modified nucleotides and nucleic acids as molecular …gc497qr2572/samantak ghosh ph.d... · wang...
TRANSCRIPT
MODIFIED NUCLEOTIDES AND NUCLEIC ACIDS AS
MOLECULAR PROBES
A DISSERTATION
SUBMITTED TO THE DEPARTMENT OF CHEMISTRY
AND THE COMMITTEE ON GRADUATE STUDIES
OF STANFORD UNIVERSITY
IN PARTIAL FULFILMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSPHY
SAMANTAK GHOSH
FEBRUARY 2010
http://creativecommons.org/licenses/by-nc/3.0/us/
This dissertation is online at: http://purl.stanford.edu/gc497qr2572
© 2010 by Samantak Ghosh. All Rights Reserved.
Re-distributed by Stanford University under license with the author.
This work is licensed under a Creative Commons Attribution-Noncommercial 3.0 United States License.
ii
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Eric Kool, Primary Adviser
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
James Chen
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Wray Huestis
Approved for the Stanford University Committee on Graduate Studies.
Patricia J. Gumport, Vice Provost Graduate Education
This signature page was generated electronically upon submission of this dissertation in electronic format. An original signed hard copy of the signature page is on file inUniversity Archives.
iii
ii
Abstract
This thesis discusses a number of projects involving the use of modified nucleotides
and oligonucleotides in addressing some basic science questions and some clinical and
technological applications.
The first chapter details our efforts at using telomere-encoding circular DNA in
elongating zebrafish telomeres. Our lab had previously successfully lengthened
telomeres in vitro using these artificial oligonucleotides and advancing to the in vivo
studies is the next logical step towards making this technology more clinically relevant.
We microinjected our synthetic circular DNA into zebrafish embryos and studied their
telomere length 24 hrs later. Using Quantitative Fluorescence in situ Hybridization (Q-
FISH) as the analytical tool to determine telomere length, we observed no significant
difference in telomere length between the group injected with the synthetic DNA and
the control group.
In the second chapter we study the potential of a non-polar shape mimic of iodo-uracil
as an imager of tumors. I123/125
-labeled iodo-uracil has been shown to colocalize with
tumors and decrease their growth. However its usage is limited by some of its
unfavorable bio-pharmacokinetics. Compared to iodo-uracil the non-polar shape mimic
was expected to have much better stability and bio-availability. Hence radiolabeled 1-
(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene was injected into nude mice
containing tumor. However it was observed that the molecule was mostly taken up in
the thyroid and showed no significant deposition in the tumor cells.
iii
We continued working with non-polar nucleotide isosteres in investigating a novel
active site in polymerase from Pyrococcus furiosus (Pfu) in the third chapter. This
polymerase which is also used in PCR applications has been found to be inhibited by
deaminated bases like uracil and hypoxanthine. In order to study the importance of
shape and hydrogen bonding in base discrimination by this polymerase pocket we
employed non-polar shape mimics of uracil (F) and hypoxanthine (Fbim). We also
attempted to study the conformation (syn/anti) in which the bases were identified in this
pocket and employed oxidized nucleobases including oxo-guanosine and oxo-inosine
for our studies. It was discovered that F, the shape mimic of uracil was recognized by
this pocket moderately while Fbim, the shape mimic of hypoxanthine was not
recognized significantly. Neither of the oxidized bases was recognized by this binding
pocket. From these observations we concluded that although shape was an important
factor in distinguishing bases, this binding site also employed hydrogen bonding to
identify nucleoabases. The lack of any recognition of the syn-oxidized bases suggested
that the enzyme recognized bases in the anti conformation rather than syn.
In the fourth chapter we were interested in understanding the factors determining the
fidelity and selectivity observed in RNA Polymerase II mediated transcription. Once
again we used non-polar shape mimics of thymidine (dF) and adenine (dQ) to study the
importance of shape and hydrogen bonding. We observed that the thymidine mimic was
recognized better by the RNA Polymerase II active site than the mis-match bases. The
adenine isostere on the other hand, was poorly recognized. This preliminary study
demonstrates the importance of both shape and hydrogen bonding.
iv
The last chapter discusses our studies using polyfluorophores on a DNA backbone to
detect gases. Following a combinatorial method, a library of oligodeoxyfluorosides
(ODFs) were synthesized from which sensors of gases were selected. Using this method
we were able to select optical sensors for a diverse set of small molecules in the vapor
state.
v
Acknowledgements
I would like to express my sincere gratitude to my adviser Prof. Eric T. Kool for his guidance
and support during my graduate school. Eric is a great scientist and an excellent mentor. He
encourages his students to flourish in their own way and in that sense has a very modern
perspective on mentoring graduate students.
I also take this opportunity to thank Prof. James Chen. He had kindly allowed us to use his
zebrafish facility and taught me various techniques which were integral part of my work on
telomeres.
I would also like to thank both James and Prof W. Huestis for guiding me during graduate school
by being my Reading Committee Members.
I am indebted to all my collaborators: the Kassis Lab (for the tumor imaging project), the
Connolly Lab (for the project investigating uracil binding in archaeal polymerase), Dr. Dong
Wang (for the RNA polymerase studies) and Dr. F. Samain (for the polyfluorophore project).
Without their contribution this Doctoral thesis would not have come to fruition.
My thanks to my former colleague and friend Dr. Lucian Orbai who taught me how to take the
QFISH measurements for the telomere project.
Dr Greg Miller (who has been a like a bullying but caring elder brother), Dr Younjin Cho (or as I
call her Younjin didi) and Rabea Grisat (my cute little German sister) are some of the very close
friends that my graduate school had bestowed upon me, for which I would be eternally thankful.
I would also like to thank Rafael, Nan, Florent and Pete for making the life in 109 such a fun
experience.
vi
My thanks to all the past and present Kool group members with whom I have worked. I have
learned more than Chemistry from them.
