morphological, biochemical and molecular …
TRANSCRIPT
MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR CHARACTERIZATION OF COMMON PEA (
AS SUMMER CROP AT RAWALAKOT AZAD KASHMIR
Thesis submitted for degree of
University of
MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR CHARACTERIZATION OF COMMON PEA (Pisum sativum L
AS SUMMER CROP AT RAWALAKOT AZAD KASHMIR
By
Uzma Arif
(Regd. No. 2012-Agri-271)
Thesis submitted for degree of Ph.D
In
Horticulture
Session 2015-2018
Department of Horticulture Faculty of Agriculture
University of The Poonch Rawalakot Azad Jammu and Kashmir
MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR L.) GROWN
AS SUMMER CROP AT RAWALAKOT AZAD KASHMIR
ii
MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR
CHARACTERIZATION OF COMMON PEA (Pisum sativum L.) GROWN AS SUMMER CROP AT RAWALAKOT AZAD KASHMIR
By
Uzma Arif (Regd. No. 2012-Agri-271)
A thesis submitted in partial fulfilment of the requirement for the degree of
Doctor of Philosophy
In
Horticulture
Session 2015-2018
Department of Horticulture Faculty of Agriculture
University of The Poonch Rawalakot Azad Jammu and Kashmir
iii
CERTIFICATION
Certified that the contents and form of thesis entitled “Morphological, biochemical and
molecular characterization of common pea (Pisum sativum L.) grown as summer crop
at Rawalakot Azad Kashmir” submitted by Uzma Arif (Reg. No. 2012-Agri.-271)
have been found satisfactory for the award of degree of Doctor of Philosophy in
Horticulture.
SUPERVISORY COMMITTEE
i. Supervisor ---------------------------------------------------- ------------------------
(Dr. M. Jamil Ahmed, Prof. of Horticulture) Signature
ii. Co- Supervisor -------------------------------------------------- -----------------------
(Dr. Malik Ashiq Rabbani, PSO, PGRI, NARC) Signature
iii. Member ----------------------------------------------------- ------------------------ (Dr. Abdul Hamid, Prof. of Horticulture) Signature iv. Member ----------------------------------------------------- ------------------------- (Dr. Shahid Iqbal Awan, Assist. Prof. in PB&MG) Signature v. External examiner ------------------------------------------------------- ------------------------- (Dr. Aman Ullah Malik, UAF) Signature vi .External examiner ------------------------------------------------------ ------------------------- (Dr. Muhammad Saleem Jilani, GU, KPK) Signature
Chairman
Department of Horticulture
Dean Director
Faculty of Agriculture Advanced Studies and Semester Affairs
iv
DECLARATION
I say publicaly that, this thesis is entirely my own work and has not been presented in any way
for any degree to any other university.
May, 2018 Signature___________________ Uzma Arif
v
DEDICATIONDEDICATIONDEDICATIONDEDICATION
This dissertation is dedicated to my
Dear Father
Arif Ijaz
Ever-Loving Mother
Kulsom Arif
&
Sweet and Loving
Brothers, Sister, Sister in Law
and my
Cute Niece “Maryam”
who always
done a lot to see me
glittering high on the
skies of success
vi
CONTENTS
CHAPTER No.
TITLE
PAGE No.
LIST OF TABLES vii
LIST OF FIGURES ix
LIST OF ABBREVIATION xi
ACKNOWLEDGEMENT xiii
ABSTRACT
xv
1
INTRODUCTION
01
2
REVIEW OF LITERATURE
14
3
MATERIAL AND METHODS
48
4
RESULTS AND DISCUSSION
67
CONCLUSION AND RECOMMENDATION 150
SUMMARY 152
5
LITERATURE CITED 156
APPENDICES
182
vii
LIST OF TABLES
Table No. Title Page
3.1.1 List of pea landraces used in morphological studies 51
3.2.1 Genotypes selected for biochemical and molecular study 56
3.3.1 Layout for PCR Master Mix
62
3.3.2 SSR primers along with forward and reverse sequence used in this study
64
4.1.1 Means values of germination percentage in pea genotypes 74
4.1.2 Means values of plant height (cm) in pea genotypes 76
4.1.3 Means values of number of leaves in pea genotypes 77
4.1.4 Means values of leaf area (cm2) in pea genotypes 79
4.1.5 Means values of leaf length (cm) in pea genotypes 80
4.1.6 Means values of leaf width (cm) in pea genotypes 81
4.1.7 Means values of days to flowering initiation in pea genotypes 83
4.1.8 Means values of days to flowering completition in pea genotypes 84
4.1.9 Means values of days to pod formation in pea genotypes 85
4.1.10 Means values of number of pods per plant in pea genotypes 87
4.1.11 Means values of pod length (cm) in pea genotypes 88
4.1.12 Means values of pod width (cm) in pea genotypes 89
4.1.13 Means values of number of seed per pod in pea genotypes 91
4.1.14 Means values of 100-seed fresh weight (g) in pea genotypes 92
4.1.15 Means values of yield kg/ha in pea genotypes 94
4.1.16 Simple correlation cofficient for morphlogical traits among 75 pea
landraces
96
4.1.17 Eigen values for 15 traits of Pisum sativum L. Landraces 100
4.2.1 Means values of moisture content (%)among 46 genotypes of pea 103
4.2.2 Means values of crude fat (%)among 46 genotypes of pea 104
4.2.3 Means values of crude fibers (%)among 46 genotypes of pea 106
4.2.4 Means values of crude protein (%)among 46 genotypes of pea 108
4.2.5 Means values of carbohydrate (%)among 46 genotypes of pea 110
viii
4.2.6 Means values of ash (%)among 46 genotypes of pea 111
4.2.7 Means values of phenolics mg/g among 46 genotypes of pea 113
4.2.8 Means values of chlorophyll content mg/g among 46 genotypes of pea 115
4.2.9 Means values of pH among 46 genotypes of pea 116
4.2.10 Means values of total soluble solid (TSS) % among 46 genotypes of
pea
118
4.2.11 Simple correlation cofficient for biochemical traits among 46 pea
landraces
125
4.2.12 Eigen values for 10 traits of Pisum sativum L. Landraces 125
4.3.1 Polymorphism among pea genotypes generted by 20 primers
144
ix
LIST OF FIGURES
Figure No. Title Page
4.1.1 Dendrogram based on average linkage distance for 75 peas genotypes
98
4.1.2 Dendrogram based on average linkage distance for 15 traits
99
4.1.3 Scatter biplot diagram of 75 landraces of pea on the basis of morphological characterization
101
4.2.1 Dendrogram based on average linkage distance for 46 peas genotypes
120
4.2.2 Dendrogram based on average linkage distance for 10 traits
122
4.2.3 Scatter biplot diagram of 46 landraces of pea on the basis of biochemical characterization
123
4.2.4 Factor loadings 01 for biochemical traits of 46 pea landraces
126
4.2.5 Factor loadings 02 for biochemical traits of 46 pea landraces
127
4.2.6 Factor loadings 03 for biochemical traits of 46 pea landraces
128
4.2.7 Factor loadings 04 for biochemical traits of 46 pea landraces
129
4.2.8 Factor loadings 05 for biochemical traits of 46 pea landraces
130
4.2.9 Factor loadings 06 for biochemical traits of 46 pea landraces
131
4.2.10 Scree plot diagram of various factors 132
4. 3.1 PCR amplification products of AD51 primer among 46 pea landraces
133
4.3.1(b) PCR amplification products of AD51 (b) primer among 46 pea landraces
134
4.3.2 PCR amplification products of AA163.2 primer among 46 pea landraces
134
x
4.3.2 (b) PCR amplification products of AA163.2 (b) primer among 46 pea landraces
135
4.3.3 PCR amplification products of AA285 primer among 46 pea landraces
135
4.3.3 (b) PCR amplification products of AA285(b) primer among 46 pea landraces
136
4.3.4 PCR amplification products of D21 primer among 46 pea landraces
136
4.3.4 (b) PCR amplification products of D21(b) primer among 46 pea landraces
137
4.3.5 PCR amplification products of AD83 primer among 46 pea landraces
137
4.3.5 (b) PCR amplification products of AD83(b) primer among 46 pea landraces
138
4.3.6 PCR amplification products of AA92 primer among 46 pea landraces
138
4.3.6 (b) PCR amplification products of AA92(b) primer among 46 pea landraces
139
4.3.7 PCR amplification products of AA72 primer among 46 pea landraces
139
4.3.7(b) PCR amplification products of AA72 (b)primer among 46 pea landraces
140
4.3.8 Dendrogram based on average linkage distance of 20 SSR primers
147
xi
List of Abbreviations
Abbreviations Description AOAC Association of Official Analytical Chemist
ARA Acetylene-Reduction-Assay bHLH Basic Helix–Loop–Helix bp base pair oC Degree Celsius Ca Calcium
Cm Centimeter CF Crude Fiber CP Crude Protein CH Check DM Dry Matter D- water Distilled water dd H2O Double Distilled Water DNA Deoxy Ribonucleic Acid DNTPs Deoxy nucleotide tri phosphates
EAI Emulsion Activity Index EE Ether Extract ESI Emulsion Stability Index EST Expressed Sequence Tag GA Gallic Acid Gp Green-Pods G Gram GCV Genotypic-Coefficients of Variation g/L Gram per Litre H2O Water IRAP Inter-Retrotransposon Amplified Polymorphism 0 Absent K Potassium Kg Kilogram MDL Matured-Dry Legumes ME Metabolizablesenergy MgCl2 Magnesium Chloride mm Millimetre L Litre 1 Present N Nitrogen
xii
NaOH Sodium hydroxide NARC National Agricultural Research Centrer OM Organic Matter P Phosphorus PARC Pakistan Agricultural Research Council PCA Principal Component Analysis PCR Polymerase Chain Reaction PCV Phenotypic-Coefficients of Variation PGRI Plant Genetic Resource Institute pH Potential of Hydrogen PIC Polymorphism Information Content ppm Parts Per Million RBIP Retrotransposon- Based Insertionspolymorphism SSGL Shelf StablesGreen Legumes SSR Simple Sequence TPC Total PhenolicsContent TSS Total Soluble Solid UPGMA Unweighted Pair Group Method with Arithmetic
Averages UPOV Union for the Protection of New Varieties of Plants USDA United State Department of Agriculture UV Ultra Violet
xiii
ACKNOWLEDGEMENT
All praises and thanks are for Almighty Allah, The Compassionate, The Merciful, The
Only Creator of Universe, The source of all knowledge and wisdom, Who blessed me with
health, thoughts, talented teachers, caring brothers and sisters and opportunity to make some
contribution to already existing ocean of knowledge. I offer my humblest thanks from the core of
my heart to the Holy Prophet (Peace be upon him), who is forever a torch of guidance for
humanity.
First of all, I would like to thank my supervisor, Dr. Muhammad Jamil Ahmed, Professor
in Horticulture for accepting me as his student, for his keen interest, most valuable and inspiring
guidance, constructive criticism throughout the research work and preparation of manuscripts
and this dissertation. In general, without his help, the thesis would not have been possible to
present by now. I have learned not only science, but also the attitude of doing science from him.
I always say Thank you very much “Sir” for your unreserved and unflagging help.
I would like to express my deep and sincere gratitude to Dr. Malik Ashiq Rabbani,
Principal Scientific Officer, Plant Genetic Resources Institute, NARC, Islamabad who gave me
strong support and guidance throughout my research program.
Thanks to Syed Zulfiqar Ali Shah, Chairman Department of Horticulture for his valuable
comments, skillful suggestions and attentive teaching helped me a lot to improve my skills in
Horticulture.
Thanks to my committee members; Prof. Dr. Hamid and Dr. Shahid Iqbal Awan
Assistant professor in Plant Breeding and Molecular Genetics, who helped me a lot to finalize
this dissertation.
xiv
It is my pleasure to convey my appreciation for my best friends Andleeb Akbar, Nosheen
Kabir and Anisa Intikhab for their contributions in my study in various ways. Without their
support and encouragement, this dissertation would not have been possible.
I present my special thanks from core of my heart to Aqsa, Saba, Rida, Zeeshan, Sohail
bhai, Ishaq bhai, Ilyas bhai, Nazma and Maryam for their various help
in completing the research work. I am highly appreciative to all my colleagues and well wishers
for their support, constructive criticism and friendly behavior, they rendered during the whole
span of this study work. I will remember their cheerful company, immeasurable support and help
throughout my research program.
Special thanks for My Dear Brothers Azhar Arif, Ayaz Ahmed Arif, Fayyaz Ahmed
Arif, Loving Sister Aasma Arif, Sister in Law Samina Farooq and cute niece Maryam who had
never left me to walk alone in this journey of seeking knowledge. Thanks for their constant love
and support to help me walk through a lot of frustrations.
Thanks also to my lab members for helping me in many ways during my research.
My Special Prayer for my Grand Parents, whom I miss a lot because they are no more
with me but their prayers for me had never left me alone or felt me discouraged at any moment.
(May their souls rest in heaven Ameen).
Last but not least, I offer my gratitude and prayers to affectionate parents (May they live
long), who inspired me to higher ideals of life and sacrificed their comforts for my brightest
future. Whatever I am today could never have been without their efforts, prayers, good wishes
and sympathetic attitude.
Uzma Arif
xv
ABSTRACT
Study0for the0morphological, biochemical0and molecular characterization0of
summer grown pea landraces to select high yielding landraces for future commercial
production was conducted at experimental farm of University of the Poonch
Rawalakot, Food Technology Laboratory and Plant/Genetic/Resource Institute (PGRI),
National0Agriculture Research/Center (NARC)/Islamabad, during the year 2015 and
2016. The seeds of seventy-five landraces of pea were collected from four districts of
Azad Jammu Kashmir (Poonch, Bagh, Sudhnoti, and Mirpur) and NARC,
Islamabad. Most of the characters revealed significant differences among important
agro economic traits. Correlation1coefficients computed0among all0the quantitative
traits1revealed that0yield was showed0maximum positive0and highly significant
correlation with seed weight (g) (1.000). Pod length was showed maximum positive
and highly significant correlation with seed weight and yield (0.912). Based on
average linkage distance between genotypes, computed from morphological data,
following genotypes showed maximum variability, Meteor, L-10, L-50, L-57, L-
34, M-07, L-47, M-86, M-83, L-33, L-24, L-71 and L-64. Cluster based on
biochemical analysis revealed that maximum variability was contributed by
carbohydrates and total soluble solids, while genotypes L-13, L-21, L-25, L-7,
L19, L-27, L-31, L-32, L-34 and L-26 were also diverse and contributing
maximum toward variation. Dendrogram constructed on the basis of molecular
studies revealed these genotypes M-39, L-29, L-32, L-1, L-5, L-8, L-11, L-24, L-
19, L-17, L-25, L-23, M-102 and M-83 showed maximum diversity. Out of 20
amplification product scored, 595 were found out of which 357 were monomorphic
xvi
and 257 were polymorphic. PCA for morphological, biochemical and morphological
studies revealed 79%, 77% and 74%, respectively. Based on the results computed
through morphological, biochemical and molecular studies, it is clear that the present
germplasm has a rich source of variation. These genotypes0can be used in1future for
breeding/and producing high yielding/cultivars for off season growing of peas.
1
Chapter 01 INTRODUCTION
Pea (Pisum sativum L.), a leguminous crop, belongs/to family Leguminoseae. It
has an important ecological advantage because it contributes to the development of
low-input farming systems by fixing atmospheric nitrogen and it serves as a break
crop1which/further0minimizes/the/need0for externals1inputs. Legumes1constitute the
third/biggest group of flowering-plants, involving in excess of 6500genera and 18,000
species (Lock et al., 2005). Economically, legumes-represent the second most the
second0most essential-group of0crop1plants after/Poaceae (grass/family), representing
around1approximately 27% of the world's crop production (Graham and Vance, 2003).
Peas contain higher amount of protein1having fundamental1amino1acids0especially
lysine (Nawab et al., 2008).
1.1.1 Origin and Domestication
The origin0and0progenitors of Pisum sativum are not0well1known. The
Mediterranean1region, western1and central1Asia and/Ethiopia have1been indicated/as
centers-of0origin. Recently1the Food0and Agriculture/Organization (FAO) designated
Ethiopia1and western1Asia as centers of/diversity, with secondary1centers in/southern
Asia1and the Mediterranean/region. Archaeological1evidence of/the use/of/peas/dating
from080001BC has1been found/in the Fertile1Crescent. The first1cultivation/of 1peas
appears to have been in western Asia, from where it spread to Europe, China and India.
In/classical1times, Greek and Roman1authors mentioned1its cultivation as a pulse1and
fodder1crop. Pea0was already1known in the mountain0regions/of/Central/and/East
Africa1before the0arrival1of the Europeans1and was a0well-established/and/important
2
food0crop in Rwanda1and southwestern0Uganda/by 1860. The0use1of the/edible/pods
was/first described/in/the Netherlands0and France0during the/16th0century, whereas, the
use/of0immature0seeds1as/a/vegetable0began in0Europe a century1later. At1present,
Pisum0sativum is found9in all0temperate/countries and in most/tropical/high- lands. In
Africa, garden0pea/and sugar1pea/are/mostly0considered/exotic/products. Those are
originally/of/some/importance, sugar/pea/2 more/in/Francophone countries, garden pea
more0in Anglophone0countries. Imported canned garden pea seeds are available
everywhere0in food0shops. Pea (Pisum0sativum L.) is/one0of the0world’s0oldest
domesticated1crop. Its zone of origin and initial domestication lies in the
Mediterranean, essentially in0the Middle0East. Before development, pea’s0together
with0vetches and0chickpeas were part0of/the/everyday1diet/of0hunter-gatherers toward
the0end/of0the last0Ice-Age0in/the/Middle0East and0Europe (Ambrose et al., 2011).
The range1of wild1representatives of P.0sativum stretches out from0Iran/and
Turkmenistan0through1Anterior/Asia, northern0Africa and/southern/Europe. In any
case, because of the early development/of0pea it0is difficult0to distinguish the exact area
of the center of its diversity, especially considering that large parts of the
Mediterranean1region and/Middle1East have0been substantially1modified by1human
activities1and changing1climatic-conditions. In addition, reliable1and thorough
passport0data are/often missing0or0incomplete for/the early/accessions0that0were
collected. The genus0Pisum contains0the wild0species P. fulvum found in0Jordan, Syria,
Lebanon0and/Israel; the cultivated1species P./abyssinicum0from Yemen1and1Ethiopia,
which1was likely domesticated1independently1of P. sativum and a large1and1loose
3
aggregate of both1wild (P./sativum0subsp./elatius) and cultivated forms0that0comprise
the1species P.0sativum in/a broad1sense (Ambrose et al., 2011; Ellis et al., 2011).
1.2. Morphology and Genetics of Pea
Pea0is one/of/the prominent winter vegetables grown in Pakistan. P. sativum is
an annual plant, with0a life0cycle/of one0year. It/is/a cool-season0crop/grown0in many
parts0of/the0world; planting0can take0place from/winter0to/early0summer, depending0on
location.0The plant is a diploid (2n=14). Flowers are fundamentally self-pollinating,
which0empowers reproducers to0make true0breeding/lines (Gill and Vear, 1980;
Hancock, 2004). Peas0are adapted0to numerous kinds of soil1types, but perform0best
on0fertile, light-textured, well-drained0soils (Hartmann et al., 1988; Elzebroek0and
Wind,02008). Peas0are sensitive0to soil0salinity and0extreme0acidity. The ideal0soil0pH
range0for/pea0production is/5.5 to 7.0 (Hartmann0et al., 1988). According to Janzen/et
al. (2014), pea0can fix0atmospheric/nitrogen through0symbiosis and/therefore does/not
need/nitrogen/fertilizer particularly since0it provide0nitrogen for0the crop0following it.
Pea also0tolerates drier0growing season0conditions and/limited0rainfall.
Pea1is a cool-season annual1vine that is1smooth and has a1bluish-green1waxy
appearance. Vines/can be/up to/9 ft/long, however/modern cultivars have shorter vines,
about/2 ft/long. Stem1is hollow1and/the/taller1cultivars cannot climb1without1support
(Elzebroek and Wind, 2008). Peas1have required1a1cool, relatively0humid/climate0and
are/grown0at/higher0altitudes/in tropics0with/temperatures from 7 to 30°C (Duke, 1981;
Davies, 1985). As a1winter1annual, pea1tolerates1frost1to -2°C at the1seedling1stage,
although1top growth1may be0affected/at -6°C. Winter0hardy peas0can withstand -10°C
and/with1snow cover0protection, tolerance1can be1increased to -40°C (Slinkard/et al.,
4
1994). Before blooming, crop can withstand some frost but flowers and pods are
susceptible to freezing temperature. A regular water supply promotes high yield but
excessive0rainfall induces0root rot (Hussain and Badshah, 2002).
1.3. Production and status of Pea
Pea is cultivated during winter in plains and during summer in highlands. In
Pakistan, pea/is an1important1crop, which plays a major r0le in farmer's econ0my. It is
cultivated1under an1extensive1range of agricultural1regions, but the1average yield per
hectare1is very1low as1compared to its1potential and yield1obtained in many1other
countries. Pea was1planted1about 45.4 th0usand/hectares/with/t0tal/producti0n of 29.8
thousand1tonnes of dry1peas (MNFSR, 2017). Pea/is/an/important/crop, which/plays a
major1role in1farmer's-economy. It is the1most1common1crop and enjoys1a great
commercial demand due to its nutritive value (Habib and Zamin, 2003). It represents
ab0ut040% of/the t0tal trade1in1pulses. In Pakistan, it is cultivated0below a wide range
of agricultural1regions, but1the average1yield per1hectare is quite1low as compared to
its potential1and yield1obtained in several1other1countries. In 2011-12, the crop was
grown over an1area of 15.8 thousand1hectares with0105 thousand1tones production0of
green0pea and average0yield was 166 mounds ha-1 (Anonymous, 2012).
Dry1pea is produced1in more than 87 countries1worldwide with1around one-a
large portion of the world's production occurring in Canada, France, China and Russia.
Other1leading pea1producing1countries include India, Germany, Australia, United-
Kingdom and United1States. Among1legumes, pea is a1critical product1with a rich
history in hereditary research going back to the traditional work by the father of
genetics, Gregor J. Mendel. It is grown1on an area of 528.71 thousand1hectares in
5
world and ranks fourth in production (441.530thousand0tons) among grain legume
after0soyabean, groundnut0and beans (Ashraf et al., 2011).
Though1the ancestral1pea/is0extinct, c0nsequent/wild0pea varieties0still exist in
the Middle1East (Weaver, 2003). As a rich1source of1proteins, carbohydrates1and
vitamins, peas are1important in0human nutriti0n. Consumed mostly as green peas, total
production/worldwide/is around 9.3 million tons. Pea is one1of the/6 major pulse crops
cultivated1globally1and is the second1highest yielding1legume in the world2after
common bean (Phaseolus vulgaris L.) Average green pod yield/of/peas in Pakistan is
quite2low (7.2/t/ha) compared1to that of several1other1countries. Dry pea1currently
ranks-second only-to common1bean as the most1widely grown1grain legume0in the
world0with primary1production in temperate1regions and global1production of 10.4 M
tones (FAO, 2016).
1.4. Nutritional Importance
Pea0seeds/are/rich0in protein (23–25%), slowly0digestible0starch (50%), soluble
sugars (5%), fiber, minerals1and-vitamins0(Bastianelli0et al., 1998). On an1overall
premise, vegetables contribute around 33% of mankind's immediate protein
consumption, while0additionally0filling in as an essential0wellspring of9grain and
scavenge-for creatures/and0of palatable0and mechanical0oils. One0of the most0important
attributes of legumes is their capacity for symbiotic nitrogen fixation, underscoring
their importance as a source of nitrogen in both natural and agricultural ecosystems
(Phillips, 1980). Legumes1also1accumulate1natural1products (secondary0metabolites)
such as iso-flavonoids that are considered helpful to human/health through anticancer
and1other0health-promoting0activities (Sumner and Dixon, 2003).
6
The fat9substance1of beans, peas, and lentils is generally very low, and there is
no0cholesterol. Protein0content is-high, more-than the amount of protein that is found in
cereal9grains (USDA 2015).
Another0imperative0segment of beans, peas, and lentils-is fiber. Fiber is a part
of plant1foods that0cannot0be1digested. Beans, peas, and lentils-have about 7 g of
dietary9fiber in a 1/2-cup serving and are particularly high in insoluble-fiber. Insoluble
fiber1bulks stool1and decreases transit1time through1the colon, thereby1preventing
constipation. The soluble fiber in beans, peas, and lentils is very fermentable in the
colon, which is1thought to being1health1enhancing. However, fermentation1also
produces1some gas (flatulence) that may cause1discomfort for some1individuals.
Enzyme preparations containing alpha-galactosidases may prevent some of the gas
production. Beans, peas, and lentils-are additionally-rich sources of some vitamins and
minerals, such as1folate, iron, potassium, and magnesium (USDA 2015).
The dietary0fiber found9in beans, peas, and lentils1may help to1reduce the
danger1of specific kinds0of cancer (Dahl et al., 2012). Beans, peas, and lentils-also
contain significant levels of antioxidants /and photochemical, which are substances
related1with preventing chronic diseases like1cancer (Sanchez-Chino et al., 2015). Pea
has also1been a model1system in plant/biology0since the work0of Gregor Mendel (Ellis
et al., 2011; Ross et al., 2011). Fundamental0discoveries1of Mendel1and1Darwin
established/the scientific1basis/of modern1plant-breeding in the1start of 20th century.
Similarly, current-progress in molecular1biology, genetic1and biotechnology1has
revolutionized plant breeding, allowing a shift toward molecular plant breeding and
adding to its interdisciplinary-nature (Mumm and Moose, 2008). In any1case, in spite
7
of the fact that the1techniques have been accessible for over 10 years, there is as yet an
extensive-gap0between/plant0biologists/engaged0in basic0research and plant0breeders.
1.5. Uses of Peas
Pea is a multipurpose crop, used for its chemicals, aesthetic value, forage crop,
pasture1crop, cover crop, green-manure, for feed and food (Nisar et al., 2007).
Recent studies have highlighted the potential health benefits of pulses in human
diet/including1a/reduced/risk/of/type II and cardiovascular1disease (Boye et al., 2010).
An increased demand for protein-rich food and feed has directed to renewed
commercial1importance in/pulse/crops/as a protein1source (Santalla/et al., 2001).
Field peas are principally1utilized for human1consumption or as0domesticated
animals feed. It is a major1source of0proteins (20 to025%) and potential1alternative to
soybean in1Europe (Barac/et al., 2010). It contains1high-levels/of1carbohydrates/and
total0digestible1nutrients (860to087%), which0makes it0an excellent1livestock feed
(Enderes0et al., 2016). Peas0are full0of nutrition1because its9grain-is rich in1protein
(27.8%), complex carbohydrates (42.65%), vitamins, minerals, dietary fibers and
antioxidant1compounds (Urbano/et al., 2003).
Peas are cultivated1for the/fresh/green/seeds, delicate1green-pods, dried/seeds
and0foliage (Duke, 1981). Green0peas are0eaten-cooked0as a/vegetable, and are
marketed0fresh, canned, or0frozen while/ripe-dried/peas are used/whole, split, or made
into0flour (Davies0et al., 1985). Green foliage of garden/pea is additionally1utilized/as
vegetable1in parts/of/Asia and/Africa. A few cultivars1are developed for their-delicate
green pods, which are eaten cooked or raw. Oil from matured seed has
8
antisexhormonic impacts; produces sterility and antagonizes effect of male hormone
(Duke, 1981).
Peas is either eaten as a vegetable1or utilized1as a part of the preparation of
soups. Also, it is also-used as animal1feed. Kevin McPhee, (2003) has revealed1that
pea-seed is exceedingly1nutritious and around a large-portion of the world1production
is fed to livestock1while the rest-of the bit is utilized for human-nourishment, basically
in developing1counties.
Increasing1demand of1protein-rich1raw-materials1for feed and food has led to a
greater1interest/in this1crop as1a protein1source (Santalla et al., 2001). It/is a/cheap
source1of protein that is known as poor-man meat in the developing1world and used in
rotation1with cereals1and oil seed0crops. It/provides balance0diet in-combination/with
wheat, rice/and other/cereals. Another1product/is prepared/by finely1grinding the/peas
and extruding1them under/pressure to create/different1shapes. The different/shapes are
then/fried, seasoned and packaged (Jambunathan et al., 1994). Seeds are thought to
cause dysentery1when eaten raw. In Spain, flour is considered/emollient and/resolvent,
applied as a cataplasm. It has been reported that seeds contain trypsin and
chymotrypsin which could be used for contraceptive, ecbolic fungistatic and
spermicide (Duke, 1981). Smart (1990) reported that there are no significant1amounts
of toxicity1or anti-metabolites in peas.
Protein0convergence of0peas ranges from015.5-39.7% (Davies0et al., 1985;
Bressani0and0Elias, 1988). Fresh0green-peas0contain per0100 g: 440calories, 75.6%
water, 6.20g/protein, 0.40g fat, 16.9 g carbohydrate, 2.4 g crude-fiber, 0.9 g ash, 32 mg
Ca, 102 mg P, 1.2 mg Fe, 6 mg Na, 350 mg K, 0.28 mg thiamine, 0.11 mg riboflavin,
9
2.8 mg niacin, and 27 mg ascorbic acid, while dried-peas contain: 10.9% water, 22.9%
protein, 1.4% fat, 60.7% carbohydrate, 1.4% crude-fiber, and 2.7% ash (Duke, 1981;
Hulse, 1994).
1.6. Landraces
Landraces are the major-source to cope the recent1problems (Zeven, 1998). Global
seed companies are providing new cultivars with high and uniform production,
significantly with reference1to maturity and seed size. These motives1mainly started
replacement1of landraces by these-cultivars, leading to landraces-erosion. Therefore,
identification and preservation of these landraces as genetic resources is most
important for the1future (Lioi et al., 2005). Still1no well-defined-variety has been
developed and provided1to the farmers by exploiting the natural-diversity (Landraces)
of the crop within Azad Kashmir. The proper0understanding of0genetic diversity0among
the0genotypes which0are already0adaptable to local0conditions is pre0requisite of0any
breeding1program of any1crop (Graham and Ranalli, 1997).
1.7. Molecular Markers
Molecular markers, based on polymorphism of DNA sequences, provide
information, which are independent of environmental conditions or the plant
development1phase. Several1methods, such0as/isozymes, restriction0fragment0length
polymorphisms/(RFLP), randomly0amplified polymorphic0DNA (RAPD), amplified
fragment1length0polymorphism (AFLP) and0SSR (simple/sequence/repeat) have/been
used0in the0analyses of/pea0genetic0diversity. Applicability0of SSR0markers in/plant
organisms0has been confirmed0for pea/corn, soybean, rice, barley, wheat etc. In/pea,
SSR1markers were/used/to/assess genetic/diversity (Baranger et al., 2004; Taran et al.,
10
2005) in evolutionary-studies (Ford et al., 2002) and to map locuses responsible for the
resistance0to diseases1or another0important1traits (Loridon et al., 2005).
Marker-assisted selection (MAS) may contribute to improve these complex,
polygenic1traits and9reduce/the need/for costly1field selection1trials. However, the
identification of quantitative trait0loci0(QTL)0and0linked0markers0exploitable0for
selection0is hindered1by the/fact that/the pea0genome is very0large (Ellis0&/Poyser
2002) and0not yet0sequenced.00,Several0pea0molecular linkage maps0have0been
constructed by integrating different types of markers, such as RFLP, AFLP, STS, SSR,
RAPD and/or CAPS. Taran et al. (2005) used AFLP, RAPD, STS, CAPS and ISSR
markers0to localize0QTL for yield components0and protein0content of two0sets of
recombinant/inbred/lines (RIL), reporting0loci/with consistent0or inconsistent0effects.
Single0nucleotide/polymorphisms (SNP) have0now become/the preferred/markers/due
to0their abundance0and uniform0distribution1throughout genomes1as confirmed by
molecular1linkage maps-produced. However, investigations0on the linkage1of SNP
markers with pea production, phenology or grain quality traits are relatively few
Burstin/et al. (2008) and/the/QTL/ability/to explain0sufficient phenotypic/variation/for
use in MAS is0controversial. One reason for that is the complex0and polygenic control
of/most/of these0traits, which/results/in/only moderate0cumulative QTL/effect.
Among0the0most broadly used0markers in crop0species are simple0sequence
repeats (SSRs) or0microsatellites (Blair0et al., 2007; Sarıkamiş0et al., 2009). They/are
highly reliable because they are reproducible, co-dominant in inheritance and
exceptionally highly polymorphic. In any case, SSR markers require a substantial
11
investment0of time and money to1develop, and henceforth, sufficient numbers for
high- density0mapping are not accessible for some crop-species.
1.8. Diversity
Envisaging the importance of this crop, there is a requirement for
improvement and to develop varieties suited to specific agro-ecological
conditions and also for specific end use. Genetic diversity is a important factor
that/determines/expectation of yield0improvement in0future. Knowledge0of0genetic
diversity within a crop and correlation among the yield contributing characters is
fundamental0for the0long-term/prevalence0of a breeding0program and maximizes0the
investigation/of germplasm-resources (Rahman et al. 2014). In order-to enhance yield,
genetic variability is the main factor since it is the source of variation and raw material
for yield0advancement0work (Mahbub/et al., 2015). Moreover, evaluation0of genetic
diversity is important to identify the source of genetic materials for an
individual trait within the available germplasm. Diversity analysis acts as an
effective tool to identify the degree of divergence among the biological materials
at genotypic level and to determine the relative contribution of various components to
the whole0divergence both0inter and0intra cluster/levels (Mahbub et al., 2016).
Rawalakot is a0sensational-city located in Azad-Kashmir, offering semi-tropic
flat area0of ground due to its upward0altitude. Rawalakot climate0restrain hot1and
moisture in summer-season, while at the same-time distant and cool in winter-season.
The temperature might rise up to 38 0C or 100 0F in the mid summer season and may
fall1down lower than -3 0C or 27 0F in the winter0season. Average-rainfall1during the
year 2018 was 983.19 mm.
12
Cultivars perform differently under various agro-climatic conditions and
different0cultivars of same0species grown0even in same condition and0environment
often have yield differences. Yield and quality of crop are very complex
characteristics0depending on certain biological0alignments between0environment and
heredity. The characteristics of a cultivar as well as combination of traits differ
according0to climatic0conditions of the0localities (Khokar/et al., 1998). Unimproved
varieties, local populations, show high degree of genetic diversity, thus, great
differences0occur0with respect to morphological0traits, time0to maturity, pod/size and
type, seed attributes, and yield (Santalla et al., 2001). These properties can be
improved0by selection0so0that yield0performance0can be increased. Pea crop has
promising future and attempt should be made to improve yield through the
development of high yielding landraces which are adaptable to local climatic
conditions.
Growing0vegetables during the0off-season has a lot of prospect0for export as
well as a good1earning by the1farmers. Among different-offseason vegetables, pea
(Pisum sativum L.) has prime importance as its demand1persists throughout1the year.
To the best of the authors’ knowledge, pea genotypes were never screened during
summer-season in agro-climatic-conditions of Rawalakot.
Keeping1in view the importance0of pea-crop and the importance of its genetic
diversity, the available1germplasm was evaluated1for economically important-traits,
phenotypic elaboration and their further utilization in the breeding programs. The
current study/was designed to/select some-morpho-physiological and yield0parameters
13
responsible0for higher yield of peas that could be helpful to0develop high1yielding off
season varieties in future.
These studies0were carried with following0objectives:
• To evaluate the landraces of pea cultivated in Azad Kashmir at morphological,
biochemical and molecular levels.
• To investigate genetic diversity through physico-chemical traits and SSR
markers.
• To identify suitable and high yielding summer landraces of pea to be used for
further crop improvement.
14
Chapter 02
REVIEW OF LITERATURE
2.1. MORPHOLOGICAL STUDIES
Fie1d0Pea (Pisum sativum L.), a commercia11y0imp0rtant crop0for food0and feed,
be1ongs0to fami1y0Fabaceae (former1y Leguminosae), sub0fami1y Papilionoideae. Fie1d
pea, c1assified0as Pisum sativum L. is a0coo1-season01egume or pu1se0crop. Pea is one of
the wor1d’s0o1dest0crops, cu1tivated as0ear1y as 9,000 years0ago. The adaptive0behavior
of exotic0pea (Pisum sativum L.) varieties0under 1oca10condition of Peshawar0studied
by Hussain0and Badshah, (2002) and found0that “C1imax” produced0more/number0of
pods0per0p1ant (19.3) whi1e01ess number0of pods/per0p1ant (13.8) was obtained0in P-42.
Variety C1imax out yie1ded fundamenta11y (5290.1 kg ha-1).
Agronomic0eva1uation/of0crop is important0for detecting0genetic/variabi1ity0and
for0genetic/improvement0of any crop0species. Performance0of nine pea0cu1tivars i.e.
AM-I, Samrina Zard, 226-Y/B, P-48. O1ympia, P-42. Meteor, Knight and P-I was
checked0under/Faisa1abad0conditions. Numerous0quantitative-attributes0qua1ities, for
examp1e, seed germination, p1ant height at the time of first f 1owering, fina1 p1ant
height, number0of 11eaves0p1ant-1, number0of days taken0to first0f1owering, number0of
pods per p1ant, pod 1ength, green pod weight, number of seeds per pod, green pod
yie1d and crop duration were examined. Every one of the parameters had all the
earmarks of being abso1ute1y hereditary characters, in 1ight of the fact that the
cu1tivars possessed high1y significant-difference among them, with the exception of
seed germination, which re1ies on physio1ogica1 period of seed at harvesting and
subsequent hand1ing, and crop duration which was significant on account of other
15
quantitative0characters. The cultivars0Knight, Meteor0and Samrina0lard followed0by
Olympia0were found high0yielding when compared0with different cultivars0due to their
ability0to create the higher0green pod0yields, while the performance0of AM-I and P-48
was poorer (Amjad0and Anjum, 2002).
