Mol Gen Genet (1991) 227:260 266 002689259100172L OlGXI

© Springer-Verlag 1991

Molecular cloning of a glutathione S-transferase overproduced in insecticide-resistant strain of the housefly (Musca domestica) Jian-ying Wang 1, Steve McCommas z, and Michael Syvanen 1

1 Department of Medical Microbiology and Immunology, School of Medicine, University of California, Davis, CA 95616, USA 2 Department of Biological Sciences, University of Southern Illinois, Edwardsville, IL 62026, USA

Received June 4, 1990 / January 17, 1991

a n

Summary. We report the cloning and sequencing of a glutathione S-transferase (GST) gene from the housefly Musca domestica. A cDNA 2gtl1 library was prepared from the organophosphate insecticide-resistant housefly strain Cornell-R - a variant that has elevated GST activ- ity. The 2 phage GST clone was identified on the basis of its ability to cross-hybridize to a GST DNA probe from Drosophila melanogaster. Based on amino acid ho- mology to other GSTs and expression of GST activity in Escherichia coil, the Musca GST gene (MdGST-1) belongs to the GST gene family. Although organophosp- hate resistance in Cornell-R is largely due to one of the GSTs, MdGST-I is probably not the enzyme respon- sible for resistance. The mutation that controls resistance to organophosphate insecticides in Cornell-R is highly unstable and we isolated spontaneous variants to both insecticide sensitivity and to even higher levels of resis- tance. This provided us with an isogenic set of three strains. We found that MdGST-I transcript levels as measured by Northern assays are higher in all three Cor- nell-R strains relative to the sensitive wild type, but that the sensitive Cornell-R strain has more MdGST-1 tran- script than does the highly resistant Cornell-R strain. These data as well as Southern analysis of genomic DNA allow us to conclude: (1) there are multiple GST genes in M. domestica; (2) the natural variant Cornell-R over- produces excess transcript from two and probably more of these genes; and (3) the unstable mutation in Cornell- R influences the levels of multiple GSTs.

Key words: Glutathione S-transferase - Musca domestica - cDNA sequence - Organophosphate triesters - Insecti- cide resistance

Introduction

Glutathione S-transferase (GST) is one of the major de- toxification enzyme families found in metazoans and

Offprint requests to: M. Syvanen

plants (Picket and Lu 1989). Evidence supporting a role for GST in the detoxification of xenobiotic compounds includes the discovery of insecticide-resistant insects with greatly elevated levels of this enzyme; for example, in the housefly Musca domestica, GST is a major candidate in the detoxification of organophosphate toxins (Oppen- oorth etal. 1972; Motoyama and Dauterman 1975; Clark et al. 1973, 1976). In particular, Tripathi and O'- Brien (1973) have isolated a strain of the housefly M. domestica, called Cornell-R, that is resistant to organo- phosphate neurotoxins and constitutively overproduces a GST (Oppenoorth et al. 1977).

GST in the housefly is present as multiple isoenzymes (Motoyama and Dauterman 1977, 1978; Clark and Sha- maan 1984; Clark and Dauterman 1982), and different isoenzymes seem to recognize different xenobiotics. Genes controlling expression of GST have been mapped to chromosome II (Plapp 1984; Motoyama et al. 1977; Ottea and Plapp 1984), and may exist as a tandem array encoding GST subunits and spanning several genetically defined loci (Clark and Shamaan 1984). However, the number of active GST genes and the distribution of sub- strate specificities across the different isoenzymes re- mains undetermined. We have set out to characterize the GST gene family from M. domestica by taking ad- vantage of the organophosphate resistance phenotype of Cornell-R. This paper describes the cloning and se- quence of one of the GST genes whose product is over- produced in the resistant strain Cornell-R.

Materials and methods

Strains. The housefly strain CSMA was provided by Dr. W. Dauterman and Cornell-R was provided by Dr. F. Plapp.

Chemicals. TCVP is 2-chloro-l-(2,4,5-trichlorophenyl) vinyl dimethylphosphate [Rabon] from Chem Services.

TCVP sensitivity tests. The interiors of 20 cm 3 scintilla- tion vials were coated with a defined amount of TCVP

by evaporating 1 ml of an acetone-TCVP solution while turning the vials. Then 10 to 15 3 day old adult flies were placed in each vial and the vials were incubated at 30 ° C for 3 h. At this time, the number of lethally intoxicated flies was counted. This method is from Pro- fessor Frederick Plapp at Texas A&M (personal commu- nication).

Isolation of high resistance variants of Cornell-R. Approx- imately 1000 3 day old adults of the strain Cornell-R (maintained at 23 ° C) were separated by sex. (Separation by sex was necessary because the male Cornell-R strain is about four times as sensitive to TCVP as is the female.) Each was fed dried milk that was 0.2% TCVP by weight, prepared by adding 2 ml of TCVP in acetone (at 1 rag/ ml) to 1 g dry milk and thoroughly mixing the resulting paste. After 24 h there were 8 surviving males and 30 surviving females, which were used to rebuild a popula- tion of 10000 adult flies. These were fed dried milk con- taining 0.5% TCVP. Approximately 100 males and 2000 females survived after 2 days, at which time selection was stopped. This population is called Cornell-HR.

