mycobacteriophages genes and genomes review

8/8/2019 Mycobacteriophages Genes and Genomes Review

http://slidepdf.com/reader/full/mycobacteriophages-genes-and-genomes-review 1/26



MI64CH18-Hatfull ARI 27 May 2010 17:22

Mycobacteriophage:a bacteriophage thatinfects mycobacterialhosts

ContentsINTRODUCTION . . . . . . . . . . . . . . . . . . 332GENERAL PROPERTIES OF

MYCOBACTERIOPHAGES. . . . . . 333 Mycobacteriophage Virion

Morphologies . . . . . . . . . . . . . . . . . . . 333Host Range and Host Range

Determinants . . . . . . . . . . . . . . . . . . . 333Life Cycles . . . . . . . . . . . . . . . . . . . . . . . . 337

MYCOBACTERIOPHAGEGENOMICS . . . . . . . . . . . . . . . . . . . . . . 337Sequenced Mycobacteriophage

G e n o m e s . . . . . . . . . . . . . . . . . . . . . . . 3 3 7Overview of Genomic Diversity . . . . 338Genome Organizations. . . . . . . . . . . . . 339Genome Mosaicism... . . . . . . . . . . . . . 342 Mechanisms for Generating

Mosaic Genomes . . . . . . . . . . . . . . . 344 Transposons and Other Mobile

E l e m e n t s . . . . . . . . . . . . . . . . . . . . . . . 3 4 6 MYCOBACTERIAL GENE

FUNCTION ANDEXPRESSION . . . . . . . . . . . . . . . . . . . . 347Lysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 347Integration and Prophage

Maintenance. . . . . . . . . . . . . . . . . . . . 347Gene Expression and Its

Regula t ion . . . . . . . . . . . . . . . . . . . . . . 349Other MycobacteriophageGene Functions. . . . . . . . . . . . . . . . . 349

MYCOBACTERIOPHAGEGENETIC MANIPULATION. . . . 349

S U M M A RY. . . . . . . . . . . . . . . . . . . . . . . . . . 3 5 0

INTRODUCTION Mycobacteriophages are viruses that infect my-cobacterial hosts. Interest in mycobacterio-phages began in the late 1940s with the isola-tion of phages that infect Mycobacterium smeg-matis (31, 121), followed shortly by phages thatinfect Mycobacterium tuberculosis (27). A pri-mary motivation of these early studies was totype mycobacterial clinical isolates, which wasfurther advanced by collecting sizable num-bers of mycobacteriophages from a variety

of environmental and clinical sources (37, 57,105). Theuse ofmycobacteriophagesfor typingpurposes dominated the literatureover thenext

35 years, although important advances weremade in understanding mycobacteriophage bi-ology including the use of phage I3 as a gen-eralized transducing phage for M. smegmatis (91), lysogeny in environmental and clinicalstrains (55, 72,77), visualization byelectronmi-croscopy (100), and transfection of mycobacte-riophage DNA (59, 114).

Mycobacteriophages emerged in the late1980s as key players in the establishment of a facile genetic system for the mycobacteria(50). A breakthrough wasestablished in 1987by Jacobs et al., who used phageTM4 to construct

novel shuttle phasmids that replicate as largecosmids inEscherichia coli and as phages in my-cobacteria (53). These shuttle phasmids can bemanipulated in E. coli using standard geneticengineering approaches and used to efciently introduce foreign genes into mycobacteria. Inthe absence of other methods for direct manip-ulation of mycobacteriophage genomes, shuttlephasmids haveproven invaluable forspecializedtransduction (1), transposon delivery (2, 98),and diagnostic introduction of reporter genes(51, 88). They also facilitated the use of an-tibiotic selectable markers through temperate

phage L1 shuttlephasmids (103) andcharacter-ization of high-efciency transformation mu-tants of M. smegmatis (104).

A notable feature of shuttle phasmidconstruction is that it does not require phagegenomic information (52). However, realiza-tion of thefull potential of mycobacteriophagesfor contributing to an understanding of theirhostsclearly requiresgenomic characterization,and the rst sequenced genome was that of my-cobacteriophage L5 in 1993 (46). As the tech-nologies forDNA sequencing advancedandbe-came both quicker and cheaper, a large collec-tion of complete mycobacteriophage genomesequences has emerged, revealing a delight-fully complex, diverse, and interesting set of genomes. Seventy genome sequences are avail-able in GenBank ( Table 1 ) and a comparativeanalysis of 60 of these has been described (44).

332 Hatfull




dsDNA: double-

stranded DNA

Mycobacteriophages hold considerablepromise for elucidating phage diversity andevolution, gaining novel insights into the

physiology and perhaps virulence of their my-cobacterial hosts, and aiding the developmentof tools for mycobacterial genetics. In thisreview I focus primarily on the rst of these,although the last two aspects have been greatly explored, providing insights into biolmformation (80), cell wall composition (82, 87),tools for transposon delivery (2), reportergene delivery (51), gene replacement (1, 118),point mutagenesis (119), single copy vectors(65), and non-antibiotic selectable markers(23), among others. Several additional reviewsprovide the reader with further information

about mycobacteriophage genomics and appli-cations (39–43, 75, 76). As our understandingof mycobacteriophage genomics expands, it will undoubtedly invigorate further utilitiesand insights.

GENERAL PROPERTIES OF MYCOBACTERIOPHAGES

Mycobacteriophage Virion Morphologies All the characterized mycobacteriophages are

double-stranded DNA (dsDNA) tailed phagesbelonging to the order Caudovirales. Most (61of 70) are of the family Siphoviridae, character-ized by relatively long exible noncontractiletails, whereas nine are of the family Myoviri-dae, containing contractile tails (44). There isa notable absence of phages from the family Podoviridae(containing short stubby tails), al-though it is unclear whether their absence isdue to evolutionary constraints or to physicalproblems in traversing the complex and rela-tively thick mycobacterial cell envelope.

Although the nine myoviral mycobacterio-phages ( Table 1 ) are morphologically indistin-guishable, the siphoviruses show considerable variation. For example, the tail lengths vary by almost a factor of three (∼ 105 to ∼ 300nm) andthe structures at the tail tips are discernibly dif-ferent in many of these phages (44). For the

most part, the heads are isometric, althoughthree—Corndog, Che9c, and Brujita—containprolate heads, with the most extreme being

Corndog,whoselength-to-width ratiois almostfour; the previously described but unsequencedphage R1(106) has a prolate headsimilarto thatofChe9c andBrujita (44). Those with isometricheads spana range ofsizes, with the smallest be-ingBPsandHalo(∼ 48 nm in diameter) and thelargest being Bxz1 and its relatives (∼ 85 nm indiameter). In general, the capsid size correlates with genome size, suggesting there is a rela-tively constant DNA packaging density (44).

Host Range andHost Range Determinants The early phage-typing studies showed thatmycobacteriophages can have an almost end-less variety of preferences fordifferent bacterialhosts. Some phages (e.g., D29) have broadhost ranges and infect many species of bothfast-growing and slowlygrowing mycobacteria,including M. smegmatis and M. tuberculosis (94), whereas others (e.g., Barnyard) have very narrow preferences and infect only a singleknown host (94). At least one phage(DS6A) hasbeen reported whose host range is restricted tostrains composing the M. tuberculosis complex

(10, 56), although only a partial genomesequence of this potentially extremely usefuland interesting phage is available. Severalphages discriminate between strains or isolatesof a particular species, and we note that phage33D differentiates between BCG strains and Mycobacterium bovis , and several phages havepreferences for specic strains of M. smegmatis (C. Bowman, G. Broussard, D. Jacobs-Sera &G.F. Hatfull, unpublished observations).

For the most part, the molecular and ge-netic barriers to mycobacteriophage host rangepreferences are not known. Presumably, dif-ferentiation occurs at the cell surface due tothe presence or absence of specic receptors,from the need for particular metabolic re-quirements after DNA has been injected intothe cell, or from specic phage protectionmechanisms such as immunity and restriction.

www.annualreviews.org • Mycobacteriophages 333




T a b l e 1

G e n o m e t r i c s o f 7 0 s e q u e n c e d m y c o b a c t e r i o p h a g e g e n o m e s a

P h a g e

S i z e

( b p )

G C %

N o . o f

O R F s

t R N A #

t m R N A #

E n d s

A c c e s s i o n n o .

C l u s t e r

O r i g i n s

R e f e r e n c e

B e t h l e h e m

5 2 , 2 5 0

6 3 . 3

8 7

0

0

1 0 - b a s e 3 í

A Y 5 0 0 1 5 3

A 1

B e t h l e h e m , P A

4 5

B x b 1

5 0 , 5 5 0

6 3 . 7

8 6

0

0

9 - b a s e 3 í

A F 2 7 1 6 9 3

A 1

B r o n x ,

N Y

7 6

a

D D 5

5 1 , 6 2 1

6 3 . 4

8 7

0

0

1 0 - b a s e 3 í

E U 7 4 4 2 5 2

A 1

U p p .