Some morphological characters such as main stem length (cm), number of
branches per plant, leaf length (cm), number of leaves per main stem, number of
leaflets0per-leaf, diameter0of main0stem (mm), pods0main-stem-1 and seeds0pod-1 as
well as0agricultural-herbage0yield (t ha-1), dry0matter0yield (t ha-1), seed0yield (t ha-1),
crude0protein (%) were investigated0in Turkey, during the 1999-2002. The maximum
main0stem-length (124.38 cm), leaf0length (24.80 cm), number0of pods per0main stem
(16.53), herbage0yield (27.88 t ha-1), dry-matter0yield (7.32 t ha-1) and seed0yield (2.59
t ha-1) were determined0from the 16-K and 16-DY field pea0lines. K line has given
higher0values than four0lines for the number of0branches per-plant (5.57). Main0stem-
diameter ranged from 3.07 to 4.30 mm. Leaves/ main-stem (23.02), leaflets/leaf (6.83),
seeds/pod (7.69) and crude 0protein (17.55%) were noticed0in case of0various-pea0lines
(Tekeli and Ates, 2003).
Another study conducted0by Atta et al. (2004) to revealed0that pea seed0protein
content (SPC) and seed dry weight (SDW) are both impacted by hereditary and
ecological0factors or variables. To0assess the differences0of these within-plant0traits
between0seeds, six0genotypes were tried. The sequential0seed development at0nodes
along the main stem was determined. Nitrogen fixation was measured by the
acetylene0reduction0assay (ARA). At0maturity, protein0content and dry0weight were
measured according to seed position on the plant. Individual protein content were
16
determined by near-infrared0transmission0spectroscopy. The outcomes demonstrated a
critical0difference in protein0content between nodes0of the0genotypes Solara, L765 and
L833. Protein0content tended to0diminish from0the base to0the top0of the plant0for these
genotypes. The distinction0in protein0content between the0lowest and the0uppermost
node was around026 g kg–1 for0Solara, 40 g kg–1 for L765 and 49 g kg–1 for0L833.
There were likewise0critical differences0in dry-weight0between plant0nodes for0all
genotypes, aside from0Finale. Also, the trange0of difference in dry0weight between
plant0nodes was higher0than that0for protein0content.
Genetic0variability and character0association in 26 advanced lines of0vegetable
pea (Pisum sativum L.) in view of eight characters. The field experiment was
conducted at the research0farm, Bangabandhu0Sheikh Mujibur0Rahman Agricultural
University, Gazipur, Bangladesh. Analysis0of variance showed0significant differences
among0the genotypes0for all0characters. Phenotypic0coefficients of0variation (PCV)
were close0to genotypic0coefficients of0variation (GCV) for0all the parameters0except
branches per0plant, seeds per0pod, pods0per-plant, 100-seed0weight and0seed yield0per
plant. High0heritability related with0high hereditary progress was watched for0plant-
height, pod0length and seed yield per0plot. Critical0positive genotypic0and0phenotypic
relationship0between's seed yield0per plant and0days to 50% harvest, pod0length, pod-
breadth and0seeds per0pod were watched. Path0coefficient analysis0revealed that0days
to 50% blossoming, days0to 50% harvest, number0of branches per0plant, pods0per-
plant, seeds-per0plant and 100-seed0weight had positive0direct impact0on seed0yield
per0plant (Siddika et al., 2007).
17
The effect of agro-management0practices like, irrigation0and nutrition0on0two
pea (Pisum sativum L.) cultivars0named Climax and Meteor was studied at
Horticultural1Research0Area, U.A.F. Growth0parameters like0Main-stem0length (cm),
number0of leaves per0plant, leaf0Area (cm2), number of0pods per0plant, length of0pod
(cm), number0of seeds per0pod and reproductive0attributes like01000 seed0weight, seed
yield/hectare were contemplated. Climax gave maximum0seed0yield (2.24 tons) as
compared0to Meteor0with 2.33 tons0ha-1seed0yield. Irrigation0up to0seed0filling + P120
kg ha-1+ K100 kg ha-1 (T3) showed0better-performance0for vegetative0and0reproductive
parameters0comparatively most0astounding seed0yield 2.63 tons0ha-1 were found in T3
for0the two0cultivars of0pea when0contrasted with different0combinations (Ashraf et al.,
2011).
Gatti et al. (2011) characterized 13 accessions0of dry peas0of different0origins
from various growing regions in Argentina with the target of choosing those with
positive0qualities for0use in breeding0programs. Significant0differences were found0for
length0and width0of stipule and0pod, length0of the0internodes and0leaflets, plant0height,
total0number of0nodes, number0of nodes0at the first0pod, number0of days to0flowering
and0to harvest, number0of0pods and0seeds per0pod, 100-seed0weight and0grain
diameter, exhibiting a0high level0of hereditary0fluctuation. Phenotypic0relationship
examination exhibited that large pods delivered more seeds per pod, but the seed
weight decreased. Assessments0of genotypic0correlation-coefficients showed a0solid
natural0relationship among0the distinctive0attributes. Clustering0methods grouped0the
accessions into five0clusters. Cluster05 included0two-accessions0and demonstrated0the
most0astounding esteems0for length0and width0of0stipules (4.9 and 4.5 cm,
18
respectively), length0of0leaflets (7.43 cm) and0days to0flowering (122.6), while0cluster
3, with one accession, and cluster 4, with two accessions, demonstrated the most
noteworthy0esteems for0number of0seeds-per0pod (3.78 and 4.39), number0of pods0per
plant (5.330and05.70), length0of0pods (5.540and 5.720cm), and0width of0pods (1.210and
1.200cm, respectively). They presumed that0clusters 3 and 40would be helpful0for
crosses0with different cultivars0in pea breeding0programs.
An analysis was led on0botanical-characteristics0of chickpea0genotypes (Cicer
arietinum L.). In the0exploration, plant0height, first pod0height, number0of first0branch,
number0of second0branch and stem0diameter varied0between 38.330to 47.730cm, 23.87
to 34.270cm, 2.070to 2.800number0plant-1, 0.730to 2.030number0plant-1 and 4510to0584
µm, respectively. Results0demonstrated0that0genotypes were essentially0differing in
plant height and stem diameter while no significant differences were resolved in
alternate0parameters-measured (P < 0.05) (Cokkizgin, 2012).
The study was design0to screen the pea0material collected0from 61 different
locations0in order0to assess yield0and its0contributing traits (Mustafa et al., 2012). They
identified remarkable varieties with best traits and said that Avcilar and Ortakent
ecotypes0could be considered0for varietal0development as theses0ecotypes were high
yielding.
The performance0of 13 peas0genotypes for0higher-yield0and drought0tolerance
under0rainfed0conditions was studied by (Khan et al., 2013). Their0outcome
demonstrated0that in most0extreme case0yield was noted0in 2001-55 (10.43 t/ha) and
genotype 2001-55 exceeded expectations in number of seeds per pod (8.56) and pod-
length (9.330cm) while highest plant0height was seen in0Shareen (125.7 cm). Most
19
extreme 100-seed fresh0weight (49.50 g) was noted in0FS-21-87. Toward0the end they
suggested0genotypes 2001-550and FS-21-870for further0evaluation.
Likewise, Tolessa et al. (2013) assessed fourteen0field-pea0genotypes at 16
environments0in Ethiopia. Genotype × environment0interaction and yield0stability were
assessed0utilizing the additive main effects and multiplicative0interaction and site
regression0genotype plus0genotype × environment- association biplot. Pooled
examination0of fluctuation for0grain yield indicated significant (P<0.01) differences
among0the0genotypes, environments0and the0genotype × environment0interaction
effects. This demonstrated0that the genotypes0differentially reacted0to the changes in
the test0environments or the test-environments0differentially separated by the
genotypes0or0both. No single0assortment demonstrated0superior performance0in every
one0of the situations0however0genotype EH02-036-2, trailed by Co ll.026/01-4,
exhibited0top positioning0at five of0the sixteen0environments.
Another0analysis was directed0to assess the chick-pea-varieties for0yield
performance and adaptability under research and farmer managed conditions and
assess0farmer’s0preferences. Five0varieties Arerti, Shasho, habru, chefe0and0Dz-10-4
were planted0on 4.8m20plots0at spacing0of00.1m×0.3m. The0varieties Arerti0and0Habru
were selected0both by Researcher0and farmers0because of0its large seed0size, long0pod-
length, number of pod0per-plant, earliness0in maturity0and high0yield. The0best
yielding0varieties Arerti and Habru delivered01358.850kg ha-1, 1326.840kg ha-1 of
grain, 39.2 %0and 35.9%0more than0the standard0check (Dz-10-4), respectively at0on
farm0trials. Likewise more0than two0stations 1630.750kg ha-1, 1542.20kg ha-1 of0grain,
45.6 % and 37.7% more than Dz-10-4 was recorded by those two best yielding
20
varieties. It is therefore0recommended that0Arerti and0Habru which0had higher0yields
be adapted for cultivation in the study area and similar agro ecological zones of the
south0Ethiopia (Goa, 2014).
The objective0of this investigation was to0examine the genetic0diversity exhibit
in twelve Algerian pea genotypes utilizing 240agro-morphological0traits. The
experiment was done0in three growing0seasons (2013 to 2014, 2014 to 2015 and 2015
to 2016). ANOVA analysis revealed the presence of hereditary fluctuation for all
characters0contemplated. Additionally, expression of characteristics is very affected0by
the0environment. For0quantitative0traits, correlation studies showed that weight of 100-
seeds was significantly and0positively-correlated0with leaflet0length. Number of0pods
per 1 m² has a positive0significant-correlation0with leaflet-width. Weight of0pods-per 1
m² was correlated0with three0characters: Stipule0length, leaflet length and leaflet-
width. The principal component analysis revealed that three components clarified
85.92% of0variation. Two0groups were noted0by0dendrogram. The first0group (demchi
1, p069, bouch1, p539, p593, p595 and p596) was characterized by a high pod0yield;
the other0group comprises0the less productive genotypes (p071, sefrou, p072, p073 and
p350). Something else, the genotype p593 produced the best results for pods yield
(Ouafi et al., 2016).
21
2.2. BIOCHEMICAL STUDIES
Pea (Pisum sativum L.), faba bean (Vicia faba L. spp. minor), and lentil (Lens
culinaris Medik.) meals, protein-concentrates0and-isolates were analyzed for
proximate composition, oligosaccharides, and amino acid composition. Protein
quality was evaluated1using a mouse-bio-assay. The concentrates contained 59.2 to
70.6% and0the isolates086.7 to 90.8% protein (N × 6.25) on1moisture-free0basis.
Glucose, sucrose, raffinose, stachyose and verbascose were present in the highest
concentrations in the protein concentrates (7.1 to 11.1%), the pea protein concentrate
contained 8.7% sugars0and0faba0bean0and0lentil0protein0concentrates 7.1% and 6.6%
respectively. The protein isolates were almost free (containing less than 0.79%) of
the sugars. Amino acid0composition0of the0meals, concentrates0and isolates0showed,
as expected, sulfur-amino0acid deficiency, which was probably0largely0responsible
for1the0low0protein0efficiency0ratios (0.75 to 1.18), and net protein ratios (0.25 to
0.73) of the three products, compared to values of 2.56 and 2.18n respectively
obtained for casein. The protein0digestibility0of0the0meals, concentrates0and0isolates
(81 to 90%) were similar to that of0casein (87%). The poor0growth-promoting
abilities0of1the0meals, concentrates0and0isolates0were possibly-also0due0to0growth-
depressing factors0such as0tannins, trypsin inhibitors0and0hemagglutinins0present,
particularly0in0faba0bean0and0lentil (Bhatty and Christison, 1984).
The performance of twelve0pea0cultivars (yellow-, green- and0brown-seeded)
that were evaluated for chemical composition and digestibility in poultry studied by
(Igbasan et al.,1997). The evaluation involved analyses for protein, amino acids
(AAs), fat, starch, dietary fibre, ash, calcium, phosphorus and tannins. True
22
metabolizable0energy [nitrogen corrected (TMEn) and uncorrected (TME)] and true
AA bioavailability values were also determined with adult cockerels. The cultivars
demonstrated an extensive variety of0protein (207.5– 264.00g kg– 1) and0starch (385.3–
436.80g kg– 1) substance which were not identified with the seed coat colours. The
concentrations0of0several0AAs0varied0among0the0cultivars. With the exception of
arginine, the0concentrations of0all1other essential0AAs on a protein0basis-decreased1as
protein0levels increased. Out0of 100essential0AAs0including0cystine, only1arginine0had
a positive0correlation (r = 0.79) with protein0content. The0dietary-fibre0contents varied
between 190.7 and 223.1 g0kg–1 and the values were slightly higher in the brown-
seeded cultivars. The brown-seeded cultivars contained appreciable quantities of
tannins, while the0yellow-0and0green-seeded0cultivars0were devoid of tannins. The
cultivars were almost devoid of fat and calcium but relatively high in phosphorus.
Starch0and0dietary0fibre0were0negatively0correlated0with0protein0content (r = –0.78 and
–0.46, respectively), and0accounted0for0the0greatest-difference0in0protein0content. The
TME0values ranged from 11.60to 13.30MJ kg–1 while the TMEn0values ranged from
11.0 to 12.90MJ kg–1. The mean availabilities of AAs ranged0from a high of 89.6 to a
low of 75.9%, with total sulphur0AAs (cystine0and0methionine) having the0lowest
value and glutamic0acid1having the highest0value. There was a trend (P ≤ 0.05)
towards1lower0AA0bioavailability0values0in0the0brown-seeded0cultivars. It0can0be
concluded0that0these0cultivars0varied0in0chemical0composition, metabolizable0energy
content0and bioavailability0of AAs.
23
It has been documented that a physico-chemical properties of Beach pea
(Lathyrus maritimus L.) seeds were evaluated1and their proximate composition were
determined. Results were also0compared0with0those0of0green0pea (Pisum0sativum L.)
and field0pea (Lathyrus sativus L.) Beach-pea0seeds0had0a0very0low0grain0weight,
density, hydration0capacity, hydration0index, swelling0capacity and swelling0index as
compared0to0green0pea0and0field0pea. The contents0of1crude0protein (29.2%), crude
fibre (12.0%), reducing0sugars (0.2%), total0phenolics (1.2%) and ash (3.0%), and0total
free amino acids (0.6%) of beach pea were substantially higher than other pea
varieties0examined. The contents of cysteine (1.6%), methionine (1.1%), and
tryptophan (0.3%) in beach pea0proteins were low, but higher0than those0in green0pea
and0field0pea0varieties0from0Canadian0and0Indian0cultivars. Beach0pea0lipids0were
dominated by linoleic acid (69.1%) and were similar to green pea (45.1%) and
Canadian0grown0field0pea (57.0%). The macroelements0of beach0pea were dominated
by potassium (476 mg/100 g), phosphorus (413 mg/100 g), magnesium
(1180 mg/100 g) and calcium (144 mg/100 g). The contents of0microelements, namely
manganese, zinc, and0iron in beach0pea were 3.5, 3.0 and 9.4 mg/100 g, respectively
(Chavana et al., 1999).
Amarteifio et al. (2002) investigated the raw seeds of six varieties that were
analyzed0forsdry0matter, crude0fat, protein, fiber, and ash, using Association0of
Official0Analytical0Chemists0procedures. Major0minerals, Ca, K, P, Mg, Na and
trace minerals, Cu, Fe and Zn were also assessed. The ranges1of nutrient
contents0obtained were: dry smatter 86.6–88.0%, crude0protein 19.0–21.7%, crude
fat 1.2–1.3%, crude fiber 9.8–13.0%, and1ash 3.9–4.3%. Minerals0ranges (mg/100 g
24
dry matter) were: K 1845–1941, P 163–293, Ca 120–167, Mg 113–127, Na 11.3–
12.0, Zn 7.2–8.2, Fe 2.5–4.7 and Cu 1.6–1.8. There were1no significant1differences
in Na among the six varieties (P>0.05). For the other components, varietal
differences (P < 0.05) were observed. The values0obtained0for0the0dry0matter, crude
protein, fat, ash, Ca, Cu, Fe, and Mg were similar to those in pigeon peas grown
elsewhere, while1those for crude fiber and Zn were-higher. In general, the
composition0of0pigeon0peas0compared0favorably0with0those0of0other0legumes0such0as
Bambara-groundnut (Vigna subterranea).
Pulses (pea, chickpea, lentil and bean) are an0important0source of0food
proteins. They contain0high amounts0of lysine, leucine, aspartic0acid, glutamic0acid
and arginine and provide well balanced essential0amino acid profiles when consumed
with cereals1and other foods rich in sulphur-containing amino2acids and tryptophan.
The protein content of most pulse legumes fall within the range of 17–30%. Apart
from0their nutritional0properties, pulse proteins also possess1functional1properties
that play an important role in food formulation and0processing. Examples of such
functional0properties include solubility, water and fat binding0capacity and0foaming.
Pulses, especially when blended with cereal proteins, may offer a promising
alternative0source for0nutritional and functional0proteins. This review0provides an
overview of the characteristics of pulse proteins, current and emerging techniques for
their fractionation, their major functional properties and opportunities for their use in
various applications (Boye et al., 2003).
El-Adawy et al. (2003) performed0an experiment to0check the response0of
mung0bean, pea and lentil0seeds that were germinated0for 72 hr and 120 hr at0room
25
temperature (25 ± 2 ◦C) and to determine0the changes0in their0chemical0composition,
antinutritional factors, in vitro digestibility and functional properties. Germination
caused0a significant (P<0.05) decrease0in total0protein, fat0and carbohydrate0contents
with increased0germination time in all0legume-seed0flours while non-protein nitrogen,
ash0and fiber0contents were significantly (P<0.05) increased. Mineral0contents (Na, K,
Ca, P, Mg, Fe and Mn) increased during germination of legume seed flours.
Significant (P<0.05) decreases were observed0in carbohydrate0fraction0contents
(starch, reducing sugars, stachyose and raffinose) of legume0seed flours
during0germination. Germination resulted in a significant (P<0.05) decrease in the
antinutritional0factors of all0germinated1legume0seed0flours. The levels of0trypsin-
inhibitors and tannins decreased in the first stage of germination (72 hr) then
increased0gradually in the last1stage of germination (120 hr) but0remained lower than
the0controls. Reduction0in phytic0acid and hemagglutinin0activities increased1with
increased germination0time. Germination significantly (P<0.05) improved in vitro-
protein0digestibility. Protein0solubility0indexes, water0absorption and0emulsification
capacities, foam capacity and foam stability were significantly (P<0.05)
improved0with increase in germination0time while fat0absorption0decreased.
This study0investigated the composition of pigeons peas (Cajanus cajan),
grown0at Sebele, Botswana. The raw0seeds of six0varieties1were analyzed for dry
matter, crudes fat, protein, fiber, and ash, using1Association0of0Official
Analytical0Chemists0procedures. Major0minerals, Ca, K, P, Mg, Na and0trace
minerals, Cu, Fe and Zn were also0assessed. The range0of nutrient0contents0obtained
was: dry matter 86.6–88.0%, crudes protein 19.0–21.7%, crudes fat1.2–1.3%, crudes
26
fiber 9.8–13.0%, and ash 3.9–4.3%. Minerals1ranges (mg/100 g dry matter)were: K
1845–1941, P 163–293, Ca 120–167, Mg 113–127, Na 11.3–12.0, Zn 7.2–8.2, Fe2.5–
4.7 and Cu 1.6–1.8. There were no significant differences in Na among the six
varieties (P>0.05). For0the0other0components, varietals differences (P<0.05) were
observed. The values0obtained0for the dry0matter, crudes protein, fat, ash, Ca, Cu, Fe,
and Mg were similar to those in pigeon peas grown elsewhere, while those for crude
fiber0and Zn were0higher. In0general, the0compositions of pigeon peas compared
favorably0with those of other legumes such as Bambara-groundnut (Vigna
subterranea). The levels0of crude0protein, crude0fiber, K, Ca, P and Mg indicated0that
pigeonspeas0could be valuables in the diet of the people of Botswana. This0crop0would
positively contribute protein in the diet and the diversification0of agricultural0produce
(Amarteifio et al., 2002).
To0determine the0effect of0mildshydrothermal0treatment and the0addition of
phytase0under optimal0conditions (pH 5.5, 37°C) on0the nutritive0utilization of0the
protein0of pea (Pisum sativum L.) flour was studied (Urbano et al., 2003) in0growing
rats by0examining0the chemical0and biological0balance. Mild0hydrothermal0treatment
produced0reductions of 83, 78, and 72%, respectively, in the levels0of R-galactosides,
phytic0acid, and trypsin0inhibitors and also produced a significant0increase in the
digestive0utilization of0protein. The additional0fall in the levels0of phytic0acid caused
by the0addition of0phytase did not0lead to a subsequent0improvement in the0digestive
utilization of protein. The mild hydrothermal treatment of pea flour produced a
significant increase in the metabolic0utilization of protein0and0carbohydrates, which
27
was reflected1in the protein efficiency ratio and food transformation growth indices.
These effects1were not observed in the phytase-supplemented1pea diet.
The0effects of0germination for 2, 4 or 6 days0with and without0light, on the
proteolytic0activity, the0contents1of soluble0protein and non0protein nitrogen, and the
amount0of available0starch of (Pisum0sativum L.) as0well as their0nutritive0utilization
by growing0rats were studied0by (Urbano et al., 2005). Food0intake0increased
significantly0when the peas were germinated1for 2 or 4 days. This0improvement was
correlated0with the reduction0of factors0responsible for0flatulence. Digestive0utilization
of0nitrogen was similar (among0all the groups0fed germinated-pea flour) to0raw-pea
flour. The0values0for nitrogen0balance, percentage0of retained0to absorbed0nitrogen,
protein0efficiency0ratio, and index0of available0carbohydrates were significantly higher
among0the animals0that consumed0peas allowed0to germinate0for 2 or 4 days0than
among0the animals0given the raw-pea or 6-day-germinated0pea0diets. It was
concluded0that germination0of peas for 2 days0would be sufficient0to0significantly
improve the palatability and nutritive utilization of protein and
carbohydrates0from Pisum sativum L. The presence0or absence0of light0during the
germination0process did not0affect the results0achieved.
Yalcin et al. (2006) studied the physical0properties of pea0seed as a function of
moisture0content. The average0length, width0and0thickness were 7.80, 6.410and 5.55
mm, respectively, at0a moisture0content of010.06 % dry0basis (d.b.). In the0moisture
range0from 10.06%0to 35.08% d.b., studies0on rewetted0pea seed1showed that the
thousand0seed0mass increased1from 177.70to 214.1 g, the projected0area from 30.840to
44.080mm2, the0sphericity0from 0.8360to 0.851, the0porosity0from 38.64%0to 40.32%
28
and0the terminal0velocity from 9.00to 9.4 m/s. The static0coefficient of0friction0of0pea
seed0increased the linearly0against0surfaces0of0four structural0materials, namely,
rubber (0.388– 0.413), aluminium (0.292–0.351), stainless0steel (0.270–0.311) and
galvanized iron (0.360–0.409) as the moisture0content increased0from 10.06%0to
35.08% d.b. The bulk0density decreased1from 712.10to 647.50kg/m3 and the0true
density from 1160.5 to 1085.0 kg/m3 respectively, with an increase in moisture0content
from 10.06%0to 35.08% d.b.
This study was1carried out0to determine the effect of0moisture1contents0on
physical0properties of some0grain legumes0seeds such as kidney0bean (Phaselous
vulgaris), dry0pea (Pisum0sativum), and0black-eyed0pea (Vigna0sinensis) seeds. Three
different0moisture contents0for each grain0legume were evaluated. The average0length,
width, thickness, geometric0mean0diameter, and0it mass0of0seeds ranged0from 16.66,
8.86, 7.17, 10.17 mm and 0.715 g for kidney bean; 7.46, 6.02, 4.49, 5.85 mm and
0.158 g for pea; 9.19, 6.96, 6.26, 7.32 mm, and 0.255 g for black-eyed pea at a
moisture content of 8.21 %,8.20 %,and 5.66 % (wet basis), respectively. The
sphericity, thousand-seed0mass (1000-seed mass), and0projected1area0increased,
whereas the bulk and1kernel0densities-linearly decreased1within increase in0moisture
content0for each grain0legume0seed. The0porosity, the volume0of seed, and angle0of
repose0increased for0three grain0legumes seeds, whereas the angle0of repose0decreased
for black0eyed pea seeds in0the moisture0contents studied. The static0and0dynamic
coefficient0so friction0on0various1surfaces2namely, galvanized metal chipboard,
mildsteel, plywood, and0rubber0also linearly increased with an0increase in0moisture
content0of each grain legume0seed (Altuntas and Demirtola. 2007).
29
The chemical composition and functional properties of two under utilized
legume0seeds (Jack bean and Pigeon pea) flours were compared with that of the
popularly consumed Cowpea seed flour found in Nigeria. The three seeds were
sampled0from the six0geo-political0zones in Nigeria and each of them was0separately
ground0and sieved into0powder and analyzed0for proximate0composition, minerals0and
functional0properties. The result revealed that Jack bean seed flour had the
highest1composition of ash (6.51±0.28%), protein (26.20±0.40%), carbohydrate
(57.83±0.80%), potassium (2.20±0.40mg/g), foam capacity (20.67±0.41%) and
emulsion capacity (71.73±0.44%); Pigeon pea had the highest1compositionsof fat
(4.78±0.22%), fibre (1.10±0.10%), energy (369.38±0.05kcal/100g), calcium
(0.65±0.03mg/g), sodium (2.20±0.01mg/g), magnesium (1.55±0.01mg/g),
phosphorous (55.00±0.20mg/g), least gelatin concentration (6.00±0.10%), oil and
watersabsorption1capacity (148.17±%0.37; 189.77±0.28% respectively) and1Cowpea
had the highest value of1iron (0.80±0.03mg/g), zinc (1.62±0.03mg/g), copper
(0.57±0.10mg/g), foam (15.70±0.31%) and emulsion (15.20±0.37%) stability
(Olalekan and Bosede, 2010).
Tresina et al. (2010) conducted an experiment on three different varieties0of
the1Vigna mungo L. Hepper were analyzed for0their proximate0and0mineral
composition, vitamins (niacin and ascorbic acid), protein fractions, amino0acid0profile
of0total seed0proteins, fatty0acid profile0of seed0lipids, in vitro0protein digestibility0and
certain antinutritional0factors. The major0findings were as follow: crude0protein0content
ranged from 24.37 – 26.22%, crude lipids2.94 – 4.24%, total dietary-fibre 4.24 –
5.47%, ash 2.98 –3.33%, carbohydrates 61.24 – 64.43% and calorific value 1603.65 –
30
1691.81 kJ 100-1 g DM. Seed0samples contained0minerals such as Na, K, Mg and P
in0abundance. The ratios0of Na/K ranged from 0.16 – 0.19% and Ca/P 0.68 – 1.19%.
Albumins1and globulins seem to be the principle protein of the investigated Vigna
mungo varieties. The essential0amino0acid profile0of total0seed0proteins were found0to
be high when compared to the FAO/WHO (1991) recommended pattern. The
fatty0acid0profiles of0all the three0varieties revealed0that the seed-lipids contained
linoleicsand0linolenic acid in high0concentration. The anti-nutritional0factors ranged
from: total0free0phenolics=0.48 – 1.41% and tannins 0.62 – 0.70%.
In another0experiment Barac et al. (2010) studied the extractable0protein
compositions, technological-functional0properties of0pea (Pisum sativum L.) proteins
from six genotypes0grown in Serbia. Also, the relationship0between these
characteristics were presented. Investigated0genotypes showed0significant0differences
in storage0protein content, composition0and extractability. The ratio0of vicilin: legumin
concentrations, as well as the ratio of vicilin + convicilin:
Legumin0concentrations0were positively0correlated with0extractability. Our0data
suggest0that the higher0level of vicilin0and/or a lower0level of legumin have a0positive
influence on0protein extractability. The emulsion activity index (EAI) was
strongly0and positively0correlated with the solubility, while no0significant correlation
was found between emulsion-stability (ESI) and solubility, nor
between1foaming0properties and solubility. No0association was evident
between ESI and EAI. A moderate0positive correlation between emulsion0stability and
foam0capacity1was observed. Proteins0from the investigated0genotypes expressed
significantly0different emulsifying0properties and foam0capacity at different pH
31
values, whereas0low foam0stability was0detected. It0appears0that genotype0has
considerable influence on content, compositionsand1technological-functional
properties of1pea bean proteins. This0fact can be0very useful0for food0scientists in
efforts0to improve0the quality0of peas1and0pea protein0products.
The aim of0this0study was to0determine the dry0matter (DM), ash, organic
matter (OM), crude0protein (CP), ether0extract (EE), crude0fiber (CF), total0sugars,
starches0and0estimate the metabolizable0energy (ME), in ruminants, pigs, poultry,
horses0 and pets (dogs and cats) and digestible0energy (DE) in rabbits0from the 10
most productive0field-pea0genotypes (Pisum sativum L.) obtained0in a trial0with 4×20
different0genotypes. The results (% DM - genotype) allowed0us to0state the0following:
all the 100field pea0genotypes grain were an important0source of0energy (cytoplasmic
carbohydrates) with high0percentages of0soluble sugars (7.95% ISARD to 9.42%
ENDURO) (P<0.05) (Rodrigues et al., 2012).
To explore0the extent0of the variation0for important0seed traits0present in a0set
of028 field0pea landraces collected from various regions of Turkey. A high level0of
variation0was observed for the content0of0protein, crude0fat, ash, fiber0and starch. Seed
weight, volume0and density0also varied markedly, as did hydration0capacity, swelling
index0and cooking0time. The capacity0of the0landraces to0accumulate trace0minerals
(Cu, K, Ca, Mg, P and Zn) also varied. Trait0correlations were established, although
the genetic component of these remains uncertain pending multi- location testing.
Landraces0which produced0either seed0with high protein0content or which0had a0short
cooking0time were identified. One0of the high0protein types0also was a0good
accumulator0of Zn, P and Mg. Our0results provide0an initial0step toward0the
32
identification0of field0pea landraces0that may be useful0for the development0of high-
quality0field pea0cultivars (Ozer et al., 2012).
Likewise Sila and Malleshi, (2012) studied that the premature0green legumes
are good0sources of0nutraceuticals/and antioxidants0and are consumed0as snacks0as
well as0vegetables. They0are seasonal0and have limited0shelf-life. Efforts0are provided
to0prepare shelf-stable0green legumes0to extend0their availability0throughout the0year.
Green0legumes from0chick pea0or Bengal0gram (Cicer arietinum L.) and field0bean
(Dolichos lablab L.) have been0processed to0enhance their0shelf-life, and0determined
their0nutritional, physico-chemical0and nutraceutical0qualities. The0shelf stable0green
legumes (SSGL) show higher water absorption0capacity compared0to matured-dry
legumes (MDL). The total0colour change0in the0processed/dried0SSGL and0MDL
samples0increased significantly (P ≤ 0.05) compared to the freshly0harvested green
samples. The carotenoid0content of Bengal0gram and field0bean SSGLs0are 8.0 and
3.2 mg/100 g, and0chlorophyll0contents are 12.5 and 0.5 mg/100 g, respectively,
which0are in negligible0quantities in matured0legumes; the corresponding0polyphenol
contents0are 197.8 and 153.1 mg/100 g. These0results indicate0that SSGLs0possess
potential0antioxidant0activity.
The Sharma et al. (2013) experiment0performed to investigate the
changeability in dietary arrangement, mineral profile, anti-nutritional0factors
and in0vitro starch edibility of five0desi and four kabuli chickpea0cultivars.
Proximate synthesis fluctuated altogether (P<0.05) among various kinds of
chickpea0cultivars. The unrefined0protein0content changed from018 to031%
being0higher in Kabuli0chickpea cultivars0than desi0chickpea. The0iron was the
33
most0copious mineral0present in each0of the cultivars0of0chickpea (4.6 to
10.5%). Among0anti-nutritional0factors tannin0fixation went from 0.07 to 0.22%
and trypsin inhibitor's substance extended from 9 to 31 mg/g in both the
cultivars0of0chickpea.
Witten et al. (2015) to0studied the composition0of organically0produced0field
peas and field beans as a source of valuable protein for the planned 100 %
organic feeding regulations in organic farming. For this reason, the influence of
environment0and variety0on the contents0of crude0nutrients and the0amino acids0lysine,
methionine, and0cysteine0were examined over three0years. Peas contained on an
average 21.9 g crude0proteins100 g-1 dry0matter with 8.00g lysine0100 g-1, 1.0 g
methionine0100 g, and 1.4 g0cysteine 100 g-1. Environmental0factors and0interactions
also0had influences on the composition0of legume0species. Furthermore, significantly-
negative0correlations were found0between the content0of0crude0protein and0starch (r =
-0.79), sugar (r = -0.55), lysine (r = -0.78), methionine (r = -0.61), and0cysteine (r = -
0.55) in0field0peas.
The aim of this study was to investigate the nutritional and anti nutritional
factors0of0the0two0local0varieties0of0red0gram0seeds. The results0obtained1are presented
as mean0percentage for0moisture1contents0as08.92, ash, 3.21, dietary0fiber, 6.60,
protein, 23.23, Fat, 1.450and total0carbohydrate as 53.230respectively. The study0also
elicited0the mean manganese0content to0be 1.76, copper01.80, iron05.95 and zinc03.52
mg/100g of dried sample respectively. The mean content of galactosyl
oligosaccharides0for the0two varieties0was found0to be 1.42%, for raffinose, 1.75% for
stachyose0and 4.95% for verbascose0respectively. Raffinose0family sugars in split0dhal
34
and immature0seeds were found0to be 0.85 and 1.00%, for0raffinose, 1.54% and
1.11%, for0stachyose and 4.20 and 1.38% for0verbascose0respectively. The0mean
content0of trypsin0inhibitor was 199.40 (TIA)/g sample0and chymotrypsin0inhibitor
was 270 (CIU)/g0sample (Aruna and Devindra, 2016).
Breeding and selection of winter pea for seed quality is a serious
challenge to every breeder. The result of breeding mainly depends on good
knowledge of the genetic material. Chemical and technological analysis was
necessary0for accurate0determination of0the following0traits of technologically0mature
seed0of the winter pea0collection: protein0content, total0nitrogen0content, total0sugars
content, starch0content, fatty oil0content, cellulose0content, and ash0content (g 100 g-1).
Protein0content in tested0lines of pea0ranged 22.86-28.04 g 100 g-1, total0nitrogen
content 3.66-4.49 g 100 g-1, total0sugars0content 10.30-14.67 g 100 g-1, starch0content
39.44-46.23 g0100 g-1, fatty0oil0content 1.48 1.89g0100 g-1,cellulose0content08.79-10.28
g 100 g-1, ash0content 3.08-3.670g 100 g-1. PCA0analysis was used0to mark out the0three
components, which0collectively explained081.59% of0the t0tal variation. The first0one
was mainly0defined by ash0content, total0nitrogen, protein0and0cellulose. The second
main component, independent from the first one, was mainly correlated to fatty oil
content and starch, while the third was defined by the content of total sugars
(Cervenski et al., 2017).
35
2.3. MOLECULAR STUDIES
Baranger et al. (2004) studied 148 Pisum accessions/using01211protein- and
PCR-based0markers. This molecular0marker-based classification0allowed tracing/major
lineages/of pea/breeding and to0follow/the main breeding0objectives/and0improvement
of0frost/tolerance0for winter-sown0peas. The0classification/was/largely0consistent/with
the0available pedigree0data, and0clearly/resolved0the different0main/varietal1types
according0to their0end-uses (fodder, food0and feed peas) from0exotic types0and0wild
forms. Fodder types were further separated into two sub-groups. Feed peas,
corresponding to either spring-sown or winter-sown types, were also separated, with
two0apparently different0gene0pools for0winter-sown0peas. The garden0pea/group was
the most difficult to structure, probably due to a continuum in breeding of feed peas
from0garden0types. The classification also stressed0the paradox between the1narrowness
of the genetic basis of0recent cultivars0and the very large diversity/available within
Pisum sativum.
This experiment was conducted to provide1reliable and cost1effective
genotyping conditions, level of polymorphism in a scope of genotypes and map
position0of/recently/created/microsatellite0markers/to advance0expansive/utilization0of
these0markers/as0a typical/set0for genetic0studies in pea (Loridon et al., 2005). Optimal
PCR conditions-were determined for0340 microsatellite1markers based0on
amplification0in eight0genotypes. Levels1of polymorphism were determined1for 3091of
these1markers. Compared1to data1obtained/for1other1species, levels1of/polymorphism
detected1in a panel1of eight1genotypes were high with a mean0number of03.81alleles0per
polymorphic0locus0and an average0PIC value of00.62, indicating0that pea0represents a
36
rather0polymorphic1autogamous0species. One1of the main0objectives/was to1locate a
maximum0number of/microsatellite0markers0on0the0pea/genetic/map. Data/obtained
from0three/different0crosses were0used/to0build a0composite/genetic0map of 1,4300cm
(Haldane) comprising1239 microsatellite1markers. These includes2160anonymous
SSRs1developed/from1enriched/genomic1libraries and113 SSRs1located/in1genes. The
markers were quite1evenly/distributed1throughout/the seven1linkage/groups1of the1map,
with185% of1intervals/between1the/adjacent1SSR-markers0being/smaller1than110 cm.
There1was a good1conservation/of1marker/order1and linkage1group/assignment1across
the three1populations. In conclusion, this0report was expected1wide application1of0these
markers and0allow information0obtained by0different/laboratories0worldwide0in0diverse
fields1of pea1genetics, such as1QTL mapping1studies and1genetic resource1surveys, to
be easily1aligned.