Measurement of GST activity. Enzyme activity was mea- sured using the spectrophotometric technique of HaNg et al. (1974), with slight modifications. As substrate we used either 1-chloro-2,4-dinitrobenzene (CDNB) or 3,4- dichloronitrobenzene (DCNB) (both purchased from Sigma). Adult flies were homogenized on ice in 0.1 M TRIS-HC1, 0.25 M sucrose, pH 9.0. The homogenates were then centrifuged at 500000 g for 15 rain, to remove debris and the microsomal fraction. Thus, only the solu- ble GSTs are assayed. The 1 ml reaction mixture con- sisted of 1 mM DCNB or CDNB, 1 mM reduced glu- tathione, and contained 38 ~tl of homogenate. A reaction mixture without the enzyme was used as a control to correct for nonenzymatic conjugation. The absorbance at 344 nm was converted to micromoles of conjugated substrate using the extinction coefficients given in Aske- lof et al. (1975) and HaNg et al. (1974). Total protein was determined using the method of Bradford (1976) with bovine serum albumin as a standard. Standard er- rors for specific activities were based on two to five sam- ples of flies.

Molecular cloning. The Md-GSTI clone was found in a cDNA gene bank prepared in the 2gtll vector. Po- ly(A) + RNA was purified from about 200 adults of Cor- nell-R (Maniatis et al. 1982) and cDNA prepared from this RNA was inserted into 2gtl I DNA using a reverse transcriptase kit from Bethesda Research Laboratories. The resulting DNA was packaged into phage 2 particles using the Packagene kit from Promega. The pool of re- sulting phage was amplified by growing a plate lysate on the Escherichia coIi strain Y1088. Individual plaques were transferred to nitrocellulose filters and annealed with a 32p-labeled probe (Maniatis etal. 1982). The DNA probe was the Drosophila melanogaster GST-2 DNA fragment that was purified from plasmid pDmGST2 (a gift from Dr. Bruce Cochrane from the U. South Florida; Cochrane et al. 1989). After screening

261

50000 plaques from this library, we found 30 that gave a positive signal with the DmGST-2 probe.

Northern procedure. RNA was purified from 3 to 4 day old adult flies that had been pulverized under liquid N2 using a mortar and pestle. Purification followed the procedure of MacDonald et al. (1987). Glyoxal-agarose gel separation and hybridization were by standard pro- cedures (Maniatis et al. 1982). Stringency of hybridiza- tion is given in the figure legend.

Southern procedure. DNA was purified from adults that had been pulverized under liquid N2 using a mortar and pestle. The frozen powder was dissolved in 4 M guanidinium thiocyanate, 0.07 M TRIS-HC1, pH 7.6, 25 mM EDTA, 0.1 M/~-mercaptoethanol, 0.5% SDS at 65 ° C, and incubated for 30 rain. Then the DNA was centrifuged onto a 5.7 M CsC1 cushion at 20 ° C. At this point purification followed the procedure outlined by Iversen et al. (1987). The stringency of hybridization is given in the figure legend.

Results

An unstable mutation controlling resistance in CornelI-R

The strategy we have employed in order to characterize the M. domestica GST gene family and its relationship to organophosphate insecticide resistance takes advan- tage of an unstable mutation responsible for organo- phosphate resistance in the strain Cornell-R (Tripathi and O'Brien 1973).

Mutational analysis of Cornell-R illustrates the rela- tionship between organophosphate resistance and its GST activity. For example, the high level of resistance in Cornell-R is an unstable trait and spontaneous changes in insecticide resistance levels are accompanied by comparable changes in GST activity levels. We showed this by first isolating a spontaneous revertant to insecticide sensitivity from a population of Cornell-R to give a new strain called Cornell-R*. In these studies, we used the organophosphate insecticide tetrachlorvin- phos or TCVP. We isolated Cornell-R* from a popula- tion of Cornell-R that had been maintained for two years without selection for resistance to TCVP. Ten brother-virgin sister pairs were isolated and ten new pop- ulations built from these; two of these showed the sensi- tive phenotype. From one of these sensitive strains a brother-virgin sister pair was used to rebuild the popula- tion that we call Cornell-R*.

We also isolated a variant of Cornell-R that is hyper- resistant to organophosphate poisoning, which we call Cornell-HR. Cornell-HR was isolated by submitting the already resistant Cornell-R to killing concentrations of TCVP (Materials and methods). In this procedure, we separated males from females to give 1000 of each sex and then killed 98% of them with TCVP. A new popula- tion of flies was built up from the survivors and a second round of killing performed; in this round 99% of the males and 80% of the females were killed. The survivors of this second round of killing yielded Cornell-HR.