S t . C l a i r , P A

4 4

J a s p e r

5 0 , 9 6 8

6 3 . 7

9 4

0

0

1 0 - b a s e 3 í

E U 7 4 4 2 5 1

A 1

L e x i n g t o n , M A

4 4

K B G

5 3 , 5 7 2

6 3 . 6

8 9

0

0

1 0 - b a s e 3 í

E U 7 4 4 2 4 8

A 1

K e n t u c k y

4 4

L o c k l e y

5 1 , 4 7 8

6 3 . 4

9 0

0

0

1 0 - b a s e 3 í

E U 7 4 4 2 4 9

A 1

P i t t s b u r g h , P A

4 4

S o l o n

4 9 , 4 8 7

6 3 . 8

8 6

0

0

1 0 - b a s e 3 í

E U 8 2 6 4 7 0

A 1

S o l o n , I A

4 4

U 2

5 1 , 2 7 7

6 3 . 7

8 1

0

0

1 0 - b a s e 3 í

A Y 5 0 0 1 5 2

A 1

B e t h l e h e m , P A

4 5

C h e 1 2

5 2 , 0 4 7

6 2 . 9

9 8

3

0

1 0 - b a s e 3 í

D Q 3 9 8 0 4 3

A 2

C h e n n a i , I n d i a

4 5

D 2 9

4 9 , 1 3 6

6 3 . 5

7 7

5

0

9 - b a s e 3 í

A F 0 2 2 2 1 4

A 2

C a l i f o r n i a

2 4

L 5

5 2 , 2 9 7

6 2 . 3

8 5

3

0

9 - b a s e 3 í

Z 1 8 9 4 6

A 2

J a p a n

4 6

P u k o v n i k

5 2 , 8 9 2

6 3 . 3

8 8

1

0

1 0 - b a s e 3 í

E U 7 4 4 2 5 0

A 2

F t . B r a g g ,

N C

4 4

P e a c h e s

5 1 , 3 7 6

6 3 . 9

8 6

0

0

1 0 - b a s e 3 í

G Q 3 0 3 2 6 3 . 1

A 2

M o n r o e ,

L A

U n p u b l i s h e d d a t a

B x z 2

5 0 , 9 1 3

6 4 . 2

8 6

3

0

1 0 - b a s e 3 í

A Y 1 2 9 3 3 2

A 2

B r o n x ,

N Y

8 3

C h a h

6 8 , 4 5 0

6 6 . 5

1 0 4

0

0

C i r c P e r m

F J 1 7 4 6 9 4

B 1

R u f f s d a l e ,

P A

4 4

C o l b e r t

6 7 , 7 7 4

6 6 . 5

1 0 0

0

0

C i r c P e r m

G Q 3 0 3 2 5 9 . 1

B 1

C o r v a l l i s ,

O R


O r i o n

6 8 , 4 2 7

6 6 . 5

1 0 0

0

0

C i r c P e r m

D Q 3 9 8 0 4 6

B 1


4 5

P G 1

6 8 , 9 9 9

6 6 . 5

1 0 0

0

0

C i r c P e r m

A F 5 4 7 4 3 0

B 1


4 5

P u h l t o n i o

6 8 , 3 2 3

6 6 . 4

9 7

0

0

C i r c P e r m

G Q 3 0 3 2 6 4 . 1

B 1

B a l t i m o r e ,

M D


U n c l e H o w

i e

6 8 , 0 1 6

6 6 . 5

9 8

0

0

C i r c P e r m

G Q 3 0 3 2 6 6 . 1

B 1

S t . L o u i s , M O


Q y r z u l a

6 7 , 1 8 8

6 9 . 0

8 1

0

0

C i r c P e r m

D Q 3 9 8 0 4 8

B 2


4 5

R o s e b u s h

6 7 , 4 8 0

6 9 . 0

9 0

0

0

C i r c P e r m

A Y 1 2 9 3 3 4

B 2

L a t r o b e , P A

8 3

P h a e d r u s

6 8 , 0 9 0

6 7 . 6

9 8

0

0

C i r c P e r m

E U 8 1 6 5 8 9

B 3


4 4

P h l y e r

6 9 , 3 7 8

6 7 . 5

1 0 3

0

0

C i r c P e r m

F J 6 4 1 1 8 2 . 1

B 3



P i p e f i s h

6 9 , 0 5 9

6 7 . 3

1 0 2

0

0

C i r c P e r m

D Q 3 9 8 0 4 9

B 3


4 5

C o o p e r

7 0 , 6 5 4

6 9 . 1

9 9

0

0

C i r c P e r m

D Q 3 9 8 0 4 4

B 4


4 5

N i g e l

6 9 , 9 0 4

6 8 . 3

9 4

1

0

C i r c P e r m

E U 7 7 0 2 2 1

B 4


4 4

B x z 1

1 5 6 , 1 0 2

6 4 . 8

2 2 5

3 5

1

C i r c P e r m

A Y 1 2 9 3 3 7

C 1

B r o n x ,

N Y

8 3

C a l i

1 5 5 , 3 7 2

6 4 . 7

2 2 2

3 5

1

C i r c P e r m

E U 8 2 6 4 7 1

C 1

S a n t a C l a r a , C A

4 4

334 Hatfull




C a t e r a

1 5 3 , 7 6 6

6 4 . 7

2 1 8

3 5

1

C i r c P e r m

D Q 3 9 8 0 5 3

C 1


4 5

E T 0 8

1 5 5 , 4 4 5

6 4 . 6

2 2 1

3 0

1

C i r c P e r m

G Q 3 0 3 2 6 0 . 1

C 1

S a n D i e g o , C A


L R R H o o d

1 5 4 , 3 4 9

6 4 . 7

2 2 7

3 0

1

C i r c P e r m

G Q 3 0 3 2 6 2 . 1

C 1

S a n t a C r u z ,

C A


R i z a l

1 5 3 , 8 9 4

6 4 . 7

2 2 0

3 5

1

C i r c P e r m

E U 8 2 6 4 6 7

C 1


4 4

S c o t t M c G

1 5 4 , 0 1 7

6 4 . 8

2 2 1

3 5

1

C i r c P e r m

E U 8 2 6 4 6 9

C 1


4 4

S p u d

1 5 4 , 9 0 6

6 4 . 8

2 2 2

3 5

1

C i r c P e r m

E U 8 2 6 4 6 8

C 1


4 4

M y r n a

1 6 4 , 6 0 2

6 5 . 4

2 2 9

4 1

0

C i r c P e r m

E U 8 2 6 4 6 6

C 2

U p p .

S t . C l a i r , P A

4 4

A d j u t o r

6 4 , 5 1 1

5 9 . 7

8 6

0

0

C i r c P e r m

E U 6 7 6 0 0 0

D


4 4

B u t t e r s c o t c h

6 4 , 5 6 2

5 9 . 7

8 6

0

0

C i r c P e r m

F J 1 6 8 6 6 0

D


4 4

G u m

b a l l

6 4 , 8 0 7

5 9 . 6

8 8

0

0

C i r c P e r m

F J 1 6 8 6 6 1

D


4 4

P - l o t

6 4 , 7 8 7

5 9 . 7

8 9

0

0

C i r c P e r m

D Q 3 9 8 0 5 1

D


4 5

P B I 1

6 4 , 4 9 4

5 9 . 7

8 1

0

0

C i r c P e r m

D Q 3 9 8 0 4 7

D


4 5

T r o l l 4

6 4 , 6 1 8

5 9 . 6

8 8

0

0

C i r c P e r m

F J 1 6 8 6 6 2

D

S i l v e r S p r i n g s , M D

4 4

2 4 4

7 4 , 4 8 3

6 2 . 9

1 4 2

2

0

9 - b a s e 3 í

D Q 3 9 8 0 4 1

E


4 5

C j w 1

7 5 , 9 3 1

6 3 . 1

1 4 1

2

0

9 - b a s e 3 í

A Y 1 2 9 3 3 1

E


8 3

K o s t y a

7 5 , 8 1 1

6 2 . 9

1 4 3

2

0

9 - b a s e 3 í

E U 8 1 6 5 9 1

E

W a s h i n g t o n ,

D C

4 4

P o r k y

7 6 , 3 1 2

6 2 . 8

1 4 7

2

0

9 - b a s e 3 í

E U 8 1 6 5 8 8

E

C o n c o r d ,

M A

4 4

P u m p k i n

7 4 , 4 9 1

6 3 . 0

1 4 3

2

0

9 - b a s e 3 í

G Q 3 0 3 2 6 5 . 1

E

H o l l a n d ,

M I


B o o m e r

5 8 , 0 3 7

6 1 . 1

1 0 5

0

0

1 0 - b a s e 3 í

E U 8 1 6 5 9 0

F 1


4 4

C h e 8

5 9 , 4 7 1

6 1 . 3

1 1 2

0

0

1 0 - b a s e 3 í

A Y 1 2 9 3 3 0

F 1


8 3

F r u i t l o o p

5 8 , 4 7 1

6 1 . 8

1 0 2

0

0

1 0 - b a s e 3 í

F J 1 7 4 6 9 0

F 1

L a t r o b e , P A

4 4

L l i j

5 6 , 8 5 2

6 1 . 5

1 0 0

0

0

1 0 - b a s e 3 í

D Q 3 9 8 0 4 5

F 1


4 5

P a c c 4 0

5 8 , 5 5 4

6 1 . 3

1 0 1

0

0

1 0 - b a s e 3 í

F J 1 7 4 6 9 2

F 1


4 4

P M C

5 6 , 6 9 2

6 1 . 4

1 0 4

0

0

1 0 - b a s e 3 í

D Q 3 9 8 0 5 0

F 1


4 5

R a m s e y

5 8 , 5 7 8

6 1 . 2

1 0 8

0

0

1 0 - b a s e 3 í

F J 1 7 4 6 9 3

F 1

W h i t e B e a r ,

M N

4 4

T w e e t y

5 8 , 6 9 2

6 1 . 7

1 0 9

0

0

1 0 - b a s e 3 í

E F 5 3 6 0 6 9

F 1


8 6

C h e 9 d

5 6 , 2 7 6

6 0 . 9

1 1 1

0

0

1 0 - b a s e 3 í

A Y 1 2 9 3 3 6

F 2


8 3

A n g e l

4 1 , 4 4 1

6 6 . 7

6 1

0

0

1 1 - b a s e 3 í

E U 5 6 8 8 7 6 . 1

G

O í H a r a

T w p ,

P A

9 6

B P s

4 1 , 9 0 1

6 6 . 6

6 3

0

0

1 1 - b a s e 3 í

E U 5 6 8 8 7 6

G


9 6

H a l o

4 2 , 2 8 9

6 6 . 7

6 4

0

0

1 1 - b a s e 3 í

D Q 3 9 8 0 4 2

G


4 5

H o p e

4 1 , 9 0 1

6 6 . 6

6 3

0

0

1 1 - b a s e 3 í

G Q 3 0 3 2 6 1 . 1

G

A t l a n t a , G A


K o n s t a n t i n e

6 8 , 9 5 2

5 7 . 3

9 5

0

0

C i r c P e r m

F J 1 7 4 6 9 1

H 1


4 4

P r e d a t o r

7 0 , 1 1 0

5 6 . 3

9 2

0

0

C i r c P e r m

( C o n t i n u e

d )

E U 7 7 0 2 2 2

H 1

D o n e g a l ,

P A

4 4





T a b l e 1

( C o n t i n u

e d )

B a r n y a r d

7 0 , 7 9 7

5 7 . 3

1 0 9

0

0

C i r c P e r m

A Y 1 2 9 3 3 9

H 2

L a t r o b e , P A

8 3

B r u j i t a

4 7 , 0 5 7

6 6 . 8

7 4

0

0

1 1 - b a s e 3 í

F J 1 6 8 6 5 9

I

V i r g i n i a

4 4

C h e 9 c

5 7 , 0 5 0

6 5 . 4

8 4

0

0

1 0 - b a s e 3 í

A Y 1 2 9 3 3 3

I


8 3

C o r n d o g

6 9 , 7 7 7

6 5 . 4

9 9

0

0

4 - b a s e 3 í

A Y 1 2 9 3 3 5

N o n


8 3

G i l e s

5 3 , 7 4 6

6 7 . 5

7 8

0

0

1 4 - b a s e 3 í

E U 2 0 3 5 7 1

N o n


7 8

O m e g a

1 1 0 , 8 6 5

6 1 . 4

2 3 7

2

0

4 - b a s e 3 í

A Y 1 2 9 3 3 8

N o n

U p p . S t . C l a i r , P A

8 3

T M 4

5 2 , 7 9 7

6 8 . 1

8 9

0

0

1 0 - b a s e 3 í

A F 0 6 8 8 4 5

N o n

C o l o r a d o

2 5

W i l d c a t

7 8 , 2 9 6

5 6 . 9

1 4 8

2 4

1

1 1 - b a s e 3 í

D Q 3 9 8 0 5 2

N o n

L a t r o b e , P A

4 5

T O T A L

5 , 0 7 8 , 0 9 0

7 9 3 0

3 6 3

A V E R A G E

7 3 , 5 9 5 .

5

6 3 . 7

1 1 4 . 9

5 . 2 6

a C o l o r e d s h a d i n g c o r r e s p o n d s t o g e n o m e g r o u p i n g s a c c o r d i n g t o

c l u s t e r r e l a t i o n s h i p s .

For many mycobacteriophages the barriers ap-pear to beabsolute,and no plaques areobservedon a nonpermissivehost even after plating large

numbers of phage particles. For other phagesplaques are observed at modest plating efcien-cies (10− 4 to10− 6) on a nonpermissivehost, andphages BPs and Halo—which were isolated on M. smegmatis —form plaques on M. tuberculosis at a frequency of 10− 5 (96). Further char-acterization shows that the plaques recoveredon M. tuberculosis are expanded host range mu-tants that infect both strains with equal platingefciency (96).

Although mycobacteriophage host prefer-ences are expected to be strongly dominated by theavailabilityofspeciccellular receptors, few

have been identied or studied. Lipid extractsof M. smegmatis have been shown to inhibitinfection by phages D29 and the uncharacter-ized D4 (113), and a specic peptidoglycolipid,mycoside C(sm), has been puried and pro-posed to play a role in phage D4 binding (29).Glycolipids may act as receptors for adsorptionof mycobacteriophage Phlei (8), and a subset of lyxose-containing molecules has been furtherchemically characterized (60). More recently,a single methylated rhamnose residue on the M. smegmatis cell wall–associated glycopep-tidolipid has been shown to be involved in

adsorption of phage I3 (16).Isolation of spontaneous M. smegmatis mu-

tants resistant to D29 infection is simplied by thehighefciency with which this phagekills itshost. However, characterization of the mutantsis complicated by their poor growth and ge-netic instability. Surprisingly, robust resistanceto D29 can arise though simple overexpressionof the wild-type M. smegmatis mpr gene whenpresent on an extrachromosomal plasmid (4),from an integrated mpr gene expressed from astrong promoter (4), or by transposon activa-tion (93). It is thus plausible that spontaneousD29 resistance occurs through localized geneamplication at the mpr locus, leading to en-hanced expression of the Mpr protein, and thatthe locus reduces back to a singlecopy when se-lective pressure is removed. It is not clear what

336 Hatfull




CRISPR: clustered

regularly interspacedshort palindromicrepeat

the normal cellular function of mpr is, or why mpr overexpression gives D29 resistance.

