field. 268

Our bioinformatic analysis gives example that the rapidly increasing numbers of cyanobacterial 269

genomes will help to identify potentially transformable species and offers a simple way to rank 270

potential candidates. A recently published similar analysis (24) also comes to the conclusion that 271

natural competence could be a common feature among cyanobacteria. However, not only the 272

complete set of essential genes for natural competence but also their coordinated expression is 273

important. Gene expression of NTFs is probably dependent on internal or environmental parameters. 274

Studies on the regulation of natural competence are mostly limited to the gram positive genera 275

Bacillus and Streptococcus and the gram negative Vibrio cholerae (48, 49). 276

All Phormidium lacuna filaments are highly motile on agar medium (35), and motility of 277

cyanobacteria is thought to be dependent on type IV pili (50), the same structure that mediates NT. 278

Motility indicates that pil genes are expressed, and a preselection of motile strains or conditions that 279

increase motility could help in successful NT. The filamentous growth and motility on agar surfaces 280


https://doi.org/10.1101/870006

and different membranes is the reason why no colonies are obtained after transformation and the 281

respective frequencies cannot be calculated as cfu/µg of plasmid DNA. 282

Genetic engineering is now possible for another cyanobacterium, which can be used in the future for 283

basic research and biotechnological applications. The established protocol includes few washing 284

steps, DNA addition and subcultivation, and clear results are obtained after about 4 weeks. 285

Homogenization of filaments and subsequent washings could remove extracellular polymeric 286

materials and nucleases (5) and could thereby promote NT. Members of the genus Arthrospira (or 287

Spirulina), for which high nuclease activities were reported (40, 51), might be transformed by the 288

same or a similar approach. Trials with other cyanobacteria that follow either the standard protocol 289

or a simplified version of it are easy and can rapidly provide clear results. 290

The Phormidium lacuna transformants have an extraordinarily high resistance against Kn. We have in 291

the meantime targeted other loci and found a strong antibiotic resistance for these transformants as 292

well. We therefore would rule out a gene-positional effect on kanR expression. Although the origin of 293

this strong resistance is unclear, it could accelerate the segregation into chromosomes and thereby 294

speed up the entire transformation process. 295

We have shown that a newly isolated cyanobacterium Phormidium lacuna can be transformed by 296

natural transformation and homologous recombination during which a kanR resistance cassette is 297

integrated into the genome, that the transformants are extraordinarily resistant against Kn, that the 298

cyanobacterium has multiple chromosome copies and that rapid segregation of the kanR resistance 299

cassette into all chromosomes can be by achieved by the high resistance. We hope that our results 300

stimulate trials on natural transformation of other cyanobacteria and thereby contribute to a 301

broadening of research on more species, especially the filamentous ones. 302

Acknowledgments 303

The work for supported by the PhD fellowship of the Nagelschneider Foundation to Fabian Nies. We 304 thank Nadja Wunsch for technical assistance. 305

Confilct of interest: The authors declare that there is no conflict of interest with other parties 306


https://doi.org/10.1101/870006

Tables 307

Table 1. Summary of NT protocol for Phormidium lacuna. Additional details are given in the methods 308

section. 309

310

Duration

Cultivate of 100 ml Phormidium lacuna until OD750 nm = 0.3 6 d

Ultraturrax treatment and OD750 measurements 20 min

Centrifuge and remove supernatant 20 min

Suspend cells in 20 ml H2O and centrifuge, 4°, repeat 1 x 40 min

Suspend cells in 1 ml H2O and centrifuge (for 10 transformations) 20 min

Mix 100 µl cell suspension with 30 µg DNA (from midi prep) 15 min

Cultivate in 10 ml f/2 2 d

Centrifuge 1 x 15 min

Growth on agar plates with and without Kn 2 - 4 weeks

Select resistant filaments under microscope, transfer into f/2 with Kn 30 min for each