262

100

80

(/3

t >

03 o~ 40

20 CSMA k , \

.51.02 4 8 16 31 62 125 250 500 1000 2000 ~g TCVP

Fig. 1. Sensitivity of flies to 2-chloro-l-(2,4,5-trichlorophenyl) vinyl dimethylphosphate (TCVP). The strains CSMA (A) Cornell-R* (m) Cornell-R (o) and Cornell-HR (zx) were tested for their sensitivity to TCVP as described in Materials and methods. The amount of TCVP coated onto the interior of a 20 cm 3 scintillation vial is shown on the abscissa. The percentage of flies that appear healthy after the 3 h incubation at 30 ° C is given on the ordinate

The results of the TCVP sensitivity tests that display the phenotypes of Cornell-R*, CorneU-R and Cornell- H R are shown in Fig. 1. Also shown is the standard sensitive strain CSMA. The LDso for CSMA is 1 ~tg of TCVP, and that for Cornell-R is about 500 gg, while Cornell-R* has lost much of its resistance (LDso of 12 gg) and Cornel l -HR has developed near total resis- tance (LD5o > 2000 lag).

The important point is that Cornell-R*, Cornell-R and Cornell H R are an isogenic set and the mutat ional event that links R* and H R to R is spontaneous and relatively frequent. For example, Cornell-R* arose f rom Cornell-R after this latter strain had been grown for 30 generations without selection for TCVP resistance, and Cornel l -HR arose at a frequency of greater than 10-4 f rom Cornell-R. The sensitivity phenotype of Cor- nell-R* appears to be relatively stable. We found 0 survi- vors among 1980 adults of Cornell-R* fed 0.05% TCVP in dry milk, while Cornell-R itself has more than 75% survivors when treated similarly.

GST activities

The levels of GST activity were measured in the four housefly strains by assaying the conjugation reaction be- tween glutathione and D C N B (Table 1). This reaction defines one of the classes of GST to which belongs the enzyme that detoxifies organophosphate insecticides such as TCVP (Clark 1984). In addition we also assayed GST activity using CDNB. As has been shown by Clark et al. (1984), the M. domestica GST isoenzymes can be divided into at least two classes: the first is active against both D C N B and CDNB, and the second is active against CDNB only.

Table 1. Activity of glutathione S-transferase (GST)

Strain DCNB CDNB LDso Ratio TCVP DCNB/

CDNB

CSMA 0.0244-0.004 0.364-0.043 1 0.07 Cornell-R* 0.0154-0.002 0.1334-0.010 12 0.13 Cornell-R 0.106 4- 0.034 0.295 4-0.05 500 0.36 Corneli-HR 0.403 4- 0.017 0.5764-0.02 > 2000 0.67

Activity of GST is in gmol of product per milligram of soluble protein per minute. DCNB, 2,4-dichloronitrobenzene; CDNB, 1- chloro-2,4-dinitrobenzene. The standard error based on multiple assays is given. The LDso for TCVP, in micrograms, is shown for comparison and is taken from Fig. 1

The results in Table 1 indicate that the " r eve r t an t " Cornell-R* is not a revertant to the wild-type state; it is rather associated with a mutat ional event that resulted in a decline of both the D C N B and C D N B GST activi- ties below the wild-type levels. The salient point f rom this experiment is that the GST activity as measured by D C N B correlates positively with resistance in the isogenic set Cornell-R*, Cornell-R and Cornell-HR. Be- cause C D N B assays both classes of GST activities while DCNB assays only one (Clark et al. 1984), the ratio of DCNB to C D N B will give a rough estimate of the frac- tion of GST that is active against insecticide. As is shown in the last column of Table 1, this ratio strongly corre- lates with resistance.

Cloning a GST overproduced in Cornell-R

Because Cornell-R produces larger amounts of a GST enzyme than does the wild type (CSMA), we assumed that Cornell-R would also overproduce an m R N A for that enzyme. We searched for the overproduced R N A by probing the poly(A) ÷ R N A fraction from the housefly strains with a GST clone (called DmGST-2) isolated from D. melanogaster (Dr. Bruce Cochrane, personal communication). Cornell-R, when compared with CSMA, clearly overproduced an m R N A fraction that hybridized to this probe. We therefore prepared a c D N A gene bank f rom this Cornell-R R N A preparat ion using the lambda expression vector 2gtl 1.

From 50000 phage in this bank, we found 30 that hybridized to the Drosophila GST probe. We kept the largest of these and determined its complete nucleotide sequence (Fig. 2). The c D N A insert contained a 628 nu- cleotide open reading frame that was followed by AT- rich sequences characteristic of the 3' end of genes. In addition, the deduced amino acid sequence of this read- ing frame shows an 84% identical amino acid match and a 93% functional amino acid match with the D. melanogaster GST-1 enzyme (Fig. 2) sequenced by Tuong et al. (1990).

Tuong et al. (1990) have shown that the Drosophila DmGST-1 amino acid sequence has similarity to maize GST-1 over a region of 40 amino acids. The Musca and Drosophila sequences, when compared with a larger

MD-GSTI

DM-GSTI

MD-GSTI

DM-GST1

MD-GSTI

i I0 AT~TGGATTICTACTACTTGCCCGGTTCCGCTCCCIGCCGCTCGGTCTTGATGACCGCC

M D F Y Y L P G S A P C R S V L M T A MV . . . . . . . . S . . . . . I . .