(Burstin et al., 2008) studied1the genetic1variability/among112 pea1genotypes.
Thirty-one genotypes were polymorphic and the average number of variants per
marker1was 3.6 when1considering/only0polymorphic0markers. Overall, the number0of
variants1for a given1SSR/marker0was correlated0with the length1of the0SSR0but some
12-bp long0SSRs showed1the same0degree0of0polymorphism as longer0ones. The
groupings resulting from the SSR genotyping among the 12 genotypes gave an
interesting0insight into1the possible0origin of1one/recent0cultivar. Database-derived
SSR0markers are highly1variable. They1can provide1useful1information1on the0genetic
diversity0among P. sativum0cultivated0type.
Smykal et al. (2008) made a standard1classification by 121morphological
descriptors1and a classification1by biochemical-molecular1markers. Two1isozyme
37
systems, 10 microsatellite0loci, 2 retrotransposons0for multilocus0inter-retrotransposon
amplified polymorphism (IRAP), and 12 retrotransposon-based insertion
polymorphism (RBIP) DNA0markers0were analyzed. The main1objective of0the0study
was1to examine0the potential of each method1for discrimination1between pea0varieties.
The1results1demonstrated1high0potential1and0resolving0power0of DNA-based0methods.
Superior0in terms0of high0information0content and0discrimination0power0were0SSR
markers, owing1to high1allelic1variation, which was the1only1biochemical-molecular
method0allowing0clear1identification0of all0varieties. Retrotransposon1markers in1RBIP
format1proved to0be the most0robust and0easy to score0method, while0multilocus1IRAP
produced0informative/fingerprint0already in a single0analysis. Isozyme0analysis0offered
a fast0and less0expensive0alternative. The results0showed that0molecular0identification
could be0used to assess0distinctness and complement0morphological0assessment,
especially0in cases0where the0time frame0plays an important1role. Currently1developed
pea marker0systems might serve also9for germplasm0management and genetic0diversity
studies.
In the same way, Tihomir0et al. (2009) analyzed genetic diversity of0European
pea (Pisum sativum L.) germplasm, to0determine differences0between P. sativum var.
arvense and P. sativum ssp. sativum0groups, and to0estimate genetic variability0among
and within0eighteen P. sativum accessions. Co0ancestry/coefficients1across investigated
accessions0varied from00.46 to 1.00. The average0dissimilarity/index0between Pisum
sativum var. arvense and P. sativum ssp. sativum groups was 0.99, where estimates
obtained0by pedigree0data might be0overestimated. Average0morphological0distance
among0all accessions0was slightly0higher than0average molecular0distance (0.620and
38
0.59, respectively). Average0morphological/distance0between P. sativum ssp. sativum
and P. sativum var. arvense0groups/was also0higher/than0average/molecular0distance
(0.710and 0.69, respectively). Results, according0to morphological0traits used in0this
study were well suited to assess differences among accessions. Accessions were
grouped0according to0their/botanical0characters and agronomic0use. Genetic0distances
estimated0by molecular0marker (SSR) data in0comparison with0distances/estimated0by
conventional0methods (pedigree0and morphologic0traits) showed0higher/similarity0with
genetic0distances estimated0by morphological0data. Results0indicated that0inter- crosses
between arvense and sativum0accessions as well0as inclusion of valuable/landraces into
breeding0programmes might0prevent/loss0of diversity in the Pisum gene0pool.
The need for0the conservation0of/plant genetic0resources has been0widely
accepted. Germplasm0characterization and evaluation0yield information0for0more
efficient1utilization of0these valuable0resources. The aim0of the present0study was to
characterize the pea germplasm conserved at the Aegean Agricultural Research
Institute of Turkey using0morphological0and simple0sequence0repeat (SSR)-based
molecular approaches studied by Sarikamis et al. (2010). Genetic characterization of
30 pea-genotypes collected from different/regions of Turkey and 10 commercial pea
cultivars0was performed0using the criteria0of the International0Union for the0Protection
of New Varieties of Plants (UPOV) (TG 7/9 Pisum sativum), and with 10 SSR
markers. Originally 15 SSR markers were tested; 10 of these markers were selected on
the basis0of high0polymorphism information0content in the molecular0assays. Sixty-one
alleles were detected0at the010 loci. The number0of alleles0per SSR0locus ranged from 3
(PVSBE2) to012 (AB53), with0a mean0of06.10alleles. The most0informative0loci were
39
AB53 (120alleles), AA355 (90alleles), AD270 (80alleles), A9 (70alleles), AD61 (7
alleles), and AB25 (60alleles). The0UPGMA0dendrogram defined by0markers0revealed
genetic0relatedness of0the pea0genotypes. These0findings can be0used to guide0future
breeding0studies and germplasm0management of0these pea0genotypes.
Ahmad et al. (2012) studied1genetic diversity1in 35 diverse Pisum0accessions
using 15 polymorphic0microsatellites located on different pea0chromosomes.
Microsatellites1were found1to be1polymorphic, amplifying/a1total of 411alleles and
were able1to differentiate1all 35 Pisum1genotypes. These markers1were scored1by their
polymorphic1information1content (PIC), ranging1from 0.055 (AA206) to 0.660 (AB72)
with1an average1of 0.460, and by their1discriminating1power (D), which varied1from
0.057 (AA206) to 0.679 (AB72) with1an average1of 0.475. Genetic0similarity0values
ranged from00.074 (between Maple0pea NZ0and Line045760) to00.875 (between0Galena
and0Dakota) with an0average0of00.336. Unweighted0pair group0method with0arithmetic
averages (UPGMA) cluster analysis grouped the 35 pea accessions into two major
clusters0and eight0sub-clusters. The majority0of Canadian/and European0genotypes
were0grouped/separately, suggesting0both0these groups0are from0genetically/distinct
gene0pools. The genetically0diverse0groups0identified in this0study can be used0to
derive0parental lines0for pea0breeding
Kumari et al. (2013) assessed0genetic/diversity0among 28 pea (Pisum sativum
L.) genotype0using 32 simple/sequence0repeat0markers. A total0of 440polymorphic
bands, with0an average of02.1 bands per0primer, were obtained. The0polymorphism
information0content ranged from00.657 to 0.309 with an average0of 0.493. The
variation0in genetic/diversity0among these cultivars0ranged from 0.11 to 0.73. Cluster
40
analysis0based0on0Jaccard's0similarity/coefficient0using the unweighted0pair-group
method1with arithmetic0mean (UPGMA) revealed 2 distinct clusters, I and II,
comprising16 and 220genotypes, respectively. Cluster0II was further0differentiated0into
2 sub clusters, IIA and IIB, with 12 and 100genotypes, respectively. Principal
component (PC) analysis revealed results similar to those of UPGMA. The first,
second, and third0PCs contributed021.6, 16.1, and 14.0% of the1variation, respectively;
cumulative0variation of1the first 3 PCs was 51.7% .
Simple0sequence/repeat1markers were developed1based on0expressed/sequence
tags (EST-SSR) and screened0for polymorphism0among 23 Pisum sativum0individuals
to1assist/development1and refinement1of pea0linkage/maps (Zhuang et al., 2013). In
particular, the SSR0markers were1developed1to assist in mapping1of white/mold1disease
resistance1quantitative/trait1loci. Primer1pairs were designed1for 46 SSRs1identified in
EST1contiguous/sequences1assembled from1a 4541pyrosequenced0transcriptome1of the
pea0cultivar, ‘LIFTER’. Thirty-seven1SSR markers1amplified/PCR1products, of1which
11 (30%) SSR0markers produced1polymorphism in 231individuals, including1parents of
recombinant inbred lines, with two to four alleles. The observed and expected
heterozygosities1ranged from00 to 0.43 and from 0.31 to 0.83, respectively.
Gixhari et al. (2014) investigate1the genetic1diversity in the pea1germplasm1of
28 local pea genotypes for 23 quantitative morphological traits, through 14
retrotransposon- based0insertion0polymorphism (RBIP) markers. RBIP0marker0analysis
revealed0the genetic0similarity in range0from 0.06 to00.45. PCA and cluster0analysis
(Ward's method) carried0out for0morphological/traits0divided the local0pea0genotypes
41
into0three clusters. Finally, the study0identified the0agronomicaly important0traits
which will facilitate/the maintenance/and agronomic/evaluation of the collections
Handerson et al. (2014) studied the performance of 34 pea (Pisum sativum L.)
genotypes0including 7 adapted0varieties, 6 popular0local/cultivars0and 210advanced
breeding lines for genetic diversity and relatedness0with 16 morphological0traits and 15
SSR0markers. Genotypes viz., DDR-23, E-6, Makuchabi and KPMR-885 were
identified0as early0flowering while0Rachna, IPFD 09-2, CAU FP-1, IPFD 1-10 and
Pant P-136 were identified0as high0yielding. The number0of alleles/per0SSR/marker
varied from 2 to 5 per0locus. Polymorphic0information/content0values (PIC) ranged
from00.105 to 0.560 per0locus. Variability0among0groups (FIS=0.938) and0variability
within individuals (FIT=0.948) was low. The minimum0and0maximum0molecular
genetic0distances were found0to be 0.12 (Pant P-136 with VL-51) and 0.78 (E-6 with
LP-4) respectively. Genotypes0IPFD 09-2, HFP-620, Azad P-1, Matek, IPFD 1-10,
CAU FP-1, IPFD 09-3, Pant P-136, Rachna, E-6, Matek and LP-3 showed0high/level
of genetic/diversity.
The aim of this research was the development0of a genome-wide0transcriptome-
based pea single-nucleotide polymorphism (SNP) marker platform using next-
generation0sequencing0technology. A total0of 1,536 polymorphic0SNP loci0selected
from0over 20,000 non-redundant0SNPs identified using0deep0transcriptome0sequencing
of0eight diverse Pisum accessions0were used for0genotyping in five RIL0populations
using0an Illumina0GoldenGate assay. The first0high-density0pea/SNP0map/defining0all
seven linkage groups was generated by integrating with previously published anchor
markers. Syntenic relationships of this map with the model legume Medicago
42
truncatula0and lentil (Lens culinaris Medik.) maps were0established. The genic0SNP
map0establishes a foundation0for future0molecular breeding0efforts by enabling0both
the identification0and tracking0of introgression0of genomic0regions harbouring0QTLs
related0to agronomic0and seed/quality0traits (Sindhu et al., 2014).
Simple sequence repeat (SSR) markers have previously been applied to
linkage0mapping of0the/pea (Pisum sativum L.) genome. However, the0transferability
of existing loci to0the molecularly distinct Chinese winter pea gene pool was limited. A
novel0set of pea0SSR markers was accordingly0developed. Together0with existing0SSR
sequences, the genome of the G0003973 (winter hardy) × G0005527 (cold sensitive)
cross was mapped0using 190 F2 individuals. In total, 1570SSR markers were placed in
110linkage/groups0with an average0interval of 9.7 cm and total0coverage of01518 cm.
The novel1markers and genetic1linkage map1will be useful1for marker-assisted1pea
breeding (Sun et al., 2014).
Teshome et al. (2015) stated that field pea (Pisum sativum L.) is among0the
prominent crops in the world as food and feed. There are relatively few simple
sequence0repeat (SSR) markers0developed from0expressed/sequence0tags (ESTs) in P.
sativum. Results: In the present study, 15 new EST-SSR0markers were developed0from
publicly available ESTs. These markers have successfully amplified their target loci
across0seven Pisum sativum sub sp. sativum0accessions. Eleven (73 %) of these0SSRs
were trinucleotide repeats, two (13 %) dinucleotide and two (13 %) were
hexanucleotide0repeats. Across-taxa0transferability of these/new0markers was also
tested0on/other0subspecies of Pisum as well as on P. fulvum, Vicia faba and Lens
culinaris. In Pisum sativum sub sp. sativum, 13 of the 150markers were0polymorphic
43
and 120of them subsequently0used for0genetic/diversity0analysis. Forty0six0accessions,
of0which/43 were from0Ethiopia, were subjected0to genetic0diversity analysis0using
these newly developed markers. All accessions were represented by 12 individuals
except0two (NGB103816 and 237508) that were represented0by 9 and 110individuals,
respectively. A total0of 370alleles were detected0across all0accessions. PS10 was the
most0polymorphic/locus0with six0alleles, and the average0number of0alleles/per0locus
over the 12 polymorphic loci was 3.1. Several rare and private alleles were also
revealed. The most0distinct0accession (32048) had private0alleles at three0loci with 100
% frequency.
Retrotransposons have been highly studied in monocots; however
retrotransposon0diversity in dicot0crops has not0been well0documented. Our0objective
was to assess the diversity harbored by field pea landraces using retrotranposon
markers. In this9research, molecular0characterization of0104 landraces and 34 field pea
breeding lines was assessed using newly developed iPBS-retrotransposon markers.
The 12 iPBS-retrotransposon0primers/generated0a total0106 scorable bands, and 810of
these were found0to be0polymorphic (76.4%), with an0average of 6.750polymorphic
fragments0per0primer. Polymorphism0information0content (PIC) ranged from 0.330to
0.84 with an average0of 0.61. It was evident0that field0pea/landraces0from the0same
geographical region were often placed in different groups in the neighbor joining
analysis, indicating0that grouping0based on0genetic/parameters was not0closely0related
to the geographical0origin. The population structure was determined by using
STRUCTURE0software, and three0populations at K = 3 and five0populations at K = 5
were identified0among0landraces. The plentiful0diversity present0in Turkish0field-pea
44
landraces0could be0used as genetic0resource in0designing/breeding0program, and may
also0contribute to0worldwide0pea breeding0programs. Our0data also suggested a0role of
iPBS-retrotransposons0as ‘a universal0marker’ for0molecular characterization0of pea
germplasm (Baloch et al., 2015).
Ahmad et al. (2015) expressed0that the field0pea (Pisum sativum L.) is an
imperative protein-rich heartbeat trim delivered all around. Expanding the lipid
substance of Pisum seeds through customary and contemporary atomic reproducing
instruments0may convey0increased the value0of the0product. Be that as it may,
information0about hereditary0decent/variety0and lipid0content in field0pea is0restricted.
A comprehension of hereditary decent variety and populace structure in different
germplasm0is vital0and an essential0for hereditary analyzation0of complex0qualities and
marker-attribute0affiliations. Fifty polymorphic0microsatellite/markers0recognizing a
sum0of 2070alleles were utilized0to acquire0data on0hereditary/decent0variety, populace
structure and marker-characteristic affiliations. Bunch investigation was performed
utilizing0UPGMA to0develop a dendrogram0from a pairwise0likeness/lattice. Pea
genotypes were partitioned into five noteworthy groups. A model-based populace
structure0investigation partitioned the pea0promotions into four0gatherings. Rate0lipid
content0in 35 assorted0pea0promotions was utilized0to discover0potential0relationship
with0the SSR0markers. Markers AD73, D21, and AA5 were fundamentally0connected
with0lipid/content0utilizing a blended0direct9model (MLM) taking0populace0structure
(Q) and0relative/family0relationship (K) into0account. The consequences0of this
preparatory0investigation proposed0that the populace0could be0utilized for0marker-
characteristic0affiliation/mapping thinks about.
45
Only1a few studies1on pea (Pisum sativum) investigated1the association1of
single0nucleotide0polymorphisms (SNP) markers0with key agronomic0traits. This study
aimed0to explore0the association0of a standard0set of 3840SNP with grain0yield, seed
protein content, seed weight, onset of flowering, plant height and lodging
susceptibility, in three connected bi-parental recombinant inbred line (RIL)
populations0including 900lines/each. These0RIL originated0from crosses0between three
cultivars that displayed high and stable grain yield across Italian environments,
namely, Attika (A), Isard (I), and Kaspa (K). The 270 lines were phenotyped0in a
spring-sown0environment of0Lodi (northern Italy; 45°19'N, 9°30'E). Variation0among
lines0within the0populations was significant (P < 0.01) in all0cases/except0lodging
susceptibility0in one0cross and, when0expressed in terms of0the genetic0coefficient of
variation, proved0moderately/large0for most0traits (including grain yield and seed
protein content). Overall, we detected0six quantitative0trait0loci (QTL) in the A × I
linkage/map, eight QTL in K × A, and nine QTL in K × I. Among them, there were
three QTL in K × A and two QTL in K × I for grain yield, and one QTL in A × I and
two QTL in both K × A and K × I for0seed protein0content. The consensus0map, which
included0130/markers (covering about 1094 cm), retained0one QTL0for grain0yield and
one0for flowering0time that0co-located on0LGII, and three0for seed0weight on0LGIII,
LGVI/and LGVII. The/QTL0co-locating for0yield and flowering0time explained08%
and 31% of the overall0phenotypic0variation, respectively, for0the two0traits, and0could
be0exploited in marker-assisted0selection for0adaptation to0the target0region (Ferrari et
al., 2016)
46
Genetic0diversity among023 newly0developed homosegregate0pea0lines (Pisum
sativum L.) was assessed0with a total of 13 expressed sequence tag (EST) based-simple
sequence/repeat (SSR) markers. The percentages0of/amplified0and non0amplified
primers were 92% and 8%, respectively, and 58.33% of the used primers0gave the0PCR
product0within the reported0size0range, while041.66% of0primers0gave a0different
product0size. Polymorphism0information0content (PIC), major0allele0frequency, and
variation0in genetic0diversity were calculated. The PIC0ranged from00.32 to00.63 with
an average0of 0.50. Major allele frequency0ranged from 0.48 to 0.78 with a mean value
of 0.56. The dissimilarity0in genetic0multiplicity between0these pea lines extended
from 0.36 to 0.68 by an unkind0value of 0.56. Cluster0analysis/based0on a0dendrogram
divided the 23 pea0lines into0two/main0groups (L-1 and L-2), separated0at 25% genetic
distance. Seven0subclusters were evident/from0these two0main/groups. L-1 grouped
51.2% (12 pea lines) while L-2 contained 47.8% (11 pea lines) of the total0analyzed
population. It was concluded0that EST-SSR0markers are convenient0for0improvement
of0the pea/association0map (Nisar et al., 2017).
Rana et al. (2017) stated0that pea (Pisum sativum L.) is one0of the0oldest
domesticated, highly valued and extensively cultivated pulse crops throughout the
world. They studied its genetic/structure, diversity and inter-relationships in a
worldwide0collection of0151 pea/accessions0using 21 morphological0descriptors and 20
simple0sequence0repeat (SSR) primers. Among0quantitative/traits, seed0yield/per0plant
followed0by seed/weight0and pod0length have shown0significant0variation. SSR0primers
showed0a high level0of diversity/and0amplified/a total0of 1790alleles with usual0of 8.95
alleles0each/primer0in a size/range0of 95–510 bp. Primer AA-122 amplified the
47
maximum (21) alleles0while/primer0AB-64 amplified0the/minimum (4) alleles. Mean
polymorphism information content (PIC) was 0.72. Observed heterozygosity (Ho)
varied from 0.10 to 0.99 in0primers AB-64 and AD-160, respectively, with a0mean
value0of 0.46. Expected0heterozygosity (He) ranged from 0.47 to 0.94 in primers0C-20
and0AA-122, with a mean of00.75. Genetic0relationships/inferred0from a0neighbor
joining0tree separated0accessions into030groups. Bayesianmodel-based0STRUCTURE
analysis0detected 30gene/pools0for the analyzed0pea germplasm0and showed/a high
admixture0within/individual0accessions. Furthermore, STRUCTURE0analysis0showed
that these03 gene/pools co-existed in accessions0belonging to different0geographic
regions indicating frequent transference and exchange of pea germplasm during its
domestication/history.
48
Chapter 03
MATERIAL AND METHODS
These studies were c0nducted during 2015 and 2016 at the University 0f
P00nch Rawa1ak0t, Azad Kashmir. The 1andraces were c011ected fr0m different
locations of district Poonch (Banjosa, Devi gali, Jandali, Dhoke, and Rawalakot), Bagh
(Harigal, Sudhan Gali, Mallot, and Dirkot), Sudhnoti (Trarkhal, Mang, Bloch, and
Plandri), Mirpur and Plant Genetic Resource Institute, NARC, Islamabad.
Seventy five landraces0of0field peas (Pisum sativum L.) were0planted in the
field0following augmented design and one local check variety (Meteor) was used for
the comparison of germplasm and planted 5 times after every 20 landraces. Prior0to
planting, the0field was/prepared by using/standard agronomic practices. Seeds for each
entry were sown in single rows. Sowing was practiced by keeping row0to/row/distance
of060cm and plant0to plant0distance/of 30cm. The fertilizer doses containing nitrogen
(N), phosphorus (P2O5) and potassium (K2O) were/applied/at 30, 45, 50 kg ha-1 in/the
form0of0N, P2O5 and1K2O, respectively. Weeding was done at 2-3 leaf stage, medium
height stage and at pod formation stage. Recommended agronomic practices were
performed from sowing till maturity.
3.1.1. Meteorological Information of locations
3.1.1.1. Poonch District
Poonch/is/located0at/33.77°N 74.1°E. It has/an average elevation of 981 metres
(3218 feet). Poonch has a humid subtropical climate because of its moderately high
elevation0and northerly0position. Winters0are cool, with day time a January normal of
2-6 °C (36.5 °F), and0temperatures below0freezing at0night. Summers are short0and
49
usually p1easant. The0summer1temperature generally d0es n0t rise ab0ve031 °C.
Winters are cool and characterized by rainfall due t0 western disturbances. The
average annua1 rainfall is 674.7 mm. Snowfall is quite common during the months of
January and February.
3.1.1.2. Bagh District
The general0elevation is between 1500 and 2500 meters above0sea level. The
aggregate9area0of the district is 770 square0kilometers. The climate0of0the0region
fluctuates with0height. The temperature for the most0part stays between 2 °C to 40 °C.
The main1eastern0part of the0region is exceptionally cool in winter0and moderate in
summer. May, June and July are the hottest months. Maximum and minimum
temperatures during the-month0of June are about040 °C and 22 °C, respectively.
December, January0and February are the coldest0months. The maximum0temperature
in January is about 16 °C and minimum-temperature is 3 °C, respectively. About0594
mm of precipitation falls annually, mostly during monsoon months.
3.1.1.3. Sudhnoti District
Sudhnoti is situated at Latitude 33° 42′ 54″ N, Longitude 73° 41′ 9″ E. The
aggregate0area of the region is 569 square0kilometers. Climate of0the region fluctuates
with/the height00f the area. Temperature0in0summer is nearly020 to 35 °C and in winter
2 °C. In winter, one may see snow on the close-by Mountains. Snowfall occurs in
December0and0January, while0most rainfall0occurs during the monsoon season from
July0to September. Snowfall0occurs in December and January, while0most rainfall (72
mm) occurs during the monsoon0season from0July to0September.
50
3.1.1.4. Mirpur District
Mirpur City is at 459 m above sea level. It is the0headquarters of Mirpur
District. The latitude of Mirpur is 33.148392, and the0longitude is 73.751770. Mirpur
City, is located1at Pakistan country map in the1Cities place category with the GPS
coordinates0of 33° 8' 54.2112'' N and 73° 45' 6.3720'' E. Mirpur0elevation is 32000
meters height, that is equal to 104,987 feet. The average annual temperature is 27.4 °C.
The average annual rainfall is 109 mm. Mirpur has a climate that is extremely hot and
dry0during summer, making it very similar0to the Pakistani-areas of Jehlum and Gujar
Khan.
3.1.1.5. NARC Islamabad
National-Agricultural-Research-Centre (NARC), Islamabad, is the largest0research
centre0of the Pakistan Agricultural Research0Council (PARC). NARC, with a0total land
area of0approximately 1400 acres, is located0near Rawal-Lake, six0kilometers South-
East0of0Islamabad.
• Latitude: 33°37'N.
• Longitude: 73°5'E.
• Latitude & Longitude for Islamabad, Pakistan in decimal degrees: 33.6°, 73.1°.
• Altitude/ elevation: 508 m (1667 ft).
51
Table.3.1.1: Genotypes selected for morphological studies
FIELD EXPERIMENT
The experiment-was carried 0ut in Augmented-design f0r the m0rph0l0gical
studies. This experiment-was repeated f0r tw0 years (2015 and 2016).
EXPERIMENT No: 01
3.1. MORPHOLOGICAL STUDIES
Morphological study was divided in two parts
Landraces Locat ion Landraces Locat ion Landraces Locat ion L 1 Meteor L 2 6 T rarkhal 3 L 5 1 P landr i 3
L 2 B an j o sa L 2 7 Mang L 5 2 P land r i 4
L 3 B an jo sa 1 L 2 8 Mang 1 L 5 3 Har iga l 1
L 4 B an jo sa 2 L 2 9 Mang 2 L 5 4 Har iga l 2
L 5 B an jo sa 3 L 3 0 Mang 3 L 5 5 Har iga l 3
L 6 Dev i ga l i L 3 1 B lo ch L 5 6 Har iga l 4
L 7 D e v i g a l i 1 L 3 2 B lo ch 1 L 5 7 S .ga l i
L 8 D e v i g a l i 2 L 3 3 B lo ch 2 L 5 8 S .ga l i 1
L 9 D e v i g a l i 3 L 3 4 B lo ch 3 L 5 9 S .ga l i 2
L 1 0 J and a l i M 25 NARC L6 0 Meteor L 1 1 J and a l i 1 M 116 NARC L 6 1 S .ga l i 3
L 1 2 J and a l i 2 M 1 0 2 NARC L 6 2 Ma l l o t
L 1 3 J and a l i 3 M 9 1 NARC L 6 3 Ma l l o t 1
L 1 4 Dho ke M 0 7 NARC L 6 4 Ma l l o t 2
L 1 5 Dho ke 1 M 8 3 NARC L 6 5 Ma l l o t 3
L 1 6 Dho ke 2 M 2 2 NARC L 6 6 D i r ko t
L 1 7 Dho ke 3 M 72 NARC L 6 7 D i r ko t 1
L 1 8 R.ko t 1 M 3 9 NARC L 6 8 D i r ko t 2
L 1 9 R.ko t 2 M 8 6 NARC L 6 9 D i r ko t 3
L 2 0 Meteor M 0 8 NARC L 7 0 M i r p u r
L 2 1 R.ko t 2 M 7 9 NARC L 7 1 M i r p u r 1
L 2 2 R.ko t 3 L 4 7 NARC L 7 2 M i r p u r 2
L 2 3 Tra rkha l L 4 8 P land r i L 7 3 M i r p u r 3
L 2 4 Tr a r k h a l 1 L 4 9 P landr i 1 L 7 4 M i r p u r 4
L 2 5 Tr a r k h a l 2 L 5 0 P landr i 2 L 7 5 M i r p u r 5
52
3.1.1. Qualitative study
3.1.2. Quantitative study
3.1.1. Qualitative study: F0ll0wing parameters were included
1. Gr0wth vig0r
2. Fl0wer c0l0r
3. P0d shape
4. P0d c0l0r
5. Seed Shape
6. Seed C0l0r
Procedure for data collection
1. Growth vigor
Gr0wth vig0r 0f the plant was n0ted by visual 0bservati0n and was n0ted as P,
M, E, f0r p00r, m0derate and excellent.
2. Flower color
After 4-6 weeks 0f planting, fl0wer c0l0r 0f each plant was n0ted by visual
observation. 1, 3 and 7 c0des were used for pure-white, pink and purple-respectively.
3. Pod shape
P0d shape was n0ted by visual 0bservati0n as 3 and 5 c0des were used for
inflated and c0nstricted.
4. Pod color
C0l0r 0f each p0d was n0ted by visual 0bservati0n as 3, 5, 7 for pale-green,
intermediate green and dark-green.
53
5. Seed shape
Seed shape was n0ted by visual 0bservati0n as 3 and 5 f0r r0und and wrinkled.
6. Seed color
Seed c0l0rs were n0ted by visual 0bservati0n as 3, 5, 7 f0r green, yell0w and
br0wn.
3.1.2. Quantitative Study
1. Germination percentage
2. Plant height (cm).
3. Number 0f leaves plant-1.
4. Leaf area (cm2)
5. Leaf length (cm)
6. Leaf width (cm)
7. Days t0 fl0wering initiati0n
8. Days fl0wering c0mpleti0n
9. Days t0 p0d f0rmati0n
10. Number 0f p0ds plant-1
11. P0d length (cm)
12. P0d width (cm)
13. Number 0f seed p0d-1
14. 100-seed weight (g)
15. Seed yield (kg ha-1)
54
Procedure for data collection
1. Germination percentage
Ten (10) seeds 0f each plant were s0wn and after 3 weeks, germinati0n
percentage was calculated.
Germination %age= No. of plant germinate×100 Total seeds sown
2. Plant1height (cm)
Plant height was measure with help of measuring tape from the soil
surface/t0 the/t0p 0f plant/and/then/average was w0rked 0ut.
3. Number/of/leaves/plant-1
T0tal number 0f leaves plant-1 were c0unted at the physi0l0gical
maturity stage fr0m rand0mly selected five plants and average was calculated.
4. Leaf area (cm2)
Leaf0area was measured1with the help/0f leaf area meter.
5. Leaf length (cm)
Leaf1length was/measured with/help/of meter/rod.
6. Leaf width (cm)
Leaf1width was measured with0help/of/meter/rod.
7. Days to flowering initiation
Days1to flowering0initiation were counted0from date/of sowing in each
plot.
8. Days to flowering completion
Days1to flowering completion were counted0from date of/sowing in
each0plot.
55
9. Days to pod formation
Days/were c0unted fr0m germinati0n upt0 50% 0f p0d f0rmati0n.
10. Number of pods plant-1
T0tal0number 0f p0ds/plant -1 was c0unted at 3-4 days interval and/average
was0calculated.
11. Pod length (cm)
P0d/length/was/measured/with/help/0f measuring/tape/and then average
was/w0rked 0ut.
12. Pod width (cm)
P0d width was/measured/with/help 0f measuring/tape/and then average
was/w0rked 0ut.
13. Number of seed pod-1
Number/of seeds of average0f rand0mly selected 20 ripened p0ds was
calculated.
14. 100 dry seed weight (g).
The 100 seed weight of each gen0type was measured by using t0p
l0ading balance/in/grams.
15. Seed yield (kg ha-1)
Seed yield in each pl0t was calculated by weighing the seeds 0n 0pen
pan/balance/and/was c0nverted it int0 kg per/hectare.
56
Experiment No: 02
3.2). BIOCHEMICAL STUDY
Table. 3.2.1: Gen0types selected f0r Bi0chemical and m0lecular study:
On the basis 0f best m0rph0l0gical perf0rmance, 46 genotypes were selected
for biochemical-and molecular-analysis:
Landraces Locat ion Landraces Locat ion
L 1 Meteor M0 7 NARC L 2 Banjosa M8 3 NARC L 3 Banjosa M2 2 NARC L 4 Dev i gal i M7 2 NARC L 5 Dev i gal i M3 9 NARC L 6 Jandal i M8 6 NARC L 7 Jandal i M0 8 NARC L 8 Dhoke M7 9 NARC L 9 Dhoke L3 2 P landr i L 1 0 R.kot L3 3 P landr i L 1 1 R.kot L3 4 Har igal L 1 2 R.kot L3 5 Har igal L 1 3 R.kot L3 6 S .gal i L 1 4 Trarkhal L3 7 S .gal i L 1 5 Trarkhal L3 8 Mal lo t L 1 6 Mang L3 9 Mal lo t L 1 7 Mang L4 0 D i rkot L 1 8 B loch L4 1 D i rkot L 1 9 B loch L4 2 Mi rpur M 2 5 NARC L4 3 Mi rpur M 1 1 6 NARC L4 4 Mi rpur M 1 0 2 NARC L4 5 Mi rpur M 9 1 NARC L4 6 Mi rpur
57
3.2.1. Moisture Content (%)
T0tal m0isture c0ntent 0f seed was determined0by/the meth0d 0f0AOAC
(1994). Two gram fruit sample was taken in petridish and placed it in 0ven at 130oC
for/1 h0ur. After/1 h0ur ample was rem0ved fr0m 0ven and was kept in dessicat0r and
weighed0again. The l0ss in weight was rep0rted as percent m0isture.
Moisture (%) = Weight of fresh sample – Weight of sample after drying×100
Weight of sample
3.2.2. Crude Fat (%)
Fat1content 0f the/sample was determined acc0rding t0 the Soxhlet1extraction
meth0d (AOAC, 1994). A sample0of 7-80g was taken0and kept/in thimble 0n0the
Soxhlet0at165-70oC. Difference-between the weight 0f the r0und b0tt0m flask bef0re
and after extracti0n was rec0rded as the weight 0f the fat extracted.
Crude fat (%) = Weight of beaker with fat – Weight of empty beaker ×100 Weight of original sample
3.2.3. Crude Fiber (%)
Crude0fiber c0ntent was determined0by the meth0d 0f AOAC (1994). Tw0
gram sample was taken fr0m 0il extracted sample and 200 ml H2SO4 (0.255 N) was
added0in/it. The sample was/heated0then kept f0r 300minutes at r00m0temperature. The
sample/was filtered0and residues were collected in another0beaker carefully. About0200
ml NaOH (0.313 N) was added in it and heated till boiling. Then residues were
collected0in crucible and placed1in0oven/at 130 oC for02 hours. After0drying, the sample
was weighed and kept/in furnace/for 3qhours at0550-600 oC. The sample was weight
after0ashing.
58
% crude fiber = (W2 – W3) Weight/of/sample
Where W2 = weight/of/crucible + sample after boiling, washing and drying
W3 = weight/of/crucible × sample/and/ash
3.2.4. Crude Protein (%)
Prt0ein c0ntent were/estimated0by Kjeldhal1Meth0d as0described by1AOAC (1994).
The sample0was weighed/and transferred t0 the/digesti0n/flask. Added 2-3/g digesti0n
mixture0and 250ml c0ncentrated sulphuric acid0and sample was digested. The flask was
rem0ved, co0led and transferred material t0 the 250 ml vl0umetric flask and rinsed
with/small-am0unt 0f water/and/then v0lume was made up. 500ml material0was0taken
and 10 ml str0ng alkali was added till s0lution bec0me alkaline. The material was
distilled int0 250ml 4% b0ric0acid s0lution using0methyl red as0an indicat0r. Finally
material was titrated/with H2SO4 soluti0n. Nitr0gen c0ntent was estimated0as under:
% � =1.4 �V2 − V1�x Normality of HCl x �dilution�
Weight of sample x 100
% Protein = % N x conversion factor (6.25)
3.2.5. Carbohydrate (%)
Carbohydrate1percentage was estimated by the meth0d as described by AOAC
(1990).
% carb0hydrate = 100 - % (crude pr0tein + ash + m0isture + crude fat).
59
3.2.6. Chlorophyll Content (mg/g)
Chlorophyll0content was0estimated0from fresh0leaves, collected0from0base,
middle0and apex0of every0selected0plant from0each0population0under study. Three0leaf
samples0from0each plant were subjected to0experiment. Leaf0cutting of 1 cm2 was
soaked0in 5 ml ethanol0in test-tube for0each sample0and left for0overnight. Next0day
greenish0liquid from0each test0tube was collected0in cavetti and optical0density of that
mixture was taken0at two0different wavelengths0of 663 nm for0chlorophyll A and 645
nm for chlorophyll B at spectrophotometer. Observations of optical densities for
chlorophyll0A and chlorophyll0B from0all the0samples were taken0and their0mean were
obtained. These0values were subjected0to the following0formula for0the final0evaluation
of total0concentration of chlorophyll0for receptive0replication of selected0populations.
Total chlorophyll = 8.0 × O.D at 663 nm +20.2 × O.D at 645 nm
3.2.7. Ash content (%)
Ash c0ntent was determined0by0AOAC (1994). Weight of sample was taken0in
crucible and was placed in open flame to start burning for removal of smoke and
smell. When/smoke was finished0it was kept0in/furnace0at 600oC0for/three0hours. After
removal, it/was/kept0in desicat0r0and/then measured.
Ash% = Weight of sample after ashing x 100 Weight of sample
3.2.8. Phenolic content (mg/g)
T0tal phen0lic c0ntent (TPC) was/determined/by a F0lin-ci0calteu assay/using
gallic0acid (GA) as/the/standard (Singleton et al., 2000). The mixture 0f the sample
s0luti0n (501μL), distilled water (30ml), 250/μL 0f F0lin-ci0calteu’s reagents/s0luti0n
and/70% Na2CO3 (750 μL) was v0rtexed and incubated f0r 8 min at r0om temperature.
60
Then, a dose0of/9500μL of0distilled0water/was added. The0mixture was allowed0to0stand
for02 hr0at room0temperature. The0absorbance was measured0at 765 nm against0distilled
water0as a0blank. The total0phenol0content was expressed0as gallic0acid0equivalents (mg
of0GAE/g0sample) through0the calibration0curve of gallic0acid. Linearity0calibration
curve was 50 to 1000 µg/ml (r = 0.99).
3.2.9. pH
pH was measured with the help 0f digital pH meter. pH of pea plant was
determined by/making 0f extract/0f 1 : 2.5 (pea/extract/and/water) in H0rticulture Lab,
The University 0f P00nch Rawalak0t. Electrode0of pH0meter was inserted0in the
mixture/and/reading/was rec0rded 0n pH meter.
3.2.10. Total Soluble Solid (TSS) %
T0tal s0luble s0lids was determined acc0rding t0 the Ass0ciati0n 0f Official
Analytical Chemists (AOAC, 1994) using a digital refract0meter m0del PA-202
(Misco, USA). at r00m temperature. One1drop of extracted-juice fr0m each sample
was placed 0n abs0lutely dry refract0meter prism and readings were rec0rded in
percent Brix.
61
3.3. MOLECULAR STUDIES
3.3.1. Extraction of genomic DNA
Genomic0DNA isolation0method of Doyle0and/Doyle, (1987) was/utilized; one
or0two/leaves0of every/landrace were1ground/to0fine powder1using liquid0nitrogen.
