molecular cloning and characterization of wdpks1, a gene ... · dermatitidis, verticillium dahliae,...

INFECTION AND IMMUNITY,0019-9567/01/$04.0010 DOI: 10.1128/IAI.69.3.1781–1794.2001

Mar. 2001, p. 1781–1794 Vol. 69, No. 3

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Molecular Cloning and Characterization of WdPKS1, a GeneInvolved in Dihydroxynaphthalene Melanin Biosynthesis and

Virulence in Wangiella (Exophiala) dermatitidisBIN FENG,1 XU WANG,1 MELINDA HAUSER,2 SARAH KAUFMANN,2 SIMONE JENTSCH,3

GERHARD HAASE,3 JEFFERY M. BECKER,2 AND PAUL J. SZANISZLO1*

Section of Molecular Genetics and Microbiology, Institute for Cellular and Molecular Biology, The University of Texasat Austin, Austin, Texas 787121; Microbiology Department, University of Tennessee, Knoxville, Tennessee 379192;

and Institute of Medical Microbiology, University Hospital RWTH Aachen, Aachen, Germany3

Received 21 September 2000/Returned for modification 11 October 2000/Accepted 17 November 2000

1,8-Dihydroxynaphthalene (1,8-DHN) is a fungal polyketide that contributes to virulence when polymerizedto 1,8-DHN melanin in the cell walls of Wangiella dermatitidis, an agent of phaeohyphomycosis in humans. Tobegin a genetic analysis of the initial synthetic steps leading to 1,8-DHN melanin biosynthesis, a 772-bp PCRproduct was amplified from genomic DNA using primers based on conserved regions of fungal polyketidesynthases (Pks) known to produce the first cyclized 1,8-DHN-melanin pathway intermediate, 1,3,6,8-tetrahy-droxynaphthalene. The cloned PCR product was then used as a targeting sequence to disrupt the putativepolyketide synthase gene, WdPKS1, in W. dermatitidis. The resulting wdpks1D disruptants showed no morpho-logical defects other than an albino phenotype and grew at the same rate as their black wild-type parent. Usinga marker rescue approach, the intact WdPKS1 gene was then successfully recovered from two plasmids. TheWdPKS1 gene was also isolated independently by complementation of the mel3 mutation in an albino mutantof W. dermatitidis using a cosmid library. Sequence analysis substantiated that WdPKS1 encoded a putativepolyketide synthase (WdPks1p) in a single open reading frame consisting of three exons separated by two shortintrons. This conclusion was supported by the identification of highly conserved Pks domains for a b-ketoacylsynthase, an acetyl-malonyl transferase, two acyl carrier proteins, and a thioesterase in the deduced amino acidsequence. Studies using a neutrophil killing assay and a mouse acute-infection model confirmed that allwdpks1D strains were less resistant to killing and less virulent, respectively, than their wild-type parent.Reconstitution of 1,8-DHN melanin biosynthesis in a wdpks1D strain reestablished its resistance to killing byneutrophils and its ability to cause fatal mouse infections.

The zoopathogenic fungus Wangiella (Exophiala) dermatiti-dis is one of many form species of the Fungi Imperfecti, whichare darkly pigmented (dematiaceous) owing to the depositionof 1,8-dihydroxynaphthalene (1,8-DHN) melanin in their cellwalls (22, 45). This fungus has recently become better knownas a paradigm for the causative agents of phaeohyphomycosisand other emerging dermatomycoses of humans, because of itsincreasing detection as a systemic pathogen in both immuno-competent and immunocompromised patients (34, 35). More-over, because W. dermatitidis has a well-defined polymorphicnature and a well-characterized cell wall chemistry, it serves asan excellent model for the more than 100 other dematiaceousfungal pathogens of humans (14, 37, 42).

Although dark pigments of fungi are often called melaninwithout regard to mode of enzymatic synthesis or chemicalcomposition, most syntheses of melanin are attributed to eithera phenoloxidase, e.g., laccases and tyrosinases, or a polyketidesynthase (Pks) of a pentaketide biosynthetic pathway (52). Thephenoloxidases have been found mostly among basidiomycetefungi and are usually composed of soluble enzymes with broadsubstrate specificities (9, 33). In contrast, the pentaketide path-way that leads to 1,8-DHN melanin biosynthesis is mostly as-

sociated with known or suspected ascomycetes and is verysubstrate specific (4). Also, while these two kinds of melaninsare not essential for fungal growth, they have been docu-mented to have relevance to virulence in W. dermatitidis (15–18, 41) and Cryptococcus neoformans (7, 30) as well as in manyphytopathogenic fungi, including Colletotrichum lagenarium (26),Magnaporthe grisea (10, 54), and Alternaria alternata (25). In ad-dition, disruption of the polyketide synthase gene alb1 of Aspergil-lus fumigatus reduces its virulence by inhibiting conidial pigmen-tation, although the end product of the pentaketide pathway inthis human pathogen is probably not 1,8-DHN melanin (46).

Using the specific pathway inhibitor tricyclazole, metaboliccross-feeding, and melanin-deficient (Mel2) mutants with le-sions producing either albino (mel3 and mel4) or brown (mel1and mel2) phenotypes, the first pentaketide, 1,3,6,8-tetrahy-droxynaphthalene (1,3,6,8-THN), synthesized in the 1,8-DHNmelanin pathway in W. dermatitidis was shown to be convertedthrough a series of intermediates to 1,8-DHN (13, 22). Theenzymatic steps involved consisted of two alternating dehydra-tions and reductions, i.e., reduction of the 1,3,6,8-THN toscytalone, dehydration of scytalone to 1,3,8-trihydroxynaphtha-lene (1,3,8-THN), reduction of 1,3,8-THN to vermelone, anddehydration of vermelone to 1,8-DHN; the 1,8-DHN is thenoxidized and polymerized to yield 1,8-DHN melanin. Biochem-ical analysis of the dehydratases and reductases of the melaninpathway has been reported for the enzymatic activities from W.

* Corresponding author. Mailing address: Section of Molecular Ge-netics and Microbiology, School of Biological Sciences, University ofTexas at Austin, Austin, TX 78712. Phone: (512) 471-3384. Fax: (512)471-7088. E-mail: [email protected].

1781

on January 6, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

dermatitidis, Verticillium dahliae, Cochliobolus miyabeanus andM. grisea (4, 22, 43, 47, 51, 53). In general, most studies of thepathway leading to 1,8-DHN-melanin biosynthesis have beenoriented toward its downstream genes and enzymes and not tothe synthesis of the first pentaketide, 1,3,6,8-THN, which ap-pears to be made by a Pks either from malonyl coenzyme A(malonyl-CoA) exclusively or from malonyl-CoA together withacetyl-CoA (19, 21).

In this study, a gene (WdPKS1) that encodes a putativepolyketide synthase (WdPks1p) of W. dermatitidis was cloned,sequenced, and disrupted. The WdPKS1 gene contained a sin-gle open reading frame, consisting of three exons separated bytwo short introns. The predicted WdPks1p consisted of 2,177amino acids and showed significant similarities with otherpolyketide synthases, but particularly those encoded by the pksgene of C. lagenarium, the alb1 gene of A. fumigatus, and thewA gene of Aspergillus nidulans (8, 44, 46). The derived proteinalso contained sequences for the highly conserved b-ketoacylsynthase, acetyl-malonyl transferase, acyl carrier protein (ACP),and thioesterase domains, which are all characteristic of a typeI polyketide synthase (23). Disruption of WdPKS1 producedstrains that had albino phenotypes, which strongly indicatedthat WdPKS1 was involved in 1,8-DHN melanin biosynthesis.Support for this hypothesis was provided by precursor feedingstudies and also by complementation experiments that remela-nized the albino wdpks1D-1 mutant, as well as mutants de-scribed previously (13) with mel3 lesions, but not those withmel4 lesions. When tested in human neutrophils or in an acutemouse model, the albino wdpks1D mutants were less resistantto neutrophil killing and less virulent, respectively, than theirwild-type parent, as was found previously for other Mel2 mu-tants of W. dermatitidis tested similarly (18, 41). The impor-tance of WdPKS1 to virulence was further supported by show-ing that the disruptants had no growth rate defects or othermorphological abnormalities. Furthermore, reconstruction of1,8-DHN melanin biosynthesis in the wdpks1D-1 mutant bycomplementation with WdPKS1 reestablished its ability to re-sist killing by human neutrophils and to cause fatal mouseinfections.