20 30 ~GGCC~GGGCATTG~CTC~C~GAAA~G~G~C~GC~GCTGGCG~CACTTG K A L G I E L N K K L L N L Q A G E H L

• V . V . . . . . . . . . . . . . . . 4~ 50 ~GCCCG~TTC~G~GATC~TCCCC~CACACCATCCCCACCTTGGTCGATGGCGAT K P E F L K I N P Q H T I P T L V D G D

DM-GSTI . . . . . . . . . . . . . . . . . . N G 60 70

MD-GSTI ~CGCC~GTGGG~TCTCGTGCCATTATGGTCTAC~GG~GAG~GTACGGCAAAACC F A L W E S R A I M V Y L V E K Y G K T

DM-GSTI . . . . . . . . . E . . . . . . . . . . 80 90

MD-GST1 GACTCC~G~CCCC~GTGCCCC~G~GCGCG£CGTC~C~CC~CGC~GTACTTC D S k F P K C P K K R A V I N Q R L Y F

DM-GSTI Y . . . . . . . . . . . . . . . . I0~ llO

MD-GST1 GACATGGGTACC~GTAC~GAGCT~GCCGACTACTA~ATCCTCAGATAT~GCC~G D M G T L Y K S F A D Y Y Y P Q I F A K

DM-GSII . . . . . . Q . N . . . . . V 120 130

MD-GSTI GCTCCTGCTGATCCTG~CTC~C~GAAAATCGAAACCGCT~CGA~TC~AAACACC A P A D P E L F K K I E T A F D F L N T

DM-GSTI . . . . . . A . . . . . A . E . . . . 140 150

MD-GSTI TTC~G~GGGTCATG~TATGCTGCCGGTGATAGC~GACGG~GCCGAT~GGCT~G F L K G H E Y A A G D $ L T V A D L A L

DM-GSTI E N D . . . . . . . . . . . I 16~ 170

MD-GSTI ~GGCCAGTGTCAGCACCTTTG~GTGGCCAGCTTCGA~TCAGCPJ~ATACCCC~TG~ L A S V S T F E V A S F D F S K Y P N V

DM-GSTI V T . . . . . . . K E I . . A . 180 190

MD-GSTI GCC~GTGGTACGCC~CCTT~GACGGTTGCTCCCGGCTGGG~GA/Vt~CIGGGCCGGT A K W Y A N L K T V A P G W E E N W A G

DM-GSTI N R . E . A . K . I . . . . . . . . . 200 210

MD-GST1 TGC~GG~TTC~GAM~TACTTCGG~AAAI~fTTG~GT~ATG~TTAAA~A~A C L E F K K Y F G

DM-GST] . . . . . . . . E

Fig. 2. Nucleotide sequence of GST-1 ~om Musca domestica (MD). Below the MD-GSTI nucleotide sequence is the deduced amino acid sequence of the only long reading Lame. The GST gene ~om Dros~hila melanogaster (DM-GST1) is shown ~r comparison. Only differences are shown; a period indicates identity

263

group of GSTs, align with this larger group over their entire length. In Fig. 3, we show comparisons with the maize GST-II I , a helminth and two human GSTs, and the bacterial dichloromethyl dehalogenase. The align- ments for four of these GSTs were taken f rom LaRoche and Leisinger (1990), who use the G C G program BestFit to align the sequences. Figure 3 shows only those regions with the best match to those of the insects; however the five segments shown are colinear over the six taxa. Interestingly, in the region from 87 108 and 14%163, the insect GSTs are more closely related to the bacterial protein than to any of the other eukaryotic GSTs.

M d G S T 1 encodes a G S T activity

To show that MdGST1 encodes a GST, we expressed the M d G S T I c D N A insert in the Eo coli strain K12. This was accomplished by first inserting the 5' end of the open reading frame shown in Fig. 2 into a site in the plasmid Bluescript immediately to the 3' side of the T7 R N A polymerase promoter . This construct and a T7 R N A polymerase encoding plasmid (pBGST1 f rom Stan Tabor) were t ransformed into E. coli. When the T7 D N A polymerase was provided in trans to the MdGST1 construct, we detected GST activity with the CDNB assay (Table 2).

To characterize this GST activity further, we fraction- ated these E. coli extracts through steps designed to puri- fy GSTs. A nucleic acid-free extract was adsorbed to an N-hexyl-conjugated agarose column, eluted with

3 10 Mus fYYIPgSa PCRSv Dro fYYIPgSs PCRSv Maz IYgmPlSp nvvrv dcd lIYhPaSq PCRSa jap IgYwkikg Ivqpt hum ? lhYfnarg rmeSt hum g Ytvvyf PvRgr