These0finely/ground samples, were0taken in/a01.5mL/Eppendorf1tube and 1000µL of
CTAB0buffer was/mixed to0it. The samples0were then heated for030 minutes0at 65°C,
followed0by the incorporation0of 0.75mL of CIA (24:1). Then samples were vortexed
to0mix the0contents and spin0at 10,000xg for/100minutes, upper0most/layers/from0each
tube was moved0to a fresh01.5mL Eppendorf0tube. Refrigerated0propanol was mixed to
supernatant, heated for 10 minutes at normal temperature and tubes were shaked by
turning0upside0down. The samples were vortexed0again at 10,000xg for010 minutes.
Aliquoit0was then taken0out and pellet0was treated with070% ethanol0following
centrifugation0at 10,000xg for 50minutes. DNA0pellet was air/dried for 10-15 minutes
and was re-suspended0in 50µL of TE0buffer. Quantification0and dilutions/of DNA/up
to required0level were prepared1prior to/PCR.
3.3.2. Quantification and visualization of DNA
The DNA was quantified0through optical0density (O.D.) at0A260 and0A280
with0a UV/Mass0spectrophotometer. Samples/were subjected0to/electrophoresis0in 1×
TBE0buffer for01 hour at080 V. 5 μL of the isolated0genomic DNA was loaded0on 1 and
2% Agarose0gel stained0with ethidium1bromide to0check/DNA0quality. The/gel was
photographed/under0a Gel/Documentation0system.
62
3.3.3. Conditions optimized for SSR analysis:
The primer0pairs were used0in polymerase0chain reaction for all0genotypes. For
simple0sequence/repeat0analysis/concentration0of/genomic0DNA, MgCl2, dNTPs, Taq
DNA0polymerase, 10x/PCR0buffer, forward0and/reverse0primers/were optimized.
3.3.4. PCR (polymerase/chain/reaction)
Following concentration of PCR reagents were used to make the final reaction
mixture of 20 µL (1x).
Table.3.3.1: Layout for PCR Master Mix
Reagents Concentration Volume Template1DNA 10 mg 2.0 µL0 DNTPs1 2.5 mM1 4.0 µL0 Buffer1 10X 2.0 µL1 MgCl21 25 mM1 1.6 µL1 Primer–F1 20 µM 1.5 µL1 Primer-R1 20 µM 1.5 µL1 DNA Taq/Polymerase 5Uint/µL 0.25 µL1 Double/distilled H2O1 7.15µL Total Volume0 20µL
63
3.3.4. SSR (PCR) Profile
PCR/was carried0out in BIOMETRA1PCR/machine MJ mini personal thermal
cycler (BIORAD). Polymerase1chain0reaction0profile0used0to0amplify0the0genomic
DNA/as follows:
3.3.5. Different/steps/of/PCR
Temperature of PCR steps were changed according to primer nature.
• Heating0Lid (100°C0for 4:000minutes)
• Initial0Denaturation (95°C/for 3:00/minutes)
• Denaturation (94°C0for 00:300seconds)
• Annealing0step (48-55°C0for/00:300seconds) 35/Cycles
• Extension/elongation0step (72°C0for/1:00/minute)
• Final0Extension (72°C0for 10:000minutes)
• Hold0and End (4 0C forever)
3.3.5. Primer Sequences for microsatellite SSR Analysis
Following0primer0combinations0were0utilized0to0validate0the0presence0or
absence/of/variability/among different/landraces of pea.
64
Table. 3.3.2. List of 20 SSR primers along with forward and reverse sequence
used in this study
Sr.No. Primer Forward sequence Reverse sequence
1 AC58 Tccgcaatttggtaacactg Cgtccatttcttttatgctgag
2 AD270 Ctcatctgatgcgttggattag Aggttggatttgttgtttgttg
3 AA335 Acgcacacgcttagatagaaat Atccaccataagttttggcata
4 AB53 Cgtcgttgttgccggtag Aaacacgtcatctcgacctgc
5 AA205 Tacgcaatcatagagtttggaa Aatcaagtcaatgaaacaagca
6 AA163.2 Tagtttccaattcaatcgacca agtgtattgtaaatgcacaaggg
7 AA92 Aaggtctgaagctgaacctgaagg Gcagcccacagaagtgcttcaa
8 D21 Tattctcctccaaaatttcctt Gtcaaaattagccaaattcctc
9 AD148 Gaaacatcattgtgtcttcttg Ttccatcacttgattgataaac
10 AA285 Tcgcctaatctagatgagaata Cttaacattttaggtcttggag
11 AD147 Agcccaagtttcttctgaatcc Aaattcgcagagcgtttgttac
12 AA175 Ttgaaggaacacaatcagcgac Tgcgcaccaaactaccataatc
13 AD83 Cacatgagcgtgtgtatggtaa Gggataagaagagggagcaaat
14 AD73 Cagctggattcaatcattggtg Atgagtaatccgacgatgcctt
15 AB141 Atcccaatactcccaccaatgtt agacttaggcttcccttctacgactt
16 AB72 Atctcatgttcaacttgcaaccttta Ttcaaaacacgcaagttttctga
17 AA103 Aagtgtgaaagtttgccaggtc Cgggtacgggttatgttgtc
18 AA67 Cccatgtgaaattctcttgaaga Gcatttcacttgatgaaatttcg
19 AD51 Atgaagtaggcatagcgaagat Gattaaataaagttcgatggcg
20 AA90 Cccttaccatatttcgtttct Tgcgactccattctagtattg
3.3.6. Gel Electrophoresis
The agarose1gel/was/prepared/by/using/TBE/buffer, visualized0under UV light
by0Etidium bromide staining, gel documentation system was used for taking
65
photograph. Amplified0DNA0fragments/in PCR/were electrophoresed0on Agarose0gels
(3.0 % using0TBE0buffer (0.5X).
3.3.7. Methodology9
1. Three gram of Agarose was added in flask containing 100ml electrophoresis
buffer (0.5X/TBE).
2. The/Agarose/was melted in0microwave/oven0for/30minutes/and/was swirled/to
ensure even mixing.
3. The melted agarose was cooled down by keeping it under tap water with
constant0shaking.
4. Three0µl ethidium1bromide (0.50µl/ml) was added0to flask/containing0melted
agarose.
5. The melted1agarose was poured/in casting0tray by inserting/the gel0comb0and
all/bubbles on0the/surface0of the1agarose was removed/using/micro/tip/before
the gel/will /set.
6. It was kept at/room0temperature/for/15-200minutes/for0solidification.
7. The gel0casting0tray/containing/solidified/gel/was placed/in/the0electrophoresis
tank.
8. Sufficient/electrophoresis0buffer/was/added to cover the/gel.
9. Three/µl 6X0loading0dye (Bromophenol0Blue) was/added in each/PCR0product.
10. The samples (8 µl) were loaded0into/the wells by using a0micropipette.
11. 2µl or 3µl of 100bp DNA/ladder/was/run/along/with/the/samples.
66
12. The voltage was adjusted at 80V to start the electrophoresis and was turn off
when0the loading0dye was migrating to the0end of the0gel for the separation of
DNA0fragments.
13. The gel for variable bands was visualized using gel documentation system
attached0with0computer/having DNA analysis packages/and photographs were
taken1for/references.
14. Scoring0of gel bands0for marker0alleles; The DNA0bands were scored as ‘1’ for
present0band and absent0band was scored as ‘0’ for each0marker.
3.3.8. Statistical/analysis1
The collected/data/for/morphological1and biochemical1traits/were analyzed0to
determine the phenotypic correlation coefficients among various parameters using
SPSS 16.1. Mean0values of/the0agronomic/and biochemical/traits1for/genotypes0were
standardized1and1used/for0computing Euclidean distances between them. Dendrogram
was formed/by1using computer0software PAST. Principal0component0analyses (PCA)
and cluster0analyses were used0to obtain Euclidean0distances between0genotypes and0to
characterize0the relation0to the most0discriminating0traits.
For molecular0analysis, all0the0monomorphic and polymorphic bands were
scored. Only0unambiguous bands were used0in the0analysis. Each band was given0score
of 1 for presence/of polymorphism1and 0 for1absence. Similarities1between0cultivars
were estimated using the numerical taxonomy based software NTSYS-pc (Rohlf,
2000). The dendrogram1based on dissimilarity/matrix was done/using unweighted pair
group0method with arithmetic1averages (UPGMA).
67
Chapter 04
RESULTS AND DISSCUSION
4.1. Morphological Studies
4.1.1.1. Growth vigour
Landraces with 90-100% plant vigor was marked excellent and ranked as 1,
with 80-89% plant vigor marked very good and ranked as 2, with 70-79% plant vigor
marked good and ranked as 3. Appendices No. 11 shows that maximum value of
growth vigor was found for genotypes, L-8, L-9, L-10, L-34, L-47, L-48, L-49, L-50,
L-56, L-57, L-66, L-67, L-68, L-69, L-74 and M-86. Minimum value of growth vigor
was found in L-1, L-2, L-3, L-7, L-14, l-20, L-23, L-25, L-64, M-25, M-91 and M-102
respectively. Genotypes L-5, L-11, L-15, L-49, M-8 and M-82 were showing0moderate
values for growth vigor. Initial seedling vigour plays in important role for
establishment0of normal0crop. Raje (1992) has reported0positive0association0of0seed
size0with vigor0index in0gram. Seedling0vigour is a complex character which is
administered0by numerous0parameters and a critical0trait in seed0technology. Initial
seedling0vigour plays an important0role for0high planting0value of0seed lot0and early
establishment0of0crops (Jain et al., 1998). In chickpea, early0growth and0vigour can be
important0in providing0increased0biomass. Considerable0losses are observed0because of
stiff0competition of0the crop0with0weeds. Particularly0in irrigated and0late-sown
conditions (Lather0et al., 1997). Oudhia0et al., (1997) reported early0establishment of
the crop0to reduce0early crop0weed0competition. The establishment0of healthy0seedling
is important0for successful0production of0any0crop (Matthews et al., 1988). Poor0vigour
call0decrease yields0in two0ways: first. Decreased0emergence may0lead to0sub-optimal
populations0of0irregularly0distributed0plants: secondly, those0seedlings0which0do
68
emerge0grow more0slowly and under0some circumstances. This0can affect final0yields.
The experimental material exhibited significant differences in the field when data was
recorded on plant vigor based on their vegetative growth. Muehlbauer and McPhee,
(1997) also reported that maximum0yield requires0maximum vegetative0growth during
the establishment0of crop0growth.
4.1.1.2. Flower colour purple and white
The values of flower colour were ranging from 1 (white) to 7 (purple).
Appendices No.11 shows that white colour flowers was found for genotypes, L-8, L-9,
L10, L-34, L-47, L-48, L-49, L-50, L-56, L-57, L-66, L-67, L-68, L-69, L-74 and M-
86, whereas purple colour was found in L-1, L-2, L-3, L-4, L-14, L-21, L-22, L-23, L-
24 respectively. Mendel noticed that coloured0seed-coats were always connected
with0coloured (purple) blossoms. He likewise noticed that these coloured0assortments
had pigmentation in the leaf axils. Then again, an unmistakable or dreary testa was
constantly connected with0white blossoms and0the non-appearance of0pigmentation in
the leaf0axils, proposing that0these were pleiotropic0effects of0a single0gene. In0pea, as
in numerous different0plants, the0red, purple0or blue0pigmentation is because of the
amassing of0anthocyanin0compounds. The mutation0in (a) gene cancels anthocyanin
pigmentation0all through the0plant. The discovery that0A was potentially0a0regulatory-
gene0controlling the spatial0expression of0different members0of a structural0multi-gene
family, at the0time, was an exciting0finding. A0gene that0encodes a basic0helix–loop–
helix (bHLH) transcription0factor was identified0as a candidate0gene for0the A0locus
through0comparative0genomics (Hellens0et al., 2010).
69
4.1.1.3. Green and yellow pod (Gp versus gp)
The pod colour remains green in all genotypes. Of Mendel’s three genes that
have not been sequenced, the colour of the immature pods have possibly become the
greatest consideration. For the duration of 1980s there were detailed studies on the
movement of the gene Gp, which controls the green/yellow colour of the pods. Price et
al. (1988) considered the organizational and physical foundation of this alteration and
that the yellow0pod (gp) mutation0resulted in the mesocarp0containing plastids0with an
internal0membrane system constrained0to solitary and paired0membranes. Not0at all the
plastids0of green0pods (Gp), the mutant0form needed grana0and contained0only 5% of
the chlorophyll of the wild type green pods. The synteny between the pea and
Medicago0genomes and the identification0of genes in other0species that are known0to
outcome in tissue-specific regulation of chloroplast development, it might now be
conceivable to recognize candidate genes that may control the green/yellow pod
colour0transformation (Reid and Ross, 2011).
4.1.1.2. Inflated and constricted pod
The values of pod shape were ranging from 1 (inflated), 5 (constricted).
Inflated pods were found in genotypes (CH, L-1, L-2, L-3, L-4, L-13, L-14, L-15, L-
16, L-29, L-32,L-50 and L-53, whereas constricted pod were found in genotypes (L-5,
L-6, L-7, L-8, L-9, L-10, L-11, L-12, L-17, L-18, L-19, and L-20 respectively)
(Appendices No.11). Mendel (1866) mentioned0to the form of the ripe0pod as also over
stated or0deeply constricted (with the pod being quite wrinkled in appearance). Wild-
type0pods are over stated, with a complete0layer of sclerenchyma0on the inside0of the
70
pod0wall. There0are0two0different0single-gene0recessive0mutants, p and v, that lack a
complete layer of0sclerenchyma in the endocarp0of the mature pod, and their pods0are
deeply0constricted because they are inflated0only in those0zones where the seeds0have
occupied. These pods are comestible while undeveloped and are mentioned to as sugar
pods. The over stated against constricted pod phenotype refers to the existence or
absence0of a layer0of lignified0cells (sclerenchyma) adjoining0the epidermis of the0pod
wall0and is referred0to as0parchment. Such pods0without ‘rough0skinny0membrane’
were previously0defined in Herball, and in general0this cell0layer is0absent in0vegetable
pea0types where the whole0pod is0eaten. Absence of these cell layer pointers to a pod
that is constricted0around the seeds at0maturity. Mendel mentioned to peas with this
pod characteristic as P. saccharatum proposing that he used a ‘sugar snap’ type. There
are two0possible genes0involved and it is tough0to be sure which0locus Mendel was
learning0because homozygous0individuals resounding0mutations in either0of the0two
genes0P or V lack0this cell0layer (Ellis et al., 2011). This0trait has obviously0received
less attention0than any of0the other0seven traits0of Mendel, creating the prediction0of
supposed0candidate genes0difficult (Reid & Ross 2011).
4.1.1.5. Round versus wrinkled (R versus r) seeds.
The values of seed shape were ranging from 1 (Round), 5 (Wrinkled).
(Appendices No: 11). Round shape seed were observed in genotypes (CH, L-1, L-2, L-
3, L-4, L-13, L-14, L-15, L-16, L-29, L-32,L-50 and L-53, whereas wrinkled seed
were found in genotypes (L-5, L-6, L-7, L-8, L-9, L-10, L-11, L-12, L-17, L-18, L-19,
and L-20 respectively). Wrinkled seeds0possess higher0sucrose, fructose, and0glucose
levels0on expenditure of0starch, and these effects in higher0water content0in0immature
71
seeds0due to amplified osmotic0pressure and0hence water uptake. Moreover, the
wrinkled0seeds contain a higher level of lipids and a reduced percentage of some
storage0proteins such as0legumin. Given the wide0range of pleiotropic0characteristics
that result0from a change0at the R0locus, it appeared0possible that R0is a0regulatory-
gene that controls multiple structural genes, leading to the wide range of unlike
characteristics. However, the biochemical0indication accumulated0to date well-known
that the primary0lesion in r0embryos was in starch0biosynthesis. This trait0results in the
failure of sugars0to starch conversion and was the first gene0recognized by0biochemical
method. Today0there are known0to be numerous0genes in pea that0discuss a0crumpled
or0wrinkled (rugosus) phenotype0and all are lesions0in unalike0enzymes involved0in
starch0biosynthesis. However, only the r mutant is known to have been obtainable0to
Mendel (Ellis et al., 2011). Thus the first of Mendel’s mutants to be categorized
corresponded0to a mutation0in a gene0encrypting a biosynthetic0enzyme and it was
connected with anvigorous0transposon (Bhattacharyya et al., 1990).
4.1.1.6. Yellow and green seed colour
The values of seed colour were ranging from 1 (green), 5 (yellow) and 7
(brown). Green colour were (CH, L-5, L-6, L-7, L-8, L-9, L-10, L-11, L-12, L-13, L-
14, L-15, L-16, L-17, L-18, L-20,L-66, L-67, L-68, L-69, L-71, L-72, L-73 and L-74,
whereas yellow colour seed were found in genotypes (L-70, M-07, M-08, M-91, and
M-25 respectively. Brown colour was observed in L-1, L-2, L-3, L-4, L-21, L-22, L-
23, and L-24 (Appendices No.11). Another of Mendel’s genes to be sequenced was the
gene accountable for cotyledon colour. This gene was assign0the symbol I by White
(1917). Ripe wild-type (II) seeds are yellow because of the point that the0chlorophyll is
72
lost as the seeds develop, while (ii) seeds stay. This division0can be realized through
the seed0coat; however0is strongest0if the testa0is expatriate. The phenotype0is to0some
degree0variable: wild-type0seeds that dry0out early0once in a while0hold green0shading,
though0green ii seeds can infrequently0fade (Ellis et al., 2011). It was demonstrated
that not0exclusively do the0cotyledons in pea0display a green0shading in the0advanced,
dry seed as0announced by Mendel (1866), but also0senescing leaves0stay green, as do
removed0leaves location0in the0dark (Armstead et al., 2007; Sato et al., 2007; Aubry et
al., 2008). This was the result of0reduced chlorophyll0breakdown during0dark-
incubation (Sato et al., 2007). The matching0gene; homolog0of Stay-Green (SGR) has
been recognized0based on contender0gene approach0using knowledge0from rice0and
Arabidopsis. SGR seems to direct0chlorophyll to the degradation0trail (Armstead et al.,
2007; Sato et al., 2007). However, they provide no indication that this was certainly
the precise mutation that Mendel had used.
4.1.2. Quantitative Study
Seventy five landraces of peas were compared for yield and yield related
characters for two consecutive years (2015-2016). Five randomly selected plants from
each landraces were used to data collection and avareage values were computed for
analysis. The data regarding to germination percentage, plant height, number of leaves,
leaf length, leaf width, leaf area, flowering initition, flowering completion, pod
formation, number of pods per plant, pod length, pod width, seed per pod, 100 seed
weight, and yield are presented in Appendices No. 12.
73
4.1.2.1. Seed Germination
Table 4.1.1 showed mean values for germination percentage. Mean values for
germination percentage ranged from 70% to 90%. Maximum value was recorded for
M-25, M-102, M-91 and M-72 (90%). Minimum value (70%) was observed for L-16,
L-18, M-86, L-47 and L-48.All other landraces remained transitional in performance
with regard to this trait. It is evident from the results that the cultivars differed
significantly for seed germination percentage. Seed0germination and seedling0vigour
are influenced by physiological0age of the seed0at harvest and subsequent0handling
(Muehlbauer and McPhee, 1997). The seeds collected 28 days after anthesis
accomplished, attained0complete viability. If the seed is harvested0earlier than the
proper0maturity-stage, it may result in its reduced0viability0or in other0words, younger
the seed at harvest, lower will be the0viability. Besides harvesting0time, harvesting and
threshing0methods and storage0conditions also affect the seed0viability which affects
the seed0germination (Castillo et al., 1992).
74
Table No: 4.1.1 Means values of germination percentage in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 85 L25 80 L50 75 L1 85 L26 80 L51 80
L2 85 L27 85 L52 80 L3 85 L28 85 L53 85 L4 80 L29 85 L54 75 L5 80 L30 85 L55 85 L6 80 L31 80 L56 75 L7 85 L32 80 L57 75 L8 75 L33 80 L58 80 L9 75 L34 75 L59 80 L10 75 M-25 90 L60 85 L11 80 M-116 85 L61 85 L12 85 M-102 90 L62 85 L13 85 M-91 90 L63 75 L14 85 M-07 85 L64 85 L15 80 M-83 80 L65 85 L16 70 M-22 85 L66 75 L17 75 M-72 90 L67 75 L18 70 M-39 85 L68 75 L19 75 M-86 70 L69 75 L20 75 M-08 80 L70 80 L21 80 M-79 85 L71 80 L22 80 L47 70 L72 75 L23 85 L48 70 L73 80 L24 85 L49 75 L74 75
4.1.2.2. Plant height (cm)
Pea’s landraces also showed variation in plant height. Maximum plant height
(80 cm) was observed in genotype L-29 followed by L-30 (78 cm), L-28 (74 cm) and
L-30 (75 cm) (Table 4.1.2). Genotype L-20 attained minimum plant height (33 cm)
followed by L-6 (34 cm), L-50 (39 cm), -L-18 (40 cm) L-51 (41 cm), CH (41 cm) and
L-15 (42 cm). All other landraces remained intermediate in performance with respect
to this trait. The difference in plant height might be due to the genetic make up of these
75
cultivars. The cultivars with minimum height at flowering are considered as not only
dwarf0but also early0flowering. The variation0in plant height0of the varieties used0may
be attributed to their variable genetic makeup and response to environmental
conditions. Different responses to plant tallness may be because of hereditary
characteristic0of genotypes0and adaptability0to a specific0situation. Scientists0acquired
lengths0changing in the vicinity of 65.67 and 132 cm (Ceyhan and Avci, 2015), 51.20
and 111.30 cm (Georgieva et al., 2016) 65.67 and 126 cm (Khan et al., 2013).On the
other hand, the average (63.64 cm) detailed by Habtamu and Million (2013) is lower
than that got in the present work (80 cm). Contrast0in plant height0may be because0of
hereditary characteristic of genotypes and adaptability to a particular environment
(Khan et al., 2013), particularly that this character is dependent on the environment
(Solberg et al., 2015).
76
Table No: 4.1.2 Means values of plant height in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 41 L25 67 L50 39 L1 55 L26 69 L51 41 L2 58 L27 71 L52 42 L3 47 L28 74 L53 44 L4 50 L29 80 L54 47 L5 52 L30 78 L55 44 L6 34 L31 73 L56 45 L7 47 L32 75 L57 49 L8 46 L33 54 L58 53 L9 47 L34 49 L59 58 L10 52 M-25 44 L60 56 L11 57 M-116 52 L61 59 L12 43 M-102 56 L62 61 L13 44 M-91 49 L63 64 L14 46 M-07 45 L64 66 L15 42 M-83 50 L65 60 L16 47 M-22 53 L66 57 L17 43 M-72 57 L67 54 L18 40 M-39 54 L68 51 L19 46 M-86 59 L69 58 L20 33 M-08 55 L70 61 L21 58 M-79 52 L71 66 L22 59 L47 57 L72 68 L23 65 L48 51 L73 64 L24 68 L49 46 L74 61
4.1.2.3. Number of Leaves per Plant
Highly significant differences were observed in this respect among the
landraces. It is clear from the data that L-72 possessed the highest number of leaves
(77), closely followed by L-64 (76), L-63 (75) and L-71 (75), while, L-20 had the
minimum number of leaves (30) followed by L-6 (35), L-18 (36), L-8 and L-19 (37),
L-12 (38), L-14 and CH (39). All other landraces remained intermediate in
performance with respect to this trait. It is evident that the tall cultivars had similarly
more number of leaves than the dwarf ones. Vegetative0development of pea0plant is
77
influenced0by both0hereditary and natural0components, which interact0with each0other
to further modify plant growth. The genetic0or hereditary0effects0include
photosynthetic0potential, water use efficiency, plant0growth rate, leaf0area index and
seed size etc. The genetic0factors are affected by0environmental conditions0including
plant0density and climatic0conditions (Muehlbauer and McPhee, 1997). Hence,
variation0in pea-cultivars0could be due to their genetic0make up and adaptability0to
prevailing environmental0conditions.
Table No: 4.1.3 Means values of number of leaves in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 39 L25 66 L50 44 L1 46 L26 65 L51 47 L2 49 L27 68 L52 48 L3 41 L28 69 L53 50 L4 43 L29 74 L54 51 L5 44 L30 71 L55 49 L6 35 L31 67 L56 49 L7 43 L32 66 L57 53 L8 37 L33 58 L58 61 L9 42 L34 52 L59 66 L10 45 M-25 49 L60 63 L11 50 M-116 57 L61 64 L12 38 M-102 62 L62 72 L13 46 M-91 57 L63 75 L14 39 M-07 54 L64 76 L15 51 M-83 56 L65 71 L16 48 M-22 60 L66 66 L17 54 M-72 64 L67 62 L18 36 M-39 59 L68 59 L19 37 M-86 67 L69 63 L20 30 M-08 63 L70 74 L21 53 M-79 61 L71 75 L22 52 L47 65 L72 77 L23 65 L48 59 L73 73 L24 70 L49 62 L74 65
78
4.1.2.4. Leaf Area
Data regarding to the leaf area of pea is presented in table 4.1.4. Means values
for leaf area ranged from 1.2-18.6 cm2. It is clear from the data that L-29 possessed the
highest leaf area (18.6 cm2), closely followed by L-30 (16.12 cm2) and L-31(14.4
cm2). These landraces exhibited the maximum vegetative growth. L-3 and L-6 had the
shown minimum leaf area (1.2 cm2) followed by L-5 (2.49 cm2), L-4 (2.77 cm2) and L-
1 (2.89 cm2) (Table 4.1.4). All other landraces remained intermediate in performance
with respect to this trait. Vegetative0development of0pea plant is influenced by0both
hereditary0and natural0components, which0interact with each0other to further0modify
plant0growth. The genetic0or hereditary0effects include0photosynthetic0potential, water
use0efficiency, plant growth0rate, leaf area0index and seed size etc. The genetic0factors
are affected by environmental conditions including plant density and climatic
conditions (Muehlbauer and McPhee, 1997). Hence, variation0in pea-cultivars0could be
due0to their genetic0make up and adaptability to0prevailing environmental0conditions.
Varietal0differences in garden0pea in leaf area were also0reported by Akhter, (2004).
79
Table No: 4.1.4 Means values of leaf area in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 4.92 L25 10.2 L50 2.23 L1 2.89 L26 11.1 L51 3.21 L2 4.56 L27 12.5 L52 3.69 L3 2.1 L28 13.4 L53 4.2 L4 2.77 L29 18.6 L54 4.93 L5 2.49 L30 16.12 L55 3.86 L6 2.1 L31 14.4 L56 4.38 L7 5.51 L32 12.87 L57 5.12 L8 4.93 L33 11.1 L58 7.01 L9 3.06 L34 5.92 L59 8.68 L10 7.01 M-25 5.32 L60 7.94 L11 7.47 M-116 5.92 L61 8.94 L12 7.94 M-102 6.78 L62 10.5 L13 9.19 M-91 6.57 L63 11.1 L14 8.19 M-07 5.92 L64 11.3 L15 6.78 M-83 5.72 L65 10.5 L16 6.13 M-22 7.01 L66 8.94 L17 5.51 M-72 7.24 L67 7.01 L18 7.24 M-39 6.78 L68 6.13 L19 6.78 M-86 7.49 L69 9.46 L20 2.36 M-08 7.24 L70 10.81 L21 5.92 M-79 7.01 L71 12.5 L22 5.72 L47 7.7 L72 13.81 L23 9.46 L48 6.13 L73 11.68 L24 11.9 L49 11.1 L74 9.99
4.1.2.5. Leaf length
Mean values for leaf length ranged from 1.7-5.1 cm. It is clear from the data
that L-29 possessed the highest leaf length (5.1 cm), closely followed by L-30 (4.7 cm)
and L-31(4.5 cm). These landraces exhibited the maximum vegetative growth. L-3 and
L-6 had the shown minimum leaf area (1.7 cm) followed by L-50 (1.8 cm), and L-
5(1.9 cm). All other landraces remained intermediate results. This can be clarified0by
photosynthesis0which is more0critical when the size0of stipules and0leaflets are0large,
80
hence the yields0are higher. Basaran et al. (2012) and Basaran et al. (2013) noticed a
strong0correlation between leaflet0length and weight0of 100 seeds in grass0pea.
Table No: 4.1.5 Means values of leaf length in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 2.5 L25 3.8 L50 1.8 L1 2.2 L26 3.9 L51 2.1 L2 2.5 L27 4.2 L52 2.3 L3 1.7 L28 4.3 L53 2.4 L4 2 L29 5.1 L54 2.6 L5 1.9 L30 4.7 L55 2.3 L6 1.7 L31 4.5 L56 2.5 L7 2.8 L32 4.2 L57 2.7 L8 2.6 L33 3.9 L58 3.1 L9 2.1 L34 2.8 L59 3.5 L10 3.1 M-25 2.7 L60 3.3 L11 3.2 M-116 2.9 L61 3.6 L12 3.3 M-102 3.1 L62 3.8 L13 3.6 M-91 3 L63 3.9 L14 3.4 M-07 2.9 L64 4 L15 3 M-83 2.8 L65 3.8 L16 2.9 M-22 3.1 L66 3.5 L17 2.7 M-72 3.2 L67 3.1 L18 3.1 M-39 3 L68 2.9 L19 3 M-86 3.3 L69 3.6 L20 1.8 M-08 3.2 L70 3.9 L21 2.9 M-79 3.1 L71 4.2 L22 2.8 L47 3.3 L72 4.4 L23 3.6 L48 2.9 L73 4 L24 4.1 L49 3.9 L74 3.7
4.1.2.6. Leaf width
Mean values for leaf length ranged from 1.7-5.1 cm. It is clear from the data
that L-29 possessed the highest leaf length (5 cm), closely followed by L-30 (4.7 cm)
and L-31(4.4 cm). These landraces exhibited the maximum vegetative growth. L-3 and
L-6 and L-50 had the shown minimum leaf width (1.7 cm) followed by L-1 (1.8 cm),
81
and L-5 (1.8 cm). All other landraces remained intermediate results. This can be
clarified0by photosynthesis0which is more0critical when the size0of stipules and leaflets
are0large, hence the0yields are0higher. Basaran et al. (2012) and Basaran et al. (2013)
noticed a strong0correlation between leaflet0length and weight0of 100 seeds in0grass-
pea.
Table No: 4.1.6 Means values of leaf width in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 2.7 L25 3.7 L50 1.7 L1 1.8 L26 3.8 L51 2.1 L2 2.5 L27 4.1 L52 2.2 L3 1.6 L28 4.3 L53 2.4 L4 1.9 L29 5 L54 2.6 L5 1.8 L30 4.7 L55 2.3 L6 1.2 L31 4.4 L56 2.4 L7 2.7 L32 4.2 L57 2.6 L8 2.6 L33 3.9 L58 3.1 L9 2 L34 2.9 L59 3.4 L10 3.1 M-25 2.7 L60 3.3 L11 3.2 M-116 2.8 L61 3.5 L12 3.3 M-102 3 L62 3.8 L13 3.5 M-91 3 L63 3.9 L14 3.3 M-07 2.8 L64 3.9 L15 3.1 M-83 2.8 L65 3.8 L16 2.9 M-22 3.1 L66 3.5 L17 2.8 M-72 3.1 L67 3.1 L18 3.2 M-39 3.1 L68 2.9 L19 3.1 M-86 3.3 L69 3.6 L20 1.8 M-08 3.1 L70 3.8 L21 2.8 M-79 3.1 L71 4.1 L22 2.8 L47 3.2 L72 4.3 L23 3.6 L48 2.9 L73 4 L24 4 L49 3.9 L74 3.7
82
4.1.2.7. Days to flowering initiation
The landraces also revealed highly significant differences for days to
flowering. Minimum number of days taken for flowering were found in L-20 (49.0)
followed by L-6 (50.0) L-34 and M-25 (51.0) (Table 4.1.7). Maximum number of days
for flowering were noted in landraces L-29 (62.0) followed by L-12, L-13, L-15 and L-
30. (61.0). The possible0reason of0early flowering0in certain genotypes0indicated
adaptability of these genotypes in a particular environment, better and efficient
utilization0of nutrients in a relatively0hostile environment0which might have resulted in
early0termination of vegetative0phase and initiation0of reproductive0stage as9compared
to0genotypes which took0longer time to0flowering (Ishtiq et al., 1996). Similar0results
have also0been reported0earlier (Hussain and Badshah 2002), Singh et al. (2004)
(Vocanson and Jeuffroy, 2008).
83
Table No: 4.1.7 Means values of days to flowering initiation in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 60 L25 58 L50 54 L1 58 L26 59 L51 53 L2 58 L27 60 L52 53 L3 58 L28 60 L53 55 L4 56 L29 62 L54 56 L5 56 L30 61 L55 56 L6 50 L31 59 L56 55 L7 55 L32 59 L57 58 L8 57 L33 52 L58 55 L9 57 L34 51 L59 56 L10 57 M-25 51 L60 56 L11 56 M-116 54 L61 58 L12 61 M-102 55 L62 59 L13 61 M-91 53 L63 58 L14 60 M-07 53 L64 59 L15 61 M-83 57 L65 58 L16 57 M-22 57 L66 55 L17 57 M-72 58 L67 55 L18 58 M-39 55 L68 54 L19 59 M-86 57 L69 57 L20 49 M-08 56 L70 58 L21 59 M-79 56 L71 59 L22 58 L47 58 L72 59 L23 56 L48 55 L73 57 L24 58 L49 54 L74 56
4.1.2.8. Days to Flowering Completition:
The time taken from germination to flower completition revealed significant
differences among the landraces. It is evident from result that L-29 took the maximum
days (77.0) for flowering completition, closely followed by L-30 (75.0) L-27 and L-28
(74.0) and L-24 and L-31 (73.0), whereas L-20, L-6, L-34 and M-25 took the
minimum number of days to complete flowering (61.0 to 64.0). The cultivars taking
minimum number0of days to0flowering are0comparatively early0maturing than0other
cultivars, from0the farmers0point of view such0cultivars seem0more desirable0because
84
early0flowering means0early crop0maturity. According to Makasheva, (1983) pea
cultivars have an adequately0wide range of0duration0of0vegetative-period0and0their
consequent phases (flowering, maturation etc.). The period of vegetative growth
corresponds to agro-c1imatic0peculiarities of0the area of their0cultivation.
Table No: 4.1.8 Means values of days to Flowering Completition in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 73 L25 72 L50 65 L1 70 L26 72 L51 67 L2 70 L27 74 L52 67 L3 70 L28 74 L53 70 L4 70 L29 77 L54 71 L5 69 L30 75 L55 69 L6 62 L31 73 L56 70 L7 70 L32 72 L57 72 L8 68 L33 65 L58 70 L9 69 L34 64 L59 70 L10 68 M-25 64 L60 71 L11 68 M-116 66 L61 72 L12 75 M-102 65 L62 73 L13 74 M-91 65 L63 72 L14 74 M-07 67 L64 73 L15 75 M-83 71 L65 72 L16 67 M-22 70 L66 69 L17 69 M-72 71 L67 69 L18 70 M-39 69 L68 68 L19 70 M-86 70 L69 71 L20 61 M-08 69 L70 70 L21 71 M-79 70 L71 73 L22 71 L47 72 L72 72 L23 70 L48 68 L73 70 L24 73 L49 67 L74 70
4.1.2.9. Days to Pod Formation of Pea
The landraces also revealed highly significant differences for days to pod
formation (Table 4.1.9). Maximum number of days taken for pod formation were
found in L-29 and L-39 (69.0 each) followed by L-15 and L-24 (68.0 each) and L-12,
85
L-13, L-23, and L-25, (67.0 each). Minimum number of days for pod formation were
noted in landraces L-6, (56.0) followed by L-33 (57.0) and L-20, L-34, and M-25 (58.0
each). The cultivars taking minimum number0of days to0flowering are0comparatively
early0maturing than other0cultivars, from the farmers0point of view such0cultivars seem
more0desirable because early0flowering means early0pod formation0result in early0crop
maturity. According to Makasheva, (1983) pea cultivars have an adequately0wide
range of duration of vegetative-period and their consequent phases (flowering,
maturation etc.). The period of vegetative growth corresponds to agro-
c1imatic0peculiarities of0the area of their0cultivation.
Table No: 4.1.9 Means values of days to pod formation in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 65 L25 67 L50 59 L1 63 L26 66 L51 59 L2 63 L27 67 L52 59 L3 64 L28 67 L53 61 L4 64 L29 69 L54 62 L5 63 L30 63 L55 60 L6 56 L31 61 L56 61 L7 63 L32 62 L57 63 L8 62 L33 57 L58 62 L9 63 L34 58 L59 61 L10 62 M-25 58 L60 62 L11 61 M-116 59 L61 62 L12 67 M-102 60 L62 66 L13 67 M-91 59 L63 65 L14 66 M-07 69 L64 65 L15 68 M-83 63 L65 64 L16 63 M-22 62 L66 61 L17 65 M-72 62 L67 61 L18 66 M-39 60 L68 60 L19 66 M-86 62 L69 63 L20 58 M-08 60 L70 62 L21 65 M-79 61 L71 63 L22 66 L47 62 L72 62 L23 67 L48 61 L73 63 L24 68 L49 61 L74 63
86
4.1.2.10. Number of pods per plant of Pea
Number of pods per plant also revealed highly significant differences among
all the landraces. Maximum pods per plant were found in L-29 (18) followed by L-22,
L-27, L-28, and L-30 (17.0). Data concerning number of pods per plant indicated
significant difference among the landraces. The landraces L-6 and L-57 produced the
minimum number of pods per plant (10.0). It indicated that priority0could be given0to a
certain cultivar over others on the basis 'of number of pods per plant, if other
parameters were also at optimum level. More number of pods per plant might
be0because0of small0pod size as fewer-nutrients0are required for0small pods0compared
with larger0pods (Baginsky et al., 1994). Number of0pods per plant identify to0plant
height. Vigorous0varieties produced0more pods while number0of pods0decreased0with
decrease in plant0height, which may be ascribed to0hereditary or genetic0make-up0of
the plants. Pods0per plant have significant and positive0correlation with biological
yield, grain yield and harvest index. Similar results have also been reported0earlier
(Hussain et al., 2005; Khokar et al., 1998). Some scientist’s observed0numbersof pods
per plant as the most useful yield-component (Javaid et al., 2002).