Growth in f/2+ with Kn 2 weeks

PCR test for insertion and segregation 5 h

311

312


https://doi.org/10.1101/870006

Table 2. Transformation of Phormidium lacuna HE10DO by electroporation and natural 313

transformation. The numbers stand for successful transformations i.e. 1 or more resistant lines could 314

be isolated in the relevant trial. Electroporation was performed in 1 mm cuvettes and 300 V pulses. 315

Mixed plasmid DNA and cell suspensions were suspended in 1 ml medium and transferred into 316

culture flasks directly after the electric pulse. 317

Homologous

sequences on either

side of kanR

Electroporation Natural

transformation

Vector pFN_7_37_kanR 500 bp 44 % (15 of 34) 67 % (2 of 3)

Vector

pFN_7_37_2k_kanR

1000 bp 44 % (8 of 18) 94 % (15 of 16)

318

319


https://doi.org/10.1101/870006

320


https://doi.org/10.1101/870006

Table 3. Summary of minimum bit score values of (putative) NTFs of 36 cyanobacterial species. In the 321 first step, NTF homologs of 6 naturally competent cyanobacteria (indicated by NCC in the last line) 322 were identified. These NTFs were used as queries in a BLAST search against protein sequences of 30 323 cyanobacterial species. The bit score of each homology hit was divided the by smallest bit score of 324 the respective NCC pairs. 325

326

327


https://doi.org/10.1101/870006

328

Figure legends 329

Fig. 1. Filaments of Phormidium lacuna after transformation with pFN_7_37_kanR during or after 330

selection on agar plates. A) 2 weeks after transformation and growth on 70 µg / ml Kn. Brownish and 331

greenish filaments can be distinguished which represent non-transformed or transformed cells, 332

respectively. B) 2 weeks after transformation and growth on 120 µg / ml Kn after, in this area of agar 333

plate, living and dead filaments are clearly distinguished C) 4 weeks after growth on 120 µg/ml Kn, all 334

filaments are resistant. Bundles of parallel filaments are characteristic for growth on agar, the growth 335

pattern is comparable to that of wild type on Kn-free agar. Scale bars 100 µm. 336

337

Fig. 2 Kanamycin resistance of Phormidium lacuna HE10JO wild type and pFN_7_37_kanR 338

transformants, liquid cultures 1 week after inoculation and growth under white light. Wild type 339

cannot proliferate at 50 µg/ml Kn or above, while pFN_7_37_kanR transformants can grow up to 340

14.3 mg/ml Kn. Kanamycin concentration from left to right: 0, 50, 100, 200 μg/ml; 4.5, 8.3, 11.5, 14.3 341

mg/ml. 342

Fig. 3 Validation of Phormidium lacuna transformants by PCR 343

a) Plasmid map of pFN_7_37_kanR, red - homologous sequences of the sc_7_37 locus, blue - 344

kanamycin resistance cassette kanR, yellow - origin of replication (f1 - bacteriophage origin, other - 345

pUC origin for E. coli), purple - ampicillin resistance cassette. 346

b) Integration site of pFN_7_37_kanR and primer binding sites. red - homologous sequences encoded 347

on the vector, pale red - Phormidium lacuna chromosome, blue - kanamycin resistance gene. Primer 348

pair: F25/F28 covering whole insertion site. 349

c) Agarose gel for the PCR with the primer pair that covers the full insert for Phormidium lacuna WT 350

and transformants. Transformants T1a and T1b were cultivated after selection on agar plate for one 351

cultivation period (7 days) in f/2+ liquid medium with 250 µg/ml Kn and one period in f/2+ with 1000 352

µg/ml Kn. T2a and T2b were cultivated only for one period at 250 µg/ml Kn. M: 1kb DNA ladder (NEB, 353


https://doi.org/10.1101/870006

USA). Integration of the kanR cassette into the genome of Phormidium lacuna is indicated by the 354

larger PCR product (2560 bp). 355

356

Fig. 4. Chromosome copies of Phormidium lacuna cells estimated by DAPI fluorescence of filaments 357

grown 1-5 days after inoculation. Each data point represents one independent measurement as 358

described in detail in the methods section. Values are plotted against OD750 nm. 359