30 Mus LGIEInkK Dro VGVEInkK Maz kGLDfeiv dcd IdVpfeee jap LeekyeeK hum ~ aGVEfeeK hum g adqgqswK

Mus Dro Maz dcd jap hum ? hum x

Mus Dro Maz dcd jap hum ? hum ~

40 50 60 70 80 ILnLqAGEh IKpEFlkI-N PqhtIPtk-V DGDFaLWESR AImvYLvEKY gktd ILnLqAGEh IKpEFlkI-N PqhtIPtL-V DngFaLWESR AIevYLvEKY gktd pVdLttGah kqpDFlaL-N PfgqIPaL-V DGDevLFESR AInrYIasKY aseg vVdIstdit eRqEFrdkyN PtgqVPiL-V DGEFtVWESv AIarYVnEKF dgag flqrdeGDk wRnkkfeLgl efpnLPyy-I DGDvkLtqSm AIirYIaDKh nmlg fIkksAeDl dKlrndgy-l mfqqVPmVel DG-mkLvqTR AIInYIasKY nlyg eevVtvetw qegslkas-c lygqLPkfq- DGDItLYqSn AIlrhLgrtl glyg

150 160

Fig. 3. MdGST-1 is a member of the GST supergene family. Align- ment of the amino acid sequences of the Musca (Mus) and Droso- phila (Dro) GSTs (Tuong et al. 1990) with those of the Zea mays GST-3 (Maz) (Grove et al. 1988), dichloromethane dehalogenase from Methylbacterium sp. (dcd) (La Roche and Leisinger 1990), the Schistosoma japonicum GST (jap) (Smith et al. 1986) and the human (hum) ? (Board et al. 1987) and ~ (Kano et al. 1987) GSTs. The alignment of the four non-insect GSTs is as determined by LaRoche and Leisinger (1990). The numbers above the line are from the MdGST-I system taken from Fig. 2. Sequences in bold face (and upper case) illustrate the identities and similarities be- tween the insect GSTs and the other members of the family. Simi- larity groups are: (K,R), (S,T), (L,V,I), (E,D) and (W, F,Y)

90 100 PKcpkkRAVInqR LYfDMGTLYkS PKcpkkRAVInqR LYfDMGTLYqS atasaaKlgVw-l eveShhfhpna PKftaeqnkgrtl LYeaMGTLeny kdfetIKvdflsK Lpemlkmfed- aKlaliKekIknR yFpafeIVlkS dnneaalvdmvnd gveDlrckYiS

180 190 Y PnVakWYanL ktVaP Y anVnrWYena kkViP ~ PhVkaWWeal aar-P F PkIaaWFkkL ser-P F PkLvcFkkrI eaI-P F PILkalktrl snL-P F PILsaYvgrL sar-P

YaAGDsLTFAD LALL YaAGDsLTFAD IALV YIAGDefTIAD anha YvcGDeVSYAD LAaF YInGDhVThpD fmLy YIvGnkLSrAD IhLV FivGDqISFAD ynLL

264

Table 2. MdGST-1 expresses a GST activity

Sample Activity

1. No extract 0.066 2. -MdGST extract 0.068 3. +MdGST extract 0.187

Activity is the absorbance increase at 344 nm in I rain when CDNB and glutathione are incubated at 25 ° C (see Materials and meth- ods). -MdGST extract is from Escherichia coli carrying either pBluescript or the T7 RNA polymerase plasmid. The +MdGSTI extract is from E. coli/pBGST1/PGT1. The extracts added to 1 ml of the CDNB and glutathione reaction mix for lines 2 and 3 were derived from 3 × 10 l° cells. The increase in absorbance is absolutely dependent on added glutathione

a b c d

0.25 M KC1 until fractions were free o f material showing absorbance at 280 nm and then eluted with 0.25 M KC1, 5 m M glutathione. This latter step eluted 67% o f the activity f rom the column. This f ract ion was assayed for GST activity using either C D N B or D C N B as substrate. Using C D N B , the specific activity was > 130 lamol prod- uc t /mg per minute. We detected no activity using D C N B as the substrate.

Tuong e ta l . (1990) have cloned a GST (called D m G S T - 1 ) f rom D. melanogaster that is active only against C D N B and no t D C N B . M d G S T 1 therefore ap- pears similar to the Drosophila D m G s t l enzyme. We conclude that M d G S T 1 is homologous to D m G S T - I .

Expression of the Musca GST transcripts

The fact that MdGST-1 codes for a GST active against C D N B but not D C N B makes it unlikely that MdGST-1 is responsible for o rganophospha te resistance. This con- jecture is suppor ted by the levels o f a 1000 bp transcript that is synthesized in our four strains and hybridizes to an MdGST-1 probe (Fig. 4). In this experiment we measured the levels o f R N A , using the Nor the rn proce- dure, f rom strains C S M A (lane a), Cornell-R* (lane b), -R (lane c), and - H R (lane d). The legend to Fig. 4 gives the relative quantities o f the four transcripts. As can be seen Cornell-R* and -R produce much more M d G S T - 1 transcript than does C S M A . However , within the series Cornell-R*, -R and H R, the former two produce more transcript than does -HR. Tha t is, the insecticide-sensi- tive revertant (Cornell-R*) produces more o f the 1000 bp R N A than does its resistant ancestor. I f this transcript represents the p roduc t o f the M d G S T - I clone, which seems to be the mos t likely possibility, then we can conclude that the MdGST-1 enzyme is not the one responsible for o rganophospha te resistance.