87
Table No: 4.1.10: Means values of number of pods per plant in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 15 L25 13 L50 16 L1 12 L26 14 L51 11 L2 13 L27 17 L52 12 L3 12 L28 17 L53 12 L4 12 L29 18 L54 13 L5 11 L30 17 L55 14 L6 10 L31 14 L56 11 L7 12 L32 11 L57 10 L8 11 L33 13 L58 12 L9 12 L34 12 L59 13 L10 10 M-25 14 L60 11 L11 16 M-116 16 L61 12 L12 13 M-102 15 L62 14 L13 13 M-91 14 L63 15 L14 12 M-07 16 L64 11 L15 14 M-83 15 L65 14 L16 15 M-22 14 L66 15 L17 14 M-72 15 L67 16 L18 16 M-39 16 L68 11 L19 13 M-86 15 L69 12 L20 13 M-08 14 L70 12 L21 16 M-79 14 L71 11 L22 17 L47 13 L72 14 L23 16 L48 14 L73 13 L24 11 L49 14 L74 12
4.1.2.11. Pod length (cm)
Data on pod0length showed important0modifications among0the landraces A
comparison of means for landraces showed that check variety demonstrated the
maximum pod0length (10.5 cm) followed0by M-83 (10.1 cm), L-57(9.8 cm), and M-22
and M-86 (9.5 cm each). Minimum pod length (4.5 cm) was recorded in L-4 followed
by L-2 (4.7 cm). ). A number of prior workers have previously0reported that pea
cultivars0differ importantly0in size and0form of pods0and number of0seeds per0pod
(Makasheva, 1983; Muehlbauer and McPhee, 1997). Shah et al. (1990) have reported
comparable0outcomes. In general, pod0size is a varietal0character, yet it is0additionally
88
influenced by vigour0of plant. More0availability0of0nutrients particularly0during0pod
formation and development stages of more vigorous pea varieties might have
translocated most of its reserved food material towards pod-formation and
development (Arshad et al., 1998; Ishtiaq et al., 1996).
Table No: 4.1.11: Means values of pod length (cm) in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 10.5 L25 7.6 L50 8.6 L1 5.5 L26 7.5 L51 8.7 L2 4.7 L27 8.5 L52 8.1 L3 5 L28 8.6 L53 7.5 L4 4.5 L29 8.7 L54 7.6 L5 5.8 L30 8.2 L55 8.7 L6 5.8 L31 8.3 L56 9.3 L7 6.1 L32 8.5 L57 9.8 L8 6.5 L33 8.6 L58 8.7 L9 7.5 L34 8.7 L59 8.7 L10 6.6 M-25 9 L60 7.6 L11 8 M-116 9.2 L61 7.6 L12 8.7 M-102 9.3 L62 8.7 L13 8.3 M-91 9.3 L63 7.5 L14 8.3 M-07 9.1 L64 8.1 L15 6.6 M-83 10.1 L65 8.2 L16 7.6 M-22 9.5 L66 7.3 L17 7.6 M-72 9.2 L67 7.3 L18 7.1 M-39 9.3 L68 8.3 L19 7.7 M-86 9.5 L69 8.2 L20 7.9 M-08 8.7 L70 8.1 L21 8.2 M-79 9.4 L71 7.6 L22 8 L47 7.6 L72 7.6 L23 7.6 L48 7.6 L73 8.2 L24 7.6 L49 8.5 L74 8.1
4.1.2.12. Pod width
Means values for leaf width ranged from 1-2.1 cm. All the landraces except L-
1, L-3, L-4, L-6, L-7, L-8, L-11 and L-12 produced nearly the same pods width. The
landraces L-1, L-3, L-4, L-6, L-7, L-8, L-11 and L-12 produced the minimum pods
89
width (1cm). In general, pod size is a varietal character, yet it is additionally
influenced by0vigour of0plant. More0availability0of0nutrients particularly0during0pod
formation and development0stages of more vigorous pea varieties0might have
translocated most of its reserved food material towards pod-formation and
development (Arshad et al., 1998; Ishtiaq et al., 1996).
Table No: 4.1.12: Means values of pod width (cm) in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 1.2 L25 1.2 L50 1.1 L1 1 L26 1.2 L51 1.1 L2 1.1 L27 1.1 L52 1.1 L3 1 L28 1.2 L53 1.1 L4 1 L29 1.2 L54 1.2 L5 1.2 L30 1.2 L55 1.2 L6 1 L31 1.2 L56 1.2 L7 1 L32 1.1 L57 1.2 L8 1 L33 1.1 L58 1.2 L9 1.2 L34 1.1 L59 1.2 L10 1.1 M-25 1.2 L60 1.1 L11 1 M-116 1.2 L61 1.1 L12 1 M-102 1.2 L62 1.2 L13 1.1 M-91 1.2 L63 1.1 L14 1 M-07 1.2 L64 1.2 L15 1.2 M-83 1.2 L65 1.2 L16 1.2 M-22 1.2 L66 1.1 L17 1.2 M-72 1.2 L67 1.1 L18 1.2 M-39 1.2 L68 1.2 L19 1.2 M-86 1.2 L69 1.2 L20 1.2 M-08 1.2 L70 1.2 L21 1.2 M-79 1.2 L71 1.1 L22 1.2 L47 1.1 L72 1.1 L23 1.2 L48 1.1 L73 1.2 L24 1.2 L49 1.1 L74 1.2
90
4.1.2.13. Number of seeds per pod
Means values for seed per pod ranged from 4-8. Landraces L-35, L-36, L-37,
L-38, L-39, L-40, L-41, L-42, L-43, L-44, and L-46 excelled in seeds per pod (8.0)
followed by L-11, L-12 and L-13 (7.0), where as landraces L-1, L-2, L-3,and L-4
produced the lowest (4.0) number of seeds per pod. According to Makasheva, (1983)
the number of seeds in a pod is variable depending upon the cultivar The number of
seeds per0pod depends mostly0on the cultivar0and on0the natural0conditions yet has
additionally0been recorded0to be influenced by plant0density. The average0number of
seeds per0pod was inversely0related to plant0population. These outcomes are similar to
those of Arshad et al. (1998) who expressed that number of seeds are correlated with
pod length. The more is the pod length, the more is number of seeds and vice versa.
The environmental and genetic factors of different cultivars may have affected process
of fertilization (Qasim et al., 2001). The number0of seeds0pod-1 is an important0yield
component0and contributes0to the final0yield. Decrease in0seeds pod-1 may result0due to
the genetic characteristics or environmental unsuitability, which may hinder the
process0of0pollination, fertilization0or0cause0abortion. The0possible0reason0of0less
number0of seeds0per-pod may be that environmental0condition was not0appropriate at
the season0of pollination0and0fertilization (Ali et al., 2002).
91
Table No: 4.1.13: Means values of number of seeds per pod in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 8 L25 6 L50 7 L1 4 L26 6 L51 7 L2 4 L27 7 L52 7 L3 4 L28 7 L53 6 L4 4 L29 7 L54 6 L5 5 L30 7 L55 7 L6 5 L31 7 L56 8 L7 5 L32 7 L57 8 L8 5 L33 7 L58 7 L9 6 L34 7 L59 7 L10 6 M-25 8 L60 6 L11 7 M-116 8 L61 6 L12 7 M-102 8 L62 7 L13 7 M-91 8 L63 6 L14 7 M-07 8 L64 7 L15 6 M-83 8 L65 7 L16 6 M-22 8 L66 6 L17 6 M-72 8 L67 6 L18 6 M-39 8 L68 7 L19 7 M-86 8 L69 7 L20 7 M-08 7 L70 7 L21 7 M-79 8 L71 6 L22 7 L47 6 L72 6 L23 6 L48 6 L73 7 L24 6 L49 7 L74 7
4.1.2.14. 100-Seed fresh weight (g)
Highly significant differences were also observed among landraces for 100-
seed fresh weight. Maximum 100-seed fresh weight was noted in M-83 (29.6 g)
followed by M-91 (28.3 g) and Check variety (28.2 g). L-2 gave minimum 100-seed
fresh weight (12.0 g) followed by L-1 (12.3 g), L-4 (12.5 g) and L-3 (12.9 g). All other
landraces remained intermediate in performance with respect to this trait. Different
ecological0conditions enable the seed0to be filled0to its genetic0potential. With
increased plants per area, each plant has fewer resources available which could
92
convert0into smaller0seeds. In a few circumstances, plants can abort flower sites so that
all fertile0seeds can fill to0larger0sizes. The reduction0in the number0of pods0per plant,
seeds per0pod and seed0weight at the0higher0densities may be because0of increased
interplant0competition. The results suggest0a strong0relationship between0source and
sink and maximum translocation0of food0material from0vegetative to reproductive
portion0in good0environmental condition0which cause higher0seed weight (Ali et al.,
2002). The rate of0acclimatization of0genotypes may be0considered the possible0cause
of this0variation. Moreover, this variation0might be due0to genetic0variability of
different0genotypes (Hatam and Amanullah, 2001).
Table No: 4.1.14: Means values of 100-seed weight (g) in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 28.2 L25 18.5 L50 22.1 L1 12.3 L26 19 L51 22.5 L2 12 L27 23.8 L52 22.3 L3 12.9 L28 23 L53 21.1 L4 12.5 L29 23.5 L54 22.1 L5 13 L30 23.5 L55 22.9 L6 13.7 L31 23 L56 24.7 L7 13 L32 23.4 L57 24.6 L8 13.4 L33 24.9 L58 23.5 L9 17 L34 23.2 L59 22.5 L10 17.5 M-25 26.8 L60 20.1 L11 19 M-116 27.2 L61 19.7 L12 18.2 M-102 26.4 L62 21.8 L13 19.2 M-91 28.3 L63 18.6 L14 19 M-07 27.2 L64 23.9 L15 18.6 M-83 29.6 L65 23.4 L16 19.2 M-22 25.8 L66 19.5 L17 18.6 M-72 26 L67 20.3 L18 19 M-39 27.3 L68 24.2 L19 21.4 M-86 27 L69 24.6 L20 22 M-08 25.3 L70 23.8 L21 22.6 M-79 26 L71 18.7 L22 22 L47 19 L72 19.8 L23 16.4 L48 19.2 L73 22.9 L24 18 L49 20.1 L74 22.3
93
4.1.2.15. Yield (kg/ha)
The variation0in yield was observed0among different0landraces. Landraces M-
83 had0maximum yield (19.73 kg/ha) followed by M-25 and M-07 (18.13 kg/ha) and
M-91 (18.8 kg/ha). Landraces L-2 produced minimum yield (8.0 kg/ha) followed by L-
1 (8.2 kg/ha) L-4 (8.3 kg/ha) and L-3 and L-7 (8.6 kg/ha each). Yield0is a complex
character determined by the interaction0of many heritable0characters with soil, climate
and agronomic0conditions (Makasheva, 1983). Maximum0yield requires maximum
vegetative0growth during crop0establishment (Muehlbauer and McPhee, 1997). Higher
number0of leaves means more0photosynthesis and ultimately0more yield. More0yields
in various0genotypes-might be because of optimum0plant survival, long0and more
number0of seeds per0pod, which eventually0contributed altogether0towards final0yield.
The performance0of a cultivar0mainly0relies upon0association of hereditary or0genetic
make up and environmental0condition. Therefore, these two0factors provide an index
for0selection of0cultivars for a specific0locality. Similar results have also0been0reported
by Ranalli et al. (1992) who0observed that dissimilar cultivars0varied in their0yield
competence. Warmer weather0condition and storm0cases must be responsible0for
lessening seed yield performance in the second experimental year because high
temperature during0flowering and pod0formation reason for0reduction in seed0yield in
pea. Further, optimum0temperature and comparative0moisture through0grain filling
period might also be responsible for maximum translocation of photo integrates
towards0final end0product. Positive0association of0grain yield with plant0height, pods
per plant and stem girth has also been observed0under field or rainfed0conditions by
Hatam and Amanullah, (2001).
94
Table No: 4.1.15: Means values of yield (kg/ha) in pea genotypes
Genotypes Means Genotypes Means Genotypes Means CH 18.8 L25 12.3 L50 14.7 L1 8.2 L26 12.66 L51 15 L2 8 L27 15.86 L52 14.8 L3 8.6 L28 15.33 L53 14.06 L4 8.3 L29 15.66 L54 14.7 L5 8.6 L30 15.66 L55 15.26 L6 9.13 L31 15.33 L56 16.4 L7 8.6 L32 15.6 L57 16.4 L8 8.9 L33 16.6 L58 15.6 L9 11.33 L34 15.46 L59 15 L10 11.6 M-25 17.86 L60 13.4 L11 12.6 M-116 18.13 L61 13.1 L12 12.13 M-102 17.6 L62 14.5 L13 12.8 M-91 18.8 L63 12.4 L14 12.66 M-07 18.13 L64 15.93 L15 12.4 M-83 19.73 L65 15.6 L16 12.8 M-22 17.2 L66 13 L17 12.4 M-72 17.3 L67 13.53 L18 12.6 M-39 18.2 L68 16.13 L19 14.2 M-86 18 L69 16.4 L20 14.6 M-08 16.86 L70 15.8 L21 15.06 M-79 17.33 L71 12 L22 14.6 L47 12.6 L72 13.2 L23 10.9 L48 12.8 L73 15.2 L24 12 L49 13.4 L74 14.8
4.1.16. Simple Correlation Coefficient
Table 4.1.16 represents the correlation coefficients among all the quantitative
traits. Yield was showing maximum positive and highly significant correlation with
seed weight (1.000** ). Leaf length was showing maximum positive and highly
significant correlation with leaf width (0.994** ) and leaf area (0.989** ) followed by leaf
area and leaf width (0.985** ). Number of seed per pod was having positive and highly
significant correlation with pod length (0.960** ), seed weight (0.935** ) and yield
(0.934** ), respectively followed by days to flower completion with days to flower
95
initiation (0.923** ). Pod length was showing maximum positive and highly significant
correlation with seed weight and yield (0.912** ). The plant height was showing highly
significant and positively correlated with four characters which are: leaf area (0.831** ),
number of leaves (0.821** ), days to flower completion (0.569** ) and days to flower
initiation (0.526** ). Number of leaves was showing highly significant and positive
correlation with the traits such as leaf length (0.798** ), leaf width (0.781** ) and leaf
area (0.777** ). A highly significant correlation was found between pod width with seed
weight and yield (0.621** ). Number of pods per plant has a positive significant
correlation with leaf length (0.227*), leaf width (0.249*) and number of leaves
(0.228*). Yield was correlated with two characters: leaf width (0.262*) and leaf length
(0.239*). This can be clarified by0photosynthesis which is more0critical when the size
of0stipules and leaflets are large, hence the yields0are higher. Basaran et al. (2012) and
Basaran et al. (2013) noted a strong correlation0between leaflet0length and weight0of
100 seeds in grass0pea. Number of0seeds per0pod was negatively0correlated to0weight
of 100 seeds. A negative-significant0correlation between these two0characters was
found0by Gatti et al. (2011). Stipule-length and width leaflet length and width were
correlated0between themselves. The same result was obtained0by Gatti et al. (2011).
Number0of grain per0pod was correlated0positively and significantly with pod0length.
Ali et al. (2007) found0also a significant positive0correlation between these two-
characters.
96
Table.4.1.16: Simple Correlation coefficient for morphological traits among 75 peas landraces
Ger PH NOL LL LW LA DFI DFC PF PP PL PW NOSP SW YIE LD
Ger 1
PH .178 1
NOL .113 .821** 1
LL .116 .822** .798** 1
LW .096 .795** .781** .994** 1
LA .118 .831** .777** .989** .985** 1
DFI .129 .526** .295* .527** .516** .526** 1
DFC .179 .569** .409** .587** .576** .584** .923** 1 PF .139 .346** .155 .382** .378** .376** .754** .748** 1
PP .137 .262* .227* .279* .296** .288* .197 .139 .260* 1
PL .148 .057 .284* .272* .291* .235* -.038 .025 -.105 .322** 1
PW .011 .211 .356** .220 .241* .206 .061 .078 .139 .303** .529** 1
NOSP .170 .015 .228* .227* .249* .190 -.089 -.041 -.127 .328** .960** .559** 1
SW .170 .092 .336** .241* .264* .211 -.127 -.060 -.196 .351** .912** .621** .935** 1
YIELD .172 .091 .334** .239* .262* .209 -.127 -.061 -.196 .355** .912** .621** .934** 1.000**
1
**. Correlation is significant at the 0.01 level (2-tailed). *. Correlation is significant at the 0.05 level (2-tailed).
Where; G= Germination % age, PH= Plant Height, NOL= Number of Leaves, LL= Leaf Length, LW= Leaf Width, LA= Leaf Area, DFI= Days to Flower initition, DFC= Daya to Flowering completion, PF= Pod formation, PP= Pod per plant, PL= Pod length, PW= Pod width, NOSP=Number of Seed per pods, SW= 100 Seed weight, Y= Yield.
97
4.1.17. CLUSTER ANALYSIS
Average linkage distance among peas landraces
The dendrogram indicated the expected association among the Peas landraces.
Dendrogram was created with computer software PAST, using seventy five landraces
showed two main clusters I, and II at linkage distance of near about 160. Cluster I
includes two sub clusters I-A and I-B. Cluster I-A comprised of 16 landraces namely
L-3 and L-7, L-4 and L-5, L-1 and L-2, L-13 and L-15, L-12 and L-14, L-18 and L-19,
L-8 and L-9 were correlating each other at same linkage distance. Genotypes Check
and L-10 were outliers in this sub cluster (I-A) showing vriability. Sub Cluster I-B
comprised of thirteen landraces. Landraces L-16 and L-20, L-53 and L-55, L-51 and L-
52, L-16 and L-17, L-54 and L-56 were similar to each other in term of traits studies
while landraces L-50, L-57 and L-34 were outliers for this cluster.
Cluster II was also comprised of two sub cluters II-A and II-B. Sub cluster II-A
was comprised of two sub sub clusters II-A1 and II-A2. II-A1 was comprised of ten
landraces M-102 and M-72, M-22 and M-79, M-39 and M-116, M-25 and M-91 that
were present at same linkage distance while landraces M-83 and M-07 were outliers
for this cluster. Sub sub cluster IIA-2 comprised of 16 landraces, L-21 and L-22, L-66
and L-67, L-69 and L-74, L-48 and L-49, M-08 and L-58 were correlated to each other
at same linkage distance whereas L-47, M-86 and L-33 were outliers for the cluster.
While sub cluster II-B was containing 20 landraces from which only L-64, L-71, L-23
and L-24 were showing maximum variability and were outliers for the cluster.
Landraces L-27 and L-28, L-31 and L-32, L-30 and L-29, L-62 and L-65, L-70 and L-
98
73, L-63 and L-72, L-60 and L-61, L-25 and L-26 were significantly related to each
other, respectively.
Figure 4.1.1: Dendrogram based on average linkage distance for 75 peas
genotypes
99
Figure 4.1.2: Dendrogram based on average linkage distance for 15 Traits
4.1.18: Average linkage distance among pea’s traits based on morphological
studies
The cluster analysis exposed as a dendrogram showed the predictable
association among 15 Peas traits. Dendrogram was constructed with computer
software PAST, using seventy five genotypes showed two main clusters I and II at
linkage distance of near about 950. Cluster I was sub divided into two clusters I-A and
I-B. I-A comprised of Germination percentage and Flower completion whereas I-B
comprised of four traits; flower inititation and pod formation, plant height and number
of leaves at same linkage distance. Cluster II was subdivided into two sub cluster II-A
100
and II-B. Sub cluster II-A comprised of three traits including pod per plant and yield at
same linkage distance whereas seed weight was outlier in this cluster. Pod length and
seed per pod, leaf length and leaf width were correlating each other for sub cluster II-
B. Leaf area and pod width were outliers in this cluster.
4.1.19. PRINCIPAL COMPONENT ANALYSIS
Principal0components analysis (PCA) has an ability0to recognize0and eliminate
redundant0data from0experimental0results. Using PCA, large0number of available0data
is0reduced, which results in different number of the new variables, so0called
principal 0components (PC). Principal0component (PC) is in fact a linear0combination
of0original0variables. In0practice, it is usually sufficient to retain only a few
principal0 components, whose sum includes large percentage of total0variable. There
are three Eigen values higher than 1 in principal components. Three separated
components0showed cumulatively 78.53 % of total0variability. The first of them
accounts for 41.22%, the second for 27.52% and the third for 9.79% of all0variations.
The principal0components (PC1 and PC2) account for 68.74 % of all0variations of
genotype0characteristics. The maximum Eigen value was 6.18, while the minimum
was 1.46.
Table 4.1.18: The Eigen values for 15 traits of Pisum sativum L. genotypes.
PC 1 2 3 Eigen value 6.18 4.12 1.46 % variance 41.22 27.52 9.79 Cumulative Eigen Value 41.22 68.74 78.53
101
Figure 4.1.3: Scatter Biplot diagram of 75 landraces of Peas on the basis of
morphological characterization
Germ.%
Plntheght
leaves.no
leaflngthleafwdthleafarea
flowrinit.flwrcomp.podform.
pod/plnt
podlngth
podwdth
seed/podseedwtyield
CH
L1L2
L3L4
L5
L6
L7L8
L9
L10
L11
L12L13L14
L15
L16
L17
L18
L19
L20
L21L22
L23
L24
L25L26
L27 L28
L29
L30
L31L32
L33
L34
A35
A36
A37
A38
A39
A40
A41A42
A43
A44
A45
A46
L47
L48
L49
L50L51
L52
L53 L54
L55
L56
L57
L58
L59
L60
L61
L62
L63
L64
L65
L66
L67
L68
L69L70
L71
L72
L73L74-8.0 -6.4 -4.8 -3.2 -1.6 1.6 3.2 4.8 6.4
Component 1
-4
-3
-2
-1
1
2
3
4
Com
pon
ent
2
102
1EXPERIMENT NO. 02
4.2. Biochemical Studies
4.2.1.1. Moisture Content (%)
Table No. 4.2.1 was shows1the values1for moisture content of peas. The values
of moisture-content ranged from 7.1 to 9.9%. Maximum value of moisture-content was
found1for landraces, M-102 (9.9%) followed by M-91 (9.4%), M-07 and M-22 (9.1%).
Minimum value/of moisture/content was1found in L-13 (7.1%) followed by L-20 and
L-29, L-23, L-28 and L-32 (7.3%) and L-30 (7.4%). Other1landraces were showing
moderate1values for moisture-content. Pea seeds with low initial seed moisture content
(7 .5percent) were0lower in germination/and/had/a slower0growth/rate as compared0to
seeds/with/moisture/content of l3.5 percent or/higher. Low/imbibitions temperature led
to1reduced seedling dry weights1of peas, but had no effect on germination. The results
with/faba/beans and/peas/agree/with/what is known1about legumes0in1general, i.e.,
germination1and seedling0vigor are adversely1affected by low seed1moisture and low
imbibition0temperatures (Roos0and Manalo, 1976; Hobbs0and Obendorf, 1972). High
variations in composition/of/Field/peas/were/found (Jezierny/et al., 2011; Ravindran/et
al., 2010; Schumacher0et al., 2009; Bastianelli0et al., 1998) with0regard1to
high1differences in the selection1of0varieties. The0present results were generally0in
agreement0with those1outcomes. Fluctuations1could be additionally1due-to varying
environmental-influence.
103
Table No: 4.2.1 Means values of moisture content in pea genotypes
Genotype Means Genotype Means CH 7.8 L24 7.7 L2 8.1 L25 7.7 L3 7.7 L26 8.6 L4 7.7 L27 7.6 L5 8.9 L28 7.3 L6 8.3 L29 7.2 L7 8.8 L30 7.4 L8 8.2 L31 7.8 L9 8.2 L32 7.3 L10 8.1 L33 7.9 L11 8.5 L34 8.3 L12 8.3 M-25 8.3 L13 7.1 M-116 8.7 L14 8.3 M-102 9.9 L15 8.8 M-91 9.4 L16 7.5 M-07 9.1 L17 7.7 M-83 8.3 L18 7.9 M-22 9.1 L19 8.3 M-72 8.9 L20 7.2 M-39 8.8 L21 7.9 M-86 8.9 L22 8.7 M-08 8.8 L23 7.3 M-79 8.7
4.2.1.2. Crude Fat (%)
Table No. 4.2.2 shows1values for fat-content. The values1of fat were ranging
from 1.21% to 1.62%. Maximum1value of (1.62%) was found for landraces, M-25,
followed1by M-72 (1.59%) and M-08 (1.57%). Minimum1value (1.21%) was found in
CH, followed1by L-8 (1.23%) and L-15 (1.24%). Other1landraces were showing
intermediates result1for this trait. The fat substance1of beans, peas, and1lentils is
generally0very low and there is no1cholesterol. Protein-content is high, more than the
amount0of protein that is found in cereal1grains (USDA, 2015). The decrease in fat
content1of seed could be due to1total solid loss1during soaking prior to germination or
104
use of1fat as an energy source in sprouting1process (Wang et al., 1997). Other1authors
observed0diverting results especially1for CP and-starch, as well as comparable1results
for1fat, ash, and CF. High variations1of the composition0of Field-peas were found
(Jezierny et al., 2011) with/regard to high differences in the selection1of0varieties. The
present1results were generally1in agreement0with those/outcomes. Fluctuations0could
be additionally/due/to/varying/environmental-influence.
Table No: 4.2.2 Means values of fat content in pea genotypes
Genotype Means Genotype Means CH 1.21 L24 1.54 L2 1.32 L25 1.31 L3 1.34 L26 1.27 L4 1.28 L27 1.32 L5 1.29 L28 1.46 L6 1.37 L29 1.51 L7 1.39 L30 1.55 L8 1.23 L31 1.34 L9 1.41 L32 1.45 L10 1.44 L33 1.47 L11 1.47 L34 1.57 L12 1.53 M-25 1.62 L13 1.43 M-116 1.34 L14 1.32 M-102 1.45 L15 1.24 M-91 1.52 L16 1.37 M-07 1.54 L17 1.38 M-83 1.34 L18 1.26 M-22 1.56 L19 1.25 M-72 1.59 L20 1.33 M-39 1.52 L21 1.39 M-86 1.48 L22 1.45 M-08 1.57 L23 1.49 M-79 1.55
105
4.2.1.3. Crude Fibers %
Minimum fiber were found0in L-3 (0.83%) followed by L-11 (0.88%) and CH
(0.89%), where as maximum fiber were observed0in L-10 (1.98%) followed1by L-31
(1.53%) and L-26 (1.52%). All1other landraces show moderate1results. Another
essential1segment of beans, peas, and lentils is fiber. Fiber is a piece of1plant
nourishments1that can't be1processed. Beans, peas, and lentils have around 7 g of
dietary fiber. Insoluble1fiber masses stool1and abatements travel1time1through the
colon, accordingly1anticipating1constipation. The solvent1fiber in beans, peas, and
lentils is profoundly fermentable in the colon, which is believed to be health-enhancing
(USDA, 2015). Fiber is an indigestible complex carbohydrate found in
structural1components of plants. They cannot-be1absorbed by the body1and therefore,
have no1calorific value1however, the health0benefits0of/eating/fiber0rich/diet are
immense1including0prevention1of1constipation, regulation1of blood/sugar, protection
against heart diseases, reducing high levels of and prevention of certain forms
of1cancers. Fibers are classified1into insoluble and soluble1depending1upon1their
solubility. Insoluble0fibers consist1mainly of/cell/wall components1such as0cellulose,
hemi-cellulose/and lignin/and soluble/fibers/are non-cellulosic/polysaccharides/such as
pectin, gums1and0mucilage (Yoon0et al., 2005). Chemical1content of pea0seeds can
vary. Genetic (variety) and environmental1factors (location0of cultivation0area, soil
characteristics, exchangeable1cations, trace1elements, cropping year, total1rainfall,
relative1humidity, solarisation, temperature) are/of importance (Kraus0et al., 2003,
Wang et al., 2004, Nikolopoulou et al., 2006) as well as technological1treatments
106
(dehulling, cooking, soaking, germination, extrusion) (MartinezVillaluenga et al.,
2008, Wang et al., 2004, Al-Marzooqi and Wiseman, 2009.
Table No: 4.2.3 Means values of fiber content in pea genotypes
Genotype Means Genotype Means CH 0.89 L24 1.44 L2 1.11 L25 1.41 L3 0.83 L26 1.52 L4 0.92 L27 1.29 L5 1.12 L28 1.34 L6 1.26 L29 1.37 L7 1.34 L30 1.42 L8 1.42 L31 1.53 L9 1.23 L32 1.47 L10 1.98 L33 1.26 L11 0.88 L34 1.37 L12 0.96 M-25 1.39 L13 0.94 M-116 1.31 L14 0.99 M-102 1.24 L15 1.23 M-91 1.28 L16 1.29 M-07 1.47 L17 1.28 M-83 1.45 L18 1.32 M-22 1.41 L19 1.34 M-72 1.39 L20 1.35 M-39 1.44 L21 1.28 M-86 1.34 L22 1.33 M-08 1.49 L23 1.45 M-79 1.35
4.2.1.4. Crude Protein %
Table No. 4.2.4 was showing the1values for protein-content. The values of
protein were ranging from 27.01% to 17.67%. Maximum-value of (27.01%) was found
for landraces, L-34, followed by L-25 (26.31%). Minimum-value (17.67%) was found
in L-3 and L-4 (19.05%). Other1landraces were showing1intermediates result1for this
trait. Differences in1climate, soil, varieties, and agronomic1practices1may cause
107
different/crude/protein/content/when/grown/in various1parts of the1world. The/results
obtained/in/this/study/are showing1us that genotype had a significant1influence on the
levels1of crude/protein/in/the/field/pea (Wang/and/Daun, 2004). In accordance1Witten
et al., (2015) describes0that the variety1of1field-peas has/an influence on its-crude
protein content. In addition they revealed that environmental conditions and agronomic
practice/have/strong0influence on0pulse-seed/quality.
However, the mean0protein0content of0235 ± 15.5 g kg–1 was0similar to1those
reported/in the literature (Marquardt/and/Bell, 1988). Although only two0green-seeded
and two1brown-seeded cultivars1were included0in this0study, it appeared1that the
variations in protein1contents are/not/related/to/seed-coat1colour, since/the lowest1and
highest/values are within the1yellow-seeded cultivars. There was also no0correlation (r
= –0.07; P ≥ 0.05) between1protein/content and seed0size. This finding1confirms the
previous1study by Ali/and/Youngs (1973), who/obtained a1correlation/coefficient of –
0.12 between0protein and seed0size and/suggested/that selection0for high0protein
would/not have any/deleterious/effects/on seed/size. This wide range of protein content
could0be a reflection1of the0conditions1under/which/the1cultivars were grown0or the
inherent1varietal-differences. In this/regard, protein1contents of peas are0known1to
vary/with soil0type and nitrogen1application (Igbasan0et al., 1996), location1and year
(Ali /and/Youngs, 1973) and1genotypes (Matthews and Arthur, 1985). The0crude
protein/content reported/by Hove et al. (1978) ranged from 205 to 226 g/kg DM. There
are numerous1causes of1variability in the content1of crude-protein, including1genetic
(variety), cultural/and/environmental (soil, climate) origins Protein content is typical of
individual1materials and depends on many1factors, such as: variety, cultivar, soil- and
108
climate1related1factors, fertilization1and others. (Rawel et al., 2002) (Labuckas et al.,
2008). Similar0protein0levels have/also been/reported by/other1authors (Chavan et al.,
1999).
Table No: 4.2.4 Means values of protein content in pea genotypes
Genotype Means Genotype Means CH 23.16 L24 25.87 L2 23.07 L25 26.31 L3 17.67 L26 25.87 L4 19.05 L27 22.09 L5 21.4 L28 21.45 L6 23.91 L29 21.34 L7 20.13 L30 23.73 L8 21.23 L31 25.76 L9 22.67 L32 25.09 L10 23.78 L33 21.79 L11 24.32 L34 27.01 L12 24.78 M-25 20.92 L13 24.89 M-116 21.78 L14 23.56 M-102 22.23 L15 23.4 M-91 23.25 L16 22.27 M-07 23.57 L17 21.35 M-83 23.45 L18 20.89 M-22 22.56 L19 22.45 M-72 21.42 L20 23.43 M-39 23.35 L21 24.23 M-86 23.32 L22 23.65 M-08 24.31 L23 24.86 M-79 21.66
109
4.2.1.5. Carbohydrate (%)
Minimum1carbohydrate were1found in L-34 (59.32%) followed1by M-91
(61.7%), M-07 (61.8%), and L-26 (61.9%), L-25 (61.9%) and L-24 (61.9%), where as
maximum1carbohydrate were observed in L-3 (69.5%) followed by L-4 (68.5%), L-18
(67.7%), L-29 (67.3%) and L-28 (67.0%). All other1landraces showed intermediate
results. Starch is the most1abundant component1of/peas. The/content/of/total (444-520
g/kg0DM) and0enzyme1susceptible (391-447 g/ kg DM) starch0in pea0seeds
significantly/differed among/cultivars. Despite/this, the/average total1starch level/was
similar1to that (480 g/kg) determined0by0Cerning-Bernard and0Filiatre, (1976).
According1to1Colonna et al., (1992) pea starch contained 33.2% amylose and 64.7%
amylopectin.
Other1authors observed1diverting1results1especially for/CP/and/starch, as well
as comparable1results for EE, ash, and/CF. High/variations/of the composition of Field
peas0were founds(Jezierny0et al., 2011; Ravindran0et al., 2010; Schumacher0et al.,
2009; Bastianelli0et al., 1998) with regard to high differences in the selection of
varieties. The present results were generally in agreement with those outcomes.
Fluctuations1could be additionally-due to varying environmental-influence.
110
Table No: 4.2.5 Means values of carbohydrate in pea genotypes
Genotype Means Genotype Means CH 65.03 L24 61.99 L2 64.11 L25 61.98 L3 69.59 L26 61.96 L4 68.57 L27 66.71 L5 65.51 L28 67.09 L6 64.23 L29 67.35 L7 65.88 L30 64.92 L8 65.84 L31 62.3 L9 65.52 L32 63.46 L10 64.38 L33 65.94 L11 63.11 L34 59.32 L12 62.19 M-25 65.96 L13 62.88 M-116 64.58 L14 63.72 M-102 62.22 L15 62.96 M-91 61.7 L16 65.16 M-07 61.89 L17 66.67 M-83 63.81 L18 67.75 M-22 63.08 L19 65.9 M-72 64.59 L20 65.68 M-39 62.93 L21 64.18 M-86 62.7 L22 63.4 M-08 62.12 L23 63.65 M-79 64.59
4.2.1.6. Ash %
Minimum ash contents were found in L-19 (2.1%) followed by L-9 (2.2%), and
L-6, L-10 and L-26 (2.3%), where as maximum ash contents were observed in M-07
(4.4%) followed by M-91 (4.2%). All1other landraces showed average1results. Ash
content1in fruits and1vegetables are affected by agro-climatic1conditions such as
cultivation1practices, nature1of soil, and climatic1conditions. Ash0content is0used to
determine0the total1mineral present in a food1produce. A0high0percentage ash1value
equals a high total/mineral/value/in/the/fruit and vegetable/sample. Mineral availability
in fruits and vegetables-are influenced positively or negatively by these agro-
111
climatic1conditions (Forster0et al., 2002). The absence0of marked0differences in0the
nature0of soil0and climatic/conditions are/factors/that/explain/the lack1of difference in
the/ash/content/of/all/cultivars examined (Bugaud et al., 2006). Other authors observed
diverting0results1especially for0CP and0starch, as/well as1comparable results0for/EE,
ash, and/CF. High1variations of the composition of Field peas were founds(Jezierny et
al., 2011; Ravindran0et al., 2010; Schumacher0et al., 2009; Bastianelli0et al., 1998)
with0regard/to high0differences in0the selection1of0varieties. The present/results were
generally0in agreement/with/those/outcomes. Fluctuations/could be additionally/due/to
varying0environmental-influence.
Table No: 4.2.6 Means values of ash content in pea genotypes
Genotype Means Genotype Means CH 2.8 L24 2.9 L2 3.4 L25 2.7 L3 3.7 L26 2.3 L4 3.4 L27 2.4 L5 2.9 L28 2.7 L6 2.3 L29 2.6 L7 3.8 L30 2.4 L8 3.5 L31 2.8 L9 2.2 L32 2.7 L10 2.3 L33 2.9 L11 2.6 L34 3.8 L12 3.2 M-25 3.2 L13 3.7 M-116 3.6 L14 3.1 M-102 4.2 L15 3.6 M-91 4.4 L16 3.7 M-07 3.9 L17 2.9 M-83 3.1 L18 2.2 M-22 3.7 L19 2.1 M-72 3.5 L20 2.7 M-39 3.4 L21 2.3 M-86 3.6 L22 2.8 M-08 3.2 L23 2.7 M-79 3.5
112
4.2.1.7. Phenolics (mg/g)
Minimum phenolic-contents were found in L-12 (1.163) followed by L-9 (1.27
mg/l), and A-43 (1.29 mg/l), where as maximum phenolic-contents were observed in
L-38 (3.91 mg/l) followed by A-36 (3.82 mg/l). All1other landraces showed average
results. It has been recognized1that phenolic compounds act as antioxidants1and were
found high/amount in peas. The association/of antioxidant-properties of plant1phenolic
compounds and their effects in the prevention1of various1oxidative stress diseases, for
example, cancer or cardiovascular/diseases were explained by Dai and Mumper 2010.
