molecular cloning and characterization of onchocystatin, a ... · in this study we show that the...

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 267, No. 24, Issue of August 25, pp. 17339-17346,1992 Printed in U. S. A.

Molecular Cloning and Characterization of Onchocystatin, a Cysteine Proteinase Inhibitor of Onchocerca uoZuuZus*

(Received for publication, April 9, 1992)

Sara LustigmanSj, Betsy Brotmanll, Tellervo Huima$, Alfred M. Prince$, and James H. McKerrowll From the $Laboratory of Virology and Parasitology, the Lindsley F. Kimball Research Znstitute of the New York Blood Center, New York, New York 10021, (Vilnb IZ, the Liberian Znstitute for Biomedical Research, Robertsfield, Liberia, and the 11 Department of Patholog-y, the University of California and the Department of Veterans Affairs Medical Center, San-Francisco,.Californ$-94121

A cDNA clone designated OV7 encodes a polypeptide that corresponds to a highly antigenic Onchocerca volvulus protein. OV7 has significant amino acid sequence homology to the cystatin superfamily of cysteine proteinase inhibitors. In this report we establish that the OV7 recombinant protein is active as a cysteine proteinase inhibitor, and we have named it onchocystatin. It contains a cystatin-like domain that inhibits the activity of cysteine proteinases at physiological concentrations. Recombinant glutathione S-transferase- OV7 (GST-OV7, 1 PM) and maltose-binding protein- OV7 (MBP-OV7,4 PM) fusion polypeptides inhibit 50% of the enzymatic activity of the bovine cysteine proteinase cathepsin B. Neither fusion polypeptide inhibits serine or metalloproteinases activity. The Kc for GST-OV7 fusion polypeptide is 170 nM for cathepsin B and 70 PM or 25 nM for cysteine proteinases purified from a protozoan parasite Entamoeba histolytica or the free living nematode Caenorhabditis elegans, respectively. The 5’ end of the OV7 clone was isolated by polymerase chain reaction and sequenced, thus extending the previous cDNA clone to 736 base pairs. This represents the complete coding sequence of the mature onchocystatin (130 amino acids). A hydrophobic leader sequence of 32 amino acids was found, in- dicating a possible extracellular function of the onchocerca cysteine proteinase inhibitor.

Onchocerciasis, or river blindness, is one of the leading causes of infectious blindness and severe chronic dermatitis, afflicting about 20 million people in Africa and Latin America (47). The parasite is transmitted by bites of Simulium black flies. Although vector control and the periodic administration of ivermectin promise a drastic reduction of the burden of skin microfilariae and disease, there is a need for alternate strategies for control of onchocerciasis. The development of a vaccine against components of the infective stages of the

*This study was supported in part by grants from The Edna McConnell Clark Foundation and United Nations Development Pro- gram, World Bank, World Health Organization Special Program for Research and Training in Tropical Diseases (Macrofil). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adver- tisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequencefs) reported in thispaper has been submitted to the GenBankTM/EMBL Data Bank with accession numberfs) M37105.

I TO whom correspondence should be sent: Laboratory of Virology and Parasitology, the Lindsley F. Kimball Research Institute of the New York Blood Center, 310 E. 67th St., New York, NY 10021.

parasite might provide a means for preventing infection and the disease associated with Onchocerca volvulus infection.

In our efforts to produce vaccine components by isolating cDNA clones encoding antigens of the L3l infective stage larvae of 0. volvulus, we immunoscreened a cDNA library derived from adult worms with antisera taken from chimpan- zees immunized with X-irradiated 0. volvulus L3 larvae. A cDNA clone, designated OV7, was identified and character- ized (1). OV7 encodes a 15.2-kDa polypeptide that corre- sponded to a native parasite antigen with an apparent molecular mass of 17 kDa. Homology analysis of the OV7 amino acid sequence revealed significant similarity with the cystatin superfamily of animal and plant origin (2-14). An overall amino acid comparison between OV7 and one of the cystatin members, bovine cystatin, showed 27% identity in a 111- amino acid region. A stretch of 5 amino acids, Gln-Val-Val- Ala-Gly (QVVAG), which is conserved in the cystatins, and a glycine residue (Gly5 in bovine cystatin numbering), which has been proposed to be essential for the inhibitory activity (15), are also present in the OV7 amino acid sequence, sug- gesting that OV7 might encode a functional member of the cystatin superfamily.

The cystatin superfamily is subdivided into three families (16-18). Family 1 is known as the stefin family. Its members have a single domain with an M, of approximately 11,000, and they lack interdomain disulfide bonds and carbohydrates. They share one region of extended homology with the other two families around the proposed reactive site. Members of this family are thought to represent the archetype of the superfamily. Members of family 2 , the cystatins, have a single domain with an M, of approximately 13,000, contain two interchain disulfide bonds but also lack carbohydrates. Mem- bers of this family share extended sequence homology to families 1 and 3 at the proposed reactive site QVVAG and to family 3 at the carboxyl terminus. Family 3 comprises the blood plasma kininogens which are larger than the members of the other two families. Kininogens consist of three parts: a glycosylated amino-terminal heavy chain, the bradykinin moiety, and a carboxyl-terminal light chain. The cysteine proteinase inhibitory activity resides in the heavy chain whose structure is made up of three tandemly repeated cystatin-like domains, two of which (fragments 2 and 3) are capable of

The abbreviations used are: L3, third-stage larvae; L4, fourth- stage larvae; bp, base pair(s); fpp, fusion polypeptide; GST, glutathione S-transferase of S. japonicum; MBP, maltose-binding protein; PMSF, phenylmethylsulfonyl fluoride; IPTG, isopropyl-1-thio-6-D- galactopyranoside; SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis; EGTA, [ethylenebis(oxyethylenitrilo)]tet- raacetic acid; PCR, polymerase chain reaction; SL, splice leader; Z, benzyloxycarbonyl; AMC, 4-amino-7-methylcoumarin; PBS, phosphate-buffered saline; 2-ME, 2-mercaptoethanol.

17339

17340 Onchocystatin, a Cysteine Proteinase Inhibitor of 0. volvulus

inhibiting cysteine proteinases (5). In this study we show that the Onchocerca protein encoded

by OV7 is a physiologically active cysteine proteinase inhibitor, now named onchocystatin. We have completed sequence analysis of onchocystatin by isolation of the 5"terminal end of the OV7 cDNA clone and discuss its structural and evolutionary relationship to other members of the cystatin superfamily. The presence of onchocystatin in molting L3 larvae and in the fourth-stage larvae is confirmed. A possible function of onchocystatin in the parasite is suggested.

MATERIALS AND METHODS

OV7 cDNA Clone-OV7, a cDNA clone of 582 bp, contains a single translational open reading frame of 131 amino acids. The cDNA clone was identified by immunoscreening a Xgtll cDNA expression library, derived from mRNA of adult worms, with chimpanzee antiserum generated against X-irradiated L3, infective larvae of 0. volvulus (1).