Hybr id iza t ion condit ions and filter washing were car- ried out under very high stringency. When lower strin- gency condit ions were employed, four other transcripts became visible (data no t shown). Two o f these could easily be seen in Cornel l -HR, but no t Cornell-R* or CSMA. Thus, it appears tha t the MdGST-1 probe hybri- dizes to transcripts f rom other members o f the Musca GST gene family and that two o f these other members are candidates for the GST that confers resistance.

Fig. 4. Musca transcripts as revealed by the MdGST-1 probe. Total RNA was purified from CSMA (lane a), Cornell-R* (lane b), Cor- nell-R (lane c) and Cornell-HR (lane d). The RNA was separated on an agarose-glyoxal gel and then processed according to the Northern procedure. The MdGST-1 gene was subcloned from 2gtll, then gel purified, labeled with 32p and used as a probe to reveal the GST transcripts. The autoradiogram is shown. The size of the single prominent transcript is 1050+_150 bp, deduced from the position of molecular weight standards that were visual- ized by ethidium bromide staining. The RNA size standards of 9.5, 7.5, 4.4, 2.4, 1.4 and 0.24 kb were purchased from Bethesda Research Laboratories. The relative amounts of MdGST-1 tran- script in the lanes was measured by densitometer tracing of the autoradiogram. The peak absorbance in blue light for the four lanes ranged from A=0.2 to A=1.5. The relative total amount of RNA added to each lane was judged from the intensity of the 23S, 16S and 5S stable RNAs as viewed by ethidium bromide staining, visible photography and densitometer tracing of the pho- tographic film. Using these data we obtained values for the relative amounts of MdGST-1 RNA divided by the amount of stable RNA: 1.0 for CSMA, 10.8 for Cornell-R*, 9.4 for Cornell-R and 3.3 for Cornell-HR. High stringency hybridization conditions were used. The hybridization reaction was for 16 h in 50% formamide, 6xSSC, 1% SDS, 200 gg/ml sheared and denatured DNA at 42 ° C. The filters were washed twice for 15 rain with 6 x SSC at 22 ° C, twice with 1 x SSC at 37 ° C and then once for 30 rain with 0.1 x SSC at 65 ° C

Restriction fragrnent pattern of genomic GST loci

Highly unstable muta t ions , such as tha t control l ing resis- tance in Cornell-R, are frequently the result o f gene rear- rangements such as duplicat ions or insertions. I f so, one would expect such events to result in visible differences in restriction f ragment patterns. Since it appeared possi- ble f rom the Nor the rn experiment presented above that MdGST-1 would hybridize to multiple members o f the GST gene family, we used MdGST-1 D N A to p robe Southern blots o f genomic D N A f rom the strains C S M A , Cornell-R* and Cornel l -HR. In this experiment,

we digested the DNA with either EcoRI (Fig. 5, lanes A, B and C) or PvuII (Fig. 5, lanes D, E and F). The complex pattern of bands most likely reflects the fact that the MdGST-I probe detects other members of the GST gene family, even under the relatively high stringen- cy conditions used to prepare the autoradiograph shown in Fig. 5. This is expected, since the same probe appears to detect multiple RNA species. There are two EcoRI sites in the coding region of MdGST1 that are 490 bp apart. As can be seen, all three strains have a prominent band at ca. 500 bp, which most likely corresponds to this internal GST-1 EcoRI fragment. The 3.2 kb band and the diffuse bands above and below the ca. 500 bp band in CSMA are absent in the two Cornell-R strains, and the 2.1 kb band in the two Cornell-R strains is ab- sent in CSMA. This restriction fragment polymorphism may be the result of a mutational event that accounts for the difference in phenotype between the CSMA and Cornell-R strains, though it could just be a neutral poly- morphism.

There is no difference in restriction fragment lengths between the sensitive Cornell-R* and highly resistant Cornell-HR strains. However, it is clear from Fig. 5 that the 1.6 kb EcoRI fragment and the 8.4 kb PvuII frag- ment are more intense in Cornell-HR than they are in

A B C D E F

-,,--10.5

~ 8.4 " - - 7.5

3 . 2 ~

2.1 -~-

1.6--~ I •

~0,5 ,.~

m ~ - - 1.1

Fig. g. GST restriction fragment patterns. Genomic DN A from Cornell-HR (lanes A and D), Cornell-R* (lanes B and E) and CSMA (lanes C and F) was purified, digested with either EcoRI (lanes A, B and C) or PvuII (lanes D, E and F) and then separated by agarose gel electrophoresis. The GST fragments were revealed by probing the gel with DNA from MdGST-1. 2DNA digested with HindIII and stained with ethidium bromide was used to cali- brate the gel. High stringency hybridization conditions were used. The probe was hybridized for 16 h in 50% formamide, 6 × SSC, 1% SDS, 50 gg/ml low molecular weight, denatured DNA at 42 ° C. The filters were washed twice for 15min with 6 x S S C at room temperature, twice for 15 min with I x SSC at 37 ° C and once for 1 h w i t h 0.1 x SSC at 65 ° C

265

Cornell-R*. The greater intensity probably represents a higher copy number of one of the GST genes in Cor- nell-HR. A highly unstable mutation that results in a higher copy number of a gene is diagnostic of a tandem duplication. If that is so, then the mutational event link- ing the three Cornell-R strains would appear to be un- equal crossing over and the mutation would appear to be an amplification.