In many bacterial hosts, clustered regu-

larly interspaced short palindromic repeats(CRISPRs) play roles in phage resistance (3,116). Most sequenced mycobacterial genomesdonot appearto have CRISPRs, with theexcep-tions being M. tuberculosis H37Rv (and relatedstrains) and M. aviumstrain104.The CRISPRsare composed of short direct repeats (21–47 bp) separated by short (∼ 30–50 bp) uniquespacer sequences, and in the well-characterizedCRISPRs the spacers have near sequence iden-tity with phage genomic sequences, an im-portant component for phage resistance (117). The mycobacterial CRISPR spacer sequences

do not have compellingly similar counterpartsin any of the sequenced mycobacteriophagegenomes, consistent with the idea that many phages of these hosts remain unidentied.

Life CyclesdsDNA tailed phages canonically are eithertemperate, forming stable lysogens at moderatefrequencies (e.g., lambda), or lytic, such that allinfections lead to phage growth and cell death(e.g., T4 and T7). Classication of mycobac-teriophages into two such groups is, however,

complex. A good example of a temperate phageis L5, which forms obviously turbid plaquesfrom which stable lysogens immuneto superin-fection can be readily isolated (23); in contrast,D29 forms completely clear plaques in which virtually all host cells are killed. Genomic analysis, however, shows that D29 is a clear-plaquederivative of an L5-like temperate parent, notof a T4-like or T7-like phage (24). Of the ge-nomically characterized phages, 12 others (theCluster A phages; Table 1 ) behave similarly to L5. Most other mycobacteriophages formlightly turbidplaques, rather than clear or obvi-ously turbid ones, and for Tweety, Giles, BPs,and Halo this reects the ability to form lyso-gens at relatively low frequencies (3–5%) (78,86, 96). Approximately one-half of the char-acterized mycobacteriophages (36 of 70) havean integration cassette and are candidates for

forming lysogens, albeit at relatively low fre-quency. Phage such as Bxz1 and its relativesalso form hazy plaques, although it is unclear

whether the cellular survivors are uninfectedcells, resistant mutants, or lysogens.

MYCOBACTERIOPHAGEGENOMICS

Sequenced MycobacteriophageGenomes

The rst completely sequenced mycobacterio-phage genome was that of phage L5 (46), atemperate phage isolated in Japan (22); it is aclose relative of phage L1, which shares a simi-

larrestrictionpattern butdoesnot grow at 42◦

C(65). Both L5 and L1 infect fast-growing andslowly growing mycobacterial strains, althoughefcient infection of slow-growers by L5 re-quires the presence of high calcium concentra-tions (28). Although the sequence of L1 has notbeen determined, derivatives that grow at both42 and 30◦ C have been identied, followed by isolation and characterization of temperature-sensitive mutants (13, 15). The next completegenome reported was that of D29 (24), which was isolated in California from a soil sample by enrichment and infects both fast-growing and

slowly growing strains, and is clearly lytic (27).D29 has considerablenucleotide sequence sim-ilarity to L5, especially in the left-most partsof the genomes that encode the virion struc-tural genes (24). Whereas D29 forms distinctly clear plaques—perhaps more so than any othermycobacteriophage—the sequenced version islikely a recent derivative of a temperate par-ent, and Bowman (9) noted a mixture of plaquemorphologies in his starting D29 stock; ge-nomic comparison with L5 is consistent withthis.

The third sequenced mycobacteriophage, TM4, was isolated by induction of a strain of M. avium(112). It is unclear whether the orig-inal strain was lysogenic or pseudolysogenic,since TM4 is capable of lysing it as well asM. smegmatis and M. tuberculosis (112); it does notappear to form stable lysogens in eitherof these





strains. Genomic analysis shows that it is dis-tinct from L5 and D29 at the nucleotide se-quence level (25), and it does not encode any

known integration system or any readily iden-tiable phage repressor. All the other sequenced mycobacteriophage

genomes were from phages isolated over thepast 20 years, and all were isolated from envi-ronmental samples usingM. smegmatis mc2155asahost.Atthetimeofwritingthetotalnumberof mycobacteriophage genomes deposited inGenBankis70( Table1 )andadetailedcompar-ative genomic analysis of 60 has been described(44). These phages have come from a variety of geographic locations, although about half of them were isolated from the western Pennsyl-

vania region. The isolation of new mycobacte-riophages has been greatly spurred by the development of phage discovery and genomics asan educational platform (38, 45). It would beof considerable interest to take advantage of the faster andcheaper technologies to sequencethe numerous mycobacteriophages isolated inthe earlier period (1950–1980)—for which de-tailed host range data have been reported—if these can still be recovered. We also note thatthe use of other mycobacterial strains forphageisolation will likely give distinct landscapes of genetic diversity to that describedbelow forthe

current collection.

Overview of Genomic Diversity The 70 sequenced mycobacteriophagegenomes encompass substantial genetic diversity, and the genomic architectures aredominated by mosaic relationships. Althoughthe overall diversity is high, it is not uniform,and any two particular phages may share eitherextensive nucleotide sequence similarity overthe entire genome lengths with only a fewbase differences (e.g., phages Adjutor andPBI1), or as few as three genes whose productsshare greater than 25% amino acid identity (e.g., phages Barnyard and Giles) (Figure 1 ).Because of the mosaic nature of these genomes,many of the relationships lie between theseextremes, with substantial numbers of genes

shared among genomes that are not otherwiseclosely related.

To recognize the heterogeneous nature of

genome diversity, the 70 genomes can begrouped into clusters according to their rela-tionships to each other (Figure 1 ) (44). Severaldifferent methods can be used for determiningthe cluster assignments, including nucleotidesequence similarities and gene content analy-ses. For many genomes the placement into aparticular cluster is simple because of extensiveandclearnucleotidesequence similarity,but forother genomes it is more complex either be-cause there is extensive but weaker similarity orbecause there is high nucleotide sequence sim-ilarity that extends over only a small genome

segment. An arbitrary cutoff measure has beenproposed that any two genomes with evidentnucleotide sequence similarity spanning morethan 50% of the genome lengths should be in-cludedwithin thesame cluster(44). Using thesecriteria, an analysis of 60 sequenced genomesplaced55 intonine major clusters (A–I), andtheremaining 5 were singleton genomes with noclose relatives (44); the additional 10 genomesavailable in GenBank all t within the ninemajor clusters (Figure 1 ) ( Table 1 ). Five of these clusters can be further subdivided intosubclusters, and it is anticipated that as addi-

tional genomes are sequenced new clusters willbe formed(becauseof expecteddiscoveryof rel-atives of genomes that arecurrentlysingletons),and that current clusters will undergo furthersubdivision. Theglobal populationof mycobac-teriophages would seem more likely to form acontinuum of relationships, and the observedclusters may emerge from biases imposed by the isolation procedures. It is also likely thatadditional genomes unrelated to any of thosesequenced to date remain to be discovered.Note that this clustering primarily provides aconvenient framework for further analysis anddoes not provide an accurate portrayal of wholegenome phylogenies, which involve reticu-late relationships due to genomic mosaicism(64, 69, 70).

An indication that the current collection of mycobacteriophages underrepresents their full

338 Hatfull




A B C D E F G HB2 B4 F2 H1 H2A1 A2 B1 B3 C1 C2 F1

I Sin

A

B

C

D

E

F

G H

B 2

B 4

F 2

H 1

H 2

A 1

A 2

B 1

B 3

C 1

C 2

F 1

I

S i n

Figure 1Dotplot comparison of 70 sequenced mycobacteriophage genomes. Each of the 70 sequencedmycobacteriophages was concatenated into a single∼ 5-Gbp sequence and compared with itself usingGepard (62). The genome order is the same as inTable 1 and the Cluster and Subcluster designations areshown above.

diversity is provided by several prophages res-ident in mycobacterial genomes. Full-lengthprophages can be identied in the genomes of M. avium 104, M. abscessus (92), and M. mar-inum (108), and there are smaller prophage-like elements in M. tuberculosis (18, 49) and Mycobacterium ulcerans (107, 109). However,none of these is closely related to any of thesequenced mycobacteriophages and should begenerally classied as singletons in the cluster-ing scheme described above. The roles of any

of the prophages or prophage-like sequences in virulence of their hosts are not clear, but they are of interest because many of the sequencedmycobacteriophage genomes do encode genescapable of inuencing host physiology (83).

Genome Organizations Mycobacteriophage genome lengths vary greatly, from 41.4 (Angel) to 164.6 kbp(Myrna), with an average length of 73.6 kbp





0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

31 32 33 34 35 36 37 39 41

16 27 28 19 20 21 22 23 24 25 26 27 29 30

Virion structure and assembly

LysisIntegration/

immunity

Terminase PortalScafold

Capsid MTSTape measure protein

1314291329151714332

1 3 2 8

1 3 5 8

4 5 6 1 3 9 3

1 3 7 1

1 3 7 3 1 3 7 2

1 3 7 4

1 3 7 5 9 3 4 1 2 2

5 0 3

142950912105381406 86432 16151413119753

140618

9020

140622

73 144728 706 1377306624 261406

171333

191334

21 23 25 27 29

2 2 9 2

1 3 9 1

1 4 1 0 1 3 9 2 1

3 7 9

1 3 8 0

1 3 7 8 1 3 9 6

1 3 8 1 1 3 9 6

1 3 9 0 4041388 1389138713841382323 1 4 1 0

1 3 8 6 1 3 8 3 4

6 0

58 6056545250 4151304424038 1385

61595551484644

494743413937 45 53 57

31

32107

137633

34 3635

1

Lysin A Lysin BMinor tail proteins

IntegraseRepressor

RDF

HNHEndo

RuvCRecTRecE

Recombination

Halo Hope BPs

MPME2MPME1

MPME1

Figure 2Organization of the mycobacteriophage Angel genome. The linear genome is represented by a horizontal bar with markers in kilobasepairs. Predicted genes are shown as colored boxes with the gene name shown inside the box; genes shown above the genome bar aretranscribed rightward, and those below it are transcribed leftward. Each of the genes has been grouped into a phamily of relatedmycobacteriophage genes (44), with the Pham number designation shown above the gene. Putative gene functions are noted whereknown. Angel is a member of Cluster G (seeTable 1 ), in which there are three other members, Halo, Hope, and BPs. These fourgenomes are similar at the nucleotide level, and differ in structure primarily by insertions of a putative mycobacteriophage mobileelement (MPME). Angel contains no insertions, both Hope and BPs contain insertions of MPME1, and Halo contains an insertion of

MPME2 as shown.

( Table 1 ). An example of genome organizationis shown in Figure 2 , in which the virionstructure and assembly genes are arranged asan array in the left part of the genome, followedby the lysis cassette, an integrationcassette, anda set of genes in the right part, some of whichencode DNA replication or recombinationfunctions, but most are of unknown function.However, there is considerable variation ingenome organization and several themesemerge for different phage clusters (Figure 3 ).

The most obvious is that all the mycobac-teriophages with a siphoviral morphotype(all but Cluster C) share a syntenic group of genes encoding virion structure and assembly proteins—as seen in all siphoviruses regardlessof their bacterial host and regardless of the lack

of sequence similarity. For representationalpurposes these are shown in the left parts of the genomes (Figure 3 ).

Clusters F, G, and I all contain genomes with dened ends with short single-stranded DNA extensions ( Table 1), andthe leftmost of the structure and assem-bly genes (terminase) is located close tothe genome end (Figure 3 ). In contrast,Clusters A and E, together with singletonsCorndog, Giles, Omega, TM4, and Wildcat,

have dened genome ends but additional genesare present between the terminase and the end(Figure 3 ), most of which likely do not encode virion structure and assembly functions. Thenumber of genes varies from 4 (Cjw1; ClusterE) to 31 in the singleton Corndog, and in

340 Hatfull




Giles

A

B

C

D

E

F

G

I

H

( )

( )( )

( )( )

( )

( )

( )

Lysis Integration Immunity StructureReplication/

recombination Other

Wildcat

TM4

Omega

Corndog

Figure 3Schematic representations of mycobacteriophage genomes architectures. The genomes of phages in the ninemain clusters (A–I) and the ve singleton genomes are represented by black bars with genes regions shown ascolored boxes. Genes transcribed rightward are shown above the bar, and those transcribed leftward areshown below it. Putative functions of the gene blocks are represented by different colors, with the key shownat the bottom of the gure. In some clusters there is organizational variation within the cluster, and variations are given in parentheses. The genome organizations are schematic and are not drawn to scale.