360

Fig. 5 Detection of wild type and recombinant chromosomes in Kn resistant Phormidium lacuna 361

pFN_7_37_kanR lines. Following cultivation in 100 µg/ml Kn until 2 weeks after transformation, the 362

sample was divided and subcultivated one to four times on the Kn concentrations given in the panel. 363

Primers: F25, F28. Marker: 1 kb DNA ladder (NEB, USA). 364

365

366

367

References 368

1. Angermayr SA, Rovira AG, Hellingwerf KJ. Metabolic engineering of cyanobacteria for the 369 synthesis of commodity products. Trends Biotechnol. 2015;33(6):352-61. 370 2. Vijayakumar S, Menakha M. Pharmaceutical applications of cyanobacteria—A review. Journal 371 of Acute Medicine. 2015;5(1):15-23. 372 3. Johnson TJ, Katuwal S, Anderson GA, Gu L, Zhou R, Gibbons WR. Photobioreactor cultivation 373 strategies for microalgae and cyanobacteria. Biotechnol Prog. 2018;34(4):811-27. 374 4. Dexter J, Armshaw P, Sheahan C, Pembroke JT. The state of autotrophic ethanol production 375 in Cyanobacteria. J Appl Microbiol. 2015;119(1):11-24. 376 5. Stucken K, Koch R, Dagan T. Cyanobacterial defense mechanisms against foreign DNA 377 transfer and their impact on genetic engineering. Biol Res. 2013;46(4):373-82. 378 6. Koksharova OA, Wolk CP. Genetic tools for cyanobacteria. Appl Microbiol Biot. 379 2002;58(2):123-37. 380 7. Stucken K, Ilhan J, Roettger M, Dagan T, Martin WF. Transformation and Conjugal Transfer of 381 Foreign Genes into the Filamentous Multicellular Cyanobacteria (Subsection V) Fischerella and 382 Chlorogloeopsis. Curr Microbiol. 2012;65(5):552-60. 383 8. Shestakov SV, Khyen NT. Evidence for Genetic Transformation in Blue-Green Alga Anacystis-384 Nidulans. Mol Gen Genet. 1970;107(4):372-5. 385 9. Stevens SE, Porter RD. Transformation in Agmenellum-Quadruplicatum. P Natl Acad Sci-Biol. 386 1980;77(10):6052-6. 387