MATERIALS AND METHODS

Strains and media. The laboratory wild-type strain of W. dermatitidis 8656(ATCC 34100 [Exophiala dermatitidis CBS 525.76]) and the melanin mutantsMel1 (mel1; ATCC 44502), Mel2 (mel2; ATCC 44503), Mel3 (mel3-1; ATCC44504), Mel4 (mel3-2; ATCC 58058), and Mc2w-3 (cdc1 mel4 arg1) have beenextensively described (11, 12, 13, 15, 22). Routine propagation of these strainswas in the rich medium YPD (2% peptone, 1% Bacto Yeast extract, and 2%dextrose), and all transformations were carried out as previously described (49,58). For the precursor cross-feeding experiments with melanin mutants and forthe scytalone (kindly provided by M. H. Wheeler, Texas A&M University, Col-lege Station) and acetate feeding experiments, strains were grown on modifiedCzapek-Dox (MCD) agar (11, 13, 22,). For long-term storage, all strains werestored deep frozen (270°C) in 25% glycerol. Strains cultured for neutrophilexperiments were plated on Sabouraud dextrose agar (SDA) (Oxoid, Wesel,Germany) and incubated at 37°C for 4 days. One colony of the growing yeast wasthen suspended in 30 ml of Sabouraud broth (Oxoid) and incubated at 37°C for7 days to late stationary phase in a tissue culture flask. Escherichia coli XL1-Blue(Stratagene, La Jolla, Calif.), which was used for the subcloning and plasmidpreparation, was grown in Luria-Bertani (LB) medium supplemented with am-picillin (100 mg/ml) or chloramphenicol (25 mg/ml).

Preparation and analysis of nucleic acid. Genomic DNA of W. dermatitidiswas isolated by spheroplasting with Zymolase-20T (ICN Biomedicals, Inc., Au-rora, Ohio) followed by detergent lysis, phenol-chloroform extraction, and eth-anol precipitation as previously described (55). Total RNA was isolated by the

FIG. 1. (A) Predicted structure for the integration of pBF9 at theWdPKS1 locus. The 772-bp PCR product of WdPKS1 was used as atarget sequence to disrupt the gene. The whole gene was then clonedby a marker rescue method. The two rescued plasmids pBF10 andpBF32 are also shown. The arrow labeled WdPKS1 indicates the po-sition of the gene and the direction of its transcription. Prior to trans-formation, pBF9 was linearized with SacII. (B) Southern hybridizationanalysis of five transformants in which pBF9 was integrated into the W.dermatitidis genome. Genomic DNA of wild type; albino transformants1, 2, and 3; and black transformants 4 and 5 (lanes 6 and 1 to 5,respectively) was extracted, digested with XhoI, fractionated on a 0.9%agarose gel, and subjected to Southern blotting analysis using the772-bp WdPKS1 PCR fragment as a probe. Albino transformants 1, 2,and 3 showed hybridization consistent with site-specific integration ofpBF9 into the WdPKS1 locus, whereas the plasmid was ectopicallyintegrated at different genomic positions in black transformants 4 and5.

1782 FENG ET AL. INFECT. IMMUN.


.org/D

ownloaded from

http://iai.asm.org/

hot phenol method (1). Southern and Northern blotting were performed usingstandard methods (1). DNA fragments (25 ng) used for probes in Southern andNorthern analysis were labeled with [32P]dATP by using a Prime-a-Gene kit(Promega, Madison, Wis.). Plasmids with WdPKS1 fragments were sequenced bythe Institute for Cellular and Molecular Biology of The University of Texas atAustin using an ABI Prism 377 Sequencer. Sequence analysis was performedusing Wisconsin Package G software (Genetics Computer Group, Inc., Madison,Wis.). The 772-bp PCR fragment of WdPKS1 was amplified from genomic DNAusing primers PKS-1 (59 TGAATTCGACACGGCCTGTTCA/CTCCA 39) andPKS-2 (59 ACATATGGCGGCACTGAAGTTGTTGA 39). The PCRs were per-formed as described previously (48). The primers used for reverse transcription(RT)-PCR were RT-PKS1 (59 CGTCCACTCGCTCACACTCT 39), RT-PKS2(59 ACCGACTAGTCGAGCAT 39), RT-PKS9 (59 GGGTGCTGAAGTCTGTAAA 39), and RT-PKS10 (59 TCCCTCTGTGTCGAGAAT 39). First-strandsynthesis of the cDNA was achieved using SuperScript II reverse transcriptase(Life Technologies Inc., Rockville, Md.) according to the instructions of themanufacturer. PCR amplification of the first strand synthesized was for 35 cyclesas follows: premelt, 94°C for 5 min; denaturation, 94°C for 1 min; hybridization,50°C for 2 min; and extension, 72°C for 3 min (10 min on the last cycle). For therescue of fragments flanking the WdPKS1 transgene insertion, DNA from thewdpks1D-1 clone was digested to completion with appropriate restriction en-zymes and diluted to #1 mg/ml to favor intramolecular ligation with T4 DNA

ligase (New England Biolabs Inc., Beverly, Mass.). After transfection of E. coliXL1-Blue (Stratagene) by electroporation using a Gene Pulse apparatus (Bio-Rad Laboratories, Richmond, Calif.), plasmids were isolated from chloramphen-icol-resistant colonies.

Plasmid construction. Plasmid pBF5 was constructed by ligating a WdPKS1,772-bp PCR fragment into pGEM-T vector (Promega). The WdPKS1 disruptionplasmid pBF9 (see Fig. 1A) was constructed by inserting the 800-bp ApaI-SalIfragment containing the PCR product of WdPKS1 from pBF5 into pCB1004(provided by J. Sweigard, DuPont Co., Wilmington, Del.), which is a pBluescriptSK(1)-based vector that contains the hygromycin phosphotransferase gene(hph) from E. coli, which confers resistance to hygromycin B (HmB), and thetryptophan synthase (trpC) promoter from A. nidulans (6). The complementationplasmid pBF50 (see Fig. 5A) was constructed by ligating the ApaI- and NotI-digested plasmid pCB1532 (provided by Kevin McCluskey, Fungal GeneticsStock Center, Kansas City, Kans.), which is a pBluescript SK(1)-based vectorthat contains a surfonyl-urea (SUR) resistance gene, with both the ApaI-AclIfragment from pBF10 and the AclI-NotI fragment from pBF32. Plasmid pMO-cosX (provided by Marc J. Orbach, University of Arizona, Tucson, and DuPontExperimental Station, Wilmington, Del.), which contains cos sites from bacte-riophage l, and plasmid pCB1004, which contains a bacterial origin, a bacterialchloramphenicol resistance gene, and the hph gene, were used to construct thecosmid vector pCB1004cos. The XbaI site in plasmid pCB1004 was removed to

FIG. 2. Characterization of the melanin defect in wdpks1D-1 by comparisons with other Mel2 strains. (A) Diffusion cross-feeding by Mel2(mel2): wdpks1D-1 was streaked close to Mel2 on MCD agar (note blackening of wdpks1D-1 at arrow). (B) Precursor feeding with scytalone: lawnof wdpks1D-1 was first grown on MCD agar for a few days, after which time a few drops of scytalone solution was added to the resulting growthat one point (note blackening of wdpks1D-1 at arrow). (C) Contact cross-feeding by Mc2w-3 (mel4): wdpks1D-1 was cross-streaked from top tobottom through a streak of Mc2w-3 on MCD agar (note blackening region of the wdpks1D-1 streak where the Mc2w-3 [mel4] cells and wdpks1D-1cells were mixed and thus were in intimate contact). (D) Effect with acetate: cultures of wdpks1D-1 and strains with either a mel3 or mel4 lesionwere streaked on MCD agar with 1% (wt/vol) potassium acetate (note that only Mc2w-3 [mel4] is black, indicating lack of identity with Mel3 [mel3]and wdpks1D-1).