Cluster A this is where the lysis genes arepositioned.

Clusters B, D, and H have circularly per-muted genomes, andforpurposes of gene num-bering and representing the genomes as linearmaps, an arbitrary position close to the termi-nase gene is chosen as nucleotide position #1.In some genomes (e.g., Subcluster B1) this cor-responds to the rst base of the putative small

terminase subunit gene, whereas in others it is within an upstream noncoding interval. Thereis a close relationship between terminase phy-logeny and the nature of phage genome ends(12), and this is also observed in mycobacterio-phages (44).

In many of the genomes (i.e., Clusters A,D, F, G, and I) the virion structure and assem-bly genes are in the canonical and largely unin-terrupted order: Terminase, Portal, Protease,Scaffold, Capsid, presumed head-tail joininggenes, major tail subunit, G/T tail chaperones,tapemeasure protein, minor tail proteins (44). Many genomes encode both small and largeterminase subunits (e.g., Clusters B1, B4, E,

F, G, I, Corndog, TM4), whereas in othersa small terminase subunit gene has not beenidentied (e.g., Clusters A, B2, B3, D, H).Not all genomes encode a scaffold protein andthese functions may be incorporated into thecapsid subunit as they are in coliphage HK97





(19, 89). The tape measure protein gene is typ-ically the largest in the genomes of the my-cobacterial siphoviruses, reecting their rather

long tails (from 107 nm in L5 to nearly 300 nm in Predator). There are, however,numerous genomes that contain additionalgenes in the structure and assembly gene array (Figure 3 ). These insertions occur at multi-ple locations, such as between the small andlarge terminase subunits (Cluster E), immedi-ately following the major capsid subunit gene(Subcluster B1), and between the portal andprotease genes (inCluster H),and there are rel-atively large insertions in the singletons Corn-dog and Omega (Figure 3 ). The insertions inClusters B, E, and H correspond to Holliday

junction resolving enzymes (RuvC-likein Clus-ter B and Endo VII-likein E andH), consistent with a role for these genes in DNA packaging(36).

As noted above, in the Cluster A genomesthe lysis genes are located between the termi-nase gene and the left end. However, this is un-usual, and it is more typically located immedi-ately downstream of the tail genes (Figures 2and 3) and transcribed in the same direction. This is a notable departure from the lambdaprototype, where the lysis functions are locatedclose to the right end of the genome (97). Clus-

ters A, E, F, G, and singletons Giles and Omegaencode integration cassettes that are near thecenters of their genomes regardless of substan-tial differences in genome lengths (40). In Gilesthe integration cassette is in an atypical locationtotheleftofthelysisgenes(78).Althoughgenesinvolved in DNA replication (including DNA Pol I, Pol III, and Holliday junction resolvingenzymes) and DNA metabolism (such as ThyXand ribonucleotide reductase) can be identied(Figure 3 ), most other genes in the siphoviralgenomes are of unknown function (44).

All Cluster C mycobacteriophages havemyoviral morphologies and relatively largegenomes, and thevirionstructureandassembly genes do not appear tobe organized into a well-dened array as they are in the siphoviruses.However, relatively few of the structureand assembly genes have been identied

and the virion proteins are not well charac-terized. A striking feature of these genomes isthat they encode a large number of tRNA genes

( Table 1 ) organized into at least two large ar-rays. Myrna (Subcluster C2) is predicted to ex-press 41 tRNAs, only modestly fewer than its M. smegmatis host (47 predicted tRNAs). TheSubcluster C1 phages, as well as the singleton Wildcat, also encode a tmRNA gene ( Table 1 ).

Genome Mosaicism A notable feature of all bacteriophage genomesis their mosaic architectures, where eachgenome can be thought of as a specic assem-blage of individual modules (81, 83, 101). Each

module may correspond to a single gene ora group of genes, and its modular nature isreected by its location in genomes that areotherwise not closely related. The exchange of modules may have occurred relatively recently in evolutionary time, in which case the mod-ules may retain substantial similarity at the nu-cleotide sequence level, or it mayhave occurredat more distant times, with the only remain-ing evidence of common descent being weak but statistically signicant amino acid sequencesimilarity. Examples of both extremes can befound amongthe mycobacteriophagegenomes.

An excellent example of a relatively recentexchange is seen in the Cluster B genomes(Figure 4 ). Cluster B genomes can be readily subdivided into four subclusters (B1–B4) suchthat genomes within each subcluster have highlevels of nucleotide sequence similarity overtheir entire genome lengths, but nucleotidesequence similarity is poor between genomesof different subclusters. However, there is a∼ 1.9-kbp DNA sequence segment that departsfromthis pattern and is sharedat a level of94%nucleotide sequence similarity between phagesRosebush (a Cluster B2 member) and all six of the Cluster B1 genomes; the only other mem-ber of the B2 subcluster (Qyrzula) has a quitedistinct sequence in its place (Figure 4 a). Be-cause sufcient evolutionary time has passedto allow for the accumulation of about 100nucleotide differences between the sequences,

342 Hatfull




366 (18)37

1406 (454)32

GTCGTCTGGCACGTCGTCGTGGACGAGTAGGGAGGCCGCCAATGGCCGTTATGATCGTCTGGCACATCG-CG-G-ACGAGTGATGTCGACACCGCGC

CAGCTGGACCGTGGTCGAGTAGGGAGGCCACCAATGGCCGTTATG

)

a

b

Orion

PG1

Qyrzula

Qyrzula

1406 (454)31

1406 (454)32

1406 (454)31

1406 (454)32

1406 (454)33

364 (9) 366 (18) 367 (9)34 365 (9) 366 (18) 360 (18)35

36

37

38

39

)1406 (454)33

1406 (454)33

32363 (9)31

363 (9)29

364 (9) 366 (18) 367 (9)34 365 (9) 366 (18) 360 (18)

35

364 (9)34 365 (9)

35

36

37

366 (18)36

38

367 (9)38

366 (18)35

1406 (454)31

1406 (454)30

364 (9)32 365 (9)

33

366 (18)34

367 (9)36

39

Rosebush

PG1Rosebush

33 34

35

313029 32 33 34 35 36

313029 32 33 34 35 36

313029 32 33 34 35 36 37

313029 32 33 34 35 36 37

Sequencesimilarity:

I n c r e a s i n g s i mi l a r i t y

Figure 4Recombination between Cluster B mycobacteriophages. (a) Phages Orion and PG1 are members of Subcluster B1 and are closely related at the nucleotide level ( Table 1 ). Phages Rosebush and Qyrzula are members of Subcluster B2 and are closely related at thenucleotide level across most of their genome spans. A short portion (∼ 7 kbp) of the genomes is shown and aligned, with sequencesimilarity represented as colored shading between the pairwise genomes. The strengths of the relationships are shown according to thecolor spectrum, with violet representing the closest similarity. Note the segment of Rosebush that is closely related to the Subcluster B1genomes, but not to its B2 relative Qyrzula. Genes are shown as gray boxes, with the gene name within the box, the phamily assignmentabove the box, and the number of phamily members in parentheses. Figure was generated using the program Phamerator (S. Cresawn,R. Hendrix & G.F. Hatfull, unpublished data). (b) Alignment of PG1, Rosebush, and Qyrzula sequences at the rightmost recombinant junction. The arrow above the sequences shows the position of the 3ends of genes35 of PG1 and Rosebush; the arrows below showthe 3 and 5 ends of Qyrzula genes33 and 34, respectively. The box shows a region of interrupted similarity between PG1 and Qyrzula within which recombination could have given rise to the Rosebush recombinant structure.





Phamily (Pham):

a group of mycobacteriophagesgenes related to eachother as dened by BlastP and ClustalW

examination of the recombinant junctionsshould be interpreted cautiously. Nonetheless,at the right junction, which corresponds closely

with the 3 ends of gene 35 , there is a shortsegment of interrupted sequence similarity be-tween PG1 (and all of its ve relatives) andQyrzula that could have served as a site for re-combination to give rise to the Rosebush struc-ture (Figure 4 b). The common sequence atthe junction is not completely conserved andit is impossible to tell whether the differenceshave occurred subsequent to recombination, or whether they might have been present in theparent genomes (which were not necessarily Qyrzula or other known Cluster B1 phages). Ithas been proposed that homeologous recombi-

nationevents (involving sequences that aresim-ilar but divergent) mediated by phage-encodedrecombinases (such as lambda Red or theRecET systems) acting at partially conservedsequences could give rise to junctions such asthese (74).

Themycobacteriophages appear to havenu-merous examples in which individual modulescorrespond to single genes, with the relation-shipsmadeevidentbyaminoacidsequencesim-ilarity (83). When the phylogenies of individ-ual genes are determined, they are often dif-ferent, revealing distinct evolutionary paths to

residence in any particular phage genome. Tosimplify the representation of this, we have uti-lized phamily circles, which have the advan-tage of displaying all genome members used inthe analysis, including those that do not con-tain a particular gene member of the pham-ily being analyzed (83). Examples are shown inFigure 5 in which both Pham 233 and Pham471 have a member in phage Omega but havePham members in a variety of other genomes.

In the Omega genome, genes 126 and 127 represent these two phamilies, respectively,and their distinct phylogenetic relationships

strongly suggest they have evolved separately,and have been juxtaposed by a recombina-tion event between them. This is further il-lustrated by examining the locations of the re-lated pham members in other genomes. Forexample, Pham 233 has a member in phageCjw1 (gene 73) that is anked on both sidesby genes unrelated to those anking Omegagene 126 . Likewise, Pham 471 has a memberin phage KBG (gene 84) anked by genes un-related to those in Omega. This single-genemosaicism, especially among the nonstructuralgenes, is a prominent feature of these genomes

and underscores the dominant role of hor-izontal exchange processes in bacteriophageevolution.

Mechanisms for Generating Mosaic Genomes There has been considerable speculation re-garding thespecic molecular mechanismsthatgive rise to mosaic phage genomes (47, 48). An early model suggested that short, conservedboundary sequences located at gene boundaries

may serve as targets for genetic exchange (110),and such boundary sequences have been de-scribed in coliphage HK620 (17). Boundary se-quences arenot,however,prevalentamongmy-cobacteriophages (or other groups of phages)and thus seem unlikely to solely account forthe pervasive mosaicism. A second view is thatmosaicism results from events that are primar-ily illegitimateor nonsequence determined. Al-though most of these events will be destructive,

−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−→

Figure 5

Examples of mycobacteriophage mosaicism. (a) A segment of the Omega genome is shown that encodes for genes125 –128. Gene 125 and 128 are orphams and have no known mycobacteriophage homologs, and genes126 and 127 are members of Pham 233 and Pham471, respectively, which have ve and eight members, respectively. Members of Pham 233 and Pham 471 are found in phages Cjw1 andKBG, and in each case they are in distinct genomic contexts. Presumably, recombination events between these genes occurred indistant evolutionary time to generate these mosaic structures. (b) Phamily circle representations for Pham 233 and Pham 471. Each of the 60 sequenced mycobacteriophage genomes is represented around the circumference of each circle, grouped according to cluster. Maps and circles were generated using the program Phamerator (S. Cresawn, R. Hendrix & G.F. Hatfull, unpublished data).