Discussion

The isogenic set of strains Cornell-R*, Cornell-R and Cornell-HR have varying levels of GSTs and represent a convenient genetic background from which to clone and characterize the members of the GST gene family. The convenient phenotype that distinguishes among these three strains is resistance to organophosphate in- secticides. One of the GSTs detoxifies these compounds, although multiple members of this gene family are dere- pressed in Cornell-R. This paper reports the isolation of a cDNA clone and the complete nucleotide sequence for one of these GST genes.

The MdGST-1 clone can be identified as a GST gene copy since the only open reading frame in the insert of MdGST-1 is very similar to the DmGST-1 gene from D. melanogaster: at the amino acid level the residues are 84% identical and 93% similar and both of the pro- teins align with other members of the GST gene family. In addition, MdGST-1 expresses GST activity in E. coli when placed in an appropriate expression vector. The enzyme catalyzes the conjugation of glutathione to the substrate CDNB, but not to DCNB. Thus, at the level of sequence and activity, MdGST-1 is homologous to DmGST-1.

Our work supports the results of others in indicating that multiple members of the GST gene family are over- produced in the resistant Cornell-R strain, compared with the sensitive CSMA strain. We conclude that though MdGST-I is overproduced in Cornell-R, it is not the GST responsible for resistance.

We also observed that the relative amounts of the different GST isoenzymes in Cornell-R are controlled by a highly unstable mutation. Tripathi and O'Brien (1973), in their initial characterization of Cornell-R, re- ported that organophosphate insecticide (TCVP) resis- tance in this strain is highly unstable. We confirmed that observation in the current work with the isolation of the spontaneous TCVP-sensitive revertant of Cornell-R called Cornell-R*, and the isolation of a spontaneous hyperresistant variant of Cornell-R called Cornell-HR. We find in these three strains that as the level of TCVP resistance increases, so does the fraction of GST activity that is due to the DCNB substrate class. Comparison of the isogenic pair Cornell-R and Cornell-HR strongly supports the notion that the levels of at least two and possibly more GSTs are affected by the mutation that distinguishes this pair. For example, in Table 1 we see that in the conversion of Cornell-R to -HR, both the DCNB and CDNB GST activity increases. However, the same mutation causes a decrease in the MdGST-1

266

t ranscr ip t , as shown in Fig. 4. O u r results are in te rp re ted easily by pos i t ing tha t there a re at least two dif ferent m u t a t i o n a l events inf luencing the express ion o f the G S T isozymes in Corne l l -R , as was ini t ia l ly suggested by Op- p e n o o r t h et al. (1972). F i rs t , there is a re la t ively s table m u t a t i o n in Corne l l -R , re la t ive to the wi ld - type C S M A , tha t causes at least one m e m b e r o f the G S T gene fami ly to be ove rp roduced . The second m u t a t i o n in Corne l l -R is a h ighly uns tab le (ca. 10 -3 to 10 -4) event tha t is respons ib le for the in te rconvers ion a m o n g Corne l l -R* , -R and -HR. The second m u t a t i o n m a y be a t a n d e m dup l i ca t i on tha t ampli f ies one o f the G S T loci in Musca. We have di rec t evidence for an ampl i f i ca t ion o f one o f the G S T genes in the Sou the rn b lo t shown in Fig. 5. We can see a 1.6 kb EcoRI f r agmen t and a 8.4 kb PvuII f r agmen t tha t appea r s to be grea t ly ampl i f i ed in Cornel l - H R , c o m p a r e d with the " s e n s i t i v e " Corne l l -R*. This pa r t i cu l a r b a n d is miss ing in the wi ld - type C S M A , and we have no t ye t ident i f ied the o r t h o l o g o u s region f rom C S M A . Gene ampl i f i ca t ion has been seen before in resis- tance o f insects to insect ic ides: Mouches e t a l . (1986) have shown tha t res is tance to an insect icide in the mos- qui to corre la tes wi th an ampl i f i ed esterase k n o w n t o de tox i fy the insecticide.

Acknowledgment. This work was supported, in part, by a grant from the U.S. Army.