VOL. 69, 2001 CLONING AND CHARACTERIZATION OF WdPKS1 1783


.org/D

ownloaded from

http://iai.asm.org/

produce the plasmid pCB1004DXbaI. A 2.9-kb DNA fragment in plasmidpMOcosX, which contains the l bacteriophage cos sequence, was released byClaI and BamHI double digestion and was inserted into pCB1004DXbaI toproduce the new cosmid vector pCB1004cos.

Construction of cosmid library. A genomic cosmid library of W. dermatitidiswas constructed using pCB1004cos by the method of Osiewacz (38). After di-gesting pCB1004cos with XbaI and dephosphorylating the cohesive ends usingcalf intestine alkaline phosphatase (Promega), the linearized plasmid wascleaved with BamHI to produce two cosmid arms. The cosmid arms were thenligated to DNA fragments generated from high-molecular-weight genomic DNA(;150 kb) of W. dermatitidis wild-type 8656 (concentration, 100 mg/ml), whichhad been partially digested with Sau3AI to generate fragments of 40 to 50 kb,recovered by ethanol precipitation, and resuspended in double-distilled H2O.Incubation of the ligation reaction mixture was for 16 h at 16°C in a total volumeof 10 ml, using 5 mg of partially digested genomic DNA and 1 mg of the twocosmid arms. The reaction products were then used immediately for in vitropackaging, which together with the determination of the titer of the cosmidpackaging reaction mixture was carried out according to the instruction manualfrom the Gigapack III XL packaging kit (Stratagene Inc.). The resulting library,consisting of about 5 3 104 colonies, was pooled and stored in 25% glycerol at270°C, prior to use in experiments designed to rescue Mel2 mutants by comple-mentation.

Measuring of phagocytosis and oxidative burst by flow cytometry. To assessphagocytosis, sedimented (3,000 3 g at 4°C for 5 min) and washed (in 5 ml ofsterile 0.9% [wt/vol] NaCl) yeast cells from SDA broth (5 ml) were incubatedwith bis-carboxyethyl-carboxyfluorecein-pentaacetoxy-methylester (BCECF-AM) (final concentration, 1 mmol/liter; Roche Biochemicals, Mannheim, Ger-many) for 30 min at 37°C in phosphate-buffered saline (PBS) (1 ml) as previouslydescribed (40, 41). The labeled cells (5 3 106) were then incubated at 37°C fora maximum of 120 min with 1 ml of heparinized (10 units of heparin [as definedby the German Pharmacopeia]/ml [equivalent to ca. 5 units of heparin {asdefined by the U.S. Pharmacopeia}/ml]) whole blood from healthy donors in aThermomixer (Eppendorf, Hamburg, Germany) at 1,000 rpm. At 0, 10, 30, and60 min, samples (100 ml) were removed and immediately mixed with 2 ml ofice-cold lysis buffer (Becton Dickinson, Heidelberg, Germany) to lyse the eryth-rocytes, and then after 2 h, leukocyte and yeast cell isolations were carried out bycentrifugation (10 min, 4°C, 1,300 rpm; Beckman GS-6R centrifuge). After beingwashed twice in ice-cold PBS, cells were resuspended in PBS (500 ml) andanalyzed by flow cytometry, using a FACScan flow cytometer (Becton Dickinson)and Cellquest (Becton Dickinson) software (40, 41). Instruments setting, linearparameters for forward and side scatter, and logarithmic parameters for FL1 andFL2 with the best test performance were revealed to be the same as those setpreviously for experiments with W. dermatitidis and its melanin-deficient mutants(41). Oxidative burst was assessed during the phagocytosis by incubation ofunlabeled yeast cells in heparinized blood under conditions identical to thosedescribed above. Dihydrorhodamine (DHR) (Molecular Probes, Eugene, Oreg.)was added to samples at a final concentration of 10 mg/liter as described previ-ously (41). The association of neutrophils with the labeled yeast cells and theoxidative burst of the neutrophils induced by unlabeled yeast cells in the pres-ence of DHR were detected by an increase in fluorescence of the neutrophils.The increased fluorescence signal was expressed as a percentage of nonfluoresc-ing neutrophils.

Neutrophil killing assay. For quantification of killing by human neutrophils,yeast cells of the strains tested were diluted in PBS to 103 to 104 CFU per ml. Thediluted cells (100 ml) and fresh heparinized human blood (900 ml) were thenmixed and rotated at 37°C for 4 h. Initial viable counts and cell counts weredetermined after 10 min and after 1, 2, 3, and 4 h of rotation by plating samplesof yeast cells either undiluted (20 ml) or after dilution with 180 ml of PBS (20 ml)on SDA.

Microscopy. To ensure the intracellular location of the yeast cells associatedwith the neutrophils, representative samples used for determination in flowcytrometry were examined by epifluorescence interference contrast microscopy(Leitz DM RB microscope; Leica, Wetzlar, Germany) as described previously(40, 41). From three independent assays of each strain studied, we examined 300yeast cells with respect to their association with the neutrophils at the beginning,after 30 min, and after 60 min of incubation in heparinized blood.

Virulence studies with mice. Test strains (wdpks1D-1, wdpks1D-2, wdpks1D-3,the wild type, and the complemented strains 501 and 502) of W. dermatitidis werecultured in YPD (5 ml) overnight at 30°C with shaking. An aliquot of theovernight culture was used to inoculate 50-ml YPD cultures, which were thengrown overnight to mid-log phase. Yeast cells were harvested, washed threetimes with sterile water, counted on a hemacytometer, and diluted to a final

density of 9 3 107 cells/ml. Virulence of the strains was then tested in animmunocompetent (normal) mouse model system. Male ICR mice (22 to 25 g;Harlan Sprague-Dawley) were housed five per cage; food and water were sup-plied ad libitum, according to National Institutes of Health guidelines for the

FIG. 3. Mapping and sequence analysis of the WdPKS1 gene andRT-PCR confirmation of the WdPKS1 introns. (A) Map of the WdPKS1gene. The hatched box represents the 772-bp PCR product and the probeused for Southern and Northern analysis. The start codon (ATG) and thestop codon (p) are indicated in the map. (B) RT-PCR confirmation ofintrons. Total RNA was isolated and cDNA was synthesized as describedin Materials and Methods. Primers PKS1 and PKS2 were used for am-plification of the WdPKS1 fragment from cDNA (lane A3) and genomicDNA (lane A2). The band shift from 500 bp of cDNA PCR product toclose to 600 bp of genomic DNA PCR product suggested the existence ofan intron between primers PKS1 and PKS2. Primers PKS9 and PKS10were used for amplification of WdPKS1 fragment from cDNA (lane B2)and genomic DNA (lane B1). The band shift from 200 bp of cDNA PCRproduct to close to 250 bp of genomic DNA PCR product suggested theexistence of an intron between primers PKS9 and PKS10. DNA standards(1-kb ladder) are shown in lane 1 in subpanel A and lane 3 in subpanel B.(C) Multiple protein sequence comparisons by CLUSTAL analysis of fourtype I fungal polyketide synthases. The type I fungal polyketide synthasescompared were those encoded by WdPKS1 of W. dermatitidis (WdPks1p),wA of A. nidulans (AnPks; GenBank accession no. X65866), of A. fumiga-tus (AfPks; GenBank acession no. AF025541) and pks1 of C. lagenarium(C1Pks; PIR accession no. S60224). Symbols in the consensus line: p,identical residues in all sequences in the alignment; :, conserved substitu-tions; ., semiconserved substitutions. The numbers at the right representthe number of amino acids depicted from the first methionine of eachderived protein.



.org/D

ownloaded from

http://iai.asm.org/

FIG. 3—Continued.