My friends outside the lab provided me the social cushion to weather the ups and downs of
graduate school for which I am greatly thankful to them.
I thank Avi for helping me with indexing this thesis and also for his constant support and
encouragement.
Last but not the least, I thank my parents for their selfless love and unwavering support and my
sister for bringing so much joy and inspiration to my life.
vii
Table of Contents
Chapter 1 ................................................................................................................................................ 1
Introduction ............................................................................................................................................ 1
1.1 Modified oligonucleotides encoding telomeres .............................................................................. 1
1.2 Isosteres as shape mimics of nucleotides ....................................................................................... 3
1.3 Oligodeoxynucleosides in detection of gases.................................................................................. 4
Chapter 2 ................................................................................................................................................ 5
Elongating telomeres in zebrafish (a vertebrate model organism)............................................................ 5
2.1 Introduction ................................................................................................................................... 5
2.2 Telomere shortening and Cellular Senescence ............................................................................... 6
2.3 Telomeres are maintained by Telomerase ...................................................................................... 7
2.4 Structure of Telomerase ................................................................................................................ 7
2.5 Activation or reconstruction of Telomerase ................................................................................... 9
2.6 Alternative Lengthening of Telomeres (ALT) ................................................................................. 10
2.7 Rolling Circle Elongation of Telomeres ......................................................................................... 12
2.8 Factors affecting rolling circle replication ..................................................................................... 13
2.9 In vitro elongation of Telomeres using Rolling Circle Amplification ............................................... 14
2.10 Rolling circle elongation in vivo .................................................................................................. 16
2.11 Zebrafish (Danio reiro) as a model organism .............................................................................. 17
2.12 Developmental Stages of a Zebrafish ......................................................................................... 19
2.13 Microinjection into zebrafish embryos ....................................................................................... 20
2.14 Synthesis of the circular DNA ..................................................................................................... 21
2.15 Microinjection and Distribution of Fluorescein-labeled Circular DNA in the embryo ................... 25
2.16 Available Techniques for telomere measurement ...................................................................... 27
viii
2.17 Quantitative Fluorescence in situ Hybridization (Q-FISH) ............................................................ 30
2.18 Optimization of the metaphase preparation from zebrafish embryos ......................................... 32
2.19 Preparation of slides for Q-FISH analysis .................................................................................... 33
2.20 Dosage of circular DNA and mortality rate ................................................................................. 36
2.21 Q-FISH on zebrafish metaphase spreads..................................................................................... 37
2.22 Telomere length of 24hr old zebrafish ........................................................................................ 40
2.23 Telomere length after injection with telomere encoding circular DNA ........................................ 42
2.24 Discussion of telomere determination experiments ................................................................... 46
2.24 Summary ................................................................................................................................... 48
Chapter 3 .............................................................................................................................................. 49
Investigating the potential of radio-iodinated non-polar nucleoside analogs in tumor detection and
therapy ................................................................................................................................................. 49
3.1 Introduction ................................................................................................................................. 49
3.2 Therapeutically useful Auger emitters .......................................................................................... 50
3.3 Auger emitters targeting tumor ................................................................................................... 51
3.4 Radiolabeled 5-Iodo-2’-deoxyuridine (*IdU).................................................................................. 52
3.5 Non-polar nucleoside analogs ...................................................................................................... 55
3.6 Pharmacokinetics and metabolism of IdF (5-iodo-dF) ................................................................... 57
3.7 Effect of IdF on cancer cells .......................................................................................................... 57
3.8 Preparation radiolabeled ICl2PhdR ............................................................................................... 61
3.9 Synthesis of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene ...................................... 62
3.10 Stability and pharmacology of ICl2PhdR ...................................................................................... 64
3.11 Discussion of tumor-imaging experiments .................................................................................. 69
3.12 Summary ................................................................................................................................... 70
ix
Chapter 4 .............................................................................................................................................. 71
Investigating the steric and electronic discrimination of deaminated and oxidized bases by a novel
binding site of polymerase from Pyrococcus Furiosus (Pfu) .................................................................... 71
4.1 Introduction ................................................................................................................................. 71
4.2 Deamination of nucleobases ........................................................................................................ 71
4.3 Oxidation of bases ....................................................................................................................... 74
4.4 DNA repair ................................................................................................................................... 75
4.5 Base excision repair (BER) ............................................................................................................ 76
4.6 Stability and repair of DNA in hyperthermophilic archaea ............................................................ 76
4.7 Archaeal polymerases are inhibited by uracil ............................................................................... 78
4.8 Structure of archaeal polymerase bound to uracil containing DNA ............................................... 80
4.9 Role of hydrogen bonding and shape in base recognition ............................................................. 81
4.10 Non-polar analogs in investigating the importance of hydrogen-bonding ................................... 82
4.11 Dual recognition of both uracil and hypoxanthine ...................................................................... 83
4.12 Preparation of DNA sequences for polymerase extension assays................................................ 87
4. 13 Synthesis of F-phosphoramidite ................................................................................................ 88
4.14 Synthesis of oxoI-phosphoramidite ............................................................................................ 88
4.15 Primer extension assays with the polymerase enzyme ............................................................... 91
4.16 Results ....................................................................................................................................... 91
4.17 Discussion .................................................................................................................................. 98