The EcoRI insert of OV7 was subcloned into the expression plasmid vectors pGEX-1N (Gift of Dr. Coppel, The Walter and Eliza Hall Institute, Melbourne, Australia) and pPR687 (New England Biolabs, Beverly, MA). These plasmids were constructed to give fusion polypeptides (fpps) with the carboxyl terminus of Sj26, a 26-kDa glutathione 5'-transferase protein (GST) of Schistosoma japonicum, or the maltose-binding protein (MBP), respectively. The advantage of these plasmids is that the fpps can be purified from crude bacterial lysates under nondenaturing conditions by affinity chromatography on im- mobilized glutathione or amylose, respectively (19-21).

The ligation mixture of OV7 cDNA in pGEX-1N or in pPR687 was used to transform Escherichia coli subcloning efficiency DH5a- competent cells (Bethesda Research Laboratories). Mass screening of transformants for the expression of GST-OV7 fusion polypeptide was carried out on 1.5-ml induced cultures (0.1 mM IPTG, 3 h) resuspended in 300 ml of MTPBS (150 mM NaCl, 16 mM Na2HP04, 4 mM NaH2PO4, pH 7.3). After sonication and centrifugation, the supernatant was mixed with 50 pl of 50% glutathione-agarose beads (Sigma), washed three times with 1 ml of MTPBS, al,d the beads were then boiled in 100 pl of SDS-PAGE sample buffer for analysis on a 10% SDS-polyacrylamide gel (22) followed by stainingwith 0.2% Coomassie Blue. Transformants expressing the OV7 antigen were further identified by immunoblotting using affinity-purified anti-OV7 fpp antibodies (23). Large scale purification of GST-OV7 fpp was carried out according to the procedure described by Smith and John- son (20). The fpp was eluted from the glutathione beads with 5 mM reduced glutathione (Sigma) in 50 mM Tris-HC1 buffer, pH 8 (final pH 7.5, freshly prepared), followed by dialysis against MTPBS. 200 ml of culture yielded 0.5-1 mg of pure GST-OV7 fpp. Antiserum to GST or to the GST-OV7 fpp was prepared by subcutaneous injection of a rabbit with 100 pg of protein mixed in complete Freund's adjuvant (Difco) followed by repeated injection 3 and 4 weeks later in incom- plete Freund's adjuvant. The animals were bled for sera 2 weeks after the third injection.

Mass screening of transformants for expression of MBP-OV7 fusion polypeptide was carried out on 1.5-ml induced cultures (0.3 mM IPTG, 2 h) resuspended in 500 p1 of lysis buffer (10 mM phosphate buffer, pH 7.0, containing 30 mM NaCl, 0.25% Tween 20, 10 mM EDTA, 10 mM EGTA, and 1 mg/ml lysosyme). 30 min later Triton X-I00 and NaCl were added to the mixture at final concentrations of 0.2% and 0.5 M, respectively. After 30 min the mixture was sonicated and centrifuged for 30 min at 10,000 rpm. The supernatant was mixed with 50 pl of 50% amylose beads (New England Biolabs), washed three times with buffer as recommended by the manufacturer, and then the beads were boiled in 100 p1 of SDS-PAGE sample buffer for analysis on a 10% SDS-polyacrylamide gel (22) followed by staining with 0.2% Coomassie Blue. Transformants expressing the OV7 antigen were further identified by immunoblotting using affinity-purified anti-OV7 fpp antibodies (23). Large scale purification of MBP-OV7 fpp was carried out according to the procedure recommended by the manufacturer. The fpp was eluted from the amylose beads with 10 mM maltose followed by dialysis against 10 mM Tris-HC1 buffer, pH 8.0, 200 ml of culture yielded 0.3-0.5 mg of pure MBP-OV7 fpp.

Sequence of the B'-Terminal End of OV7 cDNA-5' extension of the OV7 cDNA clone was obtained by the polymerase chain reaction (PCR). The target DNA was 2 pg of Xgtll DNA prepared from a cDNA expression library that was used previously for the immuno-

screening and identification of OV7 cDNA clone (1). The Xgtll DNA was amplified by PCR in 100 pl of reaction mixture containing 100 ng of each primer, 2.5 units of Taq polymerase, and reaction buffer from Pharmacia LKB Biotechnology Inc. PCRs were carried out in a DNA thermal cycler according to the manufacturer's recommenda- tion (Perkin-Elmer Cetus Instruments). 35 cycles of amplification were usually performed, 1 min at 94 "C, 3 min at 55 "C, and 4 min at 72 "C, followed by a 7-min extension a t 72 "C. 1/10 of the volume of the PCR products from the first amplification reaction was added to 90 pl of reaction mixture for a second PCR using nested set of primers to increase the sensitivity and specificity of the amplification. Primer pair combinations and their location are listed in Table I. The primers were derived from internal sequences of OV7 cDNA, X g t l l EcoRI site forward sequence (New England Biolabs), and the 22-nucleotide splice leader (SL) sequence of Caenorhabditis ekgam (24, 25). The synthetic oligonucleotides were prepared on an Applied Biosystems PCR-Mate, model 391, DNA synthesizer. PCR products were separated on 2.5% agarose gel, and specific fragments were identified by Southern blot analysis (26) using an oligonucleotide probe comprising 25 nucleotides of the OV7 sequence between the primers (Table I). Once a positive fragment was identified, the PCR products were separated on 1.5% low melting agarose gel (NuSieve GTG agarose, FMC Bioproducts, Rockland, ME), and the specific fragment was gel purified, blunt ended, and kinase treated. The blunt-ended PCR fragment was then inserted into the SmaI site of pBluescript-SK cloning vector (Stratagene, La Jolla, CA), and plasmid DNA of the transformants was purified using standard procedures (26).

Sequence determination of the plasmid DNA was carried out in both orientations by the dideoxynucleotide chain termination method of Sanger et al. (27) using KS and SK primers. The sequence analysis was carried out using a DuPont Genesis 2000 automated sequenator. To minimize sequencing errors caused by PCR artifacts (misreading by Taq polymerase), for each target sequence at least three independ- ent clones were isolated and sequenced in both orientations, and their sequences were compared to derive the final consensus sequence representative of the extended 5' terminus of OV7 clone.

Inhibitory Activity and Determination of K, Values of OV7 Fusion Polypeptide-The activity of bovine cysteine proteinase cathepsin B (Sigma) was assayed at 40 "C in 73 mM phosphate buffer, pH 6.0, containing 1 mM EDTA, 0.1% Brij, and 2 mM cysteine according to the method of Barrett and Kirschke (28). Cysteine proteinase inhibitory activity in purified GST, GST-OV7, MBP, and MBP-OV7 was determined by incubating varying amounts of the polypeptides with 62.5 ng (8.3 p ~ ) cathepsin B in 100 pl of reaction buffer for 30 min at 30 "C and assessing the cathepsin B residual activity after a 10- min incubation with the substrate Z-Arg-Arg-2NA (0.5 mM, Bachem Bioscience Inc., Bubendorf, Switzerland) at 40 "C.