344 Hatfull




B x z 1 C o o p e r

)

B e t h l e h e m

B e t h l e h e m

B x b 1

B x b 1

D D 5

D D 5

J a s p e r

J a s p e r

K B G

K B G ( g p 8 4 )

L o c k l e y

L o c k l e y

S o l o n U

2B x z 2 C

h e 1 2 D 2 9

S o l o n U 2

B x z 2C

h e 1 2 D 2 9

L 5 P u k o v n i k

C h a h O r i o n

P G 1

L 5 P u k o v n i k

C h a h

O r i o n

P G 1

Q y r z u l a

R o s e b u s h

P h a e d r u s

P i p e f s h

Q y r z u l a

R o s e b u s h

P h a e d r u s

P i p e f s h

N i g e l

C a l i

C a t e r a

M y r n a

R i z a l

S c o t t M c G

B x z 1

C o o p e r

N i g e l

C a l i

C a t e r a

M y r n a

R i z a l

S c o t t M c G

S p u d

A d j u t o r

S p u d

A d j u t o r



G u m b a l l

P B I 1

P L o t

G u m b a l l

P B I 1

P L o t

T r o l l 4

T r o l l 4

2 4 4 ( g p 7 3 )

2 4 4

C j w 1 ( g p 7 3 )

C j w 1

K o s t y a ( g p 7 2 )

P o r k y ( g p 7 1 )

B o o m e r

K o s t y a

P o r k y

B o o m e r

C h e 8

F r u i t l o o p

L l i j

P M C

P a c c 4 0

C h e 8

F r u i t l o o p

L l i j

P M C

P a c c 4 0

R a m s e y

T w e e t y

R a m s e y ( g p 6 9 )

T w e e t y ( g p 6 9 )

T w e e t y ( g p 7 2 )

C h e 9 d

C h e 9 d ( g p 8 0 )

B P s H a l o


P r e d a t o r

B a r n y a r d B r u j i t a

C h e 9 c

B P s H a l o


P r e d a t o r

B a r n y a r d B r u j i t a

C h e 9 c

C o r n d o g

C o r n d o g ( g p 6 )

C o r n d o g ( g p 7 )

G i l e s

G i l e s

O

m e g a ( g p 1 2 6 )

O m e g a ( g p 1 2 7 )

T M 4

T M 4

W i l d c a t

W i l d c a t

P h a m

2 3 3

P h a m

4 7 1

b

a

7 3 5 ( 1 )

1 2 5

1 2 6

1 2 8

1 2 7

7 3 6 ( 1 )

6 8

5 0

5 1

6 9

O m e g a

C j w 1

K B G

2 3 3 ( 5 )

4 7 1 ( 8 )

3 0 %

2 7 . 2 %

2 3 3 ( 5 )

2 3 4 ( 5 )

2 3 1 ( 4 )

2 3 2 ( 4 )

7 1

7 2

7 4

7 3

7 5

2 2 8 ( 1 4 )

8 2

8 4

9 7 2 ( 3 )

6 5 ( 4 )

4 7 1 ( 8 )

8 5

1 8 9 0 ( 1 )

8 3

4 8

R e l a t i o n s h i p i d e n t i f e d b y B l a s t P

R e l a t i o n s h i p i d e n t i f e d b y C l u s t a l W





MPME:

mycobacteriophagemobile element

they have thecapacity to position twounrelatedDNA segments together in a highly creativeprocess. The generation of successful progeny

would likely require multiple low-frequency events, coupled with selection either for genefunction or for DNA segments of packagablesize. The low frequency of such events wouldseem to be a serious impediment in light of the dynamic nature of phage-host interactions(∼ 1024 infections per second globally), the vastnumber of phage particles (1031), and probableearly origins extending back perhaps 3 billion years (48, 111).

A third view is that homeologous recombi-nation plays an important role. Support for thisis provided by the observation that lambda Red

recombination is more procient at recom-bination between divergent sequences thanare host RecABCD pathways and can act at very short regions of sequence similarity (74).However, exchanges occurring at extremely short regions of sequence similarity may notbe readily distinguishable from illegitimaterecombination events, and exchanges at longersegments may not necessarily lead to disrup-tions of synteny (Figure 4 ). Nonetheless, theproperties of phage-encoded recombinationsystems make them attractive for playingimportant roles in phage evolution, mediating

exchange between short partially conservedsequences such as ribosome binding sites,transcriptional terminators, and repressorbinding sites (11).

A potential caveat for a general role of lambda Red–like recombinases in generatingphage mosaicism is that not all genomesobviously encode such recombination systems.In the mycobacteriophages, Clusters G, I,and Giles encode Escherichia coli RecET-likeproteins, some of which are active in re-combination (118–120); Wildcat encodes anErf-like recombinase, and a number of othermycobacteriophages (Clusters C and E) en-code RecA homologs. But recombinase genesmediating homologous exchange cannot bereadily identied in theremaining 48 genomes,suggesting that they are absent or that theseactivities lie within thelarge numberof genes of

unknown function. It is noteworthy that highlevels of recombination among TM4-derivedcosmids were observed during shuttle phas-

mid construction (53) even though no TM4recombination genes have been identied.

Transposons andOther Mobile Elements While not all phage genomes necessarily har-bor transposons or other mobile elements, they are not uncommon, and transposition is ex-pected to contribute to genomic mosaicism.Curiously, although dozens of transposons andinsertionsequences have been identied in my-cobacterial genomes, none occurs in any of

the sequenced mycobacteriophages (44). How-ever, comparative genomics has revealed anovel class of mycobacteriophage mobile ele-ments (MPMEs) that are broadly distributedamongmycobacteriophage genomes (primarily in Clusters F, G, and I) but absent from otherphages and mycobacterial chromosomes (96). Two main subclasses (MPME1 and MPME2)share 79% nucleotide sequence identity, al-though the MPME1 and MPME2 share 100%nucleotideidentity withintheir owngroup(96). The MPMEs are atypically small (MPME1 is439 bp and MPME2 is 440 bp) and generate

unusual 6-bp insertions between target DNA and the left inverted repeat at the insertionsite.

There is good evidence to support one ad-ditional transposon insertion. In Llij (ClusterF), gp83 is related to transposases of the IS200family and shares 73%amino acid identity witha putative transposase from Nocardia farcinia. A comparison of the Cluster F genomes at thenucleotide sequence level reveals a discontinu-ity 96 bp upstream of the beginning of gene83(coordinate 48209) that likely denes the junc-tion between the left end of a putative IS200family element and the target. The right endis not easy to identify, and Cluster F sequencesimilarities are less well dened, with possible junctions eitherat coordinate 49751 or at coor-dinate 49831. The ends of other IS200 family elements form hairpinloopstructures 16 bpand

346 Hatfull




RDF: recombination

directionality factor

6 bp from the left and right end junctions, re-spectively, anda plausiblestructureis present tothe left of Llij gene83. A second structure cor-

responding to the right end is less clear, raisingthe possibility that this element may have un-dergone subsequent rearrangements and may no longer be mobile.

Mycobacteriophage genomes are devoid of any clearly identiable introns, although thereare several inteins located within a variety of genes, all of which have inteinless counter-parts. Five of these are terminases (encoded by phages Bethlehem, Cjw1, Kostya, Omega, andPipesh), but the Pipesh terminase is distinctfrom theothers, in that it is circularlypermutedand does not have acos -packaging genome (44).

An intein is also present in three genes relatedto the Bxb1 recombination directionality factor(RDF) (gene 47 ) and a related intein is presentin a putative nucleotidyltransferase gene in Cali(gene3). The inteins representhighlydivergentsequences,and the intein in Bethlehem gene 51has recently been shown to represent a novelfunctional class (115).

MYCOBACTERIAL GENEFUNCTION AND EXPRESSION

Lysis A lysis cassette was rst described for mycobac-teriophage Ms6 (30, 90) and was proposed tocontain ve genes (Orfs 1–5). Although thecomplete genome sequence for Ms6 is notavailable, approximately 5 kbp of a 6.2-kbpsequenced segment is closely related to ClusterF phages, with Fruitloop the nearest relative(98% nucleotide identity). Of the ve openreading frames (ORFs) identied, three areimplicated in lysis: lysin A (Orf 2), lysin B(Orf4), and a holin (Orf 4). All the sequencedmycobacteriophages appear to encode anendolysin (lysin A), even though they arean unusual and complex group of proteinsequences composed of a large number of modules assembled in multiple combinations. These modules contain many different pepti-doglycan hydrolysis motifs including glycoside

hydrolases, amidases, and peptidases, as well aspeptidoglycan binding motifs. A direct role forthese modules in lysis is demonstrated by the

behavior of a lysin A–defective mutant of phageGiles, and in peptidoglycan hydrolysis by theendolysins of phages Corndog, Bxz1, and Che8(82). The Ms6 lysin B has lipolytic activity (34)and a Giles lysin B–defective mutant formssmall plaques and exhibits a lysis defect (82);the D29 lysin B protein is structurally relatedto cutinase-like enzymes and functions as a my-colylarabinogalactan esterase (82). Curiously,four mycobacteriophages (Che12, Rosebush,Qyrzula, and Myrna) lack a lysin B homolog yet do not exhibit small plaque morphotypeslike the Giles lysB mutant. An intriguing

possibility is that these phages have evolveda mechanism for utilizing a host-encodedcutinase-like enzyme for this function.

Integration and Prophage Maintenance Thirty-six of the sequenced mycobacterio-phages (Clusters A, E, F, G, I, and singletonsGiles and Omega) harbor integration cassettescomposed of an integrase gene, anattP attach-ment site, and an RDF. With the exceptionof Cluster A1 phages, and phages Bxz2 and

Peaches (both in Cluster A2), which encodeser-ine integrases, most of the integrases are of thetyrosine-recombinase family. In each genomeencoding a tyrosine integrase, a putativeattP site can be identied owing to a short 25- to45-bp common core region shared between theattP and attB sites in thehost chromosome. Fre-quently, the attB core overlaps a host tRNA gene and this is observed for all characterizedmycobacteriophages. In phages L5, D29,Halo, Ms6, Tweety, and Giles the attB site has beenconrmed experimentally (26, 65, 78, 85, 86,96) and it has been predicted for Che8, Llij,PMC (which are closely related to Tweety),Che9d, Omega, Che9c, Cjw1, and 244 (86).Of the remaining phages, Fruitloop integrase(gp40) is closely related to that of Ms6 andpresumably uses the same attB site; Boomerand Pacc40 integrases are similar to Tweety





integrase and its relatives. A putativeattP sitefor Brujita has yet to be identied. The M. tu-berculosis prophage-like element phiRv2 is inte-

grated into a host tRNA Val

gene (49).Integrase-mediated excisive recombinationtypically requires an RDF, and the best-characterizedRDF for the mycobacteriophage-encoded tyrosine integrases is the 56-residuegp36 Xis of L5 (66). However, the RDF classof proteins is highly diverse (67) and only the fellow Cluster A2 phages D29, Che12,and Pukovnik encode closelyrelated homologs.Ramsey (Subcluster F1) encodes a more dis-tant relative (gp34), although its location ad- jacent to the Ramsey integrase strongly impli-cates it in recombination directionality control.

The functions conferring directional control inthe other Cluster F phages as well as those inClusters E and Brujita (Cluster I) remain elu-sive. In the Cluster G phages a putative RDF with similarity to other Xis proteins is locatednear the integrase gene (Figure 2 ), and a simi-lar situation is observed in singletons Giles andOmega (genes 30 and 84, respectively). Che9c(Cluster I) encodes a putative RDF that is re-lated to Giles gp30 but is located over 6 kbpaway from the integrase gene.

Identication of attP and associated attBsites of serine integrases is more complicated

because the common core sequence can beas short as 2–3 bp (102). However, thesesystems are of interest because theattB sitesdo not overlap tRNA genes but are within hostprotein-coding genes and therefore have thecapacity to inuence host physiology throughgene inactivation or modication. A goodexample of this is Bxb1, which integrates intothe 3 end of the groEL1 gene of M. smegmatis (61, 80). As a result, Bxb1 lysogens are unableto form normal mature biolms, unveilingthe role of the unusual GroEL1 chaperone inthe regulation of mycolic biosynthesis (80). The other Subcluster A1 phages share closely related integrases (> 95% amino acid identity)and likely integrate into the same site. TheBxz2 integrase is more distantly related (27%amino acid identity with Bxb1 integrase) andintegrates into a different attB site within

Mmseg_5156 (86). The phage Peaches alsoencodes a serine integrase that is most closely related to the Bxb1 integrase (59%) but

whose integration site specicity remainsundetermined. The M. tuberculosis phiRv1prophage-like element encodes a serine inte-grase whoseattB siteis unusually located withina repetitive element that provides multiplepotential integration sites (7). The partialsequence of the glycopeptidolipid biosynthesisgene cluster of M. avium strain A5 shows thepresence of a related serine integrase (63) thatmay be part of a prophage in this strain.