4.18 Summary ................................................................................................................................... 99
Chapter 5 ............................................................................................................................................ 100
Investigating the importance of shape and hydrogen bonding in base recognition by DNA dependent
RNA polymerase II ............................................................................................................................... 100
5.1 Introduction ............................................................................................................................... 100
x
5.2 Hydrogen-bonding in RNA polymerases ..................................................................................... 100
5.3 RNA Polymerase II...................................................................................................................... 102
5.4 Hydrophobic analogs of adenine and thymine ........................................................................... 103
5.5 Synthesis of sequences for RNA polymerase studies .................................................................. 104
5.6 Synthesis of the dQ-phosphoramidite ........................................................................................ 105
5.7 Extension assays with Pol II enzyme ........................................................................................... 106
5.8 Results ....................................................................................................................................... 111
5.9 Discussion .................................................................................................................................. 111
5.10 Summary ................................................................................................................................. 112
Chapter 6 ............................................................................................................................................ 113
Development of polyfluorophores on a DNA backbone that could be used as sensors of small molecules
in the vapor phase ............................................................................................................................... 113
6.1 Introduction ............................................................................................................................... 113
6.2 Polychromophores of fluorescent nucleobases .......................................................................... 114
6.3 Using oligodeoxyfluorosides for gas detection ........................................................................... 114
6.4 Synthesis of the library and screening (Courtesy Dr. F. Samain) .................................................. 116
6.5 Re-synthesis and characterization of the selected sequences ..................................................... 117
6.6 Using the selected beads as sensors ........................................................................................... 117
6.7 The sensing of gases .................................................................................................................. 121
6.8 Discussion .................................................................................................................................. 123
6.9 Summary ................................................................................................................................... 124
Chapter 7 ............................................................................................................................................ 125
Material and Methods ......................................................................................................................... 125
7.1 Synthesis of 6-N-(l-(Dimethylamino)ethylene)-2’-deoxyadenosine (dma-dA) .............................. 125
xi
7.2 General procedure for the synthesis of non-polar thymidine/uracil analogs ............................... 126
7.3 Synthesis of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene and the corresponding
stannyl-analog ................................................................................................................................. 130
7.4 Synthesis of 7,8-dihydro-8-oxo-2’-deoxyinosine ......................................................................... 132
7.5 Synthesis of 1-[2-Deoxy-β-D-erythro-pentofuranosyl]-9-methyl-imidazo[(4,5)-b]pyridine (dQ)... 133
7.6 General Procedure for DMT protection and preparation of phosphoramidites ........................... 137
7.7 Primer extension assays with archaeal DNA polymerases enzymes ............................................ 138
7.8 Oligodeoxyfluoroside (ODF) library synthesis methods............................................................... 138
7.9 Image processing methods for screening ................................................................................... 140
References .......................................................................................................................................... 142
1
Chapter 1
Introduction
Since the identification of DNA as the basic genetic material, several attempts were
made early on to synthesize defined oligonucleotides169a-d
. However it was not until the
early 80s when the automation of oligonucleotide synthesis and the development of
versatile phosphoramidite170,171
reagents made efficient scale-up of oligonucleotides
possible, thereby expanding their application to diverse areas of fundamental and
applied biological research. Efficient solid-phase synthesis coupled with enzyme-
assisted synthetic methods and the availability of modified nucleotides increased the
utility of synthetic oligonucleotides172
. The last few decades has seen the wide use of
these synthetic biopolymers as molecular probes to understand the interaction between
proteins and nucleic acids at molecular level, and as therapeutic and diagnostic agents
and sensors173a,b,c
.
1.1 Modified oligonucleotides encoding telomeres
The Kool lab has been at the forefront of studies aimed at gaining basic understanding
of biological mechanisms by using modified nucleotides and applying this
understanding to the design and development of novel functionally useful molecular
probes174a-c
. A classic example of this approach is the group‟s work towards the
development of telomere encoding synthetic oligonucleotides. In order to study the
DNA binding properties of circular RNA involved in triple-helix formation, the group
2
had developed methods for efficient synthesis of circular oligonucleotides175
. Since
nucleic acids serve not only as recognition elements but also as encoders of genetic
information the group subsequently examined whether these circular oligonucleotides
could act as substrates of enzymes. They observed that some of these circular DNA
molecules could serve as efficient templates for transcription with RNA polymerase in
the absence of RNA primers or RNA promoter sequence176
. The group suggested that
RNA synthesis occurred by a “rolling circle” mechanism, in which after initiation the
polymerase produces many true repeating RNA copies of the DNA strand, progressing
around the circle multiple times. One year later they reported the same activity with
DNA polymerases resulting in the “rolling circle amplification” of circular DNA
sequences in the presence of complementary primers177
. The idea of rolling circle
elongation was then applied to the extension of telomeric ends of chromosomes. Using
telomeric 3‟-overhang as the primer for 54 nucleotide long complementary circular
DNA, the group was able to elongate telomeres on human chromosomes by several
thousand bases178
.
Since telomere length is the time clock that determines how long a cell can divide
before it dies10,11
, the artificial lengthening of telomeres has tremendous therapeutic
implications, as will be discussed in details in the second chapter of this thesis. Having
demonstrated the in vitro elongation of human chromosomes the Kool lab was eager to
pursue these studies in vivo. The second chapter discusses our efforts at elongating
telomeres in zebrafish (a model organism) using the principles of rolling circle
elongation.
3
1.2 Isosteres as shape mimics of nucleotides
Continuing with the theme of clinical and therapeutic significance of modified
nucleotides we discuss our studies in using artificial nucleosides as tumor tracers in the
third chapter. Almost a decade ago, the Kool lab had designed and developed non-polar
hydrophobic isosteres of nucleosides as close structural and steric mimics of natural
nucleosides99,100
. Although these bases were found to be destabilizing in DNA they
were surprisingly well accepted by DNA polymerases107
leading the group to
hypothesize the active-site tightness model which explained base pairing by steric
matching rather than hydrogen bonding. Furthermore, these nucleosides were expected
to have better metabolic stability and bio-availibility compared to natural nucleosides
because of their stable C-glycosidic bond and relative hydrophobicity, hence increasing
their therapeutic utility. In the third chapter of this thesis, we discuss the design and
application of one of these modified analogues in tumor detection and therapy.