OV7 fpps were also tested for the capacity to inhibit a variety of serine and metalloproteinases, using continuous fluorometric assays as described previously (29). Fluorescence (excitation 380 nm, emis- sion 460 nm) of the cleaved AMC (4-amino-7-methylcoumarin) group was monitored in a spectrofluorometer (Aminco SPE-500, American Instrument Co., Silver Spring, MD) over 2 min, and the slope of fluorescence over time, representing enzyme activity, was determined. Correlation coefficients for the slopes were > 0.999. The scale was calibrated with a stock solution of 1.3 p~ AMC (Sigma). Two serine proteinases, bovine trypsin (400 ng, Sigma T 8253, type 111, bovine pancreas) and bovine a-chymotrypsin (200 ng, Sigma C 7762, type I- S, bovine pancreas), were tested for susceptibility to OV7 fpps in assays with the substrates Z-Val-Leu-Arg-AMC and Suc-Leu-Leu- Val-Tyr-AMC, respectively. A metalloproteinase, leucine aminopeptidase (4 pg, Sigma L 9876, type 111-CP from porcine kidney), was assayed under the same conditions (100 mM Tris-HC1 buffer, pH 8.0, containing 1 mM CaC12) as the serine proteinases but using Leu-AMC as the substrate. 10 PM substrate was added to the enzyme-inhibitor mix after incubating the enzymes with varying amounts of inhibitors for 20 min at ambient temperature. PMSF and the substrates were prepared as a stock solution in Me,SO. Other inhibitors were made in water or assay buffer. An equal volume of Me2S0 alone was tested with the enzymes. The inhibition relative to the appropriate solvent control was calculated.

K, values for the interaction between GST-OV7 fpp and various cysteine proteinases were determined by the use of continuous fluorometric assays as described above. For cathepsin B, the assay buffer was 100 mM sodium acetate containing 5 mM dithiothreitol and 1 mM EDTA, pH 6.0. For the cysteine proteinase of Entamoeba histo-

Onchocystatin, a Cysteine Proteinase Inhibitor of 0. volvulus 17341

TABLE I Nucleotide sequences of oligonucleotide primers and probe used for PCR amplification of the 5' -terminal end of OV7 Oligonucleotide Nucleotide position Sequence (5'-3')

OV7 probe (+)185-(+)209 ACAGGTGAAAATCAAGATCGTCCCG Primers

OV7 (-)255-(-)274 GCTTGGCAATAGTTCCAGGA OV7 nested (-)225-(-)244 CTTTGGATCGCGATCTTCCC Xgtll RI site forward GGTGGCGACGACTCCTGGAGCCCG Xgtll RI site forward nested CGACTCCTGGAGCCCGTCAG C. elegans splice leader gatggcgcgccGGTTTAATTACCCAAGTTTGAG'

The nucleotides in lower case are an extended 5' sequence to the splice leader sequence and contain an ASCI restriction site (the primer was a gift from Dr. F. Perler, New England Biolabs).

lytica (29), which has a cathepsin B-like activity, a 100 mM Tris-HC1 buffer containing 5 mM dithiothreitol and 1 mM EDTA, pH 7.0, was used. For the cysteine proteinase of C. elegans, which has a cathepsin L-like activity (30), a 10 mM sodium acetate buffer containing 2 mM dithiothreitol and 140 mM NaC1, pH 5.5, was used. The specific substrates for each enzyme are listed in Table 111; they were used at final concentrations of 10 and 20 p~ each. The K, was calculated from a Dixon plot of 1/V, versus concentrations of inhibitor [I] (31).

Electrophoresis and Immunoblotting-Proteins were separated by SDS-PAGE (22) and electrophoretically transferred to nitrocellulose (23). To evaluate if reducing disulfide bonds change the mobility of onchocystatin in SDS-PAGE, a PBS-soluble crude extract of female adult worms was prepared by homogenization in PBS and centrifugation at 12,000 X g. The crude extract was separated on 20% SDS- PAGE after solubilization and boiling in SDS-PAGE sample buffer (2% SDS in 62.5 mM Tris-HC1, pH 6.8) with or without 5% 2- mercaptoethanol (2-ME). Each well was loaded with 30 pg of PBS extract. The blot was probed with rabbit antiserum raised against GST-OV7 fpp. Bound antibodies were detected by '251-protein A.

Localization of Onchocystatin in Larval Stages of the Parasite"L3 of 0. volvulus were cultured in vitro for 7 days at 37 "C in a humidified 5% CO, incubator as described previously (32, 33). L3 larvae from days 2, 3, and 4 in culture, or fourth-stage larvae (L4), 2 days after molting, were collected. 50-70% of the L3 larvae molt between the 4th and the 5th days in culture. The larvae were fixed for 30 min in 0.25% glutaraldehyde, 1% sucrose in 0.1 M phosphate buffer, pH 7.4, and then processed for immunoelectron microscopy as described (1). Thin sections of embedded worms were probed with affinity-purified anti-OV7 fpp antibodies and 15-nm gold particles coated with protein A.

RESULTS

Characterization and Sequencing of the 5'-Terminul End of the OV7 cDNA Clone

Initial PCR amplification of the DNA from the Xgtll cDNA library using an integral sequence of the OV7 clone (bp 255- 274) and X g t l l forward primer sequence yielded one specific fragment of 175 bp comprising bp 99-274 (Fig. 1). A second PCR, using this time the C. elegans SL sequence and the OV7 integral sequence, resulted in a longer specific fragment of 274 bp. This contained in its 3' end the same sequence as the smaller fragment (bp 99-156) and a 118-bp stretch of clone OV7 (bp 157-274) which have been sequenced previously (1). The first two nucleotides in the 5' end of the previously described sequence were found not to be correct. They are GC instead of CG. The sequences of both fragments were con- nected, and the extended nucleotide sequence of OV7 and the predicted amino acid sequence are shown in Fig. 1. The 736- bp sequence contains a single translational open reading frame extending from the postulated initiator methionine to a stop codon, TGA, at position 548-550. The open reading frame encodes 162 amino acids of the extended OV7 that includes the 130 amino acids reported previously (amino acids 2-132; Ref. 1). The sequence also consists of a 5"untranslated region of 61 nucleotides, which includes the SL sequence at its 5'-terminal end, and a purine (adenine) in the -3 position

I G GTT TAA TTA CCCl 13

GAA TCT GCT GAG TAA ACA AAG AGG CTT AGC GAC ACG ATA 61

" 4 9 Met Leu T h r I l e Lys Asp Gly Thr Leu Leu I le His Leu Leu Leu Phe ATG TTG ACA ATA AAG GAT GGA ACG TTG CTC ATA CAT TTA TTG CTG TTC 109

"

-16 Ser V a l Val A l a Leu V a l G l n Leu G l n G l y Ala L y s Ser A l a Arg Ala AGT GTG GTA GCA TTA GTT CAG TTG C M GGA GCC AAG TCT GCA AGA GCC 157