https://doi.org/10.1101/870006

10. Devilly CI, Houghton JA. Study of Genetic Transformation in Gloeocapsa-Alpicola. J Gen 388 Microbiol. 1977;98(Jan):277-80. 389 11. Grigorieva G, Shestakov S. Transformation in the Cyanobacterium Synechocystis Sp 6803. 390 Fems Microbiol Lett. 1982;13(4):367-70. 391 12. Dittmann E, Neilan BA, Erhard M, vonDohren H, Borner T. Insertional mutagenesis of a 392 peptide synthetase gene that is responsible for hepatotoxin production in the cyanobacterium 393 Microcystis aeruginosa PCC 7806. Mol Microbiol. 1997;26(4):779-87. 394 13. Onai K, Morishita M, Kaneko T, Tabata S, Ishiura M. Natural transformation of the 395 thermophilic cyanobacterium Thermosynechococcus elongatus BP-1: a simple and efficient method 396 for gene transfer. Mol Genet Genomics. 2004;271(1):50-9. 397 14. Vioque A. Transformation of cyanobacteria. Adv Exp Med Biol. 2007;616:12-22. 398 15. Al-Haj L, Lui YT, Abed RM, Gomaa MA, Purton S. Cyanobacteria as Chassis for Industrial 399 Biotechnology: Progress and Prospects. Life (Basel). 2016;6(4). 400 16. Trehan K, Sinha U. DNA-Mediated Transformation in Nostoc-Muscorum, a Nitrogen-Fixing 401 Cyanobacterium. Aust J Biol Sci. 1982;35(5):573-7. 402 17. Mell JC, Redfield RJ. Natural Competence and the Evolution of DNA Uptake Specificity. J 403 Bacteriol. 2014;196(8):1471-83. 404 18. Johnsborg O, Eldholm V, Havarstein LS. Natural genetic transformation: prevalence, 405 mechanisms and function. Res Microbiol. 2007;158(10):767-78. 406 19. Matthey N, Blokesch M. The DNA-Uptake Process of Naturally Component Vibrio cholerae. 407 Trends Microbiol. 2016;24(2):98-110. 408 20. Bhaya D, Bianco NR, Bryant D, Grossman A. Type IV pilus biogenesis and motility in the 409 cyanobacterium Synechocystis sp PCC6803. Mol Microbiol. 2000;37(4):941-51. 410 21. Yoshihara S, Geng XX, Okamoto S, Yura K, Murata T, Go M, et al. Mutational analysis of genes 411 involved in pilus structure, motility and transformation competency in the unicellular motile 412 cyanobacterium Synechocystis sp PCC 6803. Plant Cell Physiol. 2001;42(1):63-73. 413 22. Okamoto S, Ohmori M. The cyanobacterial PilT protein responsible for cell motility and 414 transformation hydrolyzes ATP. Plant Cell Physiol. 2002;43(10):1127-36. 415 23. Nakasugi K, Svenson CJ, Neilan BA. The competence gene, comF, from Synechocystis sp strain 416 PCC 6803 is involved in natural transformation, phototactic motility and piliation. Microbiol-Sgm. 417 2006;152:3623-31. 418 24. Wendt KE, Pakrasi HB. Genomics Approaches to Deciphering Natural Transformation in 419 Cyanobacteria. Frontiers in Microbiology. 2019;10:7. 420 25. Griese M, Lange C, Soppa J. Ploidy in cyanobacteria. Fems Microbiology Letters. 421 2011;323(2):124-31. 422 26. Chen AH, Afonso B, Silver PA, Savage DF. Spatial and temporal organization of chromosome 423 duplication and segregation in the cyanobacterium Synechococcus elongatus PCC 7942. PLoS One. 424 2012;7(10):e47837. 425 27. Sukenik A, Kaplan-Levy RN, Welch JM, Post AF. Massive multiplication of genome and 426 ribosomes in dormant cells (akinetes) of Aphanizomenon ovalisporum (Cyanobacteria). ISME J. 427 2012;6(3):670-9. 428 28. Watanabe S, Ohbayashi R, Kanesaki Y, Saito N, Chibazakura T, Soga T, et al. Intensive DNA 429 Replication and Metabolism during the Lag Phase in Cyanobacteria. PLoS One. 2015;10(9):e0136800. 430 29. Zerulla K, Ludt K, Soppa J. The ploidy level of Synechocystis sp. PCC 6803 is highly variable 431 and is influenced by growth phase and by chemical and physical external parameters. Microbiology. 432 2016;162(5):730-9. 433 30. Soppa J. Polyploidy in archaea and bacteria: about desiccation resistance, giant cell size, long-434 term survival, enforcement by a eukaryotic host and additional aspects. J Mol Microbiol Biotechnol. 435 2014;24(5-6):409-19. 436 31. Cassier-Chauvat C, Veaudor T, Chauvat F. Comparative Genomics of DNA Recombination and 437 Repair in Cyanobacteria: Biotechnological Implications. Front Microbiol. 2016;7:1809. 438