Since these non-polar nucleoside mimics differ from their natural counterparts in the
absence of hydrogen-bonding groups they allow the investigation of the involvement
and importance of shape and hydrogen bonding in the interaction of nucleosides with
each other and within enzyme complexes. Transmission of the genetic information
from the parental DNA strand to the offspring is crucial for the survival of any living
species and is achieved by the replication machinery involving DNA polymerases. It
was recently observed that archaeal DNA polymerases have a novel way of maintaining
genomic integrity. They have a pocket which recognizes deaminated nucleobases and
stalls the DNA replication126
. It is of interest to understand how this pocket
4
discriminates the deaminated bases from structurally close natural bases. In the fourth
chapter we use nucleoside isosteres and some oxidized bases to probe the base
recognition mechanism of this pocket.
In the fifth chapter we extend the scope of our studies to RNA polymerases where we
once again use non-polar nucleoside isosteres to probe the active site of yeast RNA
polymerase II.
1.3 Oligodeoxynucleosides in detection of organic vapors
We finally end this thesis with a nifty application of artificial nucleobases in detection
of gases. The intrinsic fluorescent properties of natural nucleosides and nucleic acids
are limited179
but the DNA backbone does provide a convenient scaffold for attaching
fluorophores. Using fluorophores as substitutes for nucleobases the Kool lab had
developed a library of polyfluorophores called oligodeoxyfluorosides (ODFs)153
. It was
observed that the oligodeoxyfluorosides (ODFs) underwent multiple forms of electronic
interactions among the closely spaced chromophores, resulting in complex fluorescence
emission properties distinct from the component monomers153-157
. The last chapter
demonstrates the usefulness of such a library in sensing volatile compounds.
From basic science to biotechnological applications, this thesis provides the reader a
glimpse into a few of the numerous possible applications of modified nucleosides and
nucleic acids. Given the increased interest in this field one can only be certain that new
modifications and wider ranges of applications will be found of this class of compounds
in future.
5
Chapter 2
Elongating telomeres in zebrafish (a vertebrate model
organism)
2.1 Introduction
All eukaryotes, and a few prokaryotes, keep their genomes in the form of linear DNA
molecules. Eukaryotic telomeres end with 3′ protrusions at both chromosomal ends, as
demonstrated for ciliated protozoa, budding yeast, and human telomeres1,2,3,4
. The
physical ends of chromosomes, known as telomeres, cap the chromosome ends and
protect them from nucleolytic degradation and DNA repair activities. In most
organisms the telomeric DNA sequence is G-rich and is partially conserved, such as
„TTAGGG‟ in vertebrates or „TTGGGG‟ in ciliate Tetrahymena. The length of the
telomeric sequence can range from dozens to thousands of repeats5. It is generally
believed that this sequence is double-stranded except for the last few hundred bases of
the G-rich strand which are thought to be single stranded6,51
.
Fig 1. Telomeres cap the end of linear chromosomes [Ref 180]
6
2.2 Telomere shortening and Cellular Senescence
In the 1960s, Hayflick found that human diploid cells in culture divide a limited
number of times before undergoing a state called “cellular senescence”7. This state is
characterized by an irreversible stop of cellular proliferation and this limit has been
named "the Hayflick limit". A decade later, based on the mechanism of DNA
replication, James D. Watson described what he called "the end-replication problem".
Since conventional DNA-dependent polymerases replicate DNA only in the 5' to 3'
direction and cannot initiate synthesis of DNA chain de novo an 8- to 12- base stretch
of RNA is necessary to provide the 3'-OH end to prime DNA synthesis. Thus, during
DNA replication, the extreme 5' terminal end of the chromosome is not completely
copied, leaving a small region of telomere un-replicated8. This phenomenon leads to
shortening of chromosome ends with each successive division.
Finally in 1973, Olovnikov connected cellular senescence with the loss of telomeric
DNA. He proposed that telomere length acted like an intrinsic clock of aging that tracks
the number of cell divisions before cell growth arrest or replicative senescence sets in9.
Depending upon the type of cell the loss of telomere ranges from 25-
200bp/division10,11
. However, the correlation between telomere shortening and entry in
senescence is not absolute. It has been found that certain senescent cells have still rather
long telomeres (5-10 kb) and other cells with shorter telomeres keep their capacity to
divide. This discrepancy could be explained by the hypothesis that it is the shortest
telomere, and not the average size of telomeres that sets off senescence12
.
7
2.3 Telomeres are maintained by Telomerase
It was observed that in germ line or in tumor cells, loss of telomeric DNA due to
incomplete replication was balanced by telomere elongation, which may involve de
novo synthesis of additional repeats by a specific DNA polymerase13
. This enzyme
which was called Telomerase was discovered by Carol Greider and Elizabeth
Blackburn in 1984. This enzyme was found to be responsible for the maintenance and
elongation of telomeres, in a ciliate organism, Tetrahymena thermophilia14
. Further
investigation showed that this enzyme contains an RNA component and is thus a
ribonucleoprotein complex15
. This enzymatic activity was then detected in extracts of
human cell lines, where it synthesizes TTAGGG DNA repeats at chromosomal termini.
2.4 Structure of Telomerase
Telomerase is a ribonucleoprotein (RNP) whose catalytic function depends mainly on
two components: the TERT (telomerase reverse transcriptase) protein and telomerase
RNA (known as TR or TER). The telomerase RNA contains a short segment, which
encodes the telomere repeat, and serves as a template for reverse transcription by TERT
(Figure 2). The primer for reverse transcription is provided by the 3‟-overhang of the
telomeres. Although sharing many properties of “conventional” reverse transcriptases,
TERT also exhibits unique features; the primary ones are its utilization of a template
embedded in a large RNA and its ability to add multiple complements of the template
through repeated cycles of extension and “translocation” reactions10b
.