.org/D

ownloaded from

http://iai.asm.org/

ethical treatment of animals. Mice (10 per yeast strain) were inoculated via thelateral tail vein with 100 ml of the cell suspension (9 3 107 cells/ml), such thateach mouse received a final dose of 9 3 106 cells. To determine the number ofviable yeast forms injected into each mouse, an aliquot of the suspension used forinjection was diluted and plated in top agar (0.1% Noble agar) onto YPD plates.The plates were incubated at 30°C for 48 to 72 h, and percent viability wasdetermined. Mice were checked three times daily for survival or signs of infectionup to 13 days. Visible signs of infection were torticollis, ataxia, or lethargy.Infected mice were considered moribund when they were unable to access foodor water. Moribund mice were humanely sacrificed by cervical dislocation underanesthesia.

Statistics. Differences in the extent of phagocytosis and oxidative burst exhib-ited by the neutrophils and the killing of the W. dermatitidis wild-type strain, theisogenic wdpksD mutants, and complemented revertants were evaluated by thenonparametric Mann-Whitney U test for unpaired samples (P , 0.005). Survivalfractions in virulence tests were calculated by the Kaplan-Meier method, andsurvival curves were tested for significant difference (P , 0.01) by the Mantel-Haeszel test using GraphPad Prism software (version 3.00 for Windows). Prob-ability values of ,0.05 were considered significant.

Nucleotide sequence accession number. The nucleotide sequence of theWdPKS1 gene was assigned GenBank accession no. AF 130309.

RESULTS

Disruption of WdPKS1 using a PCR product for gene tar-geting produced albino strains. PCR primers having a designbased on fungal Pks conserved regions allowed amplification ofa 772-bp PCR product from genomic DNA of W. dermatitidis,which was then cloned, sequenced, confirmed by sequencesimilarity to encode a putative polyketide synthase (WdPks1p),and used to produce the disruption plasmid pBF9 (Fig. 1A).Among 53 HmB-resistant transformants obtained after elec-troporation of pBF9 linearized with SacII, five were albino,suggesting, as expected, that WdPKS1 encoded a Pks involvedin melanin biosynthesis. Southern analysis of three albinotransformants (wdpks1D-1, wdpks1D-2, and wdpks1D-3) andtwo melanized transformants (211 and 212), using the 772-bpWdPKS1 PCR fragment as a probe, showed that the WdPKS1-hybridized DNA band was suitably shifted from a wild-typeposition of 4.1 kb to a disruptant position of 10 kb amongXhoI-digested fragments (Fig. 1B). These results confirmedthat the albino phenotype of the transformants was due tosite-specific integration and disruption of WdPKS1, whereasthe bands larger than 4.1 kb in strains 211 and 212 wereindicative of ectopic plasmid integrations.

Diffusion cross-feeding experiments showed that albinowdpks1D-1 became blackened and produced melanin whencross-fed by 1,8-DHN melanin precursors produced by thebrown strains Mel1 (data not shown) and Mel2 (Fig. 2A) orwith the purified melanin biosynthetic pathway intermediate,scytalone (Fig. 2B). These experiments also showed that novisible intermediates were secreted into the medium on which

the wdpks1D-1 disruption strain was grown. Thus, WdPks1p isinvolved in a step before 1,3,6,8-THN reductase functions toproduce the compound scytalone or before an oxidase converts1,3,6,8-THN to the colored shunt product flaviolin (53) andconsequently likely participates in the production of 1,3,6,8-THN itself. In W. dermatitidis this process is thought to involvetwo steps, which are defined by the mutations mel3 and mel4(13). Therefore, additional experiments using standard proto-cols (13) were carried out to determine whether strains witheither the mel3 or the mel4 lesion could be distinguished fromthe disruption strain wdpks1D-1. From the results of the con-tact cross-feeding experiment with strains having the mel3 mu-tation (data not shown) or the mel4 mutation (Fig. 2C) andfrom the acetate feeding experiment (Fig. 2D), wdpks1D-1 wasclearly distinguished from the latter (mel4) but not the former(mel3), suggesting for the first time that the mel3 lesion wasdue to a mutation in WdPKS1.

Cloning of WdPKS1 by a marker rescue approach and bycosmid complementation of the mel3 mutation. Plasmid pBF10carrying the 59 end of WdPKS1 was recovered by digesting

FIG. 4. Alignment of WdPks1p active sites with those of other typeI polyketide synthases by using CLUSTAL analysis. Conserved activesite residues important for enzyme function are in boldface letters andtheir functions are indicated at left (there is no report on the active siteresidue in the thioesterase domain). Consensus line symbols are de-scribed in the legend to Fig. 3C.

FIG. 3—Continued.



.org/D

ownloaded from

http://iai.asm.org/

genomic DNA of wdpks1D-1 with KpnI and then allowing self-ligation in dilute solution. The 12-kb plasmid, pBF10, was thenrescued by transformation of E. coli, and the 59 end of the genewas cloned (Fig. 1A). Using the same strategy, the 39 end ofWdPKS1 was also recovered in a 13-kb rescue plasmid, pBF32,through SpeI digestion (Fig. 1A).

The WdPKS1 gene was also simultaneously cloned indepen-dently by cosmid cloning during a search for other melaninbiosynthetic genes. After the cosmid library DNA was used totransform several W. dermatitidis Mel2 albino strains, includ-ing Mc2w-3 (cdc2 mel4 arg1), Mel1 (mel1), Mel3 (mel3-1), andMel4 (mel3-2), the transformants were selected on hygromy-cin-containing media. Although over 400 HmB-resistant trans-formants were obtained with these strains, only one black,

putatively complemented strain was obtained out of the nearly100 transformants of Mel4 (mel3-2).

The transforming cosmid responsible for the reversion of themel3-2 mutation in strain Mel4 was recovered by in vitro lpackaging of undigested genomic DNA, followed by transduc-tion of E. coli as described by Yelton et al. (56). As expected,retransformation of Mel3 (mel3-1) and Mel4 (mel3-2) with thecosmid caused most transformants of these two strains to re-gain melanin production capability (data not shown). PCRanalysis using primers for WdPKS1 yielded a 772-bp product,which was consistent with the possibility that WdPKS1 wascontained in the cosmid (now called cos-Mel3) and was re-sponsible for complementing the mel3 lesions in strains Mel3and Mel4 (data not shown).

FIG. 5. Strategy for reconstitution of 1,8-DHN melanin biosynthesis in wdpks1D-1 with the cloned WdPKS1 gene and Southern blot analysisof the WdPKS1-complemented strains in the wdpks1D-1 background. (A) The sequences that would be detected by the 772-bp PCR product usedas the probe are shown as dotted lines in the resulting locations. The location of the restriction sites for EcoRI, EagI, and XhoI used in the Southernblot analysis are also indicated. (B) Genomic DNA from the wild-type strain (w.t.) the wdpks1D-1 strain (D1), and the putative wdpks1D-1-complemented strains 501 and 502 (reconstituted melanin transformants) was digested by EagI (lanes 1 to 4), EcoRI (lanes 5 to 8), and XhoI (lanes9 to 12), respectively.



.org/D

ownloaded from

http://iai.asm.org/

WdPKS1 encodes a type 1 Pks. Restriction enzyme mappingof the cloned inserts in pBF32 and pBF10 (Fig. 3A) and com-parisons with the map of the cos-Mel3 (data not shown) con-firmed that WdPKS1 had been cloned independently by twomethods. Therefore, only the two rescued WdPKS1 gene frag-ments in pBF32 and pBF10 were completely sequenced after aseries of subclonings. A single open reading frame was de-duced for WdPKS1 and found to encode 2,177 amino acids.Two putative introns (279 to 337 bp and 6540 to 6596 bp) werealso identified in WdPKS1, which were confirmed by RT-PCR(Fig. 3B), and by sequence analysis of the RT-PCR products(data not shown). The deduced amino acid sequence showed46.8, 45.7 and 44.9% identity to pks1 of C. lagenarium, alb1 ofA. fumigatus, and wA of A. nidulans, respectively (Fig. 3C),further indicating that the cloned gene encoded a polyketidesynthase. Northern analysis showed constitutive expression ofWdPKS1 (data not shown).

