NAS Summer Institute 2010NAS Summer Institute 2010

Sassy Group 6: Gene Expression I

Sassy Group 6: Gene Expression I

Harvard UniversityTamara Brenner, Briana Burton, Robert Lue

Harvard UniversityTamara Brenner, Briana Burton, Robert Lue

University of IowaBrenda Leicht, Bryant McAllister

University of IowaBrenda Leicht, Bryant McAllister

University of California, DavisSamantha Harris, Mitchell Singer

University of California, DavisSamantha Harris, Mitchell Singer

University of MinnesotaRobin Wright

(Facilitator)

University of MinnesotaRobin Wright

(Facilitator)University of Colorado, Boulder

Katie Chapman (Consultant)University of Colorado, Boulder

Katie Chapman (Consultant)

NAS Summer Institute 2010NAS Summer Institute 2010

Sassy Group 6: Gene Expression I

Sassy Group 6: Gene Expression I

KatieKatie

BryantBryant MitchMitch RobRob BrendaBrenda BrianaBriana SamanthaSamantha TamaraTamara

NAS Summer InstituteJune 25, 2010NAS Summer InstituteJune 25, 2010

Sassy Group 6

Gene Expression I

Sassy Group 6

Gene Expression I

Brenda, Briana, Bryant, Katie, Mitch, Rob, Samantha, TamaraAnd Robin

Brenda, Briana, Bryant, Katie, Mitch, Rob, Samantha, TamaraAnd Robin

Differential Regulation of Gene Expression Determines Cell Form and

Function

Level Introductory Genetics Introductory Biology (late in the course)

Knowledge of students prior to this unit

Know gene structureKnow the basic steps of the central dogma and relevant techniques

GoalsStudents will understand that:

ObjectivesStudents will be able to:

The information that allows regulation is encoded in the DNA.

Define the regulatory components of a gene.Identify possible regulatory elements, given a DNA sequence and/or protein sequence. Evaluate the functional significance of a consensus sequence.

Protein presence, absence, varying levels or activity can alter cell form or function. Understand that this is important for normal states (regulation) and can also lead to abnormal states (misregulation).

Suggest how changes in gene expression can lead to a disease state. Make predictions about phenotypes based on certain mutations.Organize information on transcriptional components into a regulatory circuit.

The Teachable Tidbit

Provides a hands-on activity for students to identify and examine transcription factor binding sequences, and evaluate the effect of variations in these sequences.

7

Forming a Consensus with Tidbits

Forming a ConsensusForming a Consensus

Blasts from the Recent Past

HHMI Biointeractive

RNA polymerase transcribes DNA into RNA

DNA-binding proteins initiate transcription

Blasts from the Recent Past

Drew Berry/HHMI

Different base pairs present different patterns of hydrogen bond donors and acceptors

Blasts from the Recent Past

adapted from Alberts et al

www.youtube.com/user/tomcfad

"Proteins and DNA? Some interesting

chemistry. Cuz they gettin

jiggy with so

me

different affinities."

"Wanna talk about

development?

Of a single cell into a

gentleman?"

Genetic Control of Differences Between Females & Males

SRYSRY

en.wikipedia.org/wiki/File:ChIP-on-chip_wet-lab.png

Chromatin Immunoprecipitation on Microarrays (ChIP-on-chip):

a method to identify the DNA-binding sites of a specific transcription factor

You are playing the roles of spots on a microarray chip. You are all 21-mer nucleotide sequences discovered in this SRY ChIP-on-chip experiment.

Compare your sequence with others at your table and identify a series of nucleotides in common.

Come to a consensus on the nucleotide sequence recognized by SRY.

TAAACGAAGGTAAACAATAGAGCGCGCAACAATCCCGGGTTT

Group Activity: Identify the binding site for SRY

TAAACGAAGGTAAACAATAGA TTCTTAACTAACAAACGCGAT CCGTTTCACAACTATACTACT AACAATAAGGCGACGCCTCTCGCGCGCAACAATCCCGGGTTTTACTTGATGGCAAACAATATA TCGTTACGTAACAAACTCCAT GGGTTTGACAACTATGCAATT AACAATGAGGCGTTTTATCACAAGTGCAACAATAAGCCCTCT

TATAGGAAGCTAAACAATAGA CCCTTAGCTAACTAACGCTAT CTTTATGGCAACTATACTACT AACAATACGGTTACGCCTATCGGGCGCAACAATCACGGGTAT

Clicking for Data:Forming a Consensus

Use your clicker to indicate the SRY binding site in your sequence.