8
Fig 2. Telomere replication by reverse transcription of an RNA template in the
Telomerase [Ref 10(c): Mol. Biol. 2006; Reproduced with permission]
Since its discovery in 1980s, various applications of Telomerase have been proposed in
the field of diagnostics and therapeutics. Compared to most normal somatic cells where
telomerase is repressed, the expression of telomerase has been detected in most cancer
cells10a
. Hence the telomere/telomerase system offers ways to intervene in the
proliferative activity of the cell which could be beneficial for both cancer therapy as
well as treatment of degenerative diseases. Inhibition of telomere maintenance in tumor
cells by inhibiting telomerase could trigger their senescence. On the other hand,
increasing the telomere length by activating the residual telomerase or expressing
telomerase in normal somatic cells could alleviate their degeneracy.
9
2.5 Activation or reconstruction of Telomerase
Multiple lines of evidence suggest that telomere loss has a role to play in degenerative
diseases. Epidemiological studies show that individuals with short telomeres in their
blood cell DNA are statistically at higher risk for stroke (cerebrovascular dementia),
heart disease, and infections, compared to individuals with longer telomeres21,22
.
Genetic disorders like Dyskeratosis congenita, characterized by failure of proliferative
tissues like bone marrow, skin, hair and nails, are known to be caused by mutations in
the structure of telomerase leading to defective telomere maintenance23a
. So far efforts
to reduce telomerase loss have been focused on three main strategies23b
: (1) classical
gene therapy involving transfection with telomerase encoding sequences24
, (2)
telomerase promoter reprogramming in order to activate the repressed telomerase
gene25
, and (3) using telomerase activating molecules that interact directly with the
enzyme to enhance the low residual activity in some cells. However possible malignant
transformation in the presence of constitutively expressed telomerase is a concern in
ectopic expression of telomerase. On the other hand telomerase activators are limited in
their therapeutic effect because they can activate telomerase only in tissues with
residual telomerase activity. Although telomere or telomerase specific agents have been
rare, a number of activators have already shown promising results. TA-65, a telomerase
activator agent derived from the Chinese Astragalus plant, is licensed to Telomerase
Activation Sciences and Geron, has already been tested in a pivotal clinical study, and
showed to improve immune function, eye sight and skin characteristics by increasing
telomere length through hTERT gene activation26
. .
10
2.6 Alternative Lengthening of Telomeres (ALT)
In the late 90s, it was observed that some mammalian cells without any telomerase
activity are able to maintain the length of their telomeres for many population
doublings indicating the existence of non-telomerase mechanisms for telomere
maintenance27,36
. This has been called Alternative Lengthening of Telomeres (ALT).
Characteristics of human ALT cells include great heterogeneity of telomere size
(ranging from undetectable to abnormally long) within individual cells, and ALT-
associated PML bodies (APBs) that contain extra chromosomal telomeric DNA,
telomere-specific binding proteins, and proteins involved in DNA recombination and
replication28,29
. Telomeric dynamics in ALT is consistent with a recombinational
mechanism where elongation of telomere occurs by hybridization to a template and
extension by regular cellular polymerase. Four different types of recombinational
mechanism have been suggested to account for ALT36
: (1) Inter-telomeric
recombination event, where the single-stranded DNA at the end of one telomere
invades double-stranded DNA of another telomere and uses it as a copy template
resulting in a net increase in telomeric DNA within the cell30
. (2) Recombinant
dependent replication facilitated by strand invasion of the 3‟-overhang into the t-loops.
(3) Linear or circular extrachromosomal telomere repeat DNA acting as a template for
replication32,33
. Artificial circular DNA containing telomeric repeats has been shown to
be utilized by K. lactis to greatly extend its telomeres32
. Telomere repeat circles and
extra-chromosomal linear DNA have also been found in human tumors and in a human
immortal cell lines and in a human ALT lines34,35
. Hence there is a possibility that both
linear and circular DNA provide templates for telomere elongation in these cells.
11
Fig 3. Mechanisms suggested for Alternative Lengthening of Telomeres.[Ref 37 b :
Mechanisms of Aging and Development 2008; Reproduced with Permission ]
All immortalized cell lines studied to date either have telomerase activity or have the
telomere length phenotype characteristic of ALT37a
. Some cell lines like lymphocytic
cell line that may have both37b
. The situation, however, is more complex for tumors.
Approximately 85% of all human tumors have telomerase activity38
. Although an
extensive survey to determine the prevalence of ALT in human tumors has not yet been
done some suggest that the remaining 15% mainly maintain their telomeres by ALT.
12
2.7 Rolling Circle Elongation of Telomeres
In rolling circle replication model, the 3‟-overhang of telomere acts as a primer which
invades and hybridizes with the extra-chromosomal telomere repeat circles. In the
presence of cellular polymerase these primers are then elongated. The circular DNA
can roll along the telomere primer and several rounds of replication would result in
rapid telomere extension. Hence rolling circle amplification (RCA) has increasingly
becoming popular in nucleic acids amplification. It has found many applications in the
detection of nucleic acids, proteins and other biomarkers and has been used to improve
multiplexed genomic and proteomic profiling in micro-arrays39,40
. The isothermal
nature of the technology makes it far easier to adapt to clinical laboratory settings than
conventional amplification technologies.