-1

1 Lys Asn Pro Ser Lys Met Glu Ser Lys AAA AAT CCG TCA AAA ATG GAG TCC AAA

11

D T TTA TTG GGA GGT l$G GAA GAT CGC GAT CCA AAGI GAT GAA GAA 253 Pi0 Val Leu Leu Gly Gly T r D Glu Asv A r q Asv Pro Lvs Asp G l u Glu

33

ATA TTG ATG AAA GTA AAT GAA CAA TCA 301 I le Leu Met Lya V a l Asn G l u G l n Ser

4 9 Aan Asp Glu Tyr His Leu Met Pro I le Lys Leu Leu Lys V a l Ser Ser AAC GAT GAA TAT CAT TTG ATG CCG ATC AAA TTA CTG AAG GTT TCA TCT 349

"

G l n V a l Val Ala Gly V a l Lys Tyr Lys Met A s p V a l G l n Val Ala Arg CAA GTT GTC GCT GGT GTG AAA TAC AAG ATG GAT GTG CAG GTT GCT CGA 397

65

81 Ser Gln Cys Lye Lye Ser Ser Asn Glu Lys V a l A s p Leu Thr Lye Cy8 TCG M A TGT AAA AAA AGT TCG M T GAA AAA GTT GAT CTA ACA AAG TGC 445

Lys Lye Leu Glu Gly His Pro Glu Lys Val Met T h r Leu G l u Val Trp AAA AAA TTA GAA GGA CAT CCT GAA AAG GTT ATG ACT TTG GAA GTT TGG 493

Glu Lys Pro Trp G l u Asn Phe Met A r g V a l Glu I le Leu Gly T h r Lys 113

GAG AAA CCA TGG GAG AAT TTT ATG CGC GTC GAA ATT CTG GGA ACA AAA 541

129 Glu V a l *** GAA GTA T- TTC TTT CTG TAG TTT TTT TCT CCA CTC TAT TTT 589

97

AGA CTT CTT CTC TGG TVC TTT GCT AAA ACA TTT CTG TCG TTT TGG TGC 631 CTT AGA TAT TTT CGA TTA TAT TGA ATA ATT TTG TAA AAT CCA AGG TAA 685 TCT TTT BBTTbb TGC ATA AAG ATT TAA AGC TGA TAA A W AAA AM AAA 733 AAA 736

FIG. 1. Nucleotide sequence and deduced amino acid sequence of onchocystatin. The sequence contains the previously reported sequence of the OV7 cDNA clone, bp 157-736 ( l ) , combined with the additional PCR-amplified fragment, bp 1-156. Both contain the coding sequence for the mature onchocystatin (130 amino acid residues) and a 32-amino acid signal peptide. The numbering of amino acids begins at the proposed amino terminus of the mature protein; residues on the 5' side of residue 1 are indicated by negative numbers. A termination codon (TGA) at residues 548-550 is asterisked. Puta- tive polyadenylation signals are underlined. The primers and the nucleotide probe used for the extention of the OV7 sequence by PCR are boxed. The 22-nucleotide sequence at the 5' end is the SL sequence of C. elegans.

t o the first ATG (bp 62-64) postulated initiating codon. This probable initiator codon is located 24 nucleotides downstream of a stop codon (TAA) and is flanked by sequences in agree- ment with the Kozak initiation consensus (34). Sequence analysis from the postulated initiator methionine indicates a putative signal peptide of 32 amino acid residues. Using the -1, -3 prediction method of Von Heijne (35), a potential signal peptidase cleavage site was found between -1 and +1, which gives an amino-terminal lysine and a 130-amino acid


polypeptide. The calculated molecular weight of the polypeptide is about 15,000.

Expression of OV7 in pGEX-1N andpPR687 Cloning Vectors

The expression and purification of GST-OV7 and MBP- OV7 fpps are illustrated in Fig. 2, A and B, respectively. A major protein band of GST-OV7 with a relative molecular mass of about 42 kDa (27.5 kDa corresponding to GST and 15.2 kDa to the OV7 cDNA clone) became prominent after induction with 0.1 mM IPTG for 3 h (Fig. 2A, lane I). The 42-kDa GST-OV7 fpp was purified from cell lysate (lane 2 ) by affinity chromatography on glutathione-agarose beads followed by elution with reduced glutathione (lane 3). The protein band of MBP-OV7 with a relative molecular mass of about 55 kDa (40 kDa corresponding to MBP and 15.2 kDa to the OV7 cDNA clone) became prominent after induction with 0.3 mM IPTG for 2 h (Fig. 2B, lane 1). The 55-kDa MBP-OV7 fpp was purified from cell lysate (lane 2 ) by affinity chromatography on amylose beads followed by elution with maltose (lane 3). GST or MBP was purified from culture lysates of E. coli transformed with the plasmid vector alone. The purification procedure was as for the fusion polypeptides (data not shown).

OV7 Fusion Polypeptide Is a Specific Cysteine Proteinase Inhibitor

Cathepsin B Inhibitory Actiuity of OV7 Fusion Polypep- tides-The specific inhibitory activities of GST-OV7 and MBP-OV7 fpps with cathepsin B were compared in a colori- metric assay, using Z-Arg-Arg-2NA as the substrate (Fig. 3). GST-OV7 produced more inhibition of cathepsin B than MBP-OV7. 1 p~ of GST-OV7 in comparison with 4 PM of MBP-OV7 inhibited 50% of the enzymatic activity of cathepsin B (8.3 pM). On the basis of 1:l stoichiometry of reaction, the molecular mass of the OV7 fusion polypeptides, and the molar percent of the onchocerca-OV7 peptide-cystatin-like molecule, it appeared that the preparations of the fusion polypeptides ranged from 50 to nearly 100% activity. GST or MBP alone did not produce any inhibition of cathepsin B.

Specificity of Inhibition"OV7 fpps were tested for the capacity to inhibit a variety of serine and metalloproteinases (Table 11). Two serine proteinases, bovine trypsin and bovine a-chymotrypsin, were tested for susceptibility to OV7 fpps in assays with Z-Val-Leu-Arg-AMC and Suc-Leu-Leu-Val-Tyr- AMC as substrates, respectively. 5 times the concentration of GST-OV7 (5 p ~ ) or MBP-OV7 (20 PM), which inhibits 50% of cathepsin B, gave no detectable inhibition, whereas PMSF

A

84-

B : . A7 -

3A- kg- 33 - 24- '

W .I- 47-

33-

2 4- - 1 2 3 1 2 3

FIG. 2. SDS-polyacrylamide gel electrophoresis of the expression and purification of GST-OV7 ( A ) and MBP-OV7 ( B ) fpps. 10% gel was loaded with E. coli cell lysate after IPTG induction (A and B, lane I), supernatant after centrifugation and before binding to glutathione-agarose beads (A, lane 2) or amylose ( B , lane 2), and eluted material from the beads ( A and B, lane 3 ) . Samples were equivalent to 200 pl of culture. Molecular mass markers (in kDa) are indicated on the left.