https://doi.org/10.1101/870006

32. Nies F, Wörner S, Wunsch N, Armant O, Sharma V, Hesselschwerdt A, et al. Characterization 439 of Phormidium lacuna strains from the North Sea and the Mediterranean Sea for biotechnological 440 applications. Process Biochemistry. 2017;59:194-206. 441 33. Schaefer MR, Chiangg GG, COBLEY JG, Grossman AR. Plasmids from two morphologically 442 distinct cyanobacterial strains share a novel replication origin. J Bacteriol. 1993;175:5701-5. 443 34. Vieira J, Messing J. The Puc Plasmids, an M13mp7-Derived System for Insertion Mutagenesis 444 and Sequencing with Synthetic Universal Primers. Gene. 1982;19(3):259-68. 445 35. Nies F, Wörner S, Wunsch N, Armant O, Sharma V, Hesselschwerdt A, et al. Characterization 446 of Phormidium lacuna strains from the North Sea and the Mediterranean Sea for biotechnological 447 applications. Process Biochemistry. 2017. 448 36. GUILLARD RR, RYTHER JH. Studies of marine planktonic diatoms. I. Cyclotella nana Hustedt, 449 and Detonula confervacea (cleve) Gran. Can J Microbiol. 1962;8:229-39. 450 37. Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, et al. BLAST+: 451 architecture and applications. BMC Bioinformatics. 2009;10:421. 452 38. Wilson WD, Tanious FA, Barton HJ, Strekowski L, Boykin DW, Jones RL. Binding of 4',6-453 diamidino -2-phenylindole (DAPI) to GC and mixed sequences in DNA- intercalation of a classical 454 groove-binding molecule. Journal of the American Chemical Society. 1989;111(13):5008-10. 455 39. Fujita Y, Takahashi Y, Chuganji M, Matsubara H. The Nifh-Like (Frxc) Gene Is Involved in the 456 Biosynthesis of Chlorophyll in the Filamentous Cyanobacterium Plectonema-Boryanum. Plant Cell 457 Physiol. 1992;33(1):81-92. 458 40. Toyomizu M, Suzuki K, Kawata Y, Kojima H, Akiba Y. Effective transformation of the 459 cyanobacterium Spirulina platensis using electroporation. J Appl Phycol. 2001;13(3):209-14. 460 41. Ravindran CR, Suguna S, Shanmugasundaram S. Electroporation as a tool to transfer the 461 plasmid pRL489 in Oscillatoria MKU 277. J Microbiol Methods. 2006;66(1):174-6. 462 42. Ishida K, Christiansen G, Yoshida WY, Kurmayer R, Welker M, Valls N, et al. Biosynthesis and 463 structure of aeruginoside 126A and 126B, cyanobacterial peptide glycosides bearing a 2-carboxy-6-464 hydroxyoctahydroindole moiety. Chem Biol. 2007;14(5):565-76. 465 43. Vermaas W. Molecular genetics of the cyanobacterium Synechocystis sp. PCC 6803: 466 Principles and possible biotechnology applications. Journal of Applied Phycology. 1996;8(4-5):263-73. 467 44. Zang XN, Liu B, Liu SM, Arunakumara K, Zhang XC. Optimum conditions for transformation of 468 Synechocystis sp PCC 6803. J Microbiol. 2007;45(3):241-5. 469 45. Dada AC, Ahmad A, Usup G, Heng LY, Hamid R. High-level aminoglycoside resistance and 470 virulence characteristics among Enterococci isolated from recreational beaches in Malaysia. Environ 471 Monit Assess. 2013;185(9):7427-43. 472 46. Khetkorn W, Rastogi RP, Incharoensakdi A, Lindblad P, Madamwar D, Pandey A, et al. 473 Microalgal hydrogen production - A review. Bioresource Technology. 2017;243:1194-206. 474 47. Behler J, Vijay D, Hess WR, Akhtar MK. CRISPR-Based Technologies for Metabolic Engineering 475 in Cyanobacteria. Trends Biotechnol. 2018;36(10):996-1010. 476 48. Dubnau D, Blokesch M. Mechanisms of DNA Uptake by Naturally Competent Bacteria. Annual 477 Review of Genetics. 2019;53(1):null. 478 49. Johnston C, Martin B, Fichant G, Polard P, Claverys JP. Bacterial transformation: distribution, 479 shared mechanisms and divergent control. Nature Reviews Microbiology. 2014;12(3):181-96. 480 50. Khayatan B, Meeks JC, Risser DD. Evidence that a modified type IV pilus-like system powers 481 gliding motility and polysaccharide secretion in filamentous cyanobacteria. Molecular Microbiology. 482 2015;98(6):1021-36. 483 51. Jeamton W, Dulsawat S, Tanticharoen M, Vonshak A, Cheevadhanarak S. Overcoming 484 Intrinsic Restriction Enzyme Barriers Enhances Transformation Efficiency in Arthrospira platensis C1. 485 Plant Cell Physiol. 2017;58(4):822-30. 486