Phenolics or polyphenol have received considerable1attention because of their
physiological-functions, including1antioxidant, antimutagenic and antitumor-activities.
They have been reported to be potential-contender to0combat free radicals, which are
harmful to our body1and foods-systems (Nagai et al., 2003). Although, phenolic
compounds1do-not have any1known nutritional-function, they may be important to
human health because of0their antioxidant/potency (Hollman et al., 1996). Phenolics
are ubiquitous plant/components that are primarily/derived from/phenylalanine via the
phenylpropanoid/metabolism (Dixon and Paiva, 1995). Substantial/dissimilarities that
exist in quantity/and/quality/of1total/polyphenols in plant foods have been attributed to
diverse inherent and external-conditions such as genetic-composition, plant/cultivar,
soil/composition, state of plant maturity, and postharvest practices (Jaffery et al., 2003;
Faller and Fialho, 2010).
Many studies/confirmed that the content/of phenolic-compounds depends on
the type of analyzed/sources. High temperature/processing leads to/alteration of the
molecular0compounds0resulting0in0polymerization0and0alteration0of0the-molecular
113
structure of phenolic1compounds thus leading to a condensed/extractability (Nayak
et al., 2011; Sharma et al., 2012). The high phenolic1contents in all fruit1cultivars
analyzed1agree with Sarawong et al., (2014) who claim that increase in phenolics
could be due to the disruption/of cell/walls by all extrusion/conditions thus subsequent
in higher TPC/content.
Table No: 4.2.7 Means values of phenolic content in pea genotypes
Genotype Means Genotype Means CH 3.213 L24 3.311 L2 3.102 L25 2.872 L3 1.793 L26 2.635 L4 2.069 L27 1.238 L5 2.063 L28 3.612 L6 2.552 L29 1.694 L7 2.914 L30 2.436 L8 1.387 L31 2.255 L9 1.272 L32 1.755 L10 1.535 L33 1.479 L11 1.421 L34 2.981 L12 1.163 M-25 2.523 L13 1.984 M-116 3.821 L14 1.845 M-102 3.311 L15 3.219 M-91 3.913 L16 2.767 M-07 1.635 L17 3.01 M-83 2.045 L18 2.045 M-22 1.326 L19 1.342 M-72 2.454 L20 2.142 M-39 1.292 L21 2.515 M-86 1.367 L22 2.291 M-08 2.198 L23 3.125 M-79 2.987
114
4.2.1.8. Chlorophyll content (mg/g)
Minimum chlorophyll contents were found in L-19 (11.1) followed by L-23
(12.2mg/g), L-7 (13.2mg/g) and L-8 (13.6mg/g), where as maximum chlorophyll
contents were observed in L-30 (33.92mg/g) followed by L-34 (32.35mg/g) and L-24
(31.93mg/g). All/other landraces showed moderate-results. Chlorophyll1is0one of0the
major/chloroplast-components for/photosynthesis, and/relative-chlorophyll-content has
positive0relationships with0photosynthetic1rate. The1decrease in chlorophyll1content
has been considered a typical symptom of oxidative stress and may be the result
of0pigment photo-oxidation and chlorophyll degradation. Photosynthetic pigments
are0important/to plants-mainly for harvesting light/and production/of reducing/powers.
Both0the0chlorophyll0a0and0b0are0prone0to soil dehydration. Environmental0stresses
have a direct impact on the photosynthetic apparatus, essentially by disrupting all
major components of photosynthesis including the thylakoid electron transport,
the carbon0reduction0cycle and the stomatal0control of the CO2 /supply, together with
an increased accumulation of carbohydrates, peroxidative destruction of lipids and
disturbance0of water0balance. The "non-stomatal" mechanisms include1changes in
chlorophyll synthesis, functional1 and structural0changes in0chloroplasts, and
disturbances0in processes0of 1accumulation, transport, and distribution of assimilates
(Allen and Ort, 2001).
115
Table No: 4.2.8 Means values of chlorophyll content in pea genotypes
Genotype Means Genotype Means CH 28.5 L24 31.93 L2 27.2 L25 14.24 L3 23.1 L26 23.2 L4 25.6 L27 29.3 L5 27.4 L28 26.9 L6 22.66 L29 23.3 L7 13.2 L30 33.92 L8 13.6 L31 28.9 L9 21.7 L32 25.36 L10 23.7 L33 13.5 L11 18.6 L34 32.35 L12 18.9 M-25 17.5 L13 18.9 M-116 22.3 L14 33.1 M-102 25.1 L15 29.2 M-91 27.2 L16 15.9 M-07 23.2 L17 27.1 M-83 24.6 L18 17.3 M-22 22.4 L19 11.1 M-72 26.2 L20 15.6 M-39 23.9 L21 18.6 M-86 21.3 L22 13.6 M-08 22.7 L23 12.2 M-79 23.8
4.2.1.9. pH
Table No. 4.2.9 shows the values for pH. The values of pH were ranging from
5.3 to 6.9. Maximum value of pH (6.9) was found for landraces, L-3, followed by L-8,
L-17 and L-30 (6.8). Minimum value (5.2) was found in L-2 and A-36 followed by, L-
27 and A-41 (5.4). Other1landraces were showing/intermediates result/for this trait.
Alkarkhi0et al. (2011) also1report/alike fall outs for0the0pH of young/green0banana
flour. Conversely, the0pH standards of0all young0cultivars were0higher than0values
obtained0in ripe1cultivars as0reported by/Arvanitoyannis/and/Mavromatis, (2009) due
116
to0the associated1increase in organic0acids present0in fruits/as ripening increases. The
pH of/food measures the amount/of/hydronium/ions (H3O+) present in a food/produce.
Many0food/quality1criteria have0been found to/correlate/better with pH than with acid
concentration (Sadler0and9Murphy, 2010).
Table No: 4.2.9 Means values of pH in pea genotypes
Genotype Means Genotype Means CH 6.6 L24 6.5 L2 5.3 L25 5.8 L3 6.9 L26 5.7 L4 6.7 L27 5.4 L5 6.1 L28 6.4 L6 6.3 L29 6.5 L7 6.4 L30 6.8 L8 6.8 L31 6.1 L9 5.8 L32 6.3 L10 6.4 L33 6.2 L11 6.3 L34 6.4 L12 5.6 M-25 5.7 L13 6.7 M-116 5.3 L14 6.5 M-102 5.7 L15 6.3 M-91 6.2 L16 6.3 M-07 6.1 L17 6.8 M-83 6.4 L18 6.7 M-22 5.4 L19 6.3 M-72 5.7 L20 5.9 M-39 5.8 L21 6.4 M-86 5.9 L22 6.1 M-08 6.3 L23 6.7 M-79 6.5
117
4.2.1.10. Total Soluble Solid (TSS) %
Table No. 4.2.10 shows the values for total0soluble0solids. The values of0total
soluble solids/were ranging from 1.1% to 2.9%. Maximum value of (2.9%) was found
for landraces, L-23, followed by L-29, M-116 and L-9 (2.8%). Minimum value (1.1%)
was found in L-3 and L-30 followed by, L-14 and CH (1.2%), and L-5, L-19, L-22,
and M-102 (1.3%). Other landraces were showing intermediates result for this trait.
Generally, the1amount/of1TSS in/a fruit/is directly/proportional/to/the/grade/of
fruit1maturity as1TSS is supposed/to1increase with1fruit maturity. Thus, TSS/can/also
oblige/as0a convenient/directory in0the determination0of0fruit ripeness and0maturity.
Comparable outcomes were recorded for TSS of green Cavendish banana flour and
unripe1banana (Alkarkhi et al., 2011). The low1values recorded1for the TSS0of all
cultivars0are accredited to0the fact0that the obtainable0starch existent in the1unripe
cultivars1are yet to be converted/into soluble0sugars0through0enzymatic0degradation
(Zhang0et al., 2005). Degradation/and consequent0reduction0in starch/proceed/rapidly
during/the1onset/of/ripening/thus leading/to/an/overall/increase in/TSS/of/fruits.
118
Table No: 4.2.10 Means values of total soluble solid in pea genotypes
Genotype Means Genotype Means CH 1.2 L24 2.1 L2 1.4 L25 1.7 L3 1.1 L26 2.5 L4 1.7 L27 1.9 L5 1.3 L28 1.4 L6 1.8 L29 2.8 L7 2.1 L30 1.1 L8 2.6 L31 2.2 L9 2.8 L32 1.6 L10 1.7 L33 2.4 L11 2.2 L34 1.7 L12 1.6 M-25 1.4 L13 1.4 M-116 2.8 L14 1.2 M-102 1.3 L15 2.8 M-91 2.3 L16 1.7 M-07 2.7 L17 1.6 M-83 1.5 L18 1.5 M-22 2.7 L19 1.3 M-72 2.3 L20 1.8 M-39 2.4 L21 2.3 M-86 2.1 L22 1.3 M-08 2.7 L23 2.9 M-79 2.3
4.2.11. CLUSTER ANALYSIS
Average linkage distance among peas germplasm
The cluster1analysis revealed1as a dendrogram1figure 4.2.1 indicated the
expected association/among 46 Peas1landraces. Dendrogram1was constructed with
computer1software PAST, using fourty1six genotypes/showed three main1clusters I, II
and/III at linkage/distance of near about 26. Cluster I includes/two sub-clusters I-A and
I-B. Cluster I comprised/of fifteen/landraces. In/sub-cluster/I-A, landraces L-16/and L-
20, L-18 and L-35, L-11 and L-12 were significantly correlating each other while
119
landraces L-13 and L-21 were outliers in this sub/cluster. Sub/Cluster I-B comprised of
landraces, L-23 and L-22, L-8 and L-33 present at same linkage distance showing
maximum/similarity in term of traits/studied while L-25, L-7 and L-19 were outliers.
Cluster II comprised/of fourteen/landraces and was sub divided/into/two/sub
cluster, II-A0and II-B. Sub-cluster1II-A was comprised/of landraces, L-15 and L-38,
CH and L-2, L-5 and A-42, L-17 and L-28 at same linkage/distance whereas landraces
L-27 and L-31 were outliers/for the cluster. While/sub/cluster II-B1was comprised-of
landraces, L-14 and L-30, L-24 and L-34 were correlating/each other at same/linkage
distance, respectively.
Cluster0III 1was1further0divided1into two0sub clusters, III-A1and III-B. Sub
cluster1III-A was comprised1of1landraces L-3 and L-4 were at1same linkage/distance.
Sub1Cluster III-B was composed of L-9 and L-29, M-116 and M-79, L-10 and M-83,
M-22 and M-86, M-07 and M-08 were significantly/correlating to each/other at same
linkage-distance. Landraces L-37, L-32, L-26 and M-39 were outliers for this cluster,
showing-variation.
120
Figure 4.2.1: Dendrogram based on average linkage distance for 46 peas
landraces
121
4.2.12. Average linkage distance among pea’s traits based on biochemical studies
The cluster/analysis exposed as a dendrogram1showed the probable/association
among 10 Peas traits. Dendrogram1was constructed with computer1software PAST,
using fourty six genotypes showed/two1main clusters1I and II1at linkage1distance of
near/about 400. Cluster I includes only one trait i.e, Carbohydrate, while, cluster II was
subdivided into/two sub-cluster II-A/and/II-B. Sub cluster II-A comprised/of four traits
including moisture/content and pH, protein1and chlorophyll1at same linkage distance
whereas, fats and fibers, phenolics and ash contents were correlating/each other for sub
cluster II-B. Total /soluble solids/were outlier in this/cluster.
122
Figure 4.2.2: Dendrogram based on average linkage distance for 10 Traits
123
Figure 4.2.3: Scatter Biplot diagram of 46 landraces of peas on the basis of
biochemical characterization
4.1.13: Simple Correlation Coefficient
Table 4.2.11 represents the correlation0coefficients/among0all/the0biochemical
traits. Ash0was showing0maximum positive/and highly0significant/correlation0with
moisture0content (0.583** ), phenolic1content (0.76** ) and0fat (0.371** ). Fiber0was
showing1highly significant0and positively/correlated with three characters/which/are:
protein (0.455** ), total1soluble1solid (0.437** ), and0fat (0.399** ). Maximum0positive
and highly significant correlation was observed between carbohydrate and pH
(0.418** ). Fat was showing positive and significant correlation with moisture content
Moist.Moist.Moist.Moist.
TSSTSSTSSTSS
Phen.Phen.Phen.Phen.
PhPhPhPh
ProteinProteinProteinProtein
FatFatFatFat
FiberFiberFiberFiber
AshAshAshAsh
Carbo.Carbo.Carbo.Carbo.
Chloro.Chloro.Chloro.Chloro.CHCHCHCH
L2L2L2L2
L3L3L3L3
L4L4L4L4
L5L5L5L5
L6L6L6L6
L7L7L7L7
L8L8L8L8
L9L9L9L9
L10L10L10L10
L11L11L11L11
L12L12L12L12L13L13L13L13
L14L14L14L14
L15L15L15L15
L16L16L16L16L17L17L17L17
L18L18L18L18
L19L19L19L19 L20L20L20L20L21L21L21L21
L22L22L22L22
L23L23L23L23
L24L24L24L24
L25L25L25L25L26L26L26L26
L27L27L27L27
L28L28L28L28
L29L29L29L29L30L30L30L30
L31L31L31L31
L32L32L32L32
L33L33L33L33
L34L34L34L34
A35A35A35A35
A36A36A36A36
A37A37A37A37
A38A38A38A38
A39A39A39A39
A40A40A40A40
A41A41A41A41
A42A42A42A42
A43A43A43A43
A44A44A44A44
A45A45A45A45
A46A46A46A46
-5-5-5-5 -4-4-4-4 -3-3-3-3 -2-2-2-2 -1-1-1-1 1111 2222 3333
Component 1Component 1Component 1Component 1
-3.0-3.0-3.0-3.0
-2.4-2.4-2.4-2.4
-1.8-1.8-1.8-1.8
-1.2-1.2-1.2-1.2
-0.6-0.6-0.6-0.6
0.60.60.60.6
1.21.21.21.2
1.81.81.81.8
2.42.42.42.4
CC CCoo oo
mm mmpp pp
oo oonn nn
ee eenn nn
tt tt 22 22
124
(0.316*), protein (0.313*) and0total/soluble0solid (0.312*), respectively. Maximum
positive and significant correlation was observed between chlorophyll content and
phenolic1contents (0.342*), whereas maximum positive/and significant/correlation was
observed for total soluble solids and moisture content (0.338*). A strong negative and
highly significant correlation was observed between carbohydrate and protein (-
0.447** ).
It/is stated/that/starch/accounts/for/variations/in the/CP/content/of/field/peas in
the first place (Bastianelli et al., 1998); Holl and Vose, 1980; Reichert and MacKenzie,
1982; Wang et al. (2008). A reason for this negative/correlation between starch and CP
contents can be the higher1increase of0starch in0comparison to CP in the
maturation0process of1the1seeds (Borreani0et al., 2007). This0change in the
relationships1between the ingredients1during maturation1could also1is a0possible
reason for described correlations between other nutrients like CP and sugar.
Correlations1with partly1varying/strength has been0found by different1researchers.
Reichert/and/MacKenzie (1982) also/found/negative/correlations of/starch, EE, and CF
with/CP. Nikolopoulou/et al. (2007) published/higher/correlations/between/CP/and ash
and0further/correlations0between ash/and/EE, ash0and starch, as well as EE/and starch
than/within/the present/data. They found/CP and EE positively/correlated in field peas.
Bastianelli0et al. (1998) found0EE with0CP, starch, and0CF negatively1correlated.
The correlation coefficients seem strongly dependent on the data basis. Hence,
correlations1are not suitable for predicting0the composition1of0harvested crops/due/to
a high variability of genetic and environmental influences on the maturation process
(Gallardo et al., 2008); Gutierrez0et al. (2007); Weber0et al. (2005).
125
Table 4.2.11: Correlation matrix on ten traits
Moist TSS Phe pH Pro Fat F A C Chl Moist 1
TSS .338* 1
Pheno .209 .076 1
Ph -.208 -.064 .174 1
Protein .141 .251 .226 .050 1
Fat .316* .312* .113 .017 .313* 1
Fiber .273 .437** .195 .081 .455** .399** 1
Ash .583** .220 .376** .039 .010 .371** .041 1
Carbo. -.143 -.041 .026 .418** -.447** -.127 .037 -.043 1
Chloro .203 -.019 .342* .154 .284 .219 .143 .245 .027 1
**. Correlation is significant at the 0.01 level (2-tailed). *. Correlation is significant at the 0.05 level (2-tailed). Where; Moist= Moisture %age, TSS= Total soluble solid, Pheno= Phenolic content, Carbo= Carbohydrates, and Chloro= Chlorophyll content.
4.1.16. PRINCIPAL/COMPONENT /ANALYSIS
Principal1component analysis1simplifies the complex0data by1changing the
number of related variables into smaller number of variables called principal
components. Principal component analysis was performed based on ten characters. The
first1four principal1components (PC) accounted/for 68.86% of the/variation (27.06,
17.06, 14.71 and 10.03 for PC1, PC2, PC3and PC4, respectively). The1maximum
Eigen1value was 2.71 while/the minimum/was 1.00.
Table 4.2.12: The Eigen values for 10 traits of Pisum sativum L. Genotypes
PC 1 2 3 4
Eigenvalue 2.71 1.71 1.47 1.00
% variance 27.06 17.06 14.71 10.03
Cumulative variance % 27.06 44.12 58.83 68.86
126
FACTOR LOADINGS FOR VARIOUS COMPONENTS
Figure 4.2.4: Factor Loadings for PC1 for biochemical traits of pea
Figure 4.2.4 showed/the factor0loadings1for ten biochemical/traits1in Peas
genotypes. In factor loading for PC 01 maximum1positive/load1was contributed1by
protein-content (0.6077) followed0by moisture-content (0.5986), fat (0.5562), total
soluble-solids (0.4663), fiber (0.434), ash-content (0.3936), phenolic-content (0.2001)
and Chlorophyll-content (0.1853), while0maximum1negative1load1was explained1by
carbohydrates (-0.8834) followed by pH (-0.5037) respectively.
0.3639
0.2835
0.1216
-0.3062
0.36940.3381
0.26380.2393
-0.537
0.1126
Moi
st.
TSS
Phe
n. Ph
Pro
tein
Fat
Fibe
r
Ash
Car
bo.
Chl
oro.
-1.0
-0.8
-0.6
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8
Loa
ding
127
Figure 4.2.5: Factor Loadings for PC2 for biochemical traits pea
Figure 4.2.5 showed the factor/loadings for ten biochemical1traits in Peas
genotypes. In factor/loading for PC 02 maximum0positive load/was/contributed/by ash
(0.7862) followed1by moisture (0.5262), phenolic-content (0.3124), chlorophyll
content (0.2013), carbohydrates (0.112) and fat (0.0254, while/maximum negative/load
was explained by protein (-0.5943) followed by fiber (-0.5184), total soluble solids (-
0.1333) and pH (0.01622) respectively.
0.4029
-0.102
0.2392
-0.07367
-0.455
0.01496
-0.3969
0.6019
0.11730.1541
Moi
st.
TSS
Phe
n. Ph
Pro
tein
Fat
Fibe
r
Ash
Car
bo.
Chl
oro.
-1.0
-0.8
-0.6
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8Lo
adi
ng
128
Figure 4.2.6: Factor Loadings for PC3 for biochemical traits of pea
Figure 4.2.6 showed the factor1loadings for ten biochemical1traits in Peas
genotypes. In factor1loading for PC 03 maximum1positive/load1was contributed1by
chlorophyll/content (0.6559) followed1by phenolic1content (0.5436), protein-content
(0.1543), moisture-content (0.2154), carbohydrates (0.0031) and protein (0.4066) and
pH ( 0.303) while maximum negative1load was explained by total1soluble/solids (-
0.5102), followed by moisture content (-0.2826), carbohydrates (-0.2745), fiber (-
0.197), fat (-0.0495) and ash (-0.00629) respectively.
-0.233
-0.4207
0.4482
0.28140.3352
-0.07828
-0.1625
-0.005186
-0.2263
0.5408
Moi
st.
TSS
Phe
n. Ph
Pro
tein
Fat
Fibe
r
Ash
Car
bo.
Chl
oro.
-1.0
-0.8
-0.6
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8
Loa
ding
129
Figure 4.2.7: Factor Loadings for PC4 for biochemical traits pea
Figure 4.2.7 showed the factor1loadings for ten biochemical1traits in Peas
genotypes. In factor/loading for PC 04 maximum1positive/load was contributed/by pH
(0.5412) followed1by fat (0.4377), fiber (0.4), phenolic1content (0.37). Total soluble
solids (0.3), ash (0.1), carbohydrates (0.196) and chlorophyll (0.02543) while
maximum negative load was explained by protein (-0.2255) and moisture (-0.1932)
respectively.
-0.1929
0.3202 0.3205
0.5404
-0.2252
0.4370.3993
0.15970.1957
0.02539
Moi
st.
TSS
Phe
n. Ph
Pro
tein
Fat
Fibe
r
Ash
Car
bo.
Chl
oro.
-1.0
-0.8
-0.6
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8Lo
adi
ng
130
Figure 4.2.8: Factor Loadings for PC5 for biochemical traits pea
Figure 4.2.8 showed the factor1loadings for ten biochemical1traits in Peas
genotypes. In factor1loading for PC 05 maximum1positive/load1was contributed1by
phenolic1content (0.593), followed0by total/soluble/solids (0.213), fiber (0.157),
moisture/content (0.017), carbohydrate (0.087), and protein (0.006) while/maximum
negative/load/was explained by fat (-0.587) followed/by chlorophyll/content (-0.2607),
pH (-0.093) and ash (-0.0476) respectively.
0.06723
0.2767
0.6354
-0.1
0.02149
-0.629
0.1682
-0.05101
0.01272
-0.2793
Moi
st.
TSS
Phe
n. Ph
Pro
tein
Fat
Fibe
r
Ash
Car
bo.
Chl
oro.
-1.0
-0.8
-0.6
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8Lo
adi
ng
131
Figure 4.2.9: Factor Loadings for PC6 for biochemical traits pea
Figure 4.2.9 showed the factor1loadings for six quantitative1traits in Peas
genotypes. In factor1loading for PC 06 maximum positive1load was contributed by
chlorophyll1content (0.5506)) followed1by fiber (0.3598s), carbohydrates (0.227),
moisture (0.09022), and phenolic content (0.03629) while/maximum/negative load was
explained by pH (-0.3679) followed1by Protein content (-0.2391), ash (-0.2575), fat (-
0.0311) and total soluble solids (-0.0130) respectively.
0.1026
-0.01488
0.04129
-0.4186
-0.272
-0.03542
0.4093
-0.2929
0.3023
0.6264
Moi
st.
TSS
Phe
n. Ph
Pro
tein
Fat
Fibe
r
Ash
Car
bo.
Chl
oro.
-1.0
-0.8
-0.6
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8Lo
adi
ng
132
Figure. 4.2.10: Scree plot diagram of various factors
Scree1plot diagram constructed/for ten traits showed/that out of 10
six traits were showing/the Eigen value greater than 0.7. Eigen value
greater than 0.7 (Jolif cutoff) indicated that six component/or traits were
showing/maximum variance in term of/variability.
0 1 2 3 4 5 6 7 8 9 10
Component
0
3
6
9
12
15
18
21
24
27Eig
enva
lue
%
133
EXPERIMENT NO: 03
4.3. MOLECULAR STUDY
The local landraces of peas in Azad-Kashmir as well in1Pakistan1indicated
larger1diversity among them1while comparison1is made on yield1and yield1relates
characters. In order to as certain their diversity on the basis0of DNA known/primer
was employed1using PCR techniques and standard-gelelectrophoresis/methodologies.
The banding patterns were compared and photographs were taken for reference.
Twenty-different-primers for pea varietal/discrimination were used to find out the
molecular diversity among 46 local landraces of peas. Almost every primer indicated
variability1in1the amplified0band among the landraces the representative0banding
pattern with/specific/primers/are given/below.
Figure 4.3.1: PCR Amplification products of AD-51 primer among 46 pea
Landraces (A)
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
134
Figure 4.3.1(b): PCR Amplification products of AD-51 primer among 46 pea
Landraces (B)
Figure 4.3.2: PCR Amplification products of AA-163.2 primer among 46 pea
landraces (A)
L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
135
Figure 4.3.2(b): PCR Amplification products of AA-163.2 primer among 46 pea
landraces (B)
Figure 4.3.3: PCR Amplification products of AA285 primer among 46 pea
landraces (A)
L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
136
Figure 4.3.3(b): PCR Amplification products of AA285 primer among 46 pea
landraces (A)
Figure 4.3.4: PCR Amplification products of D21 primer among 46 pea landraces
(A)
L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
137
Figure 4.3.4(b): PCR Amplification products of D21 primer among 46 pea
landraces (B)
Figure 4.4.5: PCR Amplification products of AD83 primer among 46 pea
landraces (A)
L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
138
Figure 4.3.5(b): PCR Amplification products of AD83 primer among 46 pea
landraces (A)
Figure 4.3.6: PCR Amplification products of AA92 primer among 46 pea
landraces (A)
L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
1000
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
139
Figure 4.3.6(b): PCR Amplification products of AA92 primer among 46 pea
landraces (B)
Figure 4.3.7: PCR Amplification products of AB72 primer among 46 pea
landraces (A)
L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
140
Figure 4.3.7(b): PCR Amplification products of AB72 primer among 46 pea
landraces (B)
4.3.1. Molecular comparison among the Landraces
The selection system of breeding-material on the basis of morphological
characters-remain valuable, but this assessment-has limitations, including the influence
of environment or management practices (Nemera et al., 2006), whereas the SSR
based1markers are free-from such0biase. Microstaellite-polymorphism were scored/for
presence “1” and0absence “0” of/amplified1bands and were used for the1estimation of
dissimilarity-coefficients-dice-coefficient method by using-NTSYs.pc.
Moreover, the conventional1approach to characterize1the cultivars in crop1and
vegetable1species on the basis1of phenotypic1observations is slow1due to the long life
cycle1of the plants1therefore, there is need to1incorporate-the new0methods based0on
studies1at-the DNA/level/in/order to1determine the genetic/relationships and/diversity
among different cultivars. In the present study, a high value of polymorphism was
L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
3000
2000
1500
1200
1000
900
800
700
600
500
400
300
200
100
141
recorded/for/the/entire/SSR/markers/investigated.
In-traditional1breeding0programmes, large/quantity/of/useful/alleles/have/been
lost, which has hindered genetic improvement of wheat. Molecular markers are
capable to provide understanding of heritable assets, used for evaluation of1genetic
variability and also used for evaluating the variability regardless1of agronomic1and
geographical/origins (Shiran/et al., 2007). The-bands obtained through electrophoresis
were photographed using Gel-Documentation system.
Out of 20 amplification product scored, 595 were found out of which 357 were
monomorphic and 257 were polymorphic. The average number of the scorable bands
per0primer was 29.75%, while average number of monomorphic and polymorphic
bands0was 16.25% and 12.85%, respectively. The high-frequency of polymorphism
was detected0with all0selected1primers. The percentage of polymorphic0bands1was
100%0with three primers0i.e; AC58, AD270 and AA90, while low-value0of
polymorphism0was recorded0for primer AA205 and AB141 (0%), AA103 (21.4%),
AA285 (24.4%), AD147 (26.8%), AA175 (27.3%) and AA67 (30%), respectively.
Moderate-values of0polymorphism were recorded9for primer AB72 (505), AA92
(52.6%), D21 (53.6%), AA163.2 (55.8%), AA355 (60.7%), AD148 (66.7%), AD51
(68.2%) and AB53 (73.7%), respectively.
A study on genetic0diversity-among1varieties and0hybrid lines of0Pea (Pisum
sativum0L.) as revealed1by/morphological1traits and SSR/markers was conducted1by
Badr et al. (2015). The results1showed/that the number of total bands and polymorphic
bands1and the percentage1of polymorphism/in/the/five/parent/varieties were generally
higher0than their1corresponding-values1in-their hybrid0lines. A maximum0number/of
142
720bands was0scored in/Var. Master0B and includes 430polymorphic-bands/including
two unique bands scoring 59.97% polymorphism. The other four varieties showed
lower0percentages of0polymorphism; the two0parents Lincoln0and Little/marvel/have
identical1percentage of051.6%; the0variety-Sugarles0 has a percentage/of/50.0%. The
hybrid0lines Lincoln0x Little0Marvel, Lincoln0x Sugarless0and Little0Marvel x
Sugarless showed lower proportion of polymorphism (34.1%, 35.6% and 36.9%
respectively). On0the other/hand, the two hybrid lines (Luxer x Master B and Master B
x Little0Marvel) showed/higher percentage/of SSR/polymorphism (47.2% and/49. 1%)
compared to other hybrid/lines. The/other/17/hybrids /have /intermediate/percentages
of/polymorphism-ranging-between038.3% in the two0hybrid0lines Little0Marvel x
Luxer0and Sugarless/x Master/B to 45.3% in the hybrid1line Master/B x/Lincoln.
Simple0sequence/repeat/markers/were developed/based on expressed/sequence
tags (EST-SSR) and screened0for/polymorphism/among/23 Pisum/sativum/individuals
to assist development and refinement of pea linkage maps. In particular, the SSR
markers were developed to assist1in mapping of white0mold disease resistance
quantitative1trait0loci. Primer pairs were designed for 46 SSRs identified in EST
contiguous1sequences-assembled0from a 454/pyrosequenced0transcriptome of/the/pea
cultivar, ‘LIFTER’. Thirty-seven/SSR1markers0amplified PCR1products, of/which/11
(30%) SSR1markers produced0polymorphism in 230individuals, including1parents of
recombinant inbred lines, with two to four alleles. The observed and expected
heterozygosities ranged1from 0 to 0.43/and from/0.31 to 0.83, respectively (Zhuang et
al., 2013).
143
Molecular markers/have been applied to address genetic-diversity and breeding
of and have great potential to0speed-up the process of developing1improved/cultivars.
The/simple/sequence/repeats (SSR), also known as microsatellites, have/been used/on
various collections of/peas/as a sole/source of0variation (Sarıkamı0et al., 2010) and in
combination with morphological variation. Although several hundreds of simple
sequence repeats (SSR) markers have been identified. Additional SSR markers with
polymorphism0are needed, for the development1of linkage1maps for use/in1breeding-
new1varieties with-resistant to/white/mold/disease/and for/mapping/studies (Zhuang et
al., 2013).
144
Table: 4.3.1: Polymorphism among Pea genotypes generated by 20 Primers
Primers Total No. of Bands
Monomorphic bands
Polymorphic bands
Monomorphic %age
Polymorphic %age
AC58 5 0 5 0.0 100.0 AD270 4 0 4 0.0 100.0 AA335 28 11 17 39.3 60.7 AB53 19 5 14 26.3 73.7 AA205 28 28 0 100.0 0.0 AA163.2 43 19 24 44.2 55.8 AA92 57 27 30 47.4 52.6 D21 28 13 15 46.4 53.6 AD148 18 6 12 33.3 66.7 AA285 45 34 11 75.6 24.4 AD147 41 30 11 73.2 26.8 AA175 33 24 9 72.7 27.3 AD83 32 23 9 71.9 28.1 AD73 47 26 21 55.3 44.7 AB141 20 20 0 100.0 0.0 AB72 30 15 15 50.0 50.0 AA103 28 12 6 42.9 21.4 AA67 30 18 9 60.0 30.0 AD51 44 14 30 31.8 68.2 AA90 15 0 15 0.0 100.0 Total 595 325 257 970.2 984.0
4.3.2: Hirrareical cluster
The cluster/diagram constructed0by mean 0f NTSys.pc revealed8two/main
clusters I and II at distance-of about 0.38. Cluster I comprised of only one landrace; L-
46. Cluster II was subdivided0into two sub0clusters IB and IIB. Sub-cluster IB
comprised-of only/two landraces L-44 and L-45 correlating each other at same linkage
distance. Sub cluster IIB comprised-of two sub sub-clusters IIB1 and IIB2. IIB1
comprised/of only-one landrace-namely L-43 whereas cluster IIB2 further-sub-divided
145
into0three sub sub-sub-clusters, IIB2a, IIB2b and IIB2c. IIIB2a comprised0of 6
landraces-namely; L-31(M-79) and L-33, L-30 (M-08) and L-34 were correlating0each
other0at same distance while L-29 (M-86) and L-32 were outliers for the cluster. IIB2b
was consisting0of two landraces, L-41 and L-42. IIB2c was comprised of 34 landraces.
L-2 and L-3, L-6 and L-6 and L-7, L-9 and L-10, L-12 and L-16, L-13 and L-14, L-15
and L-18, L-20 (M-25) and L-24 (M-07), L-26 (M-22), L-35, L-21(M-116) and L-36
were-correlating to each other0at same linkage distance. While L-1, L-5, L-8, L-11, L-
24 (M-07), L-19, L-17, L-25 (M-83), L-23 (M-91), L-36 and L-37 were-outliers in the
clusters1showing0variation. Similar/studies were carried-out by Kumari et al., 2013
who0studied the/genetic0diversity0among028/pea (Pisum/sativum L.) genotypes/using
320simple1sequence0repeat0markers. Cluster0analysis based0on Jaccard’s0similarity-
coefficient0using the unweighted0pair-group0method with arithmetic/mean (UPGMA)
revealed02 distinct0clusters, I0and0II, comprising06/and 22pgenotypes, respectively.
Cluster0II was further0differentiated-into020subclusters, IIA0and0IIB, with012/and
100genotypes, respectively.
Ahmad et al. (2012) evaluated0the genetic1diversity in 350diverse Pisum
accessions utilizing 15 polymorphic microsatellites situated on various pea
chromosomes. Microsatellites1were observed to be1polymorphic, amplifying a total-of
411alleles and could1separate every/one of the 350Pisum0genotypes. These1markers
were scored0by their polymorphic0information0content (PIC), ranging0from 0.055
(AA206) to00.660 (AB72) with0a normal/of00.460, and by/their/discriminating/power
(D), which0varied from00.057 (AA206) to00.679 (AB72) with1an average/of00.475.
Unweighted0pair0group0method0with arithmetic0averages (UPGMA) cluster/analysis
146
grouped the 35 pea accessions into two majors clusters and eight sub-clusters. The
larger part of Canadian and European genotypes were assembled independently,
suggesting/both0these groups/are/from/genetically/distinct/gene/pools. The/genetically
diverse groups identified in this study can be used to derive parental lines for pea
breeding.
Another0scientist, Kumari et al. (2013) analyzed028 pea (Pisum sativum L.)
genotype0to asses/genetic diversity by using032 simple0sequence repeat markers. A
total of 44 polymorphic bands, with an average of 2.1 bands per primer, were
obtained. Cluster analysis based on Jaccard's similarity coefficient using the
unweighted pair-group method with arithmetic mean (UPGMA) revealed two distinct
clusters, I0and0II, comprising06 and 220genotypes, respectively. Cluster II was further
differentiated0into/2sub-clusters, IIA/and/IIB, with 12/and 100genotypes, respectively.
Principal component (PC) analysis revealed results similar to those of UPGMA. The
first, second, and0third PCs-contributed021.6, 16.1, and014.0% of the0variation,
respectively; cumulative/variation/of/the/first/3/PCs was/51.7%.
147
Figure 4.3.8: Dendrogram based on average linkage distance for 20 SSR Primer
148
4.3.3: Correlation Matrix
The correlation matrix was computed by mean of Dice similarity coefficient
(Figure No: 4.3.1. Similarity0matrix was ranging/between 0.18 and 0.98. Maximum
similarity-was noticed among L-7 and L-6 (0.97) followed by L-14 and L-13 (0.97), L-
3 and L-1, L-15 and L-13, L-17 with L-13 and L-15, L-19 with L-12, L-15, L-13 and
L-17 (0.94), L-5 and L-3, L-20 and L-18 (0.93), L-10 and L-9 (0.92), L-15 and L-14,
L-16 with L-10 and L-14, L-19 and L-14 (0.92), L-4 and L-2 , L-9 and L-8, L-12 and
L-10, L-19 and L-18, L-6 and L-2 (0.91), L-4 and L-3, L-6 and L-5, L-20 and L-12, L-
20 with L-17 and L-19 (0.90), L-13 and L-12, L-16 with L-13 and L-15, L-19 and L-
16, L-2 and L-10 (0.89), L-5 and L-2, L-7 and L-2, L-10 and L-7 (0.88), L-15 and L-
12, L-17 and L-12 (0.88),0respectively.
Moderate0values for0similarity were found/for L-15 and L-2 (0.80), L-16 with
L-2 (0.81) and L-9 (0.84), L-19 and L-4 (0.75), L-20 and L-4 (0.76), L-25 and L-24
(0.86), L-26 and L-24 (0.80), L-30 and L-24 (0.48).
Minimum/values of similarity/coefficient were noticed/among L-33 and L-46
(0.18), L-42 and L-33 (0.31), M-86 and L-33 (0.29), L-33 and M-08 (0.33), L-33 and
M-79 (0.29), M-79 and L-32 (0.22), M-08 and L-32 (0.33), M-79 and L-31 (0.33), L-
29 and L-46 (0.29), L-23 and L-24 (0.22), respectively. The genetic diversity among
280pea (Pisum0sativum L.) genotypes was analyzed using 32 simple sequence repeat
markers by (Kumari et al., 2013). A total of 44 polymorphic bands, with an average of
2.10bands per0primer, were/obtained. The polymorphism0information-content ranged
from 0.657 to 0.309 with/an average of 0.493. The variation in genetic diversity among
these0cultivars ranged from 0.110to00.73. Simioniuc0et al. (2002) reported0a
149
relatively0higher similarity1range (0.80-0.94) with/RAPD/markers compared with that
obtained0using AFLP0markers in pea0cultivars (0.85-0.94). Baranger/et al. (2004) got
an extensive variety of similitude (0.0-1.0) in 148 Pisum genotypes utilizing protein
and/PCR-based-markers. In this-examination, the evaluated-hereditary-assorted/variety
(0.05-0.82) among pea accessions in view of SSR-markers was higher than that
revealed by Tar'an0et al. (2005) (0.0-0.66) and Ford0et al. (2002) (0.05-0.48) yet/like
those0distributed0by Cupic0et al. (2009) (0.24-0.84). The1higher/estimated1genetic
distance could be described to differences between accessions owing to diversification
in/the/pedigree/of/the/genotypes.