"t * * -

GST

GST- OW

MBP MBPOW

0 ; 2 3 4 5 6 7 0 9 1 0

JJM OF INHIBITOR

FIG. 3. Inhibitory effect of GST-OV7 and MBP-OV7 fpps on the cysteine proteinase cathepsin B. 62.5 ng (8.3 pM) of enzyme was preincubated for 30 min with varing amounts of the inhibitors or the control polypeptides GST and MBP, and then the residual activity of the enzyme was determined by the addition of substrate (0.5 mM Z-Arg-Arg-2NA) for 10 min and color reagent. The absorbance was measured a t 520 nm as described (28). Results are expressed as percent of residual activity of the enzyme against the concentration of the inhibitors.

TABLE I1 Enzyme specificity of the inhibitogv activity of onchocystatin

%

tion Enzyme Substrate Inhibitor Inhibi-

Serine proteinases Tr-ypsin Z-Val-Leu-Arg-AMC 5 p~ GST-OV7

20 p M MBP-OV7 5 p M PMSF

Chymotrypsin Suc-Leu-Leu-Val- 5 p M GST-OV7 Tyr-AMC 20 p M MBP-OV7

Metalloproteinase Leu-AMC 5 p M GST-OV7 (leucine ami- 20 p M MBP-OV7 nopeptidase) 50 mM EDTA

5 p M PMSF

0 0

90 0 0

100 0 0

80

TABLE I11 Comparison of Ki values for inhibition of cysteine proteinases by

G S T - O V ~ ~ R R Cvsteine Droteinase Substrate K,

nM Cathepsin B Z-Arg-Arg-AMC 170

E. histolytica" Z-Arg-Arg-AMC 0.07

C. ekgansb Z-Phe-Arg-AMC 25 A cysteine proteinase present in crude trophozoite lysate with a

A cysteine proteinase with a cathepsin L-like activity. cathepsin B-like activity.

caused 90-100% specific inhibition. A metalloproteinase, leucine aminopeptidase, was assayed under the same conditions as the serine proteinases, but using Leu-AMC as the substrate. Both OV7 fpps gave no detectable inhibition, whereas EDTA caused 80% specific inhibition.

Inhibition Constants of Onchocystatin for Cysteine Protein- ases-As GST-OV7 fpp proved to be a more potent inhibitor of cathepsin B than MBP-OV7 fpp, we used GST-OV7 fpp in assays with a variety of cysteine proteinases and calculated the Ki values (Table 111). Cathepsin B was assayed with Z- Arg-Arg-AMC at pH 6.0 containing 1 mM EDTA and 5 mM dithiothreitol, in the presence of a series of concentrations of GST-OV7 fpp, and the results were replotted by the method of Dixon and Webb (31) to give a Ki of 170 nM. Two partially purified cysteine proteinases, one from a free living nematode,


C. elegans, and another one from a protozoan parasite, E. histolytica, were assayed with Z-Phe-Arg-AMC at pH 7.0 and with Z-Arg-Arg-AMC, at pH 5.5, respectively, in the presence of a series of concentrations of GST-OV7 fpp, to give Ki values of 25 and 0.07 nM, respectively. The OV7 cystatin-like inhibitor was a more potent inhibitor of the nematode and protozoan cysteine proteinases than of bovine cathepsin B.

Alignment of Amino Acid Sequences of Onchocystatin and Other Members of the Cystatin Superfamily

Homology search of the PIR protein data base indicated significant homology between onchocystatin and the cystatin superfamily (1). Comparison of the deduced amino acids of onchocystatin with those of the other members of the cystatin superfamily: family 1 (stefins), family 2 (cystatins), and family 3 (kininogens), using the protein entries in PIR data base (released March 1991), showed significant sequence similarity with proteins of all three families (Fig. 4). In aligning these sequences, breaks were introduced to optimize similarity. From family 1 we included human cystatin A (2), rat cystatin a (9), human cystatin B (lo), rat cystatin b (36), and rice cystain (13). From family 2 we included human cystatin C (3), ox colostrum cystatin (ll), human cystatin SN (7), human cystatin SA (37), chicken cystatin (12), and African puff adder venom cystatin (38). From family 3 we included the three segments of human (residues 19-375; 5) and ox (residues 19- 374; 39) kininogens: human segment 1 (19-130); segment 2 (131-252); segment 3 (253-375), and ox segment 1 (19-129); segment 2 (130-251); segment 3 (252-374). The codes for these cystatins were used according to the sequences and references that Rawlings and Barrett have described (40).

A sequence comparison of the 130 deduced amino acids of onchocystatin with all the other sequences showed an overall 63.8% identity, taking into account all the similar residues that were accumulated from comparison of all other sequences. In the amino-terminal region (residues 1-14, onchocystatin numbering), no sequence similarity was observed. In the rest of the region, residues 15-130, however, an overall higher sequence homology (71.5%) was observed. Comparison at the family level, an average of 18.9% (range 16.3-24.1%) was observed for family 1, 27.3% (25-28.5%) for family 2, and 12% for family 3 segment 1, 13.3% (12.9-13.7%) for segment 2, and 22.8% (20.6-25%) for segment 3. Thus, onchocystatin resembles family 2 cystatins and family 3 segment 3 kininogens more closely than family 1 and kininogen segments 1 and 2. It should be noted that the commonly conserved residues Gly', Gld3, Val55, and Gly5' (chicken cystatin numbering, Ref. 12) in all of the polypeptides with inhibitory activity (40) are also present in onchocystatin (Gly'l, Gld5, Val67, Gly6', onchocystatin numbering). Moreover, the complete pentapeptide QVVAG that is conserved in family 1 and segments 2 and 3 of the kininogens is also present in onchocystatin. This region has been proposed as either the reactive site or a region of secondary binding to the enzyme (15). The identical sequences in the carboxyl-terminal portions of all of the cystatins are related, but the most divergence has occurred between those of family 1 and the others. The carboxyl- terminal portion of onchocystatin contains more similar residues with those of family 2 and segment 3 of family 3, especially the tetrapeptide PWEN (residues 115-118 in onchocystatin numbering).