Because eukaryotic Pks are generally thought to be largemultifunctional proteins (type I Pks) (23), the predicted aminoacid sequence was investigated further. The b-ketoacyl syn-thase, acetyl-malonyl transferase, and two ACP and thioester-ase domains usually found within a type I Pks were all identi-fied (Fig. 4). The putative WdPks1p also showed completeconservation of the putative active site cysteine residue of theb-ketoacyl synthase, the active site serine residue of the acetyl-malonyl transferase, and the pantotheine-binding serine resi-due of the ACP (3, 8, 20, 31, 36, 44, 57), which provided furtherevidence that WdPKS1 was a type I Pks.

Reconstitution of melanin biosynthesis. To confirm that thealbino phenotype was not due to secondary, hidden muta-tions, melanin biosynthesis in the albino strain, wdpks1D-1,was reconstituted by integration of WdPKS1 into its genomeat the WdPKS1 endogenous site. This was accomplished withthe vector pBF50 constructed by subcloning and ligating the59 end of the gene from pBF10 to the 39 end of the genefrom pBF32 in vector pCB1532, which contained the sulfo-nyl-urea (SUR) and the ampicillin (amp) resistance genesfor selection in W. dermatitidis and E. coli, respectively.Plasmid pBF50 (Fig. 5A), which contained the full-lengthWdPKS1 with its endogenous promoter, was then trans-

formed without being linearized into wdpks1D-1 by electro-poration. Among the resulting SUR-resistant transformants,2 of 11 were restored to melanin synthesis (data not shown).Southern analysis of the two complemented strains showedthe expected DNA band shifts (Fig. 5B), which confirmedthat the cloned WdPKS1 had integrated into the 59 portionof the disrupted WdPKS1 gene.

To ensure that any differences detected in susceptibility tokilling by neutrophils or loss of virulence in mice was due onlyto loss of melanin in the wdpksD mutants, the growth rates ofwdpksD-1, wild-type 8656, and the WdPKS1-complementedstrain 501 were also compared in rich YPD (Fig. 6). The resultsconfirmed that wdpks1D-1 grew at the same rate as the wild-

FIG. 6. Comparison of the growth rates at 25 and 37°C of W.dermatitidis 8656 (wild type [wt]), its wdpks1D-1 mutant (wdpks1D),and the WdPKS1-complemented strain of wdpks1D-1 (501) in YPDmedium. Late log-phase cultures were transferred to YPD medium toa final concentration of 105/ml to initiate the experiment. Cell numberswere measured microscopically by hemacytometer counting. FIG. 7. Kinetics of phagocytosis of W. dermatitidis by human neu-

trophils as determined by flow cytometry. The data indicate the in-creases in relative fluorescence (y axis) of the neutrophils after asso-ciation for 0, 10, 30, and 60 min with each respective BCECF-AM-labeled W. dermatitidis strain. The mean values 1 standard deviations(error bars) of three independent assays are displayed. wt, wild type.

FIG. 8. Kinetics of oxidative burst evoked by phagocytized W. der-matitidis as determined by flow cytometry. The data indicate the rel-ative fluorescence (y axis) of neutrophils exhibiting an oxidative burstafter the phagocytosis of nonlabeled yeast cells in the presence ofDHR for 0, 10, and 30 min. The mean values 1 standard deviations(error bars) of three independent assays are displayed. wt, wild type.



.org/D

ownloaded from

http://iai.asm.org/

type 8656 and as the WdPKS1-complemented strain 501, bothat 25°C (generation time, 3.3 h) and 37°C (generation time,2.8 h). Microscopic comparisons of these strains with the wildtype grown identically also showed no apparent morphologicaldifferences (data not shown).

Fluorescence staining of W. dermatitidis and phagocytosis byhuman neutrophils. Staining of the W. dermatitidis strains byincubation for 30 min in PBS containing 1 mmol of BCECF-AMper liter resulted in a stable green fluorescence in the parentstrain and all of its isogenic mutants and complemented strains(501 and 502) (data not shown). Although the darkly pig-mented, wild-type strain and the respective complementedstrains exhibited a slightly lower level of green fluorescencecompared to the albino wdpks1D-1 mutant (data not shown),accurate quantitative comparisons of the rates of phagocytosisby the human neutrophils of the strains were still possible. Theresults showed that phagocytosis by the neutrophils was essen-tially the same for all the strains during three independentassays (Fig. 7). By 10 min of coincubation, .98% of yeast cellsof all the strains were localized within the phagocytes as judgedby microscopy. No significant difference with respect to theproportion of budding yeast cells in relation to their extracel-lular or intracellular location was observed by epifluorescenceinterference contrast microscopy (data not shown), which sug-gested that a good correlation existed between the flow cyto-metric assay and microscopic observations.

Oxidative burst evoked by and killing of W. dermatitidis inhuman neutrophils. Phagocytosis of yeast cells was paralleledby an oxidative burst in the phagocytosing neutrophils, as sug-gested by the increased fluorescence detected by flow cytom-etry. In no case was a significant difference in oxidative burstsdetected among the responses evoked after neutrophil phago-cytosis of the wild-type strain 8656, the mutant wdpks1D-1, and its

respective complemented strain 501 (Fig. 8). In contrast, thewdpks1D mutants were considerably more susceptible to killingby the neutrophils than the melanized strains (Fig. 9). In everycase, the killing of the melanin-deficient mutants was signifi-cantly greater (P , 0.005) after 120, 180, and 240 min ofcoincubation with whole blood compared to the wild-typestrain 8656 and the respective complemented strains. How-ever, no differences were detected among the rates of killing ofthe three wdpks1D mutants tested in five independent experi-ments (Fig. 9).

Disruption of WdPKS1 causes loss of virulence in mice.Animal studies were carried out to compare the degrees ofvirulence of the wild type, the wdpks1D disruptants, and theWdPKS1-complemented strains. In at least three independentexperiments, mice injected with the wdpks1 disruptants showeda dramatic reduction in mortality compared to that of the wildtype and the WdPKS1-complemented strains. Lethality in miceinfected with strain 8656 began on days 4 and 5, with mortalityrates of 90 to 100% by days 6 and 7 (Fig. 10). In contrast, miceinjected with the wdpks1 disruptants showed only 0 to 10%mortality at the end of the experiments (day 13). However, theWdPKS1-complemented strains all recovered full virulence;mortality started on day 5 and reached 70 to 80% by thetermination date (Fig. 10). In addition, the Mel4 (mel3-2)cos-WdPKS1-complemented strain was also found to have re-covered full virulence (data not shown).

DISCUSSION

Prior studies have strongly indicated that virulence of dema-tiaceous fungi is influenced by the presence of 1,8-DHN mel-anin (13, 15–18, 24, 41). The results of this study provideadditional support for this concept. After the melanin biosyn-

FIG. 9. Percent killing of W. dermatitidis as determined by colony counts prior to and after incubation in heparinized blood. The killing isdisplayed as the percentage decrease in the number of CFU during the incubation times indicated (n 5 5; mean values 1 standard deviations [errorbars]). The asterisk identifies a significant difference from the wild type (wt) as determined by the Mann-Whitney U test (P , 0.005), whereas n.s.identifies the absence of significant differences from wild type as determined by the same test.



.org/D

ownloaded from

http://iai.asm.org/

thetic pathway gene, WdPKS1, of W. dermatitidis was clonedand disrupted, the resulting wdpks1D mutants were shown tobe more susceptible to killing by neutrophils and to be lessvirulent in an acute mouse model. One wdpks1D mutant wasthen shown to regain resistance to neutrophil killing and toexhibit normal virulence in mice when melanin biosynthesiswas reconstituted by complementation with WdPKS1. To ourknowledge, WdPKS1 is the first melanin biosynthetic pathwaygene cloned in W. dermatitidis, or any other dematiaceouspathogen of humans, and shown to contribute directly to vir-ulence.