References

Askelof P, Guthenberg C, Jakobson I, Mannervick B (1975) Purifi- cation and characterization of two glutathione S-aryltransferase activities from rat liver. Biochem J 147:513-522

Board PG, Webb GC (1987) Isolation of a cDNA clone and local- ization of human glutathione S-transferase 2 genes to chromo- some band 6 p 12. Proc Natl Acad Sci USA 84:2377~381

Bradford MM (1976) Rapid and sensitive method for the quantita- tion of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-254

Clark AG, Dauterman WC (1982) Characterization by affinity chromatography of glutathione S-transferases from different strains of housefly. Pest Biochem Physiol 17:307-314

Clark AG, Shamaan NA (1984) Evidence that DDT-dehydrochlor- inase from the housefly is a glutathione S-transferase. Pest Bio- chem Physiol 22:249-261

Clark AG, Smith JN, Speir TW (1973) Cross specificity of some vertebrate and insect glutathione S-transferases with methyl parathion, CDNB and S-crotonyl-N-acetylcysteamine as sub- strates. Biochem J 135:385-392

Clark AG, Cropp P, Smith J, Speir T, Tan B (1976) Photometric determination of methyl parathion GSH S-methyl transferase. Pest Biochem Physiol 6:126 131

Clark AG, Shamaan NA, Dauterman WC, Hayaoka T (1984) Characterization of multiple glutathione S-transferases from the housefly, Musca domestica. Pest Biochem Physiol 22 : 51-59

Cochrane BJ, Morrissey JJ, LeBlanc GA (1987) The genetics of xenobiotic metabolism in Drosophila-IV. Insect Biochem 17:731-738

Grove G, Zarlengo RP, Timmerman KP, Li NQ, Tam MF, Tu CPD (1988) Characterization and heterospecific expression of cDNA clones of genes in the maize GSH S-transferase multi- gene family. Nucleic Acid Research 16:425-438

Habig WH, Pabst MJ, Jakoby WB (1974) Glutathione S-transfer- ases: the first enzymatic step in mercapturic acid formation. J Biol Chem 249 : 7130-7139

Iverson PL, Mata JE, Hines N (1987) Rapid isolation of both RNA and DNA from cultured cells or whole tissues with a benchtop ultracentrifuge. Biotechniques 5 : 521-524

Kano T, Sakai M, Muramatsu M (1987) Structure and expression of a human class ~ glutathione S-transferase messenger RNA. Cancer Res 47 : 5626 5630

LaRoche S, Leisinger T (1990) Sequence analysis and expression of the bacterial dichloromethane dehalogenase structural gene, a member of the glutathione S-transferase supergene family. J Bacteriol 172:164.171

MacDonald RJ, Swift GH, Przybyla AE, Chirgwin JM (1987) Iso- lation of RNA using guanidinium salts. Methods Enzymol 152: 224.226

Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York

Motoyama N, Dauterman W (1975) Interstrain comparison of glu- tathione-dependent reactions in susceptible and resistant hou- seflies. Pest Biochem Physiol 5 : 489-495

Motoyama N, Dauterman W (1977) Purification and properties of housefly glutathione S-transferase. Insect Biochem 7:361 369

Motoyama N, Dauterman W (1978) Mol weight, subunits and mul- tiple forms of GSTase from the housefly. Insect Biochem 8 : 337 348

Motoyama N, Dauterman W, Plapp FW Jr (1977) Genetic studies on glutathione-dependent reactions in resistant strains of the housefly. Pest Biochem Physiol 7:443-450

Mouches C, Pasteur N, Berge J, Hyrien O, Raymond M, Saint Vincent B, Silverstri M, Georghiou G (1986) Amplification of an esterase gene is responsible for insecticide resistance in the California Culex mosquito. Science 233:778-780

Oppenoorth F, Rupes V, E1 Bashir S, Houx N, Voerman S (1972) Glutathione-dependent degradation of parathione and its sig- nificance for resistance in the housefly. Pest Biochem Physiol 2:262 277

Oppenoorth F, Smissaert H, Welling W, van der Pas L, Hitman K (1977) Insensitive acetylcholinesterase, high glutathione S- transferase and hydrolytic activity as resistance factors in a TCVP-resistant strain of housefly. Pest Biochem Physiol 7:34- 47

Ottea JA, Plapp FW (1984) Gluthathione S-transferase in the house fly: biochemical and genetic changes associated with induction and insecticide resistance. Pest Biochem Physiol 22:203-208

Pickett CB, Lu AYH (1989) Glutathione S-transferases: Gene structure, regulation and biological function. Annu Rev Bio- chem 58:743 764

Plapp FW (1984) Genetic basis of insecticide resistance in the housefly. Pest Biochem Physiol 22:194-201

Smith DB, Davem KM, Board PG, Tiu WU, Garcia BG, Mitchell GR (1986) MR 26,000 antigen of Schistosomajaponicum recog- nized by resistant WEHI 129/J mice is a parasite glutathione S-transferase. Proc Natl Acad Sci USA 83:8703 8707

Tripathi R, O'Brien R (1973) Insensitivity of acetylcholinesterase as a factor in resistance in the housefly. Pest Biochem Physiol 2: 262-277

Tuong Y-PS, Hsieh T-S, Tu C-PD (1990) Drosophila glutathione S-transferase 1-1 shares a region of sequence homology with the maize glutathione S-transferase III. Proc Natl Acad Sci USA 87:31 35

C o m m u n i c a t e d by D.J . F i n n e g a n