A: AACTAT

B: AACAAT

C: AACAAA

D: AACTAA

most commonAACAAT

AACTAT (-1)

AACAAA (-1)

AACTAA (-2)

Consensus

Group Discussion:Forming a Consensus

Consensus

Group Discussion

Propose reasons why some sequences in your experiment are more common than others.

Groups 1 and 2

Is it significant that these sequences have identical nucleotides at certain positions but not at others? Defend your answer.

Groups 3 and 4

Predict the sequences to which the transcription factor binds most strongly. How did you arrive at this conclusion?

Groups 5 and 7

http://www.picturingtolearn.org

Express and assess your understanding through pictures

Picturing to Learn In-Class Activity

On a piece of paper you are going to create a freehand drawing to explain the following to a high school senior taking biology:

How the degree of match with a consensus sequence can affect the binding affinity of a transcription factor and the subsequent level of gene expression.

Before you begin to draw, please think about the following: if you were evaluating your drawing, what are the 3 most important scientific components/concepts/ideas that need to be included in your visual representation in order to explain the science to your target audience? The most important should be at the top. Use a blank page to create your drawing. It should contain all the necessary information you indicated above. Your audience will not see your list, so your drawing should include some labels and brief captions. 23

Back to SRY (Sex determining Region Y Gene)

SRY is a transcription factor that regulates genes needed for development of male-specific structures (e.g., testes) and male-specific traits

bio.miami.edu

+SRY-SRY +SRY-SRY

SRY protein binds DNA at the sequence 5’-ATAACAAT-3’

and bends the DNA in that region to change

the openness of chromatin.

Mutations in SRY or its Target Genes

• SRY Mutations– Cause of 10-15% of cases of 46(X,Y) gonadal dysgenesis – Some of these are nonsense or frameshift mutations that lead to

nonfunctional protein– Many are missense mutations that affect the DNA binding ability of

the SRY protein.

• Target Genes– MOA-A; altered expression is implicated in several

neuropsychiatric disorders including depression, autism and ADHD, which differ in incidence between males and females.

Homework

Gene DNA sequence (normal) Mutation (Normal>defective)

Biochemical manifestation

Disease

Promoter weakening TATA box polymorphisms

cagggctgggCATAAAAgtcagggca –31A>G deficiency

Growth hormone 1 gccaggTATAAAAAgggcccacaaga –31g>∆

growth hormone deficiency short stature

Cytochrome P450 2A6 tttcaggcagTATAAAggcaaaccac –48T>G

deficiency of nicotine oxidase lung cancer

Promoter-enhancing TATA box polymorphisms

Myeloblastin gggcTATAAGAggagcttga cgtgg –7c>T myeloblastin excess leukemia

NOS2A atggggtgagTATAAATActtcttgg –21t>C excess of NO-synthase

multiple sclerosis, diabetes

A group of Russian scientists, Savinkova et al (2008), identified changes in the TATA box of human promoters that lead to distinct pathologies. Some of the mutations and resulting phenotypes are listed below.

Savinkova, L.K., et al: Biochemistry (Moscow) 2009, 74(2): 117-129.

1. Make a drawing that explains why some changes in the TATA box lead to a decrease in protein expression, while others lead to an increase in protein expression.

2. Imagine that you identify individuals with the mutation in the β-Globin promoter that is listed in the table. However, these individuals express normal levels of β-globin protein and are not affected by β-thalassemia. It turns out that these individuals have additional mutations in their DNA. What possible mutation(s) could explain why these individuals do not express the disease?

Homework

GoalsStudents will understand that:

ObjectivesStudents will be able to:

The information that allows regulation is encoded in the DNA.

Define the regulatory components of a gene.Identify possible regulatory elements, given a DNA sequence and/or protein sequence. Evaluate the functional significance of a consensus sequence.

Protein presence, absence, varying levels or activity can alter cell form or function. Understand that this is important for normal states (regulation) and can also lead to abnormal states (misregulation).

Suggest how changes in gene expression can lead to a disease state. Make predictions about phenotypes based on certain mutations.Organize information on transcriptional components into a regulatory circuit.

30