487


https://doi.org/10.1101/870006

NT F

s

Glo e

o ba c

ter v

i ol a

ceu s

PCC

74 2

1

L ep t

olyn

g bya

bo r

y an a

PCC

63 0

6

S yn e

cho c

ysti s

sp. P

C C 6

8 03

S yn e

cho c

ysti s

sp. P

C C 7

5 09

P ro c

hlo r

o co c

cus m

a rin

us s u

bsp .

mar

inu s

str.

C CM

P13 7

5

P se u

d an a

b ae n

a sp

. PCC

73 6

7

C ya n

o bi u

m g

rac i

le P

C C 6

307

S yn e

cho c

occ u

s elo

n gat

u s P

C C 7

9 42

S yn e

cho c

occ u

s sp .

PC C

70 0

2

S yn e

cho c

occ u

s sp .

PC C

75 0

2

T her

mo s

y nec

h oco

c cu s

elo

n ga t

u s B

P -1

Geit l

e rin

ema

s p. P

C C 9

228

C ya n

o the

ce s p

. AT C

C 5 1

1 42

Art h

ros p

i ra p

late

n sis

NIE

S-3 9

T ri c

h od e

s miu

m e

r yth

rae u

m IM

S10 1

Os c

i lla t

o ria

acu

mi n

a ta

PCC

6 30 4

ComEA 0.9 1.4 2.9 1.1 0.1 1.1 0.9 2.5 2.7 1.1 2.8 1.4 1.5 1.4 1.4 1.4ComEC 1.1 1.6 5.2 1.8 0.2 1.6 0.6 7 7.3 1.6 5.9 2 1.7 1.7 1.6 1.7ComF 1.2 1.7 3.8 1.8 0.3 1.4 0.4 5 3.8 1.6 5 1.8 2.1 1.9 1.6 1.9DprA 0.9 1.2 2.8 1.3 0.1 1 0.4 2.6 2.6 1.3 2.5 1.3 1.5 1.4 1.4 1.3PilA1 1.3 1.3 5.6 1 0.5 1.8 1 5.8 7.1 1.3 3.8 1.4 2.4 1.2 1.6 1.8PilB1 0.7 1.1 1.6 1.1 0 0.9 0.7 1.7 1.6 0.9 1.7 1.1 1.3 1.1 1 1.1PilD 0.8 1.4 2.4 1.5 0.2 1.3 0.8 2.5 2.6 1.2 2.4 1.4 1.5 1.4 1.5 1.4PilM 1 1.5 2.3 1.6 0.1 1.3 0.1 2.6 2.4 1.3 2.7 1.6 1.9 1.6 1.5 1.6PilN 1.1 1.8 7.2 1.5 0.5 1.2 0.9 7.5 6.4 1.5 7.8 1.8 2.4 1.9 1.6 1.7PilO 0.7 1.5 6.2 2 0.4 0.9 0.4 6.8 8.7 1.2 6.8 1.1 2.5 1.7 1.4 1.1PilQ 1.4 2.6 8.8 2.7 0.2 1.9 1.3 6.9 8.9 2.1 8.9 3.1 3.1 2.6 2.5 2.8PilT 1 1.3 1.4 1.3 0.1 1.1 0.5 1.5 1.3 0.5 1.4 1.2 1.2 1.3 1.1 1.2RecA 0.9 1 1.4 1 1.1 1.1 1.1 1.3 1.3 1 1.3 1.1 1.2 1.1 1.1 1.1PC or NCC PC PC NCC NCC NCC NCC PC PC PC PC PC