150
CONCLUSION AND RECOMMENDATIONS
Two-years/field studies and0laboratory based0experimentation revealed/the
following-conclusions/regarding the landraces/of peas collected from Azad Jammu and
Kashmir and NARC, Islamabad. All landraces-indicated maximum0diversity in almost
all0morphological, biochemical and molecular-traits compared, hence could be utilized
in further0breeding and production0of high yielding/landraces of peas in future. Based
on0average1linkage distance0between1landraces, computed0from0morphological
data0following landraces0were showed maximum-variability, Check, L-10, L-50,
L-57, L-34, M-39, L-47, M-86, M-83, L-33, L-24, L-71 and L-64 Cluster0based
on biochemical1analysis revealed that maximum-variability was contributed0by
carbohydrates0and total-soluble-solids, while0landraces L-13, L-21, L-25, L-7,
L19, L-27, L-31, L-32, L-34 and L-26 were also0diverse and1contributing
maximum toward variation. Dendrogram constructed on the basis of molecular
studies revealed-landraces M-39, L-29, L-32, Check, L-5, L-8, L-11, L-24, L-19,
L-17, L-25, L-23, M-102 and M-83 were showing0maximum-diversity.
To select parents of desired proximate composition and put these selected seeds
through further-hybridization-program for improvement0of these and other-agronomic
traits studies on large scale are required. Based on the knowledge obtained from
morphological, biochemical1and molecular1characterization of0populations of Pisum
sativum, the present1study could/be used/as/a/benchmark/for future0studies. The study
had also-revealed the presence of0diversity, which needs to be explored further. On the
basis of present0research following1landraces Check-variety, (L-24, L-25, these
landraces are from Trarkhal), (L-32, L-34 these landraces are from Bloch), (M-39, M-
151
83 and M-86 these landraces are from NARC) show best/performance on/the/basis/of
morphological, biochemical and molecular/characterization of peas. This was indicated
by the fact0that some local1landraces of Peas were better0than the released varieties in
their proximate-composition. These landraces0can be used in future for0breeding and
producing-high yielding-cultivars for off season-growing of peas. In general, the study
implied0the importance of intensive0collection and characterization-work needed to be
done in the future.
The0prospects of Pea-crop are very bright in Pakistan. Keeping in view its
incredible potential a comprehensive and integrated effort to improve the existing
germplasm should be initiated which may lead to diversification0in conventional
agricultural system and may become a profitable venture for poor farmers of the
country.
152
SUMMARY
Legumes0are important0crops worldwide, and they have major0impacts on
agriculture, the0environment, animals1and human1nutrition. Pea (Pisum sativum L.), a
leguminous-crop, belongs0to family1leguminoseae, which/has an/important/ecological
advantage1because it contributes0to the/development of/low-input farming/systems by
fixing1atmospheric0nitrogen and it serves as a break-crop which further-minimizes the
need for1external inputs. Keeping in view the importance of pea crop and the
importance0of its genetic0diversity, the available1germplasm was evaluated for
economically-important-traits, phenotypic1elaboration and their further1utilization in
the breeding1programs. The current0study was designed1to select1some morpho-
physiological, biochemical1and yield1parameters responsible0for higher1yield of peas
that could be helpful1to develop-high yielding off season varieties in future. This study
was/conducted during/2015-16/at University of/The/Poonch, Rawalakot.
On the basis of morphology, maximum germination1percentage1was
observed0in case of M-72, M-102, M-91, M-25, L-18 and L-16 (90). Maximum
growth1vigour was noticed among/landraces, L-8, l-9, L-10, L-48, L-49, L-50, L-
56, L-57, L-63 and M-86. Maximum plant1height was observed1in case of L-29
i.e, 80 cm. Maximum-numbers of seed per pod were recorded in case of M-83 and
Check variety, while 100-seed1weight and yield was maximum in case of
landraces M-83 that was 29.60 kg and 19.73 kg/hectare, respectively. The
correlation1coefficients among all the quantitative1traits computed for1morphological
traits1revealed that the yield had maximum1positive with highly significant correlation
with seed1weight (1.000** ). Leaf length showed maximum positive and highly
153
significant correlation with leaf width (0.994** ) and leaf area (0.989** ) followed by leaf
area and leaf1width (0.985** ). Number of seed1per pod was having positive and highly
significant1correlation with pod1length (0.960** ), seed-weight (0.935** ) and1yield
(0.934** ), respectively1followed by days to flower1completion with days to flower
initiation (0.923** ). Pod1length showed maximum0positive and highly1significant
correlation with seed-weight and0yield (0.912** ). The plant1height showed highly
significant and positive-correlation with four0characters: leaf area (0.831** ), number of
leaves (0.821** ), days to flower0completion (0.569** ) and days to flower-initiation
(0.526** ). Number of leaves0showed highly significant and positive correlation with
the traits1such as leaf1length (0.798** ), leaf1width (0.781** ), leaf1area (0.777** ). A
highly significant-correlation was found between pod width with seed weight and yield
(0.621** ). Number0of pods per0plant had a positive0significant-correlation with leaf
length (0.227*), leaf1width (0.249*) and number1of leaves (0.228*). Yield was
correlated0with two0characters: leaf-width (0.262*) and leaf-length (0.239*). Principal
component1analysis demonstrated three separated0components, cumulatively-showing
78.53 % of total variability.
On the basis of biochemical1studies, maximum phenolic-content was observed
in M-91 (3.91 ml/l), protein1content in L-34 (27.01 %), fat in M-25 (1.62 %), fiber in
L-10 (1.98 %), ash1content in M-91 (4.4 %) and1carbohydrate in L-3 (69.59 %). The
correlation coefficients among all the biochemical traits illustrated that Ash was
showing maximum1positive and highly1significant-correlation with moisture1content
(0.583** ), phenolic-content (0.76** ) and fat (0.371** ). Fiber was showing highly
significant and positively1correlated with three-characters which are: protein (0.455** ),
154
total1soluble1solid (0.437** ), and0fat (0.399** ). Maximum positive1and0highly
significant0correlation was observed between1carbohydrate and/pH (0.418** ). Fat/was
showing1positive and significant1correlation with moisture0content (0.316*), protein
(0.313*) and total soluble solid (0.312*), respectively. Maximum positive and
significant correlation was observed between chlorophyll contents and phenolic
contents (0.342*) whereas maximum positive and significant-correlation was observed
for total soluble solids and moisture content (0.338*). Principal component analysis
was performed based on ten biochemical characters. The first three principal
components (PC) accounted for 77.11% of the variation (26.17. 17.99 and 15.08 for
PC1, PC20and1PC3, respectively). The maximum Eigen value was 2.60 while the
minimum was 1.50.
Dendrogram9constructed on the basis of molecular0studies revealed
genotypes M-39, L-29, L-32, L-1, L-5, L-8, L-11, L-24, L-19, L-17, L-25, L-23,
L-37 and M-83 were showing0maximum-diversity. The correlation0matrix was
computed by mean of Dice similarity coefficient. Similarity matrix was ranging
between 0.18 and 0.98. Maximum-similarity was noticed0among L-7 and L-6 (0.97)
followed by L-14 and L-13 (0.97), L-3 and L-1, L-15 and L-13, L-17 with L-13 and L-
15, L-19 with L-12, L-15, L-13 and L-17 (0.94), L-4 and L-2 , L-9 and L-8, L-12 and
L-10, L-19 and L-18, L-6 and L-2 (0.91), L-4 and L-3, L-6 and L-5, L-20 and L-12, L-
20 with L-17 and L-19 (0.90), L-13 and L-12, L-16 with L-13 and L-15, L-19 and L-
16, L-2 and L-10 (0.89), L-5 and L-2, L-7 and L-2, L-10 and L-7 (0.88), L-15 and L-
12, L-17 and L-12 (0.88), whereas minimum values of similarity1coefficient were
noticed-among L-33 and L-46 (0.18), M-72 and L-33 (0.31), M-86 and L-33 (0.29), L-
155
33 and M-08 (0.33) and L-33 and M-79 (0.29), respectively. Out of 20 amplification
product1scored, 595 were found out of which 357 were monomorphic1and 257 were
polymorphic. The average/number of the scorable1bands per/primer was 29.75% while
average number of monomorphic and polymorphic bands was 16.25% and 12.85%,
respectively. The high-frequency of1polymorphism was detected with all1selected
primers. The1percentage of1polymorphic bands/was 100%0with three primers1i.e;
AC58, AD270 and AA90, while low value of1polymorphism was recorded1for primer
AA205 and AB141 (0%), AA103 (21.4%), AA285 (24.4%), AD147 (26.8%), AA175
(27.3%) and AA67 (30%), respectively. Moderate values of polymorphism were
recorded1for primer AB72 (505), AA92 (52.6%), D21 (53.6%), AA163.2 (55.8%),
AA355 (60.7%), AD148 (66.7%), AD51 (68.2%) and AB53 (73.7%), respectively
Principal1component1analysis was performed1based on 20 primers. The eight
principal1components (PC) accounted for 74.2% of the variation (21.74, 37.46, 46.22,
53.95, 60.14, 65.33, 69.83 and 74.2 for PC1, PC2, PC3, PC4, PC5, PC6, PC7 and
PC8, respectively). The maximum Eigen value was 5.65, while the minimum was
1.13. The present research is a launching pad for future breeding programs for
improvement of peas crop, particularly for AJK agroecological1conditions.
156
Chapter No. 05
LITERATURE CITED
Acikgoz, E., A. Ustun, I. Gul, E. Anlarsal, A. S. Tekeli, I. Nizam, R. Avcioglu, H.
Geren, S. Cakmakci, B. Aydinoglu, C. Yucel, M. Avci, Z. Acar, I. Ayan, A.
Uzun, U. Bilgili, M. Sincik and M. Yavuz. 2009. Genotype×environment
interaction and stability analysis for dry matter and seed yield in field pea
(Pisum sativum L.). Spanish Journal of Agriculture Research, 7: 96-106.
Adawy, T.A., E.H. Rahma, A. A. Bedaweyand A. E. Beltagy. 2003. Nutritional
potential and functional properties of germinated mung bean, pea and lentil
seeds. Journal of Plant Foods for Human Nutrition, 58:1-13.
Ahmad, S., M. Singh, N. D. Lamb-Palmer, M. Lefsrud and J. Singh. 2012. Assessment
of genetic diversity in 35 Pisum sativum accessions using microsatellite
markers. Candian Journal of Plant Science, 92: 1075-1081.
Ahmad, S., S. Kaur, N. D. Lamb-Palmer, M. Lefsrud and J. Singh. 2015. Genetic
diversity and population structure of Pisum sativum accessions for marker-trait
association of lipid content. The Crop Journal, 3: 238- 245.
Akhter, N. 2004. Morphological change of garden pea (Pisum sativum L.) under
different reducing light level. M.Sc. Thesis, Dept. Crop Botany BSMRAU,
Gagipur, Bangladesh.
Ali, I., A. Rub and S. A. Hussain. 2002. Screening of pea germplasm for growth, yield
and resistance against powdery mildew under the agro-climatic conditions of
Peshawar. Sarhad Journal of Agriculture, 18: 177-181.
157
Ali, S. T., E. A. Tekeli and E. Ates. 2007. Yield and its components in field pea
(Pisum arvense L.) lines. Journal of Central European Agriculture, 4: 313-317.
Ali, S. T. and C. G. Youngs. 1973. Variation in protein of field peas. Canadian Journal
of Plant Science, 53: 37-41.
Alkarkhi, A. F. M., S. Ramli, Y. S. Yong and A. M. Easa. 2011. Comparing
physicochemical properties of banana pulp and peel flours prepared from green
and ripe fruits. Food Chemistry, 129: 312-318.
Allen, D. J. and D. R. Ort. 2001. Impact of chilling temperatures on photosynthesis in
warm climate plants. Trends in Plant Science, 6: 36-42.
Al-Marzooqi, W. and J. Wiseman. 2009. Effect of extrusion under controlled
temperature and moisture conditions on ileal apparent amino acid and starch
digestibility in peas determined with young broilers. Animal Feed Science
and Technology, 153: 113-130.
Altuntas, E. and H. Demirtola. 2007. Effect of moisture content on physical properties
of some grain legume seeds. New Zealand Journal of Crop and Horticultural
Science, 35: 423-433.
Amarteifio, J. O., D. C. Munthali, S. K. Karikari and T. K. Morake. 2002. The
composition of pigeon peas (Cajanus cajan L.) (Mill sp) grown in Botswana.
Plant Foods for Human Nutrition, 57: 173–177.
Ambrose, M. J., N. Maxted, C. J. Coyne, R. Ford, R. J. Redden, O. Kosterin, J.
Corander, A. J. Flavell, G. Kenicer and P. Smýkal. 2011. Phylogeny,
phylogeography and genetic diversity of the Pisum genus. Plant Genetics and
Research, 9: 4–18.
158
Amjad, M. and M. A. Anjum. 2002. Performance of nine pea cultivars under
Faisalabad conditions. Pakistan Journal of Agriculture Science, 39: 6-19.
Anonymous. 2012. Pakistan statistical year book. 2012. Statistics Division, Federal
Bureau of Stat. Govt. of Pakistan, Islamabad.
AOAC. 1990. Official method of analysis. The association of official analytical
chemist.15thEdition Arlington, USA.
AOAC. 1994. Official method of analysis. The association of official analytical
chemist.16thEdition Arlington, USA.
Armstead, I., I. Donnison, S. Aubry, J. Harper and S. Hörtensteiner. 2007. Cross-
species identification of Mendel’s locus. Science, 315: 73pp.
Arshad, M., S. A. Hussain, S. A. N. Ali, N. Muhammad and Ziaullah. 1998. Screening
of pea (Pisum sativum L.) cultivars in Kohat valley. Sarhad Journal of
Agriculture, 14: 559-562.
Aruna, T. and S. Devindra. 2016. Nutritional and Anti-Nutritional Characteristics of
Two Varieties of Red gram (Cajanus cajan L) Seeds. International Journal of
Scientific and Research Publications, 6: 567-572.
Arvanitoyannis, I. S. and A. Mavromatis. 2009. Banana cultivars, cultivation practices,
and physicochemical properties. Critical Review of Food Science and
Nutrition, 49:113-135.
Ashraf, I. M., A. Pervez, M. Amjad and R. Ahmad. 2011. Effect of varying irrigation
frequencies on growth, yield and quality of pea’s seed. Journal of Agricultural
Research, 49: 339-351.
159
Atta, S., S. Maltese and R. Cousin. 2004. Protein content and dry weight of seeds from
various pea genotypes. Agronomy, 24: 257-266.
Aubry, S., J. Mani and S. Hörtensteiner. 2008. Stay-green protein, defective in
Mendel’s green cotyledon mutant, acts independent and upstream of
pheophorbideaoxygenase in the chlorophyll catabolic pathway. Plant
Molecular Biology, 67: 243-256.
Badr, A., H. S. Ahmed, M. Hamouda and S. F. Badr. 2015. Genetic Diversity Among
Varieties and Hybrid Lines of Pea (Pisum sativum L.) as Revealed by
Morphological Traits and SSR Markers. Egyptian Journal of Botany, 55: 17-
29.
Baginsky, C., H. Faiguenbaum and C. Krarup. 1994. Pre and post-harvest evaluation
of six pea cultivars. Horticultural Abstracts, 64: 70-81.
Baloch, F. S., A. Alsaleh, L. E. Sáenz de Miera, R. Hatipoglu, V. Çiftçi, T.
Karaköy, M. Yıldız, H. Ozkan. 2015. DNA based iPBS-retrotransposon
markers for investigating the population structure of pea (Pisum sativum L.)
germplasm from Turkey. Biochemical Systematics and Ecology, 61: 244- 252.
Barac, M., S. Cabrilo, M. Pesic, S. Stanojevic, S. Zilic, O. Macej and N. Ristic. 2010.
Profile and functional properties of seed proteins from six pea (Pisum sativum
L.) genotypes. International Journal of Molecular Science, 11:4973-4990.
Baranger, A. G., G. Aubert, G. Arnau, A. L. Laine, G. Deniot, J. Potier, C.
Weinachter, I. L. Henaut, J. Lallemand and J. Burstin. 2004. Genetic diversity
within (Pisum sativum L.) using protein and PCR-based markers. Theoretical
and Applied Genetics, 108: 1309-1321.
160
Bastianelli, D., F. Grosjean, C. Peyronnet, M. Duparque and J. M. Regnier. 1998.
Feeding value of pea (Pisum sativum L.) chemical composition of different
categories of pea. Animal Sciences, 67: 609-619.
Basaran, U., H. Mut, O. Asci, E. Gulumser, Z. Acar and I. Ayan. 2012. Variation in
seed yield and morphological traits in Turkish grass pea (Lathyrus sativus L.)
genotypes. Options méditerranéennes: serie A. Séminair méditerranian, 102:
145-148.
Basaran, U., Z. Akar, M. Karacan and A. N. Onar. 2013. Variation and correlation of
morpho-agronomic traits and biochemical contents (protein and B-ODAP) in
Turkish grass pea (Lathyrus sativus L.) landraces. Turkish Journal of Field
Crops, 18: 166-173.
Bhattacharya, S. and N. G. Malleshi. 2012. Physical, chemical and nutritional
characteristics of premature-processed and matured green legumes. Journal of
Food Science and Technology, 49: 459-466.
Bhattacharyya, M., A. M. Smith, T. H. N. Ellis, C. Hedley and C. Martin. 1990. The
wrinkled-seed character of pea described by Mendel is caused by a transposon-
like insertion in a gene encoding starch-branching enzyme. Cell, 60: 115–122.
Bhatty, R. S. and G. I. Christison. 1984. Composition and nutritional quality of pea
(Pisum sativum L.), faba bean (Vicia faba L. spp. minor) and lentil (Lens
culinaris Medik.) meals, protein concentrates and isolates. Plant Foods for
Human Nutrition, 34: 41-51.
161
Blair, M. W., J. M. Diaz, R. Hidalgo and L. M. Diaz. 2007. Microsatellite
characterization of Andean races of common bean (Phaseolus vulgaris L.).
Theoretical and Applied Genetics, 116: 29-43.
Borreani, G., P.G. Peiretti and E. Tabacco. 2007. Effect of harvest time on yield and
pre-harvest quality of semi-leafless grain peas (Pisum sativum L.) as whole-
crop forage. Field Crop Research, 100:1-9.
Boye, J. B., F. Zare and A. Pletch. 2003. Pulse proteins: Processing, characterization,
functional properties and applications in food and feed. International Journal of
Food Research, 43, 414-431.
Bressani, R. and L. G. Elias. 1988. Seed quality and nutritional goals in Pea, Lentil,
Faba Bean and Chickpea breeding. Current Plant Science and Biotechnology in
Agriculture, 5: 381-404.
Bugaud, C., M. Chillet, M. P. Beautea and C. Dubois. 2006. Physicochemical analysis
of mountain bananas from the French West Indies. Science Horticulturae,
108:167–172.
Burstin, J., G. Deniot, J. Potier, C. Weinachter, G. Aubert and A. Barranger.
2008. Microsatellite polymorphism in pea (Pisum sativum L.). Plant Breeding,
120: 311-317.
Castillo, A. G., 1. G. Hampton and P. C. Bear. 1992. Effect of time and method of
harvest on seed vigour in garden peas (Pisum sativum L.). Journal of Applied
Seed Production, 10: 31-36.
Cerning, B. J. and A. Filiatre. 1976. A comparison of the carbohydrate composition of
legume seeds: horse beans, peas and lupines. Cereal Chemistry, 53: 968-978.
162
Cervenski, J., D. Danojevics and A. Savi. 2017. Chemical composition of selected
winter green pea (Pisum sativum L.) genotypes. Jounal of Serbian Chemical
Society, 82: 1–10.
Ceyhan, E. and M. A. Avci. 2015. Determination of some agricultural characters of
developed pea (Pisum sativum L.) lines. International Journal of Biology,
Biomolecules, Agriculture and Food Biotechnology, 9:12pp.
Chavan, U. D., F. Shahidi, A. K. Balb and D. B. McKenzied.1999. Physico-chemical
properties and nutrient composition of beach pea (Lathyrus maritimus L.).
Journal of Food Chemistry, 66:43-50.
Cokkizgin, A. 2012. Botanical characteristics of chickpea genotype (Cicer arietinum
L.) under different plant densities in organic farming. Scientific Research and
Essays, 7: 498-503.
Colonna, P., A. Buleon and J. L. Doublier. 1992. Structural features of smooth and
wrinkled peas starches. Proceedings of 1st European Conference on Legume
Grains, Angers, 401-402pp.
Cupic, T., M. Tucak, S. Popovic, S. Bolaric, S. Grljusic, V. Kozumplik. 2009 .Genetic
diversity of pea (Pisum sativum L.) genotypes assessed by pedigree,
morphological and molecular data, Journal of Food Agriculture &
Environment, 7: 343–348.
Dahl, J. W., L. M. Foster and R. T. Tyler. 2012. Review of the health benefits of peas
(Pisum sativum L.). British Journal of Nutrition, 3: 85-89.
163
Davies, D. R., G. J. Berry, M. C. Heath and T. C. K. Dawkins. 1985. Pea (Pisum
sativum L.). Journal of American Society of Horticulture Science, 104:548-
550.
Dimitrios, B. 2006. Sources of natural phenolic antioxidants. Trends in Food Science
and Technology, 17: 505-512.
Dixon, R. A. and N. L. Paiva. 1995. Stress induced phenol-propanoid
metabolism. Plant Cell, 7: 1085-1097.
Doyle, J. J. and J. I. Doyle. 1987. A rapid DNA isolation procedure or small quantities
of fresh leaf tissue. Phytochem. Bulletin, 19: 11-15.
Duke, J. A. 1981. Hand book of legumes of world economic importance. Plenum
Press, New York, 39: 199-265.
El-Adawy, T. A. 2003. Nutritional composition and anti-nutritional factors of
chickpeas (Cicer arietinum L.) undergoing different cooking methods and
germination. Plant Foods Human Nutrition, 57:83-97.
Ellis, T. H. N. and S. J. Poyser. 2002. An integrated and comparative view of pea
genetic and cytogenetic maps. New Phytology, 153: 17-25.
Ellis, T. H. N., J. I. Hofer, G. M. Timmerman-Vaughan, C. J. Coyne and R. P. Hellens.
2011. Mendel, 150 years on. Trends in Plant Science, 16: 590–596.
Ellis, T. H. N. 2011. Pisum. In: Kole, C. (Ed.): Wild Crop Relatives: Genomic and
Breeding Resources. Chapter 12, Springer-Verlag, Berlin-Heidelberg, 237–
248pp.
Elzebroek, T. and K. Wind. 2008. Guide to cultivated plants. CAB International,
Oxford Shire, UK.
164
Enderes, G., S. Forster, H. Kandel, J. Pasche, M. Wunsch, J. Knodel and K. Hellevang.
2016. Field pea production. North Dakota State University, 11pp.
Faller, A. L. K. and E. Fialho. 2010. Polyphenol content and antioxidant capacity in
organic and conventional plant foods. Journal of Food Composite and
Analytics, 23: 561-568.
FAO. 2016. Global Forum on Food Security and Nutrition. FSN
Forum.http://www.fao.org/fsnforum/activities/discussions/pulses.
Ferrari B., M. Romani, G. Aubert, K., Boucherot, J. Burstin, L. Pecetti, M. Huart-
Naudet, A. Klein and P. Annicchiarico. 2016. Association of SNP markers with
agronomic and quality traits of field pea in Italy. Czech Journal of
Genetics and Plant Breeding, 52: 83–93.
Ford, R., K. Le Roux, C. Itman, J. B. Brouwer. 2002. Diversity analysis and
genotyping in Pisum with sequence tagged microsatellite site (STMS) primers.
Euphytica, 124: 397-405.
Forster, M. P., E. R. Rodriaguez, J. D. Martian and C. D. Romero. 2002. Statistical
differentiation of bananas according to their mineral composition. Journal of
Agriculture and Food Chemistry, 50:6130–6135.
Gallardo, K., R. Thompson and J. Burstin. 2008. Reserve accumulation in legume
seeds. Crop Research Biology, 331: 755-762.
Gatti, I., M. A. Esposito, P. Almiron, V. P. Cravero and E. L. Cointry. 2011. Diversity
of pea (Pisum sativum L.) accessions based on morphological data for
sustainable field pea breeding in Argentina. Genetics and Molecular Research,
10: 3403-3410.
165
Ghixari, B., H. Vrapi and V. Hobdari. 2014. Morphological characterization of pea
(Pisum sativum L.) genotypes stored in Albanian gene bank. Albanian Journal
of Agricultural Sciences, 9: 78-83.
Gill, N. T. and K. C. Vear. 1980. Agricultural Botany. 3rd edition. (K. C. Vear and D.
J. Barnard edition) Gerald Duck worth and Co. Ltd. London.
Gixhari, B., M. Ludvikova, H. Ismaili, V. Hekuran, A. Jaupi and P. Smykal. 2014.
Genetic diversity of Albanian pea (Pisum sativum L.) landraces assessed by
morphological traits and Molecular Markers. Czech Journal of Genetics and
Plant Breeding, 50:177-184.
Goa, Y. 2014. Evaluation of Chick Pea (Cicer arietinum L.) varieties for Yield
performance and adaptability to Southern Ethiopia. Journal of Biology,
Agriculture and Healthcare, 4: 34-38.
Graham, P. H., and P. Ranalli. 1997. Common Bean (Phaseolus vulgaris L.). Field
Crop Research, 53:131–146.
Graham, P. H. and C. P. Vance, 2003. Legumes: Importance and constraints to greater
use. Plant Physiology, 131: 872–877.
Gutierrez, L., O. V. Wuytswinkel, M. Castelain and C. Bellini. 2007. Combined net-
works regulating seed maturation. Trends in Plant Science, 12: 294-300.
Habib, N. and M. Zamin. 2003. Off season pea cultivation in Dir Kohistan valley.
Asian Journal of Plant Science, 2: 283-285.
Habtamu, S. and F. Million. 2013. Multivariate analysis of some Ethiopian field pea
(Pisum sativum. L) genotypes. International Journal of Genetics and Molecular
Biology, 5:78-87.
166
Hancock, J. F. 2004. Plant evolution and the origin of crop species. CABI Publishing
Wallingford UK and Cambridge, MA.
Handerson, C., S. K. Noren, T. Wricha, N. T. Meetei, V. K. Khanna, A.
Pattanayak and S. Datt. 2014. Assessment of genetic diversity in pea (Pisum
sativum L.) using morphological and molecular markers. Indian Journal of
Genetics and Plant Breeding, 74:205-212.
Hartmann, H. T., A. M. Kofranek, V. E. Rubatzky, and W. J. Flocker. 1988. Plant
Science: Growth, development and utilization of cultivated plants. 2nd edition.
Prentice Hall Career and Technology Englewood Cliffs NJ. McGee, USDA-
ARS.
Hatam, M. and Amanullah. 2001. Grain yield potential of garden peas (Pisum sativum
L.) germplasm. Journal of Biological Sciences, 1: 242-244.
Hellens, R. P., C. Moreau, K. Lin-Wang, K. E. Schwinn, S. J. Thomson, M. Fiers, T. J.
Frew, S. R. Murray, J. M. I. Hofer, Allan A.C. and T. H. N. Ellis. 2010.
Identification of Mendel’s white flower character. Plos One, 5: 132-140.
Hobbs, P. R. and R. L. Obendorf. 1972. Interaction of initial seed moisture and
imbibitional temperature on germination and productivity of soybean. Crop
Sciences, 12: 664-667.
Holl, F. B. and J. R. Vose. 1980. Carbohydrate and protein accumulation in developing
field pea seeds. Canadian Journal of Plant Sciences, 60: 1109-1114.
Hollman, P. C. H., M. G. L. Hertog and M. B. Katan. 1996. Analysis and health effects
of flavonoids. Food Chemistry, 57:43–46.
167
Hove, E. L., S. King and G. D. Hill. 1978. Composition, protein quality, and toxins of
seeds of the grain legumes Glycine max, Lupinus spp., Phaseolus spp., Pisum
sativum, and Viciafaba. Newzeland Journal of Agriculture Research, 21: 457-
462.
Hulse J. H. 1994. Nature, composition, and utilization of food legumes. Expanding the
production and use of cool season food legumes. Journal of Food, Agriculture
and Environment, 13: 77-97.
Hussain, S. A and N. Badshah. 2002. Study on the adaptive behavior of exotic pea
(Pisum sativum L.) varieties under local condition of Peshawar. Asian Journal
of Plant Sciences. 1: 567-569.
Hussain, S. A., M. Hussain, M. Qasim and B. Hussain. 2005. Performance and
economic evaluation of pea varieties at two altitudes in Kaghan Valley. Sarhad
Journal of Agriculture, 21: 587-589.
Igbasan, F. A., W. Guenter and B. A. Slominski. 1997. Field peas: Chemical
composition and energy and amino acid availabilities for poultry. Canadian
Journal of Animal Sciences, 77: 293-300.
Ishtiaq, M., Z. Ahmad and A. Shah. 1996. Evaluation of exotic cultivars of pea in
Peshawar valley. Sarhad Journal of Agriculture, 12: 425-431.
Jaffery, E. H., A. F. Brown, A. C. Kurilich, A. S. Keek, N. Matusheski and B. P.
Klein. 2003. Variation in content of bioactive components in broccoli. Journal
of Food Composite Analytics, 16: 323-330.
Jain, P. K., S. K. Ramgiry and C. B. Singh. 1998. Genotype and environment
interaction of seedling character in chickpea. Crop Research, 16: 321-324.
168
Jambunathan, R., H. L. Blain, K. H. Dhindsa, L. A. Hussein, K. Kogure, L. Li-Juan
and M.M. Youssef. 1994. Diversifying use of cool season food legumes
through processing. Journal of Food, Agriculture and Environment, 19: 98-112.
Janzen, J., G. Brester and V. Smith. 2014. Dry peas: Trends in production, trade, and
price, Agricultural Marketing Policy Center, 57-77pp.
Javaid, A., Ghafoor and R. Anwar. 2002. Evaluation of local and exotic pea (Pisum
sativum L.) germplasm for vegetative and dry grain traits. Pakistan Journal of
Botany, 34: 419-427.
Jezierny, D., R. Mosenthin, N. Sauer, S. Roth, H. P. Piepho, M. Rademacher and M.
Eklund. 2011. Chemical composition and standardised ileal digestibilities of
crude protein and amino acids in grain legumes for growing pigs. Live-stock
Science, 138: 229-243.
Kakar, A. A., M. Saleem, R. Shah and S. A. Q. Shah. 2002. Growth and pod yield
performance of peas (Pisum sativum L.). Asian Journal of Plant Science, 1:
532-534.
Khan, T. N., A. Ramzan, G. Jillani and T. Mehmood. 2013. Morphological
performance of peas (Pisum sativum L.) genotypes under rainfed conditions of
potowar region. Journal of Agriculture Research, 51:51-60.
Khokar, K. M., M. A. Khan, S. I. Hussain, T. Mahmood and H. U. Rehman. 1998.
Cooperative evaluation of some foreign and local pea cultivars. Pakistan
Journal of Agricultural Research, 9: 549-551.
Kraus, T. E. C., R. A. Dahlgren and R. J. Zasoski. 2003. Tannins in nutrient dynamics
of forest ecosystems - A review. Plant and Soil, 256: 41-66.
169
Kumari, P., N. Basal, A. K. Singh, V. P. Rai, C. P. Srivastava and P. K. Singh. 2013.
Genetic diversity studies in pea (Pisum sativum L.) using simple sequence
repeat markers. Genetics and Molecular Research, 2: 3540-3550.
Labuckas, D. O., D. M. Maestri, Perelló, M. L. Martínez and A. L. Lamarque. 2008.
Phenolic from walnut (Juglans regia L.) kernels: Antioxidant activity and
interactions with proteins. Food Chemistry, 107: 607-612.
Lather, V. S., R .S.Waldia and I. S. Mehla. 1997. Early vigour spontaneous mutant in
Chickpea. International Chickpea Newsletter, 4: 11-12.
Lioi, L., A. R. Piergiovanni, D. Pignone, S. Puglisi, M. Santantonio and G. Sonnante.
2005. Genetic diversity of some surviving on-farm Italian common bean
(Phaseolus vulgaris L.) landraces. Plant Breeding, 124: 576-581
Lock, M., B. Mackinder, B. Schrirer and G. Lewis. 2005. Legumes of the World;
Royal Botanical Gardens: Kew, UK.
Loridon, K., K. McPhee, J. Morin, P. Dubreuil, M. L. Pilet-Nayel, G. Aubert, C.
Rameau, A. Baranger, C. Coyne, I. Lejeune and J. Burstin. 2005. Microsatellite
marker polymorphism and mapping in pea (Pisum sativum L.). Theoretical and
Applied Genetics, 111: 1022–1031.
Louette, D., A. Charrier and J. Berthaud, 1997. In situ conservation of maize in
Mexico: genetic diversity and maize seed management in a traditional
community. Ecological Botany, 51: 20–38.
Mahbub, M. M., M. M. Rahman, M. S. Hossain, F. Mahmud and M. M. Kabir. 2015.
Genetic variability, correlation and path analysis for yield an yield components
170
in soybean. American-Eurasian Journal of Agricultural & Environmental
Sciences, 15: 231-236.
Mahbub, M. M., M. S. Hossain, L. Nahar and B. J. Shirazy. 2016. Morpho-
physiological Variation in Soybean (Glycine max (L.) Merrill). American-
Eurasian Journal of Agricultural & Environmental Sciences, 16: 234-238.
Makasheva, R. K. 1983. The Pea. Oxonian Press Pvt. Ltd. New Delhi, India. 78 -
107pp.
Marquardt, R. R. and J. M. Bell. 1988. Future potential of pulses for use in animals
feeds. Pages 42-441 in J. R. Summer field, World crops: Cool season food
legumes. Kluwer Academic, Dordrecht, the Netherlands.
Martinez, C., P. Gulewicz, J. Frias, K. Gulewicz and C. V. Valverde. 2008.
Assessment of protein fractions of three cultivars of (Pisum sativum L.) effect
of germination. European Food Research and Technology, 226: 1465-1478.
Matthews, P. and E. Arthur. 1985. Genetic and environmental components of variation
in protein content in peas. Pages 369-381 in P. D. Hebblethwaite, M. C. Health,
and T. C. K. Dawkins, The pea crop. A basis for improvement. Butterworths,
London, UK.
Matthews, S., A. S. Powell and S. Spaeth. 1988 .Seedling Vigour and susceptibility to
diseases and pests: In World crop: Cool season legumes. Summer field- R.J
.Reading University U.K. Dept. of Agriculture. Dordrecht (Netherlands).
Kluwer Academic Publishers, 619-625.
McPhee, K. 2003. Dry pea production and breeding – A minireview. Food, Agriculture
and Environment. 1: 64-69.
171
Mendel, G. 1866. Versuche uber Pflanzen-Hybriden. Verhandlungen des
naturforschenden Vereines in Brunn, (Abhandlungen) 4: 3–47.
MNFRS, 2017. Agricultural statistics of Pakistan 2016-17. www.mnfrs.gov.pk- last
assessed at 31st Oct, 2017.
Muehlbauer, E. J. and K. E. McPhee. 1997. Peas: In The Physiology .of Vegetable
Crops (Ed. H.C. Wein). CAB International, Walling ford, UK. 429 – 459pp.
Mumm, R. H. and S. P. Moose. 2008. Molecular plant breeding as the foundation for
21st century crop improvement. Plant Physiology, 147: 969–977.
Mustafa, H., M. M. Ozcan, S. Karadaşand E. Ceyhan. 2012. Protein and mineral
contents of pea (Pisum sativum L.) genotypes grown in central Anatolian
region of turkey. South Western Journal of Horticulture, Biology and
Environment, 1: 159-165.
Mustafa, T. A., K. O. C. Zeynep and D. Gul. 2012. Morphological characteristics and
seed yield of east anatolian local forage pea (Pisum sativum L.) ecotypes.
Turkish Journal of Field Crops, 17: 24-30.
Nagai, T., I. Reiji, I. Hachiro and S. Nobutaka. 2003. Preparation and antioxidant
properties of water extract of propolis. Food Chemistry, 80:29-33.
Nawab, N. N., G. M. Subhani, K. Mahmood, Q. Shakil and A. Saeed. 2008. Genetic
variability correlation and path analysis studies in garden pea (Pisum sativum
L.) Journal of Agricultural Research, 46: 333-340.
Nayak, B., J. D. E. Berrios, J. Tang and J. Powers. 2011. Effect of extrusion on the
antioxidant capacity and color attributes of expanded extrudates prepared from
172
purple potato and yellow pea flour mixes. Journal of Food Science, 76: 874–
883.
Nei, M. and W. H. Li. 1979. Mathematical model for studying genetic variation in
terms of restriction endonucleases.Proceeding of National Academy of Science,
USA, 76: 5269- 5273.
Nemera, G., T. M. Labuschange and C. D. Viljoen. 2006. Genetic diversity analysis in
sorghum germplasm as estimated by AFLP, SR and morpho-agronomical
markers, Biodiversity and Conservation, 15:3251-3265.