The WdPKS1 gene was cloned by a PCR method coupledwith a marker rescue approach and then sequenced. The pre-dicted WdPks1p showed highly significant sequence similaritywith type I Pks (23) and shared domains with other Pks for ab-ketoacyl synthase, an acetyl-malonyl transferase, two ACPs,and a thioesterase (3, 8, 20, 31, 36, 44, 57). This result stronglysuggested that the WdPKS1 gene encodes a polyketide syn-thase involved in melanin biosynthesis in W. dermatitidis. Inaddition, the WdPKS1 gene was also found to be constantlyexpressed throughout the W. dermatitidis growth cycle at both25 and 37°C and confirmed to be nonessential, as would beexpected of a gene involved in melanin biosynthesis by second-ary metabolism. Phenotypic analyses of wdpks disruption mu-tants further showed that these albino strains had both wild-type growth rates and cellular morphologies in vitro.

Recently, flow cytometry of BCECF-AM-stained W. derma-titidis was found to be suitable for determination of phagocy-tosis rates of yeast cells by incubation with neutrophils inwhole, heparinized, human blood: BCECF leads to a stableintracellular stain of the yeast cells (41). To ensure an intra-

cellular location of the yeast cells found associated with neu-trophils, epifluorescence microscopy was carried out in combina-tion with interference contrast microscopy of representativeexperimental samples. In accordance with the prior results(41), no differences were found in the degrees and rates ofphagocytosis between the W. dermatitidis wild-type strain andthe WdPKS1-complemented and noncomplemented wdpks1Dmutants. Evoked oxidative burst, estimated by a DHR methodthat was also recently validated for W. dermatitidis (41), simi-larly showed that the amounts and rates of the oxidative burstsinduced by the same strains were comparable. This again wastaken as confirmation of equal internalization of unstainedyeast cells by the human granulocytes, because all the neutro-phils involved exhibited a bright green fluorescence in thepresence of DHR, which is indicative of a comparable degreeof oxidative burst.

The rates of phagocytosis and subsequent amounts of killingof W. dermatitidis determined in a bioassay were also in excel-lent agreement with the prior results (41) but were obtainedwith the genetically uncharacterized W. dermatitidis albino mu-tant Mel3 (mel3-1), which was generated previously by UVmutagenesis (22). Statistically significant differences betweenthe darkly pigmented wild-type strain and the wdpks1D-1-com-plemented strain and the albino wdpks1D mutants were clearlydetected after exposure of yeast cells of these strains in wholeheparinized human blood for more than 10 min. This obser-vation clearly demonstrated that the presence of intact melaninis the main factor contributing to the difference in killing of thedifferent strains by human neutrophils. Thus, the albino mu-tant strains of W. dermatitidis are killed by neutrophils in acomparable fashion to Candida albicans and Saccharomycescerevisiae (unpublished data), which can be taken as an indi-cation that melanin synthesis contributes directly to the viru-lence of this black yeast species.

The most intriguing phenotype of the wdpks1D disruptionstrains beyond their loss of pigmentation was their significantloss of virulence in a mouse model of acute infection comparedto those of their wild-type parent and the two complementedstrains in the wdpks1D-1 background. Such reduced virulencein the mouse model was also previously observed with thealbino strain Mel3 (mel3-1) (15). However, because the UVused to generate this mutant could have given rise to multiplegene defects not easily detected in an asexual fungus, it mightbe argued that firm conclusions about the relationship of mel-anin with virulence in this strain are not be warranted (16-18).This concern is now moot because of our ability to complementthe mel3 lesion with WdPKS1, which clearly established theequivalency of strains with mel3 lesions with our newly derivedand less virulent wdpks1D disruption strains.

The importance of a polyketide synthase involved in melaninbiosynthesis in the human pathogen W. dermatitidis is nowdocumented for the first time to be equivalent to that of similarfungi found among the plant pathogens. In the plant patho-genic fungi C. lagenarium and M. grisea, deficient 1,8-DHNmelanin biosynthesis resulted in nonmelanized appressoria(27, 32, 39). In both cases, those mutants lost their ability topenetrate plant leaf tissue and thus became avirulent due tothe fact that melanin is required for the rigidity of appressoria(2). Similarly, it was reported recently that invasive hyphalgrowth in W. dermatitidis is dependent on melanin biosynthesis

FIG. 10. Mouse survival analysis after injection with wild type andwdpks mutants. Groups of 10 mice received injections of log-phaseyeast cells of W. dermatitidis wild type (wt), wdpks1D-1, wdpks1D-2,wdpks1D-3, or the melanin-reconstituted strains 501 and 502 (both arein a wdpks1D-1 background). The injections contained 9 3 106 cells permouse, and the mice monitored for 10 to 15 days to determine survivalrate. The data presented are average data from at least three experi-ments, all of which showed very similar results. Survival fractions werecalculated by the Kaplan-Meir method, and survival curves were testedfor significant difference (P , 0.01) by the Mantil-Haeszel test usingGraphPad Prism software (version 3.00 for Windows).



.org/D

ownloaded from

http://iai.asm.org/

(5). Brush and Money hypothesized that melanized hyphaeexert larger turgor-derived forces at their apices than nonmela-nized cells in W. dermatitidis, explaining their propensity forfast substrate invasion (5).

Previous studies demonstrated by parasexual genetic meth-ods that strains with the mel3 and mel4 genotypes are repre-sentative of mutants with defects in two different enzymes thatfunction during the conversion of acetyl-CoA or malonyl-CoAto 1,3,6,8-THN (12, 13). Strains with mutations in these genescan be differentiated also by physiological methods (13). Thus,comparisons of wdpks1D-1 with strains with one or the other ofthese two mutations, plus complementation studies with thecloned WdPKS1 gene itself, can be used to distinguish suchmutants. For example, although none of the strains with themel3, mel4, or wdpks1D mutations secrete visible intermediatesinto the culture medium, the wdpks1D-1 strain contact cross-feeds with strains with the mel4 mutation (Fig. 2C), whereaswdpks1D-1 does not do the same with strains with the mel3mutation (13). Also, whereas the latter two mutant types areboth very white, strains with the mel4 mutation are more beigethan white with time on YPD or MCD agar, which previouslysuggested that mel3 represents a lesion in an enzyme thatfunctions prior to mel4 (13). Finally, when grown on 1% (wt/vol) acetate-supplemented MCD agar, wdpks1D-1 and strainswith the mel3 lesion remained white, whereas strains with themel4 lesion turned black (Fig. 2D). Although the basis of thesecontact cross-feeding and acetate effects is not clear, thesephysiological tests support the hypothesis that two enzymes areinvolved in the conversion of acetyl-CoA or malonyl-CoA to1,3,6,8-THN in W. dermatitidis and that the wdpks1D disruptionmutants are equivalent to the previously described mutantswith mel3 lesions (13). Furthermore, although WdPKS1 com-plemented strains with the mel3 lesion, it did not complementa strain with a mel4 lesion. Thus, although the nature of themel3 mutation is now clear, that of mel4 remains unknown. Inthis respect, in most fungal 1, 8-DHN melanin systems, there isonly one structural polyketide synthase gene known to contrib-ute at this step in the pathway (19, 21, 29, 50). The cloning ofthe MEL4 gene in the future will enable us to understandbetter 1,8-DHN melanin biosynthesis in the human pathogenW. dermatitidis and the differences between the pathways in W.dermatitidis and in other black fungi. Unfortunately all at-tempts to clone this gene by complementation or by insertionalmutagenesis and marker rescue have failed (unpublisheddata).

Genes involved in 1,8-DHN melanin synthesis are clusteredin some fungi and not in others. In A. alternata, a melaninpathway gene cluster has been identified that contains at leastthree pathway biosynthetic genes within a 30-kb region (25),which encode the polyketide synthase, the scytalone dehy-dratase, and the 1,3,8-THN reductase. Cloning of these threegenes in C. lagenarium was also reported (28, 39, 44). However,in contrast to A. alternata it appears that these same genes arenot closely linked in C. lagenarium (27). In M. grisea, classicalgenetic analysis with melanin mutants indicates none of thepathway genes are closely linked (10). Although pathway geneshave not been isolated for C. miyabeanus and Cochliobolusheterostrophus, classical genetics analysis indicates that in bothorganisms the polyketide synthase and the 1, 3, 8-THN reduc-tase genes but not the scytalone dehydratase gene, are linked

(28). In W. dermatitidis, two independently isolated cosmidclones containing WdPKS1 were used to transform mutantswith mel1, mel2, and mel4 lesions. However, in no case wascomplementation observed. Thus, it appears that the mel4mutation (representative of the unknown enzyme in the path-way) and the genes for the scytalone reductase and for the1,8-DHN oxidase (polymerase) are not closely linked with Wd-PKS1. More extensive searches to identify these genes andothers related to 1,8-DHN melanin biosynthesis in W. derma-titidis are in progress.