Phylogenetic trees were constructed by parsimony analysis

ov 1

r.ce ha

hb rb

ra

P=

bc hc

hsn hsa cc

hk-1 bk-1

hk-2 bk-2

bk-3 hk-3

ov 7

E.1- ha

hb rb

PC.=

bc hc

hra hsn

ra

5 5

hk-l bk-l

hk-2 bk-2

bk-3 hk-3

L P P E N

D E P E I I A -

D A A K A A T D S A O A A T

S L W N G D T S L S S G D T

I K K L G Q S I N I H C Q I

E E I T R K A F R E K L

K K O L K K O L

K Y T T

G E G E

- - G E - - G E

L D L H

.. "

.. "

G K R S S T K P S V A T O T - - - - - - C O l T P A K R G N M K F S V A I O T - - - - - - ~ L I T P

C A D K A H V D V K L R I S S F S O K - - - - - - C D L Y P C T D N A Y I D I O L R I A S F S O N - - - - - - C D l Y P -

FIG. 4. Amino sequence of onchocystatin aligned with those of other members of the cystatin superfamily. In aligning these sequences, breaks have been introduced to optimize similarity. The onchocystatin is aligned with those of family 1: rice cystatin (rice), human cystatin A (ha) , rat cystatin a ( ra) , human cystatin B (hb) , and rat cystatin b ( rb) . Family 2: African puff adder venom cystatin (pac), human cystatin C (hc) , ox colostrum cystatin (bc), human cystatin SN (hn), human cystatin SA ( h a ) , and chicken cystatin (cc). Family 3: three segments of human (residues 19-375) and Ox (residues 19-374) kininogens, human segment 1 (hk-I, 19-130); segment 2 (hk-2, 131-252); segment 3 (hk-3, 253-375), and ox segment 1 (bk-I , 19-129); segment 2 (bk-2, 130-251); segment 3 (bk-3, 252-374). The codes for these cystatins have been used according to the sequences and references described in Ref. 40. Identical amino acid residues are boxed. The numbering starts from the putative amino terminus of onchocystatin. Brackets indicate the disulfide bonds identified in several family 2 cystatins and inferred by homology and other indirect evidence for the kininogens and onchocystatin.


for onchocystatin and the proteins of family 1 and 2 cystatins using PAUP 3.0 program (David L. Swofford, Illinois Natural History Survey, Champaign, IL). The tree agreed with that constructed by Rawlings and Barrett (40). Onchocystatin branched from the cystatin 1 family as early as oryzacystatin (rice cystatin) and from the cystatin 2 family as early as puff adder cystatin (data not shown). Analysis of the amino acid sequence of onchocystatin in comparison with the sequences of family 1, 2, and 3 cystatins shows that onchocystatin contains 2 cysteines that may form a disulfide bond at residues 83 and 96. This putative disulfide bond is in a similar location to one of the two disulfide bonds of family 2 and one of the three disulfide bonds of family 3, which are conserved within the two families. In this regard, onchocystatin resembles the puff adder cystatin from family 2 which also contains only one disulfide bond. Interestingly, onchocystatin contains a stretch of a pentapeptide in the carboxyl-terminal region of the molecule, 5' to PWEN, VWEKP (residues 111-115), which is identical with oryzacystatin. Oryzacystatin is more similar to family 1 than family 2.

Disulfide Bond in Onchocystatin To establish if the putative disulfide bond between residues

83 and 96 in onchocystatin is actually formed, we probed a Western blot of crude PBS-soluble extract of adult female worm, which was separated on SDS-PAGE with or without the presence of 2-ME, with anti-OV7 fpp antibodies. As shown in Fig. 5, the migration of the parasite polypeptide corresponding to onchocystatin is different under these two conditions. In the presence of 2-ME the molecular mass of the antigen is about 17 kDa, similar to that reported previously (l), whereas without 2-ME the apparent molecular mass is higher. I t is likely that a disulfide bond is probably responsible for tke difference in migration.

Localization of Onchocystatin during Molting of L3 and in L4 We reported previously the localization of the protein cor-

responding to the cDNA clone OV7 in L3 and adult female worms (1). Immunoelectron microscopy established that the antigen was present in the hypodermis and the basal layer of the cuticles of L3 (Fig. 6a and Ref. 1) and adult female worms. In addition, the protein was present in the eggshell around the developing microfilariae but not in the developed microfilariae. In this study (Fig. 6 ) , immunoelectron microscopy of larvae during the molting of L3 in culture on days 2,3, and 4 permitted the localization of onchocystatin in the intermediate stages of the molting process. In addition the localization of onchocystatin in the developed L4 2 days after molting in uitro was determined. On day 4 or 5 in culture most of the larvae had completed the molt. On days 2 and 3 (Fig. 6 , b and

110- 84- 47 -

1 2

FIG. 5. Influence of 2-ME on the migration of the native parasite protein encoded by OV7 in SDS-PAGE. Total proteins (30 pg) present in PBS-soluble extract of adult female worms were boiled in the presence (lane 1 ) or absence (lune 2 ) of 2-ME before loading a 20% SDS-PAGE and electroblotting. The Western blot was probed with rabbit antiserum raised against GST-OV7 fpp. Molecular mass markers (in kDa) are indicated on the left.

FIG. 6. Ultrastructural localization by immunoelectron microscopy of onchocystatin. Thin sections of 0. volvulus third-stage larvae (a ) , successive developmental stages during molting of third- stage larvae i n uitro; 2 days ( b ) , 3 days ( c ) , and 4 days (d and e ) in culture, and of fourth-stage larvae 2 days after molting ( e ) , were incubated first with affinity-purified anti-OV7 fpp antibodies and then with protein A coupled to 15-nm gold particles for indirect antigen localization (bar, 200 nm). Note the formation of lakes (arrowheads) in the basal layer of the L3 cuticle and the development of the epicuticle (arrow) of L4 beneath these lakes ( b ) , the beginning of the separation between the new and old cuticle where the lakes fused (c), and the separation of the cuticles before the complete molt (d and e).

c ) the newly formed cuticle of L4 was evident in some areas beneath the basal layer of the old cuticle, where the "lakes" appeared below the old basal layer of L3. The lakes then fused, and the separation between the two cuticles was evident. The affinity-purified anti-OV7 fpp antibodies reacted strongly with onchocystatin in the basal layer of the molting L3, around the fused lakes, where the separation would take place, and in the cuticle of the newly formed L4. In addition, onchocystatin was present in the hypodermis of the newly developed L4. After separation of the L3 and L4 cuticles (Fig. 6 , d and e ) , onchocystatin was still present in the lower part of the old cuticle, where the separation occurred, and on the surface of the newly formed L4 cuticle. In the developed L4, 2-4 days after molting (Fig. 6 f ) , the protein was present in the hypodermis and the basal layer of the cuticle as in L3 before molting.

DISCUSSION

In our effort to clone L3-related antigens of 0. uoluulus for possible use in immunoprophylaxis of 0. uoluulus infection we used a broad spectrum hyperimmune chimpanzee antiserum generated against irradiated infective larvae in screening a cDNA library of adult 0. uoluulus mRNA. In a previous study we described the identification of a cDNA clone, designated OV7, which encodes a highly immunogenic parasite antigen that is present in 0. uoluulus L3, L4, and adult worm stages (1). The OV7 amino acid sequence of the cDNA clone showed a significant similarity with the cystatin superfamily of cysteine proteinase inhibitors (1, 18). In the present study we extended and sequenced the 5' end of OV7 and studied its structural and evolutionary relationship to other members of the cystatin superfamily. The amino acid sequence deduced from the combined nucleotide sequence of OV7 cDNA clone and the additional PCR products contained not only the


putative mature onchocystatin (130 amino acids) but in addition a putative hydrophobic signal peptide of 32 amino acids. The cleavage site for the signal peptide is proposed to be between the alanine residue at position -1 and the lysine residue at position +1 (Fig. 1). This suggests that Onchocerca cystatin is synthesized as a precursor protein with a signal peptide of 32 residues which are removed during translocation. Sequence analysis of the amino terminus of the mature parasite protein will need to be done to confirm this. Signal peptides of other extracellularily active cystatins have been reported (8, 41-43). The presence of a signal peptide in onchocystatin suggests that this protein exists predominantly in the extracellular space, as do most members of the cystatins of family 2. In the parasite the extracellular space in which onchocystatin is present is predominantly the cuticle above the hypodermis of L3, L4, and adult worms and in the eggshell surrounding the developing microfilariae.