Thereare twotypesof RDFs associatedwiththe mycobacteriophage-encoded serine inte-grases. The phiRv2 RDF is related to Xis pro-

teins that areotherwiseassociated with tyrosineintegrases, although its mechanism of actionremains poorly dened (6). The Bxb1 RDFis not related to other known RDF proteinsand was identied as the product of gene47 through use of a genetic screen (33). Biochem-ical characterization shows that it is not a DNA binding protein but interacts directly withintegrase-DNA complexes to promote forma-tion of excisive synaptic complexes (32, 33).Bxb1 gene47 is curious in that it is conservedamong mycobacteriophages encoding tyrosineintegrases including L5, for which all the com-

ponents required for integrative and excisiverecombination are known (and do not includethe L5 gp54 homolog of Bxb1 gp47) (68, 84). Itpresumably is involved in some function otherthan recombinational control, and its genomiclocation among DNA replication genes isconsistent with a replication function. Fur-thermore, Bxb1 gp47 has sequence similarity to proteins of the PP2A class of phosphatases,raising the question whether phosphataseactivity plays any role in recombination.

Several mycobacteriophages encode pro-teins containing putative nuclease domains of the ParBc superfamily, including Cluster B3,C1, and Corndog (Cluster E phages encodegenes with similarity to these but which donot include ParBc domains). None of thesegenomes encodes an integration cassette, andit is plausible that these form lysogens in

348 Hatfull




which the genomes replicate extrachromoso-mally. However,none of these (orany of the70)mycobacteriophages encodes ParA homologs

and their mode of prophage maintenance, if any, remains unclear.

Gene Expression and Its Regulation Little is known about gene expression in mostmycobacteriophages. Perhaps the best under-stood is phage L5, where an early leftward pro-moter (P left) is under the control of the phagerepressor (gp71) [the closely related L1 phagehas an identical repressor (99)]. The Pleft pro-moter is similar toE. coli sigma-70 promoters,and a binding site (operator) for gp71 overlaps

the promoter (11, 79). The gp71 repressor rec-ognizes a 13-bp asymmetric sequence that ispresent 30 times in the L5 genome, mostly insmall intergenic intervals and in one orienta-tion relative to the direction of transcription;gp71 binding has been demonstrated for 24 of these sites (11). It is proposed that a repressorbound to these stoperator sites prevents un- wanted transcripts from extending into cyto-toxic phage genes during lysogeny (11). Bxb1encodes a related repressor protein (gp69) thatalso binds to multiple operator and/or stopera-tor sites throughout the genome, although the

binding site has a different consensus sequenceand the phages are heteroimmune (54).

All the other Cluster A1 phages encode re-pressors that share at least 98% amino acididentity with Bxb1 gp69 and presumably arehomoimmune. A rightward promoter, whichis also repressor regulated, occurs at the rightendof theBxb1 genome(54). Multiple promot-ers for repressor synthesis in L1, L5, and Bxb1are presumably required for establishment andmaintenance of lysogeny (14, 54, 79), althoughtheir specic roles remain unclear. Transcrip-tionalpromoters forMs6 lysis genes (30)are lo-cated 214 bp upstream of the rst of the genesin that region, Orf 1; however, it is not clear whether this is a general feature of phages thatsharecloselyrelatedlysis genes (inCluster F),asthe extent of sequence similarity ends approx-imately 60 bp upstream of Ms6 Orf 1. No late

promoters for any mycobacteriophages havebeenidentied,eventhough protein expressionpatterns suggest that these may be among the

most active of all mycobacterial expression sys-tems (25, 46). A mutant defective in late syn-thesis of phage L1 has been reported, but thespecic genes involved are not known (21).

Other MycobacteriophageGene FunctionsSeveral mycobacteriophage genes involved inDNA metabolism have been cloned and char-acterized. Phage L5 encodes both a thymidylatesynthase (ThyX) anda ribonucleotidereductase(RNR) (gp48 and gp50, respectively), and they

are expressed early in lytic growth and appearto function as a complex (5). A mutant defectivein early gene expression inuences expressionof a proposed phage nuclease (20). Giri et al.(35) characterized an early nuclease encoded by gene 65 of phage D29 and showed that it is astructure-specic nuclease witha preference forforked structures.

Initial studies of mycobacteriophage L5identied at least two segments of the phageL5genome that are not well tolerated in M. smeg-matis and presumably encode cytotoxic pro-teins. Further analysis identied three cyto-

toxic proteins encoded by L5 genes77 , 78, and79 (95) that prevent growth of M. smegmatis when expressed and presumably interrupt spe-cic cellular processes, although these proteinsremain ill-dened. We predict that the broadermycobacteriophage collection encodes numer-ous additionalcytotoxic proteins withconsider-able potential for development of antitubercu-losis drugs as proposed forStaphylococcus phages(71).

MYCOBACTERIOPHAGE

GENETIC MANIPULATION As noted above, shuttle phasmids have beeninvaluable tools for constructing recombinantmycobacteriophages and for using them to de-liver transposons, allelic exchange substrates,and reporter genes (1, 2, 51). However, with





MYCOBACTERIAL RECOMBINEERING

M. tuberculosis is unusual among bacteria in that when linearDNA substrates are introduced by electroporation there is a highpropensity for illegitimate recombination (58). Mycobacterio-phages have provided two useful strategies for constructing genereplacement mutants. First,mycobacteriophage shuttle phasmidscan be used to introduce allelic exchange substrate by infection,and after selection a high proportion of the progeny are the re-sult of homologous replacement (1). Secondly, a mycobacterial-specic recombineering system has been developed in whichRecET-like proteins encoded by mycobacteriophage Che9c areexpressed to confer high levels of recombination (118). Intro-duction of dsDNA or single-stranded DNA substrates into re-combineering strains of M. smegmatis or M. tuberculosis provides

an efcient means of generating gene replacement mutants andpoint mutations (118, 119). Single-stranded DNA recombineer-ing is particularly attractive for generating isogenic strains withdened point mutations with applicability to determining thecontributions of single base substitutions to the drug resistantphenotypes of multiple-drug-resistant tuberculosis and exten-sively drug-resistant tuberculosis clinical strains.

BRED: bacteriophagerecombineering of electroporated DNA

an average mycobacteriophage genome lengthof over 70 kbp and packaging constraints of ∼ 50 kbp in lambda particles, many mycobacte-riophages are not amenable to this technology.

Bacteriophage recombineering of electro-porated DNA(BRED) provides a techniquefordirect genetic manipulation of mycobacterio-phages that takes advantage of a mycobacteria-specic recombineering system (73, 118). Thisrecombineering approach is based on the useof the RecET-like recombination system en-coded by phage Che9c, such that expressionof genes 60 and 61 generates high levels of recombination in both M. smegmatis and M.tuberculosis (118, 119). In the BRED applica-tion, recombineering-procient cells are co-electroporated with two DNA substrates; oneis genomic DNA of the phage to be ma-nipulated and the other is a short (typically 200 bp) substrate that contains the desired mu-tation (73). For example, a dened gene dele-tion can be constructed by creating a 200-bpsubstrate containing 100 bp homologous to

each of the upstream and downstream regions(120). The mutation can be designed to mini-mize genetic polarity, and because recombina-

tion is efcient, there is no need to include aselectable marker or identication tag.Following co-electroporation, plaques are

recovered by plating onto lawns of a permissivebacterial host ( M. smegmatis ) in an infectiouscenter conguration, i.e., by plating prior tophage replication and lysis. Each plaque there-fore derives from a single cell that has takenup phage genomic DNA. Screening of 12–18plaques by PCR typically identies at least oneplaque that is mixed, containing both wild-typeand mutant alleles. Importantly, this is typically observed whether or not the gene is essential

for phage growth, because if the gene is essen-tial, then thepresence ofwild-typehelperphagesupports mutant growth in the mixed plaque.Replating for isolated plaques and screening by PCR usually identify a homogenous viable mu-tant (73). If a mutant is not viable, then it canbe recovered with a complementing strain in which the essential gene is expressed from aplasmid (73). Because no selection is required,BRED can been used to make virtually any recombinant that is desired, including denednonpolar deletions, insertions,pointmutations,andadditionofgenetags(73).BREDappearsto

bebroadly applicableto mycobacteriophage ge-netic manipulationprovided that plaquescan berecoveredby electroporation of phage genomicDNA. The BRED technology thus circum- ventsa major hurdlein mycobacteriophage ma-nipulation: providing facile genetic approachesfor addressing a multitude of questions in my-cobacteriophage biology.

SUMMARY In conclusion, mycobacteriophage genomicsreveals that the diversity of the population islarge, and that substantial parts of the pop-ulation at large remain unexplored. Five of the 70 sequenced genomes have no close rel-atives, prophages emerging from mycobacte-rial genome sequencing projects are not closely related to known phages, and the diversity

350 Hatfull




of the CRISPR spacers in M. tuberculosis and M. avium genomes suggests there aremany genomes yet to be discovered. With

new technologies for global expression analyses

and mycobacteriophage functional genomics,a new chapter in postgenomic mycobacterio-phage biology is anticipated with considerable

excitement.

SUMMARY POINTS

1. Mycobacteriophage genomes are genetically highly diverse.

2. Mycobacteriophages can be grouped into clusters according to their sequencerelationships.

3. Mycobacteriophage genomes are architecturally mosaic.

4. Approximately 80% of mycobacteriophage gene phamilies are of unknown function.

5. Mycobacteriophages are sources of genetic novelty, including new classes of inteins andmobile elements.

6. BRED recombineering provides a facile andgeneral means forconstructingrecombinantand mutant forms of mycobacteriophages.

7. Mycobacteriophages are rich resources for mycobacterial genetics.

FUTURE ISSUES

1. Newly discovered mycobacteriophages isolated on a variety of different mycobacterialstrains are needed to fully understand mycobacteriophage genetic diversity.

2. The potential for generating new tools for mycobacterial genetics and gaining insightsinto mycobacterial physiology is great and many advances await development.

3. Elucidating the function of mycobacteriophage genes will provide a fuller understandingof their biology and their evolution.

DISCLOSURE STATEMENT The author is notaware of any afliations, memberships, funding, or nancial holdings that mightbe perceived as affecting the objectivity of this review.

ACKNOWLEDGMENTSI thank my colleagues and collaborators, Roger Hendrix, Jeffrey Lawrence, Craig Peebles, SteveCresawn, Bill Jacobs, Debbie Jacobs-Sera, and the numerous members of the Hatfull laboratory

who have participated in mycobacteriophage isolation, sequencing, and analysis.