Fig 4. Rolling circle replication of telomere [Ref 39a : Trends in Biochemical
Sciences 2006; Reproduced with Permission]
13
2.8 Factors affecting rolling circle replication
The extent to which circular telomeric repeat DNA contributes to telomere elongation,
even in cells that solely use recombination to maintain telomeres, may depend upon a
number of factors like their size, abundance and availability of alternative templates
(such as a long telomeric repeat tract at another chromosome end) that might permit a
recombination event to elongate a telomere. The other consideration is the potential of
cellular enzymes to access the telomere ends and process them. However most DNA
and RNA polymerases dissociate from the template after reaching certain length (i.e.
poor processivity), lack intrinsic displacement activity and display some 5‟-3‟
exonuclease activity41, 42
. The topology of the circular DNA as well as that of the
telomere ends might also influence the processivity of the enzymes. The ALT-
associated PML bodies (APBs) might contain proteins that play a significant role in the
process. In fact they have been found to contain telomere binding proteins like TRF1
and TRF2 other than a large range of proteins involved in DNA recombination and
replication like RAD51, RAD52, RPA, MRE11, RAD50, NBS1, BLM and WRN43-46
.
The presence of other proteins like RecQ helicases also concur with the notion of these
bodies facilitating the process of recombination-dependent replication either mediated
by extra-chromosomal DNA or intra-chromosomal homologues.
14
2.9 In vitro elongation of Telomeres using Rolling Circle
Amplification
The rolling circle mechanism was reconstituted in vitro by Kool and coworkers when
they demonstrated the ability of circular DNA to elongate human chromosomes in the
presence of polymerase47
. In this study 54nucleotide long circular DNA with sequences
complementary to human telomere were used to elongate primers representing the
telomere 3‟-overhang in the presence of polymerase. Using chimeric and completely
complementary sequences in the circular DNA the group was able to demonstrate
elongations from a few hundred to more than 12kb long. A sequence scrambled DNA
however didn‟t show any elongation confirming the necessity of sequence
complementarity between the primer and the template. Interestingly, most enzymes
tested showed telomerase-mimicking activity as determined by TRAP assay (Telomere
repeat amplification protocol) in the presence of the telomere repeat containing
nanocircle, with thermophilic DV, KF polymerase, and human pol β giving the longest
products. The group also studied the ability of polymerases to extend human telomeres
in fixed cells. Metaphase spreads of human embryonic kidney cells were incubated with
the telomere-encoding circle, nucleotide triphosphates including fluorescein-labeled
dUTP and thermophilic Taq polymerase. While controls lacking the nano-circles gave
no signals, green-fluorescein signals from the incorporated dUTP were clearly visible at
the ends of the human chromosomes. The results were replicated with another enzyme
pol β. However, as discussed earlier, the size and secondary structure of the circular
DNA could be important factors in determining its effectiveness. In order to study these
questions the group synthesized a series of circular DNA ranging from 36 nucleotides
15
to 60 nucleotides in size and tested them as templates for the synthesis of human
telomere repeats in vitro48
. They observed that despite forming secondary structures the
nano-circles were able elongate telomere primers. This was probably because these
secondary structures were formed at pH value lower than neutral pH. Even small circles
were found to be active although the optimum size varied from enzyme to enzyme. The
group also studied telomere elongation using human polymerase and mammalian
polymerases. Although these enzymes enabled significant elongation of the telomere
primer, they were not able to produce as long elongations as their prokaryotic
counterparts. Even nuclear extracts from HeLa cells with low telomerase activity was
shown to facilitate some elongation for the larger circles. This study illustrated a
telomerase-free approach of making long telomeres which could significantly enhance
our understanding of the structure of telomeres and the mechanism of telomere
elongation. The facile synthesis of circular DNA of varying sizes also encouraged the
possibility of using these molecules for telomere elongation in vivo. Being single
stranded, these circles wouldn‟t need to be denatured before they could anneal to the 3‟-
overhang of human telomeres. Regulation of telomeres in live human cells in the
absence of telomerase could have many applications in tissue engineering as well as
have a therapeutic potential in degenerative diseases. Such studies could provide a more
direct proof of the prevalence of rolling circle amplification as means of telomere
maintenance in telomerase negative ALT-positive human cancer cells and hence
provide new tumor biomarkers and pathways to target in such tumors.
16
2.10 Rolling circle elongation in vivo
Although the ability of circular DNA encoding telomere to act as template for rolling-
circle elongation of telomeres has been conclusively demonstrated in yeast49
the only
correlative data available in human beings is the existence of extra-chromosomal
telomeric circular DNA in ALT –positive cells50
. From their study of the origin of such
circles in non-ALT cells expressing a mutant TRF2, Wang et al inferred that these
circles arise by homologous recombination within an intrachromosomal t-loop,
producing an abruptly shortened telomere and the reciprocal recombination product, an
extrachromosomal t-circle50
. The in vitro studies in the Kool lab indicated that such
molecules could act as templates for rolling-circle telomere replication in human cells
as well. In order to study this, the group carried out studies on primary human cell
lines51
. DNA nano-circles were transfected into two primary cell lines, BJ fibroblasts
and Retinal pigmented epithelial cells and their telomere length monitored. However
within the error margin, no reproducible telomere extension was observed in the treated
cells compared to controls. One of the reasons could be that transfection of nucleic acid
is difficult to control and optimize and hence there is always a possibility that sufficient
circular DNA were not transported and localized in the nucleus. In order to overcome
some of these limitations, the group decided to study effect of microinjecting these
DNA nano-circles. The rest of the chapter will discuss our observations when the
telomere-encoding circular DNAs were microinjected into a model organism, zebrafish.
17
2.11 Zebrafish (Danio reiro) as a model organism
The zebrafish, a small (1–2 in.) fresh water tropical fish species native to India, has
recently emerged as an ideal model system for the study of development. What makes
zebrafish unique is its invertebrate-like advantages but vertebrate biology53
. These
characteristics also make it a great candidate for gerontological studies. The embryos
are transparent, thus, morphological differences can easily be detected via gross and
microscopic visual examination. Zebrafish embryos hatch to become free-swimming
larvae within 2-3 days after fertilization. They are physically large enough to isolate
specific tissues for experimental analysis, minimizing the disadvantages of pooled
whole organism approaches commonly used for invertebrate analyses. Thus, screens for
aging relevant phenotypes, such as alterations in growth, or responses to stress can be
readily determined.