The existence of a SL sequence in the 5”terminal end of OV7 sequence suggests that Onchocerca mRNA contains this conserved sequence. The location of SL in various transcripts and its perfect conservation among parasitic and free living nematodes argue that it serves similar functions for these organisms (24, 25, 44, 45).

Comparison of the onchocystatin amino acid sequence with those available for other members of the superfamily is shown in Fig. 4. It is clear that OV7 is a member of the cystatin superfamily as onchocystatin shows significant similarity with all stefins (18.9%), cystatins (27.3%), and fragments 2 (13.3%) and 3 (22.8%) of the kininogens. However, in terms of homology and location of identical amino acids residues, onchocystatin more closely resembles family 2 and fragment 3 of the kininogens than family 1, especially near the carboxyl- terminal region of the proteins. In addition, family 1 does not contain disulfide bonds, whereas family 2 and the kininogens have disulfide bonds. Onchocystatin probably contains one disulfide bond. This is based on different migration of the native protein on SDS-PAGE gel in the presence or absence of 2-ME and on the location of the 2 cysteines in the molecule which are similar to one of the disulfide bonds present in family 2 and in segments 2 and 3 of the kininogens.

Nevertheless, onchocystatin differs in two important as- pects from family 2 cystatins. One difference is in segment 90-96 (onchocystatin numbering), in which there is an insertion of 3 residues into the presumptive disulfide bond, residues 83 and 96. In this regard, onchocystatin is more similar to puff adder cystatin, which has an insertion of 6 residues into the same presumptive disulfide bond (38). The second difference concerns the number of disulfide bonds. Family 2 cystatins characteristically contain two disulfide bonds. Compar- ison of the number of cysteine residues in family 2, puff adder, and onchocystatin, 4, 3, and 2 respectively, suggests that onchocystatin diverged before puff adder and the other members of family 2. This is consistent with a phylogenetic tree based on sequence alignment and parsimony analysis which predicts an early divergence of onchocystatin from the cystatin 2 family.

In the carboxyl-terminal sequence, onchocystatin contains a motif, VWEKP, similar to rice cystatin, oryzacystatin, in residues 111-115. In addition, onchocystatin from residue 115 (P, proline), is similar to family 2 and not family 1, containing the stretch PWEN (residues 115-118). The phylogenetic trees calculated for these proteins suggest that onchocystatin is an intermediate between oryzacystatin and puff adder cystatin. Oryzacystatin also appears to be an intermediate between family 1 and family 2, having the strongest similarity to family 2 but lacking any disulfide bonds. Oryzacystatin was suggested

by Rawlings and Barrett (40) to form a new family. Oncho- cystatin might have evolved from such a family.

Onchocystatin is functional as a cysteine proteinase inhibitor. Enzymatic assays using cathepsin B as a cysteine pro- tease and Z-Arg-Arg-2NA as substrate showed that OV7 polypeptide fused to GST or MBP proteins inhibited the activity of the enzyme; 1 p~ GST-OV7 and 4 p M MBP-OV7 inhibited 50% of the enzyme activity (Fig. 1). The Ki for GST- OV7 fpp was determined as 170 nM using cathepsin B and Z- Arg-Arg-AMC as the substrate. The activity of OV7 as a proteinase inhibitor was specific to cysteine proteinases as 5 times the concentration of GST or MBP-OV7 fpps did not inhibit the activity of serine proteinases or metalloproteinase (Table 111). In enzymatic assays using cysteine proteinases purified from E. histolytica or C. elegans (kindly provided by Dr. Celeste Ray, UCSF Medical Center), the GST-OV7 fpp exhibited specific inhibition with Ki values of about 70 PM and 25 nM, respectively. The Ki values are similar to the values that have been reported for other members of the cystatin superfamily, in particular family 2 (18).

Onchocystatin is the first functional cystatin in the class Nematoda to be definitely identified. Additional cDNA clones with homology to cystatins have now been identified in Di- rofilaria immitis and in Brugia spp. Their sequences in the conserved region are about 88% identical to onchocystatin.2

Although a postulated role for cystatins has been the regu- lation of cysteine proteinase activity, a precise function for these proteins is not known. The adoptive advantage of a cysteine proteinase inhibitor in 0. volvulus, which is also antigenic during infection, is not obvious. At present we can only speculate as to the possible function of onchocystatin in 0. volvulus larval and adult stages. The immunogold electron microscopy data presented previously (1) and in this paper show that onchocystatin is present in all stages of development of the parasite but not in the mature microfilariae. It is clearly expressed and present in the cuticles of L3 and L4, during molting of L3 to L4 around the sites of cuticle separation, in the cuticle of female adult worm, and in the eggshell of developing microfilariae. Our hypothesis is that L3, molting L3, L4, and adult worms express a cysteine proteinase that is regulated by onchocystatin. This cysteine proteinase may play a role in the process of molting and cuticle loss and in the development of microfilariae in the uterus of female worms. Preliminary studies to confirm this hypothesis have been carried out. The effects of specific inhibitors of cysteine proteinases have been examined during the molting of L3 to L4. Z-Phe-Ala-fluoromethyl ketone, a specific irreversible inhibitor of cathepsin B and L (46), arrested 40-100% of molting at concentrations of 50-250 P M . ~ These results are consistent with the hypothesis that cysteine proteinases are important in the development of the parasite, particularly during the molting process, which may open up important avenues for drug development. Further work will focus on the identification of the target cysteine proteinase to help define a more precise role for onchocystatin.

Acknowledgments-We thank Dong-Hun Lee for DNA sequencing and preparation of synthetic oligonucleotides, Dr. Robert Fields for computer assistance, Dr. Ross Coppel for providing the pGEX-IN plasmid, Dr. Paul Riggs for providing the pPR687 plasmid, and Dr. Xiquiang Hong for advice on proteinase assays. We are also grateful to Dr. Francine Perler for useful discussions and the SL primer and to Dr. Colvin Redman for comments on the manuscript.

* Y. Hong and L. McReynolds, personal communication. S. Lustigman, B. Brotman, T. Huima, A. M. Prince, and J. H.

McKerrow, unpublished results.

1 7

1.

2.

3.

4.

5.

6.

7. 8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

346 Onchocystatin, a Cysteine Prc REFERENCES

Lustigman, S., Brotman, B., Huima, T., and Prince, A. M. (1991) Mol.

Machleidt, W., Borchart, U., Fritz, H., Brzin, J., Ritonja, A., and Turk, V.