LITERATURE CITED1. Bardarov S, Bardarov S Jr, Pavelka MS Jr, Sambandamurthy V, Larsen M, et al. 2002. Specialized

transduction: an efcient method for generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis , M. bovis BCG and M. smegmatis . Microbiology148:3007–17





2. Bardarov S, Kriakov J, Carriere C, Yu S, Vaamonde C, et al. 1997. Conditionally replicating mycobac-teriophages: a system for transposon delivery toMycobacterium tuberculosis . Proc. Natl. Acad. Sci. USA94:10961–66

3. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, et al. 2007. CRISPR provides acquiredresistance against viruses in prokaryotes.Science315:1709–12

4. Barsom EK, Hatfull GF. 1996. Characterization of Mycobacterium smegmatis gene that confers resistanceto phages L5 and D29 when overexpressed.Mol. Microbiol.21:159–70

5. Bhattacharya B, Giri N, Mitra M, Gupta SK. 2008. Cloning, characterization and expression analysis of nucleotide metabolism-related genes of mycobacteriophage L5.FEMS Microbiol. Lett.280:64–72

6. Bibb LA, HancoxMI, Hatfull GF.2005. Integration andexcisionby thelarge serinerecombinase phiRv1integrase. Mol. Microbiol.55:1896–910

7. Bibb LA, Hatfull GF. 2002. Integration and excision of theMycobacterium tuberculosis prophage-likeelement, phiRv1. Mol. Microbiol.45:1515–26

8. Bisso G, Castelnuovo G, Nardelli MG, Oreci G, Arancia G, et al. 1976. A study on the receptor for amycobacteriophage: phage phlei.Biochimie58:87–97

9. Bowman B Jr. 1958. Quantitative studies on some mycobacterial phage-host systems.J. Bacteriol.76:52–62

10. Bowman BU. 1969. Properties of mycobacteriophage DS6A. I. Immunogenicity in rabbits.Proc. Soc. Exp. Biol. Med.131:196–200

11. Brown KL, Sarkis GJ, Wadsworth C, Hatfull GF. 1997. Transcriptional silencing by the mycobacterio-phage L5 repressor. EMBO J. 16:5914–21

12. Casjens SR, Gilcrease EB. 2009. Determining DNA packaging strategy by analysis of the termini of thechromosomes in tailed-bacteriophage virions. Methods Mol. Biol.502:91–111

13. Chatterjee S, Mitra M, Das Gupta SK. 2000. A high yielding mutant of mycobacteriophage L1 and itsapplication as a diagnostic tool.FEMS Microbiol. Lett.188:47–53

14. Chattopadhyay C, SauS, MandalNC. 2003. Cloning andcharacterization of thepromoters of temperatemycobacteriophage L1. J. Biochem. Mol. Biol.36:586–92

15. Chaudhuri B, Sau S, Datta HJ, Mandal NC. 1993. Isolation, characterization, and mapping of temperature-sensitive mutations in the genes essential for lysogenic and lytic growth of the mycobacte-riophage L1. Virology194:166–72

16. Chen J, Kriakov J, Singh A, Jacobs WR Jr, Besra GS, Bhatt A. 2009. Defects in glycopeptidolipidbiosynthesis confer phage I3 resistance inMycobacterium smegmatis . Microbiology155:4050–57

17. Clark AJ, Inwood W, Cloutier T, Dhillon TS. 2001. Nucleotide sequence of coliphage HK620 and theevolution of lambdoid phages.J. Mol. Biol.311:657–79

18. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, et al. 1998. Deciphering the biology of Mycobac-terium tuberculosis from the complete genome sequence. Nature 393:537–44

19. Conway JF, DudaRL, Cheng N, Hendrix RW,Steven AC. 1995. Proteolytic and conformationalcontrolof virus capsid maturation: the bacteriophage HK97 system.J. Mol. Biol.253:86–99

20. Datta HJ, Mandal NC. 1998. Identication of an early positive regulatory gene of mycobacteriophageL1. J. Gen. Virol.79:205–10

21. Datta HJ, Mandal P, Bhattacharya R, Das N, Sau S, Mandal NC. 2007. The G23 and G25 genes of temperate mycobacteriophage L1 are essential for the transcription of its late genes.J. Biochem. Mol.Biol.40:156–62

22. Doke S. 1960. Studies on mycobacteriophages and lysogenic mycobacteria.J. Kumamoto Med. Soc.

34:1360–7323. Donnelly-Wu MK, Jacobs WR Jr, Hatfull GF. 1993. Superinfection immunity of mycobacteriophageL5: applications for genetic transformation of mycobacteria.Mol. Microbiol.7:407–17

24. Ford ME, Sarkis GJ, Belanger AE, Hendrix RW, Hatfull GF. 1998. Genome structure of mycobacte-riophage D29: implications for phage evolution.J. Mol. Biol.279:143–64

25. Ford ME, Stenstrom C, Hendrix RW, Hatfull GF. 1998. Mycobacteriophage TM4: genome structureand gene expression.Tuber. Lung Dis.79:63–73

352 Hatfull




26. Freitas-Vieira A, Anes E, Moniz-Pereira J. 1998. The site-specic recombination locus of mycobacte-riophage Ms6 determines DNA integration at the tRNA(Ala) gene of Mycobacteriumspp. Microbiology144:3397–406

27. Froman S, Will DW, Bogen E. 1954. Bacteriophage active againstMycobacterium tuberculosis I. Isolationand activity. Am. J. Publ. Health44:1326–33

28. FullnerKJ, HatfullGF. 1997. Mycobacteriophage L5 infection of Mycobacterium bovis BCG: implicationsfor phage genetics in the slow-growing mycobacteria.Mol. Microbiol.26:755–66

29. Furuchi A, Tokunaga T. 1972. Nature of the receptor substance of Mycobacterium smegmatis for D4bacteriophage adsorption. J. Bacteriol.111:404–11

30. Garcia M, Pimentel M, Moniz-Pereira J. 2002. Expression of mycobacteriophage Ms6 lysis genes isdriven by two sigma(70)-like promoters and is dependent on a transcription termination signal presentin the leader RNA. J. Bacteriol.184:3034–43

31. Gardner GM, Weiser RS. 1947. A bacteriophage for Mycobacterium smegmatis . Proc. Soc. Exp. Biol. Med.66:205–6

32. Ghosh P, Bibb LA, Hatfull GF. 2008. Two-step site selection for serine-integrase-mediated excision:DNA-directed integrase conformation and central dinucleotide proofreading. Proc. Natl. Acad. Sci. USA105:3238–43

33. Ghosh P, Wasil LR, Hatfull GF. 2006. Control of phage Bxb1 excision by a novel recombinationdirectionality factor. PLoS Biol.4:e186

34. Gil F, Catalao MJ, Moniz-Pereira J, Leandro P, McNeil M, Pimentel M. 2008. The lytic cassette of mycobacteriophage Ms6 encodes an enzyme with lipolytic activity.Microbiology154:1364–71

35. Giri N, Bhowmik P, Bhattacharya B, Mitra M, Das Gupta SK. 2009. The mycobacteriophage D29gene 65 encodes an early-expressed protein that functions as a structure-specic nuclease.J. Bacteriol.191:959–67

36. Golz S, Kemper B. 1999. Association of Holliday-structure resolving endonuclease VII with gp20 fromthe packaging machine of phage T4.J. Mol. Biol.285:1131–44

37. Grange JM. 1975. The geneticsof mycobacteria and mycobacteriophages—a review.Tubercle56:227–3838. HanauerDI,Jacobs-Sera D,PedullaML, CresawnSG,HendrixRW, HatfullGF. 2006. Inquiry learning.

Teaching scientic inquiry. Science314:1880–8139. Hatfull GF. 2004. Mycobacteriophages and tuberculosis. InTuberculosis , ed. K Eisenach, ST Cole, WR

Jacobs Jr, D McMurray, pp. 203–18. Washington, DC: ASM Press

40. Hatfull GF. 2006. Mycobacteriophages. InThe Bacteriophages , ed. R Calendar, pp. 602–20. New York:Oxford Univ. Press41. Hatfull GF. 2008. Bacteriophage genomics.Curr. Opin. Microbiol.11:447–5342. Hatfull GF, Cresawn SG, Hendrix RW. 2008. Comparative genomics of the mycobacteriophages: in-

sights into bacteriophage evolution.Res. Microbiol.159:332–3943. Hatfull GF, Jacobs WR Jr. 1994. Mycobacteriophages: cornerstones of mycobacterial research. InTu-

berculosis: Pathogenesis, Protection and Control , ed. BR Bloom, pp. 165–83. Washington, DC: ASM Press

44. Describes theorganization of mycobacteriophagesinto clusters according to their relationships.

44. Hatfull GF, Jacobs-Sera D, Lawrence JG, Pope WH, Russell DA, et al. 2010. Comparativegenomic analysis of sixty mycobacteriophage genomes: genome clustering, gene acquisition andgene size. J. Mol. Biol. 397:119–43

45. Integrates thecomparative analysis of 30 sequencedmycobacteriophages with phage discovery and genomics as an educational enterprise.

45. Hatfull GF, Pedulla ML, Jacobs-Sera D, Cichon PM, Foley A, et al. 2006. Exploring the my-cobacteriophage metaproteome: phage genomics as an educational platform. PLoS Genet. 2:e92

46. Hatfull GF, Sarkis GJ. 1993. DNA sequence, structure and gene expression of mycobacteriophage L5:a phage system for mycobacterial genetics.Mol. Microbiol.7:395–405

47. Hendrix RW. 2002. Bacteriophages: evolution of the majority.Theor. Popul. Biol.61:471–8048. Hendrix RW. 2003. Bacteriophage genomics.Curr. Opin. Microbiol.6:506–11

49. Discusses the globalrelationships between phage and prophagegenomes.

49. Hendrix RW, Smith MC, Burns RN, Ford ME, Hatfull GF. 1999. Evolutionary relationshipsamong diverse bacteriophages and prophages: All the world’s a phage. Proc. Natl. Acad. Sci. USA96:2192–97

50. Jacobs WR Jr. 2000.Mycobacterium tuberculosis : a once genetically intractable organism. InMolecular Genetics of the Mycobacteria, ed. GF Hatfull, WR Jacobs Jr, pp. 1–16. Washington, DC: ASM Press





51. Jacobs WR Jr, Barletta RG, Udani R, Chan J, Kalkut G, et al. 1993. Rapid assessment of drug suscepti-bilities of Mycobacterium tuberculosis by means of luciferase reporter phages.Science260:819–22

52. Jacobs WR Jr, Snapper SB, Tuckman M, Bloom BR. 1989. Mycobacteriophage vector systems.Rev. Infect. Dis.11(Suppl. 2):S404–10

53. Jacobs WR Jr, Tuckman M, Bloom BR. 1987. Introduction of foreign DNA into mycobacteria using ashuttle phasmid. Nature 327:532–35

54. Jain S, Hatfull GF. 2000. Transcriptional regulation and immunity in mycobacteriophage Bxb1.Mol. Microbiol.38:971–85

55. Jones W, White A. 1968. Lysogeny in mycobacteria. I. Conversion of colony morphology, nitratereductase activity, and tween 80 hydrolysis of Mycobacteriumsp. ATCC 607 associated with lysogeny.Can. J. Microbiol.14:551–55

56. Jones WD Jr. 1975. Differentiation of known strains of BCG from isolates of mycobacteriumbovis and Mycobacterium tuberculosis by using mycobacteriophage 33D.J. Clin. Microbiol.1:391–92

57. Jones WD Jr. 1975. Phage typing report of 125 strains of “ Mycobacterium tuberculosis.” Ann. Sclavo.17:599–604

58. Kalpana GV, Bloom BR, Jacobs WR Jr. 1991. Insertional mutagenesis and illegitimate recombinationin mycobacteria. Proc. Natl. Acad. Sci. USA88:5433–37

59. KarnikSS,Gopinathan KP.1983. Transfectionof Mycobacteriumsmegmatis SN2withmycobacteriophageI3 DNA. Arch. Microbiol.136:275–80

60. Khoo KH, Suzuki R, Dell A, Morris HR, McNeil MR, et al. 1996. Chemistry of the lyxose-containingmycobacteriophage receptors of Mycobacterium phlei / Mycobacterium smegmatis . Biochemistry35:11812–19

61. Kim AI, Ghosh P, Aaron MA, Bibb LA, Jain S, Hatfull GF. 2003. Mycobacteriophage Bxb1 integratesinto the Mycobacterium smegmatis groEL1 gene. Mol. Microbiol.50:463–73

62. Krumsiek J, ArnoldR, Rattei T. 2007. Gepard: a rapid andsensitive tool forcreatingdotplots on genomescale.Bioinformatics 23:1026–28

63. Krzywinska E, Schorey JS. 2003. Characterization of genetic differences betweenMycobacterium aviumsubsp. avium strains of diverse virulence with a focus on the glycopeptidolipid biosynthesis cluster.Vet. Microbiol.91:249–64

64. A comprehensiveanalysis of thedifculties in bacteriophage

taxonomy.