https://doi.org/10.1101/870006

Os c

i lla t

o ria

nig

ro- v

i rid i

s PC C

71 1

2

P hor

mid

ium

am

bigu

um I A

M M

- 71

P hor

mid

ium

lacu

n a H

E 10 J

O

P hor

mid

ium

sp. O

SCR

P hor

mid

ium

ten u

e N

I ES-

30

P hor

mid

ium

will

e i B

DU 1

3 07 9

1

Halo

the c

e s p

. PC C

74 1

8

Gem

ino c

y stis

he r

dma n

ii P C

C 6 3

0 8

Mi c

r ocy

stis

a eru

g in o

s a N

IES -

8 43

Mi c

r ocy

stis

a eru

g in o

s a P

CC 7

8 06

Mi c

r ocy

stis

a eru

g in o

s a P

CC 7

8 06 S

L

S ta n

ieri a

cy a

nos p

h ae r

a P C

C 7 4

3 7

S pi ru

li na

maj

o r P

C C 6

3 13

Chro

o co c

cidi

ops is

t he r

mal

is P C

C 72

0 3

F is c

h ere

ll a m

u sc i

c ola

PCC

74 1

4

Anab

a ena

cy l

ind r

i ca

P CC

7 12 2

Anab

a ena

s p. 9

0

No s

t oc

pun c

t ifo r

me

P CC

7 31 0

2

No s

t oc

sp. P

C C 7

1 20

1.4 1.4 2.5 2.3 1.1 2.4 1.3 1.1 2.4 2.6 0.1 1.2 1.2 0.9 0.1 1.4 1.4 0.9 1.41.6 1.7 5.8 5 1.4 5.6 1.7 1.6 3.9 4.3 4.3 1.8 1.5 1.7 1.8 1.8 1.8 1.8 1.8

2 1.7 4 3.3 1.5 3.7 1.8 1.9 3.1 3.2 3.2 1.8 1.7 1.7 1.9 1.8 1.9 1.8 1.81.4 1.4 2.5 2.1 1.2 2.5 1.4 1.4 2.4 2.5 2.5 1.4 1.3 1.4 1.4 1.4 1.4 1.4 1.41.4 0.9 4 3.2 1.2 3.9 1.3 2.1 2.8 5.6 5.6 2.3 1.1 1.6 1.8 1.3 1.3 1.3 1.71.1 1.1 1.7 1.6 1.1 1.6 1.1 1.1 1.5 1.6 1.6 1.2 1.1 1.2 1.1 1.1 1.1 1.1 1.11.3 1.2 2.6 2.4 1.3 2.5 1.4 1.4 2.1 2.4 2.4 1.4 1.2 1.5 1.3 1.4 1.3 1.4 1.31.6 1.6 2.6 2.6 1.6 2.6 0.1 1.5 1.9 2.5 2.5 1.5 1.8 1.4 1.6 1.6 1.5 1.6 1.51.8 1.9 6.2 5.8 1.6 6.1 1.5 2.4 3.8 5.2 5.2 1.8 1.4 1.8 2.1 1.8 2 1.9 21.2 1.8 8.1 7.1 1.2 8 1.6 1.7 4.8 6.4 6.4 2.1 1.4 2 1.8 1.7 1.9 1.8 1.92.6 1.9 7.7 6 2.7 7.5 2.9 1.7 5.4 6.4 6.4 3.4 2 2.8 2.9 3 2.3 2.7 2.91.2 1.2 1.5 1.5 1.2 1.5 1.1 1.2 1.3 1.4 1.4 1.2 1.1 1.3 1.3 1.3 1.2 1.3 1.31.1 1.1 1.4 1.4 1.1 1.4 1.1 1.1 1.3 1.4 1.4 1.1 1.1 1 1.1 1.1 1 1.1 1.1

PC NCC PC PC PC PC PC NCC PC PC PC PC PC


https://doi.org/10.1101/870006

Calo

thri x

sp. P

C C 6

3 03

1.31.81.71.31.61.11.31.71.81.52.91.3

1PC


https://doi.org/10.1101/870006


https://doi.org/10.1101/870006

natural transformation of the filamentous cyanobacterium ...14 of the filamentous cyanobacterium...

Documents