Fig 5. (a) A 8 month old adult zebrafish, (b) A 48 hrs old embryo, (c) An embryo stained
with mitochondrial specific fluorescent dye Mitotracker Green [Ref 53: Experimental
Gerontology 2003; Reproduced with Permission]
18
Zebrafish has high fecundity. A single female can produce several hundreds of eggs per
week. This combined with economic husbandry requirements means thousands of
fishes can be quickly produced and cheaply maintained compared to rodents. This
facilitates large scale demographic studies not possible with other vertebrate models.
Although the average life-span of zebrafish(4 years)53
is 50% longer than that of
rodents its life span can be readily manipulated by calory intake, ambient temperature
and reproductive capacity. The true power of zebrafish as a model for aging comes
from the ability to manipulate it genetically. Well-developed in vitro-fertilization
techniques enable rapid breeding and mutant preservation. Since zebrafish spends 30-
40 minutes of its life as a single cell embryo which can be readily manipulated it can
act as a useful model for studies related to two well characterized unicellular models of
aging, budding yeast and the cellular senescence of cultured cells. The ease of genetic
manipulation has spurred a lot of efforts in developing dense genetic maps, genome
libraries and full genome sequences of zebrafish.
Molecular events that orchestrate a variety of morphogenesis and organ formation in
humans are conserved in zebrafish54a
, thus making it a good candidate for a wide range
of applications such as disease modeling and drug evaluation. Maintaining the
anatomical and physiological similarities zebrafish develop a wide spectrum of cancers
resembling human malignancies54b
. Last but not the least, like humans, zebrafish also
possess G-rich telomeric repeats (TTAGGG)n52
which make them amenable to
extension by circular DNA developed in the Kool lab.
19
2.12 Developmental Stages of a Zebrafish
Fig 6. Developmental Stages of a zebrafish (A) Single cell embryo (B) 4-cell stage (C) 8-cell
stage (D) Approximate 64-128 cell stage (E) 3 hr old blastula stage embryo (F) 24 hr old
embryo curled inside chorion (G) Free-swimming 48 hr old embryo [Ref 53:
Experimental Gerontology 2003; Reproduced with Permission]
Zebrafish takes 3-4 months to reach fertility. At its inception, the post-fertilization
embryo has one cell that appears like a half- bubble on the yolk which acts as a source
of nutrients(Fig 7 (A)). This period lasts for the first 45 minutes. The newly fertilized
egg is .7 mm in diameter and is enclosed in the chorion (egg shell). After the first
cleavage stage, the cells divide at around 15 minute intervals. This cleavage stage runs
from 45 minutes to 2 ¼ hours (Fig 7 (B),(C),(D))55
. The blastula stage lasts from 2 ¼ to
5 ¼ hours. During this period the blastoderm envelopes the yolk and the first
morphogenetic movement of the embryonic development called epiboly takes
place(Fig. 7 (E)). The pharyngula stage occurs between 24–48 hours (Fig. 7 (F)). This
is the time of development when one can compare the embryos of diverse vertebrates.
20
The heart begins to beat just at the onset of this period, the fins begin to form, the
pigmental cells differentiate and tactile sensitivity appears55
. Finally the embryo
hatches out of the chorion between the second and third day.
2.13 Microinjection into zebrafish embryos
Microinjection is a popular and reliable method of delivering nucleic acids, proteins and
small molecules into the zebrafish embryo. This method has been successfully used to
produce transgenic zebrafish expressing transgene for multiple generations56
. In this
method a microinjection pipette is filled with a solution of the sample to be injected and
attached to an apparatus that forces the solution out of the pipette with air pressure. Once
the sample is injected into the cytoplasm, the pipette is immediately withdrawn and the
injected embryos are incubated to develop further.
The basic setup includes a dissecting microscope, a pressure regulator, a micropipette
holder, and a micromanipulator. The holder for the injection pipette is mounted on a
micromanipulator and connected to the pressure regulator via a poly-ethylene tube. The
micromanipulator is used to precisely guide the location of the tip of the injection pipette
to the desired location in the embryo. An automatic system controls the pressure and the
discharges are activated with a foot paddle. The recommended injection volume is about
10–20% of that of the cytoplasmic volume since higher volumes can burst cells or
deform the embryos57
.
Agarose microinjection plates containing grooves are made by inserting a glass
microscope slide into warm agarose and letting it solidify. The day prior to
microinjection, male and female zebrafish are placed in a breeding trap separated by a
21
divider. The next morning the divider is removed. Once the eggs are laid, they are
immediately collected and positioned into the grooves so that they are supported when
penetrated by the microinjection needle. Embryos, the needle, and the microinjected
DNA are all visible under a stereomicroscope, allowing for precise control of the
microinjection process. The embryos are microinjected by first penetrating the cell wall
with the microinjection needle and then pushing gently on the syringe plunger. The
needle is immediately pulled out of the cytoplasm and moved to microinject the next
egg.
2.14 Synthesis of the circular DNA
Circular DNA containing repetitive sequences are in general difficult to synthesize.
This is because they are generally made by ligating the ends of a linear single stranded
DNA. However in order to bring the 5‟ and the 3‟ends of the DNA close to each other
templates or „splints‟ which hybridize across the broken ends need to be used. The
problem with repetitive sequences is that the template could hydrize at sites other than
the ligation site resulting in inefficient ligation. The rigidity of the splint-DNA duplex
also affects the circularization of the DNA. The Kool lab had developed a chemical
solution to this problem by using orthogonal protective groups58
. Dimethylacetamidine
(Dma) was used as protecting group for the exocyclic amine of Adenine. The modified
Adenine coupled efficiently on a standard solid-phase DNA synthesizer and remained
stable under ultra-mild deprotection conditions. Since it was recognized that the Dma
groups would inhibit duplex formation with the splint the linear DNAs were
synthesized containing Dma-protected Adenine at all adenine positions except those
22
close to the termini which had ultra-mild protecting groups on them. Upon the selective
deprotection of these groups the splint was encouraged to hybridize to the ends, thereby
preventing unwanted secondary structure.