64. Lawrence JG, Hatfull GF, Hendrix RW. 2002. Imbroglios of viral taxonomy: genetic exchangeand failings of phenetic approaches. J. Bacteriol. 184:4891–905

65. Lee MH, Pascopella L, Jacobs WR Jr, Hatfull GF. 1991. Site-specic integration of mycobacteriophageL5: integration-procient vectors for Mycobacterium smegmatis , Mycobacterium tuberculosis , and bacille

Calmette-Guerin. Proc. Natl. Acad. Sci. USA88:3111–1566. Lewis JA, Hatfull GF. 2000. Identication and characterization of mycobacteriophage L5 excisionase.

Mol. Microbiol.35:350–6067. Lewis JA, Hatfull GF. 2001. Control of directionality in integrase-mediated recombination: examination

of recombinationdirectionalityfactors (RDFs) includingXis andCoxproteins. NucleicAcidsRes.29:2205–16

68. Lewis JA, Hatfull GF. 2003. Control of directionality in L5 integrase-mediated site-specic recombina-tion. J. Mol. Biol.326:805–21

69. Describes areticulaterepresentation of phagegenome relationshipsthat accommodatestheir pervasivemosaicism.

69. Lima-Mendez G, Toussaint A, Leplae R. 2007. Analysis of the phage sequence space: the benet of structured information. Virology 365:241–49

70. Lima-Mendez G, Van Helden J, Toussaint A, Leplae R. 2008. Reticulate representation of evolutionary and functional relationships between phage genomes.Mol. Biol. Evol.25:762–77

71. Liu J, Dehbi M, Moeck G, Arhin F, Bauda P, et al. 2004. Antimicrobial drug discovery through bacte-riophage genomics. Nat. Biotechnol.22:185–91

72. Mankiewicz E, Liivak M, Dernuet S. 1969. Lysogenic mycobacteria: phage variations and changes inhost cells. J. Gen. Microbiol.55:409–1673. Presents a

methodology for simpleconstruction of recombinant or mutant mycobacteriophagegenomes.

73. Marinelli LJ, Piuri M, Swigonova Z, Balachandran A, Oldeld LM, et al. 2008. BRED: a simpleand powerful tool for constructing mutant and recombinant bacteriophage genomes. PLoS ONE 3:e3957

74. Martinsohn JT, Radman M, Petit MA. 2008. The lambda red proteins promote efcient recombinationbetweendivergedsequences: implicationsfor bacteriophage genomemosaicism. PLoSGenet.4:e1000065

354 Hatfull




75. McNerney R. 1999. TB: the return of the phage. A review of fty years of mycobacteriophage research. Int. J. Tuberc. Lung Dis.3:179–84

76. McNerney R, Traore H. 2005. Mycobacteriophage and their application to disease control. J. Appl. Microbiol.99:223–33

76a. Mediavilla J, JainS, KriakovJ, FordME, DudaRL, etal.2000. Genomeorganizationand characterizationof mycobacteriophage Bxb1.Mol. Microbiol.38:955–70

77. Mizuguchi Y. 1984. Mycobacteriophages. InThe Mycobacteria: A Sourcebook, ed. GP Kubica, LG Wayne,pp. 641–62. New York: Marcel Dekker

78. Morris P, Marinelli LJ, Jacobs-Sera D, Hendrix RW, Hatfull GF. 2008. Genomic characterization of mycobacteriophage Giles: evidence for phage acquisition of host DNA by illegitimate recombination.J.Bacteriol.190:2172–82

79. Nesbit CE, Levin ME, Donnelly-Wu MK, Hatfull GF. 1995. Transcriptional regulation of repressorsynthesis in mycobacteriophage L5.Mol. Microbiol.17:1045–56

80. Ojha A, Anand M, Bhatt A, Kremer L, Jacobs WR Jr, Hatfull GF. 2005. GroEL1: a dedicated chaperoneinvolved in mycolic acid biosynthesis during biolm formation in mycobacteria.Cell 123:861–73

81. Papke RT, Doolittle WF. 2003. Phageevolution:newworlds of genomicdiversity. Curr.Biol.13:R606–782. Payne K, Sun Q, Sacchettini J, Hatfull GF. 2009. Mycobacteriophage lysin B is a novel mycolylarabino-

galactan esterase.Mol. Microbiol.73:367–8183. Pedulla ML, Ford ME, Houtz JM, Karthikeyan T, Wadsworth C, et al. 2003. Origins of highly mosaic

mycobacteriophage genomes.Cell 113:171–8284. Pena CE, Kahlenberg JM, Hatfull GF. 1999. Protein-DNA complexes in mycobacteriophage L5 inte-

grative recombination. J. Bacteriol.181:454–6185. PenaCE, Stoner J, HatfullGF.1998. MycobacteriophageD29 integrase-mediated recombination:speci-

city of mycobacteriophage integration.Gene225:143–5186. Pham TT, Jacobs-Sera D, Pedulla ML, Hendrix RW, Hatfull GF. 2007. Comparative genomic anal-

ysis of mycobacteriophage Tweety: evolutionary insights and construction of compatible site-specicintegration vectors for mycobacteria.Microbiology153:2711–23

87. Piuri M, Hatfull GF. 2006. A peptidoglycan hydrolase motif within the mycobacteriophage TM4 tapemeasure protein promotes efcient infection of stationary phase cells.Mol. Microbiol.62:1569–85

88. Piuri M, Jacobs WR Jr, Hatfull GF. 2009. Fluoromycobacteriophages for rapid, specic, and sensitiveantibiotic susceptibility testing of Mycobacterium tuberculosis . PLoS ONE 4:e4870

89. Popa MP, McKelvey TA, Hempel J, Hendrix RW. 1991. Bacteriophage HK97 structure: wholesale

covalent cross-linking between the major head shell subunits.J. Virol. 65:3227–3790. Portugal I, Anes E, Moniz-Pereira J. 1989. Temperate mycobacteriophage from M. smegmatis . Acta

Leprol.7:243–4491. Raj CV, Ramakrishnan T. 1970. Transduction in Mycobacterium smegmatis . Nature 228:280–8192. Ripoll F, Pasek S, Schenowitz C, Dossat C, Barbe V, et al. 2009. Non mycobacterial virulence genes in

the genome of the emerging pathogen Mycobacterium abscessus . PLoS One4:e566093. Rubin EJ, Akerley BJ, Novik VN, Lampe DJ, Husson RN, Mekalanos JJ. 1999. In vivo transposition of

mariner-based elements in enteric bacteria and mycobacteria.Proc. Natl. Acad. Sci. USA96:1645–5094. Rybniker J, Kramme S, Small PL. 2006. Host range of 14 mycobacteriophages inMycobacterium ulcerans

and seven other mycobacteria including Mycobacterium tuberculosis —application for identication andsusceptibility testing.J. Med. Microbiol.55:37–42

95. Rybniker J, Plum G, Robinson N, Small PL, Hartmann P. 2008. Identication of three cytotoxic early proteins of mycobacteriophage L5 leading to growth inhibition inMycobacterium smegmatis . Microbiology154:2304–14

96. Sampson T, Broussard GW, Marinelli LJ, Jacobs-Sera D, Ray M, et al. 2009. Mycobacteriophages BPs, Angel and Halo: Comparative genomics reveals a novel class of ultrasmall mobile genetic elements. Microbiology155:2962–77

97. Sanger F, Coulson AR, Hong GF, Hill DF, Petersen GB. 1982. Nucleotide sequence of bacteriophagelambda DNA. J. Mol. Biol.162:729–73

98. Sassetti CM, Boyd DH, Rubin EJ. 2003. Genes required for mycobacterial growth dened by highdensity mutagenesis. Mol. Microbiol.48:77–84





99. Sau S, Chattoraj P, Ganguly T, Lee CY, Mandal NC. 2004. Cloning and sequencing analysis of therepressor gene of temperate mycobacteriophage L1. J. Biochem. Mol. Biol.37:254–59

100. Sellers MI, Tokuyasu K, Price Z, Froman S. 1957. Electron microscopic studies of mycobacteriophages. Am. Rev. Tuberc.76:964–69

101. Simon MN, Davis RW, Davidson N. 1971. Heteroduplexes of DNA molecules of lambdoid phages:physical mapping of their base sequence relationships by electron microscopy. InThe Bacteriophage Lambda, ed. AD Hershey, pp. 313–28. Cold Spring Harbor, NY: Cold Spring Harbor Lab. Press

102. Smith MC, Thorpe HM. 2002. Diversity in the serine recombinases.Mol. Microbiol.44:299–307103. Snapper SB, Lugosi L, Jekkel A, Melton RE, Kieser T, et al. 1988. Lysogeny and transformation in

mycobacteria: stable expression of foreign genes.Proc. Natl. Acad. Sci. USA85:6987–91104. Snapper SB, Melton RE, Mustafa S, Kieser T, Jacobs WR Jr. 1990. Isolation and characterization of

efcient plasmid transformation mutants of Mycobacterium smegmatis . Mol. Microbiol.4:1911–19105. Snider DE Jr, Jones WD, Good RC. 1984. The usefulness of phage typingMycobacterium tuberculosis

isolates.Am. Rev. Respir. Dis.130:1095–99106. Soloff BL, Rado TA, Henry BE 2nd, Bates JH. 1978. Biochemical and morphological characterization

of mycobacteriophage R1.J. Virol. 25:253–62107. Stinear TP, Jenkin GA, Johnson PD, Davies JK. 2000. Comparative genetic analysis of Mycobacterium

ulcerans and Mycobacterium marinumreveals evidence of recent divergence.J. Bacteriol.182:6322–30108. Stinear TP, Seemann T, Harrison PF, Jenkin GA, Davies JK, et al. 2008. Insights from the complete

genome sequence of Mycobacterium marinumon the evolution of Mycobacterium tuberculosis . Genome Res.18:729–41

109. Stinear TP, Seemann T, Pidot S, Frigui W, Reysset G, et al. 2007. Reductive evolution and nicheadaptation inferred from the genome of Mycobacterium ulcerans , the causative agent of Buruli ulcer.Genome Res.17:192–200

110. Susskind MM, Botstein D. 1978. Molecular genetics of bacteriophage P22.Microbiol. Rev.42:385–413111. Suttle CA. 2007. Marine viruses—major players in the global ecosystem.Nat. Rev. Microbiol.5:801–12112. Timme TL, Brennan PJ. 1984. Induction of bacteriophage from members of the Mycobacterium avium,

Mycobacterium intracellulare, Mycobacterium scrofulaceumserocomplex.J. Gen. Microbiol.130:2059–66113. Tokunaga T, Kataoka T, Suga K. 1970. Phage inactivation by an ethanol-ether extract of Mycobacterium

smegmatis . Am. Rev. Respir. Dis.101:309–13114. Tokunaga T, Nakamura RM. 1968. Infection of competent Mycobacterium smegmatis with deoxyribonu-

cleic acid extracted from bacteriophage B1.J. Virol. 2:110–17115. Tori K, Dassa B, Johnson MA, Southworth MW, Brace LE, et al. 2010. Splicing of the mycobacte-

riophage Bethlehem DnaB intein: identication of a new mechanistic class of inteins that contain anobligate block F nucleophile.J. Biol. Chem.285:2515–26

116. van der Oost J, Brouns SJ. 2009. RNAi: Prokaryotes get in on the act.Cell 139:863–65117. van der Oost J, Jore MM, Westra ER, Lundgren M, Brouns SJ. 2009. CRISPR-based adaptive and

heritable immunity in prokaryotes. Trends Biochem. Sci.34:401–7118. van Kessel JC, Hatfull GF. 2007. Recombineering inMycobacterium tuberculosis . Nat. Methods 4:147–52119. van Kessel JC, Hatfull GF. 2008. Efcient point mutagenesis in mycobacteria using single-stranded

DNA recombineering: characterization of antimycobacterial drug targets.Mol.Microbiol.67:1094–107120. vanKessel JC, Hatfull GF. 2008. Mycobacterial recombineering.Methods Mol. Biol.435:203–15121. Whittaker E. 1950. Two bacteriophages for Mycobacterium smegmatis . Can. J. Public Health41:431–36

356 Hatfull

mycobacteriophages genes and genomes review

Documents