ACKNOWLEDGMENTS

We thank Michael J. Wheeler for his helpful suggestions and forscytalone. We also thank X.-C. Ye and Z. Wang for discussion andtechnical assistance.

This research was supported by a grant to P. J. Szaniszlo from theNational Institute of Allergy and Infectious Diseases (AI 33049).

REFERENCES

1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl (ed). 1989. Current protocols in molecular biology.John Wiley and Sons, New York, N.Y.

2. Bechinger C., K. Giebel, M. Schnell, P. Leiderer, H. Deising, and M. Bast-meyer. 1999. Optical measurements of invasive forces exerted by appressoriaof a plant pathogenic fungus. Science 285:1896–1899.

3. Beck, J., S. Ripka, A. Siegner, E. Schiltz, and E. Schweizer. 1990. Themultifunctional 6-methylsalicylic acid synthase gene of Penicillium patulum:its gene structure relative to that of other polyketide synthases. Eur. J. Bio-chem. 192:487–498.

4. Bell, A. A., J. E. Puhalla, W. J. Tolmsoff, and R. D. Stipanovic. 1976. Use ofmutants to establish (1)-scytalone as an intermediate in melanin biosynthe-sis by Verticillium dahliae. Can. J. Microbiol. 22:787–799.

5. Brush, L., and N. Money. 1999. Invasive hyphal growth in Wangiella derma-titidis is induced by stab inoculation and shows dependence upon melaninbiosynthesis. Fung. Genet. Biol. 28:190–200.

6. Carroll, A. M., J. A. Sweigard, and B. Valent. 1994. Improved vectors forselecting resistance to hygromycin. Fung. Genet. Newsl. 41:22.

7. Casadevall, A., and J. R. Perfect. 1998. Cryptococcus neoformans, p. 145–176.ASM Press, Washington, D.C.

8. Chang, P.-K., J. W. Cary, J. Yu, D. Bhatnagar, and T. E. Cleveland. 1995.The Aspergillus parasiticus polyketide synthase gene pksA, a homolog ofAspergillus nidulans wA, is required for aflatoxin B1 biosynthesis. Mol. Gen.Genet. 248:270–277.

9. Chaskes, S., and R. L. Tyndall. 1978. Pigment production by Cryptococcusneoformans and other Cryptococcus species from aminophenols and diami-nobenzenes. J. Clin. Microbiol. 7:146–152.

10. Chumley, F. G., and B. Valent. 1990. Genetic analysis of melanin-deficient,non-pathogenic mutants of Magnaporthe grisea. Mol. Plant-Microbe Infect.3:135–143.

11. Cooper, C. R., Jr. 1989. Induced parasexual genetic analysis of the imperfect,pathogenic fungus, Wangiella dermatitidis: identification of selected morpho-genic and biosynthetic complementation groups. Ph.D. dissertation. Univer-sity of Texas, Austin.

12. Cooper, C. R., and P. J. Szaniszlo. 1993. Evidence for two cell division cycle(CDC) genes that govern yeast bud emergence in the pathogenic fungusWangiella dermatitidis. Infect. Immun. 61:2069–2081.

13. Cooper, C. R., and P. J. Szaniszlo. 1997. Melanin as a virulence factor indematiaceous pathogenic fungi, p. 81–93. In H. Vanden Bossche, D. A.Stevens, and F. C. Odds (ed.), Host-fungus interplay. National Foundationfor Infectious Diseases, Bethesda, Md.

14. de Hoog, G. S., K. Takeo, S. Yoshida, E. Gottlich, K. Nishimura, and M.Miyaji. 1994. Pleoanamorphic life cycle of Exophiala (Wangiella) dermatitidis.Antonie Leeuwenhoek 65:143–153.

15. Dixon, D. M., A. Polak, and P. J. Szaniszlo. 1987. Pathogenicity and viru-lence of wild-type and melanin-deficient Wangiella dermatitidis. J. Med. Vet.Mycol. 25:97–106.

16. Dixon, D. M., A. Polak, and G. W. Conner. 1989. Mel2 mutants of Wangielladermatitidis in mice: evaluation of multiple mouse and fungal strains. J. Med.Vet. Mycol. 27:335–341.

17. Dixon, D. M., J. Migliozzi, C. R. Cooper, O. Solis, B. Breslin, and P. J.Szaniszlo. 1992. Melanized and non-melanized multicellular form mutantsof Wangiella dermatitidis in mice: mortality and histopathology studies. My-coses 35:17–21.

18. Dixon, D. M., P. J. Szaniszlo, and A. Polak. 1991. Dihydroxynaphthalene(DHN) melanin and its relationship with virulence in the early stages ofphaeohyphomycosis, p. 297–318. In G. T. Cole, and H. C. Hoch (ed), The



.org/D

ownloaded from

http://iai.asm.org/

fungal spore and disease intiation in plants. Plenum Press, New York, N.Y.19. Fujii, I., Y. Mori, A. Watanabe, Y. Kubo, G. Tsuji, and Y. Ebizuka. 1999.

Heterologous expression and product identification of Colletotrichum lag-enarium polyketide synthase encoded by the PKS1 gene involved in melaninbiosynthesis. Biosci. Biotechnol. Biochem. 63:1445–1452.

20. Fujii, I., Y. Ono, H. Tada, K. Gomi, Y. Ebizuka, and U. Sankawa. 1996.Cloning of the polyketide synthase gene atX from Aspergillus terreus and itsidentification as the 6-methylsalicylic acid synthase gene by heterologousexpression. Mol. Gen. Genet. 253:1–10.

21. Fujii, L. Y., Y. Mori, A. Watanabe, Y. Kubo, G. Tsuji, and Y. Ebizuka. 2000.Enzymatic synthesis of 1,3,6,8-tetrahydroxynaphthalene solely from malonylcoenzyme A by a fungal iterative type I polyketide synthase PKS1. Biochem-istry 39:8853–8858.

22. Geis, P. A., M. H. Wheeler, and P. J. Szaniszlo. 1984. Pentaketide metabo-lites of melanin synthesis in the dematiaceous fungus Wangiella dermatitidis.Arch. Microbiol. 137:324–328.

23. Hopwood, D. A., and D. H. Sherman. 1990. Molecular genetics of polyketidesand its comparison to fatty acid biosynthesis. Annu. Rev. Genet. 24:37–66.

24. Jacobson, E. S., E. Hove, and H. S. Emery. 1995. Antioxidant function ofmelanin in black fungi. Infect. Immun. 63:4944–4945.

25. Kimura, N., and T. Tsuge. 1993. Gene cluster involved in melanin biosyn-thesis of the filamentous fungus Alternaria alternata. J. Bacteriol. 175:4425–4435.

26. Kubo, Y., K. Suzuki, L. Furusawa, and M. Yamamoto. 1985. Melanin bio-synthesis as a prerequisite for penetration by appressoria of Colletotrichumlagenarium: site of inhibition by melanin-inhibiting fungicides and their ac-tion on appressoria. Pestic. Biochem. Physiol. 23:47–55.

27. Kubo, Y., Y. Takano, and I. Furusawa. 1996. Molecular genetics analysis ofmelanin biosynthetic genes essential for appressorium function in Colletotri-chum lagenarium, p. 73–82. In D. Mills, H. Kunoh, N. Keen, and S. Mayama(ed.), Molecular aspects of pathogenicity: requirements for signal transduc-tion. APS Press, St. Paul, Minn.