Nikolopoulou, D., K. Grigorakis, M. Stasini, M. Alexi and K. Iliadis. 2006. Effects of
cultivation area and year on proximate composition and anti-nutrients in three
different Kabuli-type chickpea (Cicer arientinum L.) varieties. European Food
Research Technology, 23: 737-741.
Nikolopoulou, D., K. Grigorakis, M. Stasini, M. N. Alexis and K. Iliadis. 2007.
Differences in chemical composition of field pea (Pisum sativum L.) cultivars:
Effects of cultivation area and year. Food Chemistry, 103: 847-852.
Nisar, M., A. Khan, S. F. Wadood, A. A. Shah, H. Fatih. 2017. Molecular
characterization of edible pea through EST-SSR markers. Turkish Journal of
Botany, 41: 1608-1617.
Nisar. M., A. Ghafoor, M. R. Khan, H. Ahmad, A. S. Qureshi and H. Ali. 2007.
Genetic diversity and geographic relationship among local and exotic chickpea
germplasm. Pakistan Journal of Botany, 39: 1575- 1581.
Olalekan, A. J. and B. F. Bosede. 2010. Comparative Study on Chemical Composition
and Functional Properties of Three Nigerian Legumes (Jack Beans, Pigeon Pea
173
and Cowpea). Journal of Emerging Trends in Engineering and Applied
Sciences, 1: 89-95.
Ouafi, L. O., F. Alane, H. R. Bouziane and A. Abdelguer. 2016. Agro-morphological
diversity within field pea (Pisum sativum L.) genotypes. African Journal of
Agricultural Research, 11: 4039-4047.
Oudhia, P., S. S. Kolhe and R. S. Tripathi. 1997. Allelopathic effect of Blume alacera
L. on wheat. Abstracts Seventh Biennial Conference. Ludhlana, Punjab, India.
Indian Society of Weed Science, 109pp.
Ozer, S., E. Tumer , F. S. Baloch , T. Karakoy , F. Toklu and H. Ozkan. 2012.
Variation for nutritional and cooking properties among Turkish field pea
landraces. Journal of Food, Agriculture & Environment, 10: 324-329.
Phillips, D. A. 1980. Efficiency of symbiotic nitrogen fixation in legumes. Annual
Review of Plant Physiology, 31: 29–49.
Price, D. N., C. M. Smith and C. L. Hedley. 1988. The effect of the gp gene on fruit
development in Pisum sativum L. structural and physical aspects. New
Phytologist, 110: 261-269.
Qasim, M., M. Zubair and D. Wadan. 2001. Evaluation of exotic cultivars of pea in
Swat valley. Sarhad Journal of Agriculture, 17: 545-548.
Rahman, M. M., M. Syed A. Akter, M.M. Alam and M.M. Ahsan. 2014. Genetic
Variability, Correlation and Path Coefficient Analysis of Morphological Traits
in Transplanted Aman Rice (Oryza sativa L.). American-Eurasian Journal of
Agricultural & Environmental Science, 14: 387-391.
174
Raje, R. S. 1992. Evaluation of chickpea genotypes of varying seed size for
germination, seedling vigour and seed yield components. M.Sc. (Agriculture)
Thesis. JNKVV. Jabalpur.
Rana, J. C., M. Rana, V. Sharma, A. Nag, R. K. Chahota and T. R. Sharma. 2017.
Genetic Diversity and Structure of Pea (Pisum sativum L.) Germplasm Based
on Morphological and SSR Markers. Plant Molecular Biology Reporter, 35:
118–129.
Ranalli, P., I. Giordano, U. Ziliotto, G. M. Lomabrcho, V. Pirami, E. Lahoz, V.
Bcuonaccorso, P. Talluri, P. Bottozzi, G. Lucque, D. Rosoe, G. Ruaro, B.
Casrini and P. Re. 1992. Yield potential of pea for dry seed in different Italian
environments. SementiElette, 38: 15-43.
Ravindran, G., C. L. Nalle, A. Molan and V. Ravindran. 2010. Nutritional and
biochemical assessment of field peas (Pisum sativum L.) as a protein source in
poultry diets. Journal of Poultry Science, 47: 48-52.
Rawel, H. M., D. Czajka, S. Rohn and J. Kroll. 2002. Interactions of different
phenolic acids and flavonoids with soy proteins. International Journal of
Biology and Macromolecules, 30:137–150.
Reichert, R. D. and S. L. MacKenzie. 1982. Composition of peas (Pisum sativum L.)
varying widely in protein content. Journal of Agricuture and Food Chemistry,
30: 312-317.
Reid, J. B. and J. J. Ross. 2011. Mendel’s genes: Toward a full molecular
characterization. Genetics, 189: 3–10.
175
Rodrigues, A. M., C. M. G. Reis and P. J. Rodrigues. 2012. Nutritional assessment of
different field pea genotypes (Pisum sativum L.). Bulgarian Journal of
Agricultural Sciences, 18: 571-577.
Rohlf, F. J. 2000. NTSYSpc: Numerical Taxonomy and Multivariate Analysis System.
Version 2.02. Exeter Software, Setauket, New York.
Roos, E. E. and J. R. Manalo. 1976. Effect of initial seed moisture on Snap bean
emergence from cold soil. American Journal of Social and Horticultural
Sciences, 101: 321-324.
Ross, J. J. and J. B. Reid. 2011. Mendel’s genes: Toward a full molecular
characterization. Genetics, 189, 3-10pp.
Sadler, G. D. and P. A. Murphy. 2010. pH and titratable acidity. In: Nielsen SS,
editor; Food analysis. New York, NY: Springer Science Business Media. 219-
260pp.
Sanchez-Chino, X., C. J. Martinez, G. D. Ortiz, I. A. Gonzalez and E. M. Bujaidar.
2015. Nutrient and no nutrient components of legumes and its chemo
preventive activity: A Review. Nutrition and Cancer Research, 67: 401–10.
Santalla, M., J. M. Amurrio and A. M. Ron. 2001. Food and feed potential breeding of
green dry and vegetable pea germplasm. Canadian Journal of Plant Science, 81:
601-610.
Sarawong, C., R. Schoenlechner, K. Sekiguchi and E. Berghofer. 2014. Effect of
extrusion cooking on the physicochemical properties, resistant starch, phenolic
content and antioxidant capacities of green banana flour. Food Chemistry, 143:
33-39.
176
Sarikamis, G., F. Yasar, M. Bakir, K. Kazan and A. Ergul. 2009. Genetic
characterization of green bean (Phaseolus vulgaris L.) genotypes from eastern
Turkey. Genetics and Molecular Research, 8: 880-887.
Sarıkamis, G., R. Yanmaz, S. Ermiş, M. Bakir and C. Yüksel. 2010. Genetic
characterization of pea (Pisum sativum L.) germplasm from Turkey using
morphological and SSR markers Genetics and Molecular Research, 9: 591-600.
Sato, Y., R. Morita, M. Nishimura, H. Yamaguchi and M. Kusaba. 2007. Mendel’s
green cotyledon gene encodes a positive regulator of the chlorophyll-degrading
pathway. Proceedings of National Academy of Sciences USA, 104: 14169-
14174.
Schumacher, H., H. M. Paulsen and A. E. Gau. 2009. Phenotypical indicators for the
se-lection of methionine enriched local legumes in plant breeding. Land-
bauforsch, 59: 339-344.
Shah, A., S. D. Lal and A. Shah. 1990. Comparative performance of some pea
cultivars under rainfed conditions of U.P. hills. Progressive Horticulture in
India, 22: 121-124.
Sharma, P., H. S. Gujral and B. Singh. 2012. Antioxidant activity of barley as affected
by extrusion cooking. Food Chemistry, 131:1406-1413.
Sharma, S., N. Yadav, A. Singh and R. Kumar. 2013. Nutritional and anti-nutritional
profile of newly developed chickpea (Cicer arietinum L.) varieties.
International Journal of Food Research, 20: 805-810.
Shiran, B., N. Amirbakhtiar, S. Kiani, S. Mohammadi, B. E. Sayed Tabatabaei and H.
Moradi. 2007. Molecular characterization and genetic relationship among
177
almond cultivars assessed by RAPD ans SSR markers. Journal of Horticulture,
111: 280-292.
Siddika, A. M., A. Islam, M. G. Rasul, M. A. Khaleque and J. U. Ahmed. 2007.
Genetic variability in advanced generations of vegetables peas (Pisum sativum
L.). Global Science Books, 9: 31-53.
Sila, B. and N. G. Malleshi. 2012. Physical, chemical and nutritional characteristics of
premature-processed and matured green legumes Journal of Food Science and
Technology, 49: 459-466.
Simioniuc, D., R. Uptmoor, W. Friedt and F. Ordon. 2002. Genetic diversity and
relationships among pea cultivars revealed by RAPDs and AFLPs. Plant
Breeding, 121: 429-435.
Sindhu, A., L. Ramsay, L. A. Sanderson, R. Stonehouse, R. Li, J. Condie, S. K. Arun,
Shunmugam, Y. Liu, A. B. Jha, M. Diapari, J. Burstin, G. Aubert, B. Taran ・
K. E. Bett, T. D. Warkentin, A. G. Sharpe. 2014. Gene‑based SNP discovery
and genetic mapping in pea. Theoretical and Applied Genetics, 10: 14-32.
Singh, U. P., B. K. Sarma, D. P. Singh and A. Bahadur. 2002. Plant growth promoting
rhizobacteria-mediated induction of phenolics in pea (Pisum sativum L.) after
infection with Erysiphepisi. Current Microbiology, 44:396-400.
Singleton, V. I. and R. M. Raventos. 2000. Analysis of Total Phenols and other
Oxidation Substrates and Antioxidants by means of Folin-Ciocalteu Reagent,
Method in Enzymology, 299: 152-178.
Slinkard, A. E., G. Bascur and G. H. Bravo. 1994. Biotic and abiotic stresses of cool
season food legumes in the Western Hemisphere. 5: 195-203.
178
Smart, J. 1990. Grain Legumes: Evolution and genetic resources. Cambridge
University Press Cambridge, UK. 7: 200-202.
Smykal, P., J. Horacek, R. Dostalova and M. Hybl. 2008. Variety discrimination in pea
(Pisum sativum L.) by molecular, biochemical and morphological markers.
Journal of Applied Genetics, 49:155-166.
Solberg, S. O., A. K. Brantestam, K. Olsso, M. W. Leino, J. Weibull and F. Yndgaard.
2015. Diversity in local cultivars of (Pisum sativum L.) collected from home
gardens in Sweden. Biochemical System and Ecology, 62:194-203.
SPSS. 1999. Base 9.0 for Windows Users Guide. SPSS Inc, USA.
Sumner, L. W. and R. A. Dixon. 2003. Legume natural products: Understanding and
manipulating complex pathways for human and animal health. Plant
Physiology, 131: 878–885.
Sun, X., T. Yanga, J. Haoc, X. Zhang, R. Ford, J. Jianga, F. Wanga, J. Guana and X.
Zonga. 2014. SSR genetic linkage map construction of pea (Pisum sativum L.)
based on Chinese native varieties. The Crop Journal, 2: 170 -174.
Taran, B., C. Zhang, T. Warkentin, and A. Tullu. 2005. Genetic diversity among
varieties and wild species accessions of pea (Pisum sativum L.) based on
molecular markers, and morphological and physiological characters. Genome,
48: 257-272.
Tekeli, A. S. and E. Ates. 2003. Yield and its components in field pea (Pisum arvense
L.) lines. Journal of Central European Agriculture, 4: 313-317.
179
Teshome, A., B. R. Baum, L. Fahrig, J. K. Torrance, T. J. Arnason and J. D. Lambert.
1997. Sorghum (Sorghum bicolor L.) landrace variation and classification in
North Shewa and South Welo, Ethiopia. Euphytica, 97: 255–263.
Teshome, A., T. Bryngelsson, K. Dagne and M. Geleta. 2015. Assessment of genetic
diversity in Ethiopian field pea (Pisum sativum L.) accessions with newly
developed EST-SSR markers. Bio Med Central Genetics, 16: 2-12.
Tihomir, C., M. Tucak, S. Popovic, B. Sonja and G. V. Kozumplik. 2009. Genetic
diversity of pea (Pisum sativum L.) genotypes assessed by pedigree
morphological and molecular data. Journal of Food Agriculture and
Environment, 7: 213-219.
Tolessa. T. T., G. Keneni, T. Sefera, M. Jarsoand Y. Bekele, 2013. Genotype ×
Environment interaction and performance stability for grain yield in field pea
(Pisum sativum L.) genotypes. Global Science Books, 3: 31-44.
Tresina, S. P., K. Kala, V. R. Mohan and V. Vadivel. 2010. The Biochemical
Composition and Nutritional Potential of three Varieties of (Vigna mungo L.)
Hepper. Advances in Bioresearch, 2: 6-16.
Urbano, G., P. Aranda and E. G. Villalva. 2003. Nutritional evaluation of pea protein
diets after mild hydrothermal treatment and with and without added phytase.
Journal of Agriculture and Food Chemistry, 51: 2415–2420.
Urbano, G., P. Aranda, E. G.Villalva, S. Frejnagel, J. M. Porres, J. Friäas and M. L.
Jurado. 2005. Effects of germination on the composition and nutritive value of
proteins in (Pisum sativum L.). Journal of Agriculture and Food Chemistry, 93:
671-679.
180
United State Department of Agriculture, Agricultural Research Service. 2015. USDA
National Nutrient Database for Standard Reference, Release 28. Nutrient Data
Laboratory Home Page. Available at: http://www.ars.usda.gov/main/
site_main.htm?modecode=80-40-05-25
Vocanson, A. and M. H. Jeuffroy. 2008. Agronomic performance of different pea
cultivars under various sowing periods and contrasting soil structures. Journal
of Agronomy, 100: 748-759.
Wang, N. and J. K. Daun. 2004. Effect of variety and crude protein content on
nutrients and certain antinutrients in field peas (Pisum sativum L). Journal of
the Science of Food and Agriculture, 84, 1021–1029.
Wang, N., D. W. Hatcher, T. D. Warkentin and R. Toews. 2008. Effect of cultivar and
environment on physicochemical and cooking characteristics of field pea
(Pisum sativum L.). Food Chemistry, 118: 109-115.
Wang, X., T. D.Warkentin, C. J. Briggs, B. D. Oomah,C. G. Campbell and S. Woods.
1997. Total phenolics and condensed tannins in field pea (Pisum sativum L.)
and grass pea (Lathyrus sativus L.). Euphytica, 101: 97-102.
Weaver, W. W. 2003. Peas: Encyclopedia of Food and Culture. Edition. Solomon H.
Katz. 3rd Edition. New York, Charles Scribner & Sons.
Weber, H., L. Borisjuk and U. Wobus. 2005. Molecular physiology of legume seed
development. Annual Review of Plant Biology, 56: 253-279.
Witten, S., H. Böhm and K. Aulrich. 2015. Effect of variety and environment on the
contents of crude nutrients, lysine, methionine and cysteine in organically
181
produced field peas (Pisum sativum L.) and field beans (Vicia faba L.). Applied
Agriculture Forestry Research, 205-216pp.
Yalcın, C. O., Zarslan, T. and A. Akbas. 2006. Physical properties of pea (Pisum
sativum) seed. Journal of Food Engineering, 79: 731–735.
Yoon, K. Y., M. Cha, S. R. Shin and K. S. Kim. 2005. Enzymatic production of a
soluble fiber hydrolysate from carrot pomace and its sugar composition. Food
Chemistry, 92: 151-157.
Zeven, A. C. 1998. Landraces: A review of definitions and classifications. Euphytica,
104: 127-139.
Zhang, P., R. L. Whistler, J. N. BeMiller and B. R. Hamaker. 2005. Banana starch:
production, physicochemical properties, and digestibility- a
review. Carbohydrates Polymer, 59: 443-458.
Zhuang, X., K. E. Mcphee, T. E. Coram, T. L. Peever and M. I. Chilvers. 2013.
Development and characterization of 37 novel EST-SSR markers in Pisum
sativum. Journal of Application in Plant Sciences, 220-249pp.
Zohary, D., M. Hopf and E. Weis. 2013. Domestication of plants in the old world. 4th
edition Oxford University press, 264pp.
182
APPENDICES
1. DNA0Extraction 0Buffer (2×CTAB)
Chemicals0 Concentrations
CTAB0 20g
1M0Tris HCl0 100ml
0.5M EDTA0 40ml
NaCl0 81.8g
PVP (K-30) 10g
Distilled0water Upto 1000ml
Not autoclavable.
Mercapto-ethanol 0.2% is added at end. Buffer is kept in oven at 65°C.
2. Chloroform/isoamylalcohol (CIA)
Chemicals0 Concentration
Chloroform0 24ml
Isoamylalcohol0 1ml
3. Ice0chilled02-propanol (0.66ml)
4. 70% Ethanol (70ml- Ethanol, 30ml-D2H2O)
Chemicals0 Concentration
Ethanol0 70ml
Distilled0Water 30ml
183
5. a. Tris0acetate EDTA (5×TAE0Buffer)
Chemicals Concentration
Trizma0Base 54gm
Acetic0Acid 27.5gm
0.5M0EDTA 20ml
Distilled0Water Fill upto01000ml
5. b. 1×TAE0Buffer
Chemicals Concentration
5×TAE0Buffer 200ml
Distilled0Water 800ml
6. Loading0Dye/ Buffer
Chemicals Concentration
Bromophenol0Blue 0.25% 0.031gm
30%0Glycerol 3.75ml
70ml0H2O 8.75ml
184
7. Tris EDTA (TE) Buffer
Chemicals0 Concentration
1M0Tris HCl0 10ml
0.5M EDTA0 2ml
pH0 7.5-8.0
8. Gel Formation
Chemicals Concentration
Agarose0Gel 0.8%0
1×TBE Buffer 100ml0
Add01ul of Ethidium0Bromide
9. Layout for PCR Master Mix
Reagents Concentration Volume Template0DNA 20-50 ng/ul 1.65 µL DNTPs0 2.5 mM 2.0 µL Buffer0 10X 2.0 µL MgCl20 25 mM 2.5 µL Primer–F0 20 µM 0.8 µL Primer-R0 20 µM 0.8 µL DNA Taq0Polymerase 5Uint/µL 0.25 µL Double0distilled0H2O 10µL Total0Volume 20µL
185
10. List of 20 SSR Primers along with forward and reverse sequence used
in this study
Sr.No. Primer Forward sequence Reverse sequence
1 AD73 Cagctggattcaatcattggtg Atgagtaatccgacgatgcctt
2 AA92 aaggtctgaagctgaacctgaagg Gcagcccacagaagtgcttcaa
3 D21 Tattctcctccaaaatttcctt Gtcaaaattagccaaattcctc
4 AD148 Gaaacatcattgtgtcttcttg Ttccatcacttgattgataaac
5 AD270 Ctcatctgatgcgttggattag Aggttggatttgttgtttgttg
6 AA335 Acgcacacgcttagatagaaat Atccaccataagttttggcata
7 AB53 Cgtcgttgttgccggtag Aaacacgtcatctcgacctgc
8 AA205 Tacgcaatcatagagtttggaa Aatcaagtcaatgaaacaagca
9 AC58 Tccgcaatttggtaacactg Cgtccatttcttttatgctgag
10 AD83 Cacatgagcgtgtgtatggtaa Gggataagaagagggagcaaat
11 AB141 Atcccaatactcccaccaatgtt Agacttaggcttcccttctacgactt
12 AA285 Tcgcctaatctagatgagaata Cttaacattttaggtcttggag
13 AD147 Agcccaagtttcttctgaatcc Aaattcgcagagcgtttgttac
14 AA175 ttgaaggaacacaatcagcgac Tgcgcaccaaactaccataatc
15 AA163.2 Tagtttccaattcaatcgacca Agtgtattgtaaatgcacaaggg
16 AD51 atgaagtaggcatagcgaagat Gattaaataaagttcgatggcg
17 AA90 Cccttaccatatttcgtttct Tgcgactccattctagtattg
18 AA103 Aagtgtgaaagtttgccaggtc Cgggtacgggttatgttgtc
19 AB72 atctcatgttcaacttgcaaccttta Ttcaaaacacgcaagttttctga
20 AA67 Cccatgtgaaattctcttgaaga Gcatttcacttgatgaaatttcg
186
11. QUALITATIVE DATA
Treat. G.VIGOR F.COLOR P.SHAPE P.COLOR S.SHAPE S.COLOR
CH 1 1 1 1 1 1
L1 1 7 1 1 1 3
L2 1 7 1 1 1 3
L3 1 7 1 1 1 3
L4 2 7 1 1 1 3
L5 2 1 2 1 2 1
L6 2 1 2 1 2 1
L7 1 1 2 1 2 1
L8 3 1 2 1 2 1
L9 3 1 2 1 2 1
L10 3 1 2 1 2 1
L11 2 1 2 1 2 1
L12 1 1 2 1 2 1
L13 1 1 1 1 1 1
L14 1 1 1 1 1 1
L15 2 1 1 1 1 1
L16 1 1 1 1 1 1
L17 1 2 1 2 1
L18 1 1 2 1 2 1
L19 1 1 2 1 2 1
L20 1 1 2 1 2 1
L21 2 7 1 1 1 3
L22 2 7 1 1 1 3
L23 1 7 1 1 1 3
L24 1 7 1 1 1 3
L25 2 1 2 1 2 1
L26 2 1 2 1 2 1
L27 1 1 2 1 2 1
L28 1 1 2 1 2 1
L29 1 1 1 1 1 1
L30 1 1 1 1 1 1
L31 2 1 1 1 1 1
L32 2 1 1 1 1 1
L33 2 1 2 1 2 1
L34 3 1 2 1 2 1
M-25 1 1 1 1 1 2
M-16 1 1 1 1 1
187
M-102 1 1 1 1 1 1
M-91 1 1 1 1 1 2
M-07 1 1 1 1 1 2
M-83 2 1 1 1 1
M-22 1 1 1 1 1 1
M-72 1 1 1 1 1 1
M-39 1 1 1 1 1 1
M-86 3 1 1 1 1 1
M-08 2 1 1 1 1 2
M-116 1 1 2 1 2 1
L47 3 1 2 1 2 1
L48 3 1 2 1 2 1
L49 3 1 2 1 2 1
L50 3 1 1 1 1 1
L51 2 1 1 1 1 1
L52 2 1 1 1 1 1
L53 1 1 1 1 1 1
L54 3 1 2 1 2 1
L55 1 1 2 1 2 1
L56 3 1 2 1 2 1
L57 3 1 2 1 2 1
L58 2 1 2 1 2 1
L59 2 1 2 1 2 1
L60 1 1 2 1 2 1
L61 1 1 2 1 2 1
L62 1 1 2 1 2 1
L63 3 1 1 1 1 1
L64 1 1 1 1 1 1
L65 1 1 1 1 1 1
L66 3 1 1 1 1 1
L67 3 1 1 1 1 1
L68 3 1 1 1 1 1
L69 3 1 1 1 1 1
L70 2 1 1 1 1 2
L71 2 1 1 1 1 1
L72 3 1 1 1 1 1
L73 2 1 1 1 1 1
L74 3 1 1 1 1 1
188
12. Mean values for Morphological parameters among 75 pea genotypes
G P L LL LW LA FI FC PF P/P PL PW S/P SW Y
CH 85 41 39 2.5 2.7 4.92
60 73 65 15 10.5 1.2 8 28.2 18.8
L1 85 55 46 2.2 1.8 2.89
58 70 63 12 5.5 1 4 12.3 8.2
L2 85 58 49 2.5 2.5 4.56
58 70 63 13 4.7 1.1 4 12 8
L3 85 47 41 1.7 1.6 2.1
58 70 64 12 5 1 4 12.9 8.6
L4 80 50 43 2 1.9 2.77
56 70 64 12 4.5 1 4 12.5 8.3
L5 80 52 44 1.9 1.8 2.49
56 69 63 11 5.8 1.2 5 13 8.6
L6 80 34 35 1.7 1.2 2.1
50 62 56 10 5.8 1 5 13.7 9.13
L7 85 47 43 2.8 2.7 5.51
55 70 63 12 6.1 1 5 13 8.6
L8 75 46 37 2.6 2.6 4.93
57 68 62 11 6.5 1 5 13.4 8.9
L9 75 47 42 2.1 2 3.06
57 69 63 12 7.5 1.2 6 17 11.33
L10 75 52 45 3.1 3.1 7.01
57 68 62 10 6.6 1.1 6 17.5 11.6
L11 80 57 50 3.2 3.2 7.47
56 68 61 16 8 1 7 19 12.6
L12 85 43 38 3.3 3.3 7.94
61 75 67 13 8.7 1 7 18.2 12.13
L13 85 44 46 3.6 3.5 9.19
61 74 67 13 8.3 1.1 7 19.2 12.8
L14 85 46 39 3.4 3.3 8.19
60 74 66 12 8.3 1 7 19 12.66
L15 80 42 51 3 3.1 6.78
61 75 68 14 6.6 1.2 6 18.6 12.4
L16 70 47 48 2.9 2.9 6.13
57 67 63 15 7.6 1.2 6 19.2 12.8
L17 75 43 54 2.7 2.8 5.51
57 69 65 14 7.6 1.2 6 18.6 12.4
L18 70 40 36 3.1 3.2 7.24
58 70 66 16 7.1 1.2 6 19 12.6
L19 75 46 37 3 3.1 6.78
59 70 66 13 7.7 1.2 7 21.4 14.2
L20 75 33 30 1.8 1.8 2.36
49 61 58 13 7.9 1.2 7 22 14.6
L21 80 58 53 2.9 2.8 5.92
59 71 65 16 8.2 1.2 7 22.6 15.06
L22 80 59 52 2.8 2.8 5.72
58 71 66 17 8 1.2 7 22 14.6
L23 85 65 65 3.6 3.6 9.46
56 70 67 16 7.6 1.2 6 16.4 10.9
L24 85 68 70 4.1 4 11.9
58 73 68 11 7.6 1.2 6 18 12
L25 80 67 66 3.8 3.7 10.2
58 72 67 13 7.6 1.2 6 18.5 12.3
L26 80 69 65 3.9 3.8 11.1
59 72 66 14 7.5 1.2 6 19 12.66
L27 85 71 68 4.2 4.1 12.5
60 74 67 17 8.5 1.1 7 23.8 15.86
L28 85 74 69 4.3 4.3 13.4
60 74 67 17 8.6 1.2 7 23 15.33
L29 85 80 74 5.1 5 18.6
62 77 69 18 8.7 1.2 7 23.5 15.66
L30 85 78 71 4.7 4.7 16.12
61 75 63 17 8.2 1.2 7 23.5 15.66
L31 80 73 67 4.5 4.4 14.4
59 73 61 14 8.3 1.2 7 23 15.33
L32 80 75 66 4.2 4.2 12.87
59 72 62 11 8.5 1.1 7 23.4 15.6
L33 80 54 58 3.9 3.9 11.1
52 65 57 13 8.6 1.1 7 24.9 16.6
L34 75 49 52 2.8 2.9 5.92
51 64 58 12 8.7 1.1 7 23.2 15.46
189
A35 90 44 49 2.7 2.7 5.32
51 64 58 14 9 1.2 8 26.8 17.86
A36 85 52 57 2.9 2.8 5.92
54 66 59 16 9.2 1.2 8 27.2 18.13
A37 90 56 62 3.1 3 6.78
55 65 60 15 9.3 1.2 8 26.4 17.6
A38 90 49 57 3 3 6.57
53 65 59 14 9.3 1.2 8 28.3 18.8
A39 85 45 54 2.9 2.8 5.92
53 67 69 16 9.1 1.2 8 27.2 18.13
A40 80 50 56 2.8 2.8 5.72
57 71 63 15 10.1 1.2 8 29.6 19.73
A41 85 53 60 3.1 3.1 7.01
57 70 62 14 9.5 1.2 8 25.8 17.2
A42 90 57 64 3.2 3.1 7.24
58 71 62 15 9.2 1.2 8 26 17.3
A43 85 54 59 3 3.1 6.78
55 69 60 16 9.3 1.2 8 27.3 18.2
A44 70 59 67 3.3 3.3 7.49
57 70 62 15 9.5 1.2 8 27 18
A45 80 55 63 3.2 3.1 7.24
56 69 60 14 8.7 1.2 7 25.3 16.86
A46 85 52 61 3.1 3.1 7.01
56 70 61 14 9.4 1.2 8 26 17.33
L47 70 57 65 3.3 3.2 7.7
58 72 62 13 7.6 1.1 6 19 12.6
L48 70 51 59 2.9 2.9 6.13
55 68 61 14 7.6 1.1 6 19.2 12.8
L49 75 46 62 3.9 3.9 11.1
54 67 61 14 8.5 1.1 7 20.1 13.4
L50 75 39 44 1.8 1.7 2.23
54 65 59 16 8.6 1.1 7 22.1 14.7
L51 80 41 47 2.1 2.1 3.21
53 67 59 11 8.7 1.1 7 22.5 15
L52 80 42 48 2.3 2.2 3.69
53 67 59 12 8.1 1.1 7 22.3 14.8
L53 85 44 50 2.4 2.4 4.2
55 70 61 12 7.5 1.1 6 21.1 14.06
L54 75 47 51 2.6 2.6 4.93
56 71 62 13 7.6 1.2 6 22.1 14.7
L55 85 44 49 2.3 2.3 3.86
56 69 60 14 8.7 1.2 7 22.9 15.26
L56 75 45 49 2.5 2.4 4.38
55 70 61 11 9.3 1.2 8 24.7 16.4
L57 75 49 53 2.7 2.6 5.12
58 72 63 10 9.8 1.2 8 24.6 16.4
L58 80 53 61 3.1 3.1 7.01
55 70 62 12 8.7 1.2 7 23.5 15.6
L59 80 58 66 3.5 3.4 8.68
56 70 61 13 8.7 1.2 7 22.5 15
L60 85 56 63 3.3 3.3 7.94
56 71 62 11 7.6 1.1 6 20.1 13.4
L61 85 59 64 3.6 3.5 8.94
58 72 62 12 7.6 1.1 6 19.7 13.1
L62 85 61 72 3.8 3.8 10.5
59 73 66 14 8.7 1.2 7 21.8 14.5
L63 75 64 75 3.9 3.9 11.1
58 72 65 15 7.5 1.1 6 18.6 12.4
L64 85 66 76 4 3.9 11.3
59 73 65 11 8.1 1.2 7 23.9 15.93
L65 85 60 71 3.8 3.8 10.5
58 72 64 14 8.2 1.2 7 23.4 15.6
L66 75 57 66 3.5 3.5 8.94
55 69 61 15 7.3 1.1 6 19.5 13
L67 75 54 62 3.1 3.1 7.01
55 69 61 16 7.3 1.1 6 20.3 13.53
L68 75 51 59 2.9 2.9 6.13
54 68 60 11 8.3 1.2 7 24.2 16.13
L69 75 58 63 3.6 3.6 9.46
57 71 63 12 8.2 1.2 7 24.6 16.4
L70 80 61 74 3.9 3.8 10.81
58 70 62 12 8.1 1.2 7 23.8 15.8
L71 80 66 75 4.2 4.1 12.5
59 73 63 11 7.6 1.1 6 18.7 12
190
L72 75 68 77 4.4 4.3 13.81
59 72 62 14 7.6 1.1 6 19.8 13.2
L73 80 64 73 4 4 11.68
57 70 63 13 8.2 1.2 7 22.9 15.2
L74 75 61 65 3.7 3.7 9.99
56 70 63 12 8.1 1.2 7 22.3 14.8
SD.V 5.22 10.29 11.76 0.75 0.75 3.49 2.66 3.06 2.91 1.95 1.17 0.07 1.02 4.19 2.80
C.V 27.25 105.96 138.36 0.56 0.56 12.18 7.09 9.33 8.49 3.79 1.37 0.00 1.04 17.57 7.85
13. Means values for biochemical parameters among pea genotypes
Moist. TSS Phen. Ph Protein Fat Fiber Ash Carbo. Chloro. CH 7.8 1.2 3.213 6.6 23.16 1.21 0.89 2.8 65.03 28.5 L2 8.1 1.4 3.102 5.3 23.07 1.32 1.11 3.4 64.11 27.2 L3 7.7 1.1 1.793 6.9 17.67 1.34 0.83 3.7 69.59 23.1 L4 7.7 1.7 2.069 6.7 19.05 1.28 0.92 3.4 68.57 25.6 L5 8.9 1.3 2.063 6.1 21.4 1.29 1.12 2.9 65.51 27.4 L6 8.3 1.8 2.552 6.3 23.91 1.37 1.26 2.3 64.23 22.66 L7 8.8 2.1 2.914 6.4 20.13 1.39 1.34 3.8 65.88 13.2 L8 8.2 2.6 1.387 6.8 21.23 1.23 1.42 3.5 65.84 13.6 L9 8.2 2.8 1.272 5.8 22.67 1.41 1.23 2.2 65.52 21.7 L10 8.1 1.7 1.535 6.4 23.78 1.44 1.98 2.3 64.38 23.7 L11 8.5 2.2 1.421 6.3 24.32 1.47 0.88 2.6 63.11 18.6 L12 8.3 1.6 1.163 5.6 24.78 1.53 0.96 3.2 62.19 18.9 L13 7.1 1.4 1.984 6.7 24.89 1.43 0.94 3.7 62.88 18.9 L14 8.3 1.2 1.845 6.5 23.56 1.32 0.99 3.1 63.72 33.1 L15 8.8 2.8 3.219 6.3 23.4 1.24 1.23 3.6 62.96 29.2 L16 7.5 1.7 2.767 6.3 22.27 1.37 1.29 3.7 65.16 15.9 L17 7.7 1.6 3.01 6.8 21.35 1.38 1.28 2.9 66.67 27.1 L18 7.9 1.5 2.045 6.7 20.89 1.26 1.32 2.2 67.75 17.3 L19 8.3 1.3 1.342 6.3 22.45 1.25 1.34 2.1 65.9 11.1 L20 7.2 1.8 2.142 5.9 23.43 1.33 1.35 2.7 65.68 15.6 L21 7.9 2.3 2.515 6.4 24.23 1.39 1.28 2.3 64.18 18.6 L22 8.7 1.3 2.291 6.1 23.65 1.45 1.33 2.8 63.4 13.6 L23 7.3 2.9 3.125 6.7 24.86 1.49 1.45 2.7 63.65 12.2 L24 7.7 2.1 3.311 6.5 25.87 1.54 1.44 2.9 61.99 31.93 L25 7.7 1.7 2.872 5.8 26.31 1.31 1.41 2.7 61.98 14.24 L26 8.6 2.5 2.635 5.7 25.87 1.27 1.52 2.3 61.96 23.2 L27 7.6 1.9 1.238 5.4 22.09 1.32 1.29 2.4 66.71 29.3 L28 7.3 1.4 3.612 6.4 21.45 1.46 1.34 2.7 67.09 26.9 L29 7.2 2.8 1.694 6.5 21.34 1.51 1.37 2.6 67.35 23.3 L30 7.4 1.1 2.436 6.8 23.73 1.55 1.42 2.4 64.92 33.92 L31 7.8 2.2 2.255 6.1 25.76 1.34 1.53 2.8 62.3 28.9 L32 7.3 1.6 1.755 6.3 25.09 1.45 1.47 2.7 63.46 25.36
191
L33 7.9 2.4 1.479 6.2 21.79 1.47 1.26 2.9 65.94 13.5 L34 8.3 1.7 2.981 6.4 27.01 1.57 1.37 3.8 59.32 32.35 A35 8.3 1.4 2.523 5.7 20.92 1.62 1.39 3.2 65.96 17.5 A36 8.7 2.8 3.821 5.3 21.78 1.34 1.31 3.6 64.58 22.3 A37 9.9 1.3 3.311 5.7 22.23 1.45 1.24 4.2 62.22 25.1 A38 9.4 2.3 3.913 6.2 23.25 1.52 1.28 4.4 61.7 27.2 A39 9.1 2.7 1.635 6.1 23.57 1.54 1.47 3.9 61.89 23.2 A40 8.3 1.5 2.045 6.4 23.45 1.34 1.45 3.1 63.81 24.6 A41 9.1 2.7 1.326 5.4 22.56 1.56 1.41 3.7 63.08 22.4 A42 8.9 2.3 2.454 5.7 21.42 1.59 1.39 3.5 64.59 26.2 A43 8.8 2.4 1.292 5.8 23.35 1.52 1.44 3.4 62.93 23.9 A44 8.9 2.1 1.367 5.9 23.32 1.48 1.34 3.6 62.7 21.3 A45 8.8 2.7 2.198 6.3 24.31 1.57 1.49 3.2 62.12 22.7
A46 8.7 2.3 2.987
6.5
21.66 1.55 1.35 3.5 64.59 23.8 Max 9.9 2.9 3.913 6.9 27.01 1.62 1.98 4.4 69.59 33.92
Mini 7.1 1.1 1.163 5.3 17.67 1.21 0.83 2.1 59.32 11.1
14. The Eigen values for 15 morphological traits of Pisum sativum L. Genotypes.
PC 1 2 3
Eigen value 6.18 4.12 1.46
% variance 41.22 27.52 9.79
Cumulative Eigen Value 41.22 68.74 78.53
15. The Eigen values for 10 biochemical traits of Pisum sativum L. Genotypes
PC 1 2 3 4
Eigenvalue 2.71 1.71 1.47 1.00
% variance 27.06 17.06 14.71 10.03
Cumulative variance 27.06 44.12 58.83 68.86
192
16. The Eigen values for 20 Primers in Pisum sativum L. Genotypes
PC 1 2 3 4 5 6 7 8
Eigen Value 5.65 4.09 2.28 2.01 1.61 1.35 1.17 1.13
% Variance 21.74 15.72 8.76 7.73 6.19 5.19 4.50 4.37
Cumulative variance 21.74 37.46 46.22 53.95 60.14 65.33 69.83 74.2