Grubb, A,, and Lifberg, H. (1982) Proc. Natl. Acud. Sci. U. S. A. 7 9 , 3024-

Kitamura, N., Kitagawa, H., Fukushima, D., Takagaki, Y., Miyata, T., and

Salvesen, G., Parkes, C., Abrahamson, M., Grubb, A,, and Barrett, A. J.

Isemura, S., Saitoh, E., and Sanada, K. (1984) J. Biochem. (Tokyo) 9 6 ,

AI-Hashim. I.. Dickinson. D. P.. and Levine. M. J. (1988) J. Biol. Chem. Isemura, S., Saitoh, E., and Sanada, K. (1986) FEBS Lett. 198,145-149

Biochem. Parasitol. 45.65-76

(1983) Hoppe-Seyler’s 2. Physiol. Chem. 364,1481-1486

3027

Nakanishi, S. (1985) J. Biol. Chem. 260,8610-8617

(1986) Biochem. J. 234,429-434

489-498

263,9381-9387 Takio, K., Kominami, E., Bando, Y., Katunuma, N., and Titani, K. (1984)

Ritonja, A,, Machleidt, W., and Barrett, A. J. (1985) Biochem. Biophys.

Hirado, M., Tsunasawa, S., Sakiyama, F., Niinobe, M., and Fujii, S. (1985)

Turk, V., Brzin, J., Longer, M., Ritonja, A., and Eropkin, M. (1983) Hoppe-

Abe. K.. Emori. Y., Kondo, H., Suzuki, K., and Arai, S. (1987) J. Biol.

Biochem. Biophys. Res. Commun. 121,149-154

Res. Commun. 131,1187-1192

FEES Lett. 186,41-45

Seyler’s 2. Physiol. Chem. 364 , 1487-1496

them: 262 , i6793-16797. Kondo, H., Abe, K., Nishimura, I., Watanabe, H., Emori, Y., and Arai, S.

(1990) J. Bid . Chem. 265.15832-15837 Abrahamson, M., Ritonja, A,; Brown, M. A,, Grubb, A,, Machleidt, W., and

Barrett, A. J. (1987) J. Biol. Chem. 262 , 9688-9694 Muller-Esterl, W., Fritz, H., Kellermann, J., Lottspeich, F., Machleidt, W.,

and Turk, V. (1985) FEBS Lett. 191,221-226 Barrett, A. J., Fritz, H., Grubb, A., Isemura, S., Jarvinen, M., Katunuma,

N.. Machleidt, W., Muller-Esterl, W., Sasaki, M., and Turk, V. (1986)

Barrett, A. J., Rawlings, N. D., Davies, M. E., Machleidt, W., Salvesen, G., Biochem. J . 236,312

and Turk. V. (1986) in Proteinase Inhibitors (Barrett. A. J.. and Salvesen. G., eds) pp. 515-569, Elsevier Science Publishing Co., Amsterdam

Smith, D. B., Rubira, M. R., Simpson, R. J., Davern, K. M., Tiu, W. U., Board, P. G., and Mitchell, G. F. (1987) Mol. Biochem. Parasitol. 2 7 , 249-256

Smith, D. B., and Johnson, K. S. (1988) Gene (Amst . ) 67,31-40

lteinase Inhibitor of 0. volvulus 21. Guan, C., Li, P., Riggs, P. O., and Inouye, H. (1988) Gene (Amst . ) 67,21-

xn 22. Laemmli, U. K. (1970) Nature 227,680-685 23. Towbin, H., Staehelin, T., and Gordan, J. (1979) Proc. Natl. Acud. Sci.

24. Bektesh, S. L., and Hirsh, D., (1988) Nucleic Acids Res. 16 , 5692 25. Zeng, W., Alarcon, C. M., and Donelson, J. E. (1990) Mol. Cell. Biol. 1 0 ,

U. S. A. 76,4350-4354

376.5-377.1 26. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Moleculur Cloning: A

Laboratory Manual, 149-185, 309-401. Cold Sprlng Harbor Laboratory, Cold S rin Harbor, NY

27. Sanger, 8, dcklen, S., and Coulson, A. R. (1977) Proc. Natl. Acud. Sci. U. S. A . 74,5463-5467

28. Barrett A. J. and Kirschke H. (1981) Methods Enzymol. 80, 535-561 29. Keene, W . E.: Petitt, M. G.,’Allen, A,, and McKerrow, J. H. (1986) J. Exp.

30. Sarkis, G. J., Ashcom, J. D., Hawdon, J. M., and Jacobson, L. A. (1988)

31. Dixon M., anyWebb E. C. (1979) in Enzymes (Dixon, M., and Webb, E.

32. Lustigman, E., HGma, T., Brotman, B., Mlller, K., and Prince A. M. (1989)

33. Lole J. B., Pollack, R. J., Cupp, E. W., Bernardo, M. J., Donnelly, J. J.,

34. Kozak, M. (1986) Cell 44,283-292 35. Von Hei‘ne, G. (1988) Biochim. Biophys. Acta 947,307-333 36. Takio, d., Kominami, E., Wakamatsu, N., Katunuma, N., and Titani, K.

37. Isemura, S., Saitoh, E., and Sanada, K. (1987) J. Biochem. (Tokyo) 102 ,

38. Riton‘a A. Evans H. J., Machleidt, W., and Barrett, A. J. (1987) Biochem.

39. Sue oshi T Enjyoji K.-I., Shimada, T., Kato, H., Iwana a, S , Bando, Y.,

40. Rawlings N. D. and Barrett, A. J. (1990) J. Mol. Euol. 3 0 , 60-71 41. AbrahamLon, M., Grubb, A., Olafsson, I., and Lundwall, A. (1987) FEBS

42. Saitoh, E., Kim, H. S., Smithies, O., and Maeda, N. (1987) Gene (Amst . )

43. Colella, R., Sakaguchi, Y., Nagase, H., and Bird, W. C. (1989) J. Biol.

44. Nilsen, T. (1989) Exp. Parasitol. 6 9 , 413-416 45. BeFltEs,h, S., Van Doren, K., and Hirsh, D. (1988) Genes & Deu. 2 , 1277-

- . - - - . . I

Med. 163,536-549

Mech. Agei Deu. 4 5 , 191-201

C., lds) p 332 386, Longmans Co., London

Exp. Parasitol. 71,489-495

a i d Albiez, E. J. (1984) Tropenmed Parasit. 3 6 , 209-211

(1983) Biochem. Biophys. Res. Commun. 116,902-908

693-704

J. 4 4 6 , $99-80;

?omi;amI, E., and Katunuma, N. (1985) FEBS. Lett. 881,’193-195

Lett. 216,229-233

61,329-338

Chem. 264,17164-17169

46. Rasnick D. (1985) Anal. Biochem. 149,461-465 47. World Health Organization (1987) WHO Tech. Rep. Ser. 752, l -167

1dO.s

molecular cloning and characterization of onchocystatin, a ... · in this study we show that the...

Documents