28. Kubo, Y., Y. Takano, N. Endo, N. Yasuda, S. Tajima, and I. Furusawa. 1996.Cloning and structural analysis of the melanin biosynthesis gene SCD1 en-coding scytalone dehydratase in Colletotrichum lagenarium. Appl. Environ.Microbiol. 62:4340–4344.

29. Kurosaki, F., and M. Arisawa. 1998. Free CoA as activator of 6-hydroxy-mellein synthase, a multifunctional polyketide biosynthetic enzyme in carrot.Phytochemistry 50:565–569.

30. Kwon-Chung, K. J., and J. C. Rhodes. 1986. Encapsulation and melanin inCryptococcus neoformans. Infect. Immun. 51:218–223.

31. Langfelder, K., B. Jahn, H. Gehringer, A. Schmidt, G. Wanner, and A. A.Brakhage. 1998. Identification of a polyketide synthase gene (pksP) of As-pergillus fumigatus involved in conidial pigment biosynthesis and virulence.Med. Microbiol. Immunol. 187:79–89.

32. Lundqvist, T., J. Rice, C. N. Hodge, G. S. Basarab, J. Pierce, and Y. Lund-qvist. 1994. Crystal structure of scytalone dehydratase: the disease determi-nant of a rice pathogen, Magnaporthe grisea. Structure 15:937–944.

33. Marr, C. D. 1979. Laccase and tyrosinase oxidation of spot test reagents.Mycotaxon 9:244–276.

34. Matsumoto, T., T. Matsuda, M. R. McGinnis, and L. Ajello. 1994. Clinicaland mycological spectra of Wangiella dermatitidis infections. Mycoses 36:145–155.

35. Matsumoto, T., L. Ajello, T. Matsuda, P. J. Szaniszlo, and T. J. Walsh. 1994.Developments in hyalohyphomycosis and phaeohyphomycosis. J. Med. Vet.Mycol. 32:329–349.

36. Mayorga, M. E., and W. E. Timberlake. 1992. The developmentally regu-lated Aspergillus nidulans wA gene encodes a polypeptide homologous topolyketide and fatty acid synthases. Mol. Gen. Genet. 235:205–212.

37. Montijin, R., Van P. Wolven, G. S. de Hoog, and F. M. Klis. 1997. b-Glu-cosylated proteins in the cell wall of the black yeast Exophiala (Wangiella)dermatitidis. Microbiology 143:1673–1680.

38. Osiewacz, H. D. 1994. A versatile shuttle cosmid vector for the efficientconstruction of genomic libraries and for the cloning of fungal genes. Curr.Genet. 26:87–90.

39. Perpetua, N. S., Y. Kubo, N. Yasuda, Y. Takano, and I. Furusawa. 1996.

Cloning and characterization of a melanin biosynthetic THR reductase geneessential for appressorial penetration of Colletotrichum lagenarium. Mol.Plant-Microbe Interact. 9:323–329.

40. Schnitzler, N., G. Haase, A. Bussing, A. Kaufhold, P. Beyhs, and A. Pod-bielski. 1995. Measuring resistance to phagocytosis of group A and G strep-tococci; comparison of direct bactericidal assay and flow cytometry. Med.Microbiol. Immun. 184:17–22.

41. Schnitzler, N., H. Peltroche-Llacsahuanga, N. Bestier, J. Zundorf, R. Lut-ticken, and G. Haase. 1999. Effect of melanin and carotenoids of Exophiala(Wangiella) dermatitidis on phagocytosis, oxidative burst, and killing by hu-man neutrophils. Infect. Immun. 67:94–101.

42. Szaniszlo, P. J., L. Mendoza, and S. M. Karuppayil. 1993. Clues aboutchromoblastomycotic and other dematiaceous fungal pathogens based onWangiella as a model, p 241–255. In H. Vanden Bossche, F. C. Odds, and D.Kerridge D (ed.), Dimorphic fungi in biology and medicine. Plenum, NewYork, N.Y.

43. Tajima S, Y. Kubo, and J. Furusawa. 1989. Purification of a melanin bio-synthetic enzyme converting scytalone to 1,3,8-trihydroxynaphthalene fromCochliobolus miyabeanus. Exp. Mycol. 13:69–76.

44. Takano, Y., Y. Kubo, K. Shimizu, K. Mise, T. Okuno, and I. Furusawa. 1995.Structural analysis of PKS1, a polyketide synthase gene involved in melaninbiosynthesis in Colletotrichum lagenarium. Mol. Gen. Genet. 249:162–167.

45. Taylor, B. E., M. H. Wheeler, and P. J. Szaniszlo. 1987. Evidence for pen-taketide melanin biosynthesis in dematiaceous human pathogenic fungi.Mycologia 79:320–322.

46. Tsai, H.-E., Y. C. Chang, R. G. Washburn, M. H. Wheeler, and K. J.Kwon-Chung. 1998. The developmentally regulated alb1 gene of Aspergillusfumigatus: its role in modulation of conidial morphology and virulence. J.Bacteriol. 180:3031–3038.

47. Vidal-Cros, A, F. Viviani, G. Labesse, M. Bocara, and M. Gaudry. 1994.Polyhydroxynapthalene reductase involved in melanin biosynthesis in Mag-naporthe grisea. Eur. J. Biochem. 219:985–992.

48. Wang, Z., and P. J. Szaniszlo. 2000. WdCHS3, a gene that encodes a class IIIchitin synthase in Wangiella (Exophiala) dermatitidis, is expressed differen-tially under stress conditions. J. Bacteriol. 182:874–881.

49. Wang, Z., L. Zheng, M. Hauser, J. M. Becker, and P. J. Szaniszlo. 1999.WdChs4p, a homolog of chitin synthase 3 in Saccharomyces cerevisiae, alonecannot support growth of Wangiella (Exophiala) dermatitidis at the temper-ature of infection. Infect. Immun. 67:6619–6630.

50. Watanabe, A., Y. Ono, I. Fujii, U. Sankawa, M. E. Mayorga, W. E. Timber-lake, and Y. Ebizuka. 1998. Product identification of polyketide synthasecoded by Aspergillus nidulans wA gene. Tetrahedron Lett. 39:7733–7736.

51. Wheeler, M. H. 1982. Melanin biosynthesis in Verticillium dahliae: dehydra-tion and reduction reactions in cell-free homogenates. Exp. Mycol. 16:171–179.

52. Wheeler, M. H., and A. A. Bell. 1988. Melanins and their importance inpathogenic fungi. Curr. Top. Med. Mycol. 2:338–387.

53. Wheeler, M. H., and R. D. Stipanovic. 1985. Melanin biosynthesis and themetabolism of flaviolin and 2-hydroxyjuglone in Wangiella dermatitidis. Arch.Microbiol. 142:234–241.

54. Wolkow, P. M., and H. D. Sisler. 1982. Tricyclazole, pyroquilon, tetrachlo-rophthalide, PCBA, coumarine and related compounds inhibit melanizationand epidermal penetration by Pyricularia oryzae. J. Pestic. Sci. 7:161–166.

55. Ye, X., B. Feng, and P. J. Szaniszlo. 1999. A color-selectable and site-specificintegrative transformation system for gene expression studies in the dema-tiaceous fungus Wangiella (Exophiala) dermatitidis. Curr. Genet. 36:241–247.

56. Yelton, M. M., W. E. Timberlake, and C. A. M. J. J. van den Hondel. 1985.A cosmid for selecting genes by complementation in Aspergillus nidulans:selection of the developmentally regulated yA locus. Proc. Natl. Acad. Sci.USA 82:834–838.

57. Yu, J.-H., and T. J. Leonard. 1995. Sterigmatocystin biosynthesis in Aspergil-lus nidulans requires a novel type I polyketide synthase. J. Bacteriol. 177:4792–4800.

58. Zheng, L., and P. J. Szaniszlo. 1999. Cloning and use of the WdURA5 geneas a hisG cassette selection marker for potentially disrupting multiple genesin Wangiella dermatitidis. Med. Mycol. 37:85–96.

Editor: T. R. Kozel



.org/D

ownloaded from

http://iai.asm.org/

molecular cloning and characterization of wdpks1, a gene ... · dermatitidis, verticillium dahliae,...

Documents