For our studies, the N6-dimethylacetamidine-dA (Dma-dA) phosphoramidite was
prepared according to a published method59
. DNA oligonucleotides were synthesized
on an Applied Biosystems 394 synthesizer using β-cyanoethylphosphoramidite
chemistry. In order to enable enzymatic ligation the 5‟-end of the DNA was
phosphorylated using Chemical Phosphorylation Reagent I (Glen Research).
Deprotection of the ultra-mild protecting groups was done with 0.05 (M) K2CO3/MeOH
for 12 h at room temperature. The carbonate solution was neutralized by adding an
equal volume of 2(M) tetraethylammonium acetate. In order to facilitate ligation, a
typical reaction involved annealing the 54mer DNA (1µM) with 1.2µM of the 18mer
„splint‟ (5‟-GTTAGGGTTAGGGTTAGG-3‟) in 50Mm Tris-buffer (pH 7.5) and
10Mm MgCl2 at 900C for 20 min followed by slow cooling to room temperature.
Ligation was achieved using T4 DNA Ligase (New England Biolabs; 3.4 U/µL) in the
presence of DTT (final concentration 10mM) and ATP (final concentration 0.5µM) for
24 hrs. Followed by dialysis and evaporation the crude mixture was purified by
preparative 20% denaturing polyacrylamide gel electrophoresis (PAGE). The band
corresponding to the purified circle was cut out and extracted with 0.2 (M) NaCl. After
another step of dialysis followed by evaporation the Dma groups were cleaved from the
circular DNA by incubating it in NH4OH at 550C for 16hrs. Evapoartion of the NH4OH
23
gave pure circular DNA. Concentration was determined by UV absorbance at 260nm
and calculation of Molar Extinction Coefficients using the nearest neighbor method.
Using the above mentioned synthetic strategy we synthesized the following:
1. „HT54‟, a 54mer circular DNA which encodes 9 telomeric repeats (Fig. 7 A).
2. „SCR54‟, a 54mer circular DNA with same base composition as „HT54‟ but the
sequence is scrambled such that it cannot anneal to the telomeres. This molecule was
expected to serve as our control (Fig. 7 B).
3. „FL54‟, a 54mer circular DNA with the same sequence as „SCR54‟ but with a
fluorescein-labeled thymidine. This molecule was designed with the purpose of
detecting the distribution of circular DNA after microinjection (Fig. 7 C).
24
Fig 7. Single stranded circular DNA synthesized for the experiments (A) HT54, a telomere-encoding 54mer (B) SCR54, A 54 base long circular DNA with scrambled sequence (C) FL54, a circular DNA with the same sequence as SCR54 but with one fluorescein-T
25
2.15 Microinjection and Distribution of Fluorescein-labeled
Circular DNA in the embryo
Before the telomere encoding circular DNA was microinjected it was important to
make sure that it would be properly taken up and uniformly distributed at least amongst
the early group of dividing cells in the egg. Otherwise the telomere length elongation
could be localized and a sample homogenate may not accurately reflect the telomere
elongation in all the cells. Taking advantage of the transparency of the zebrafish
embryos the fluorescein labeled circular DNA (FL54) was microinjected into embryos
to see if they were uniformly distributed. Microinjections at different points on the
embryo and at different developmental stages were done to figure out the best method.
A solution of 4µM DNA in 0.25% phenol-red was found to be the optimum
concentration for fluorescence detection under the microscope once the circular DNA
was microinjected. The position of microinjection also seemed to have a strong bearing
on the distribution of DNA. While microinjection into the cell or any random position
in the yolk resulted in non-uniform distribution, it was found that microinjecting into
the yolk of the embryo right below the cell, in the single cell developmental stage was
the best method of getting uniform distribution of the circular DNA. Under these
conditions it was observed that on an average 90% of the embryos had uniform
distribution when they are 3 hrs old which is the blastula stage of the embryo, an
important developmental stage which is followed by epiboly (Fig 6 E). Beyond this
stage however the distribution of the circle as evinced by fluorescence becomes random
probably because of the morphogenetic movements that accompany it.
26
Fig 8. (A) Picture of a multi-cell embryo. The DNAs are microinjected right under the cell into
the yolk (B) A mixture of 3hr old embryos injected with fluorescein-labeled DNA (C) A
control embryo with no DNA injected (D) A 3hr old embryo with un-uniform distribution of
DNA and (E) A 3hr old embryo where the DNA is evenly distributed amongst the cells
27
2.16 Available Techniques for telomere measurement
Although microinjection may ensure the delivery of the DNA nanocircles into the cell
we still needed a suitable detection method to measure the telomere length. Since
evaluation of telomere length has diagnostic and prognostic value considerable efforts
have been focused to develop efficient method of telomere measurement. While
Southern Blot, the traditionally used technique for nucleic acid length determination
has been applied for telomeres a number of new hybridization based techniques have
also been introduced in the last decade which overcome some of its limitations. These
include hybridization protection assay, fluorescence in situ hybridization, flow
cytometry, primed in situ, quantitative-polymerase chain reaction and single telomere
length analysis60a
.
Southern Blot, where the DNA is fragmented by restriction enzymes, separated by gel
electrophoresis and labeled with sequence specific probes, still happens to be one of the
most widely used techniques for telomere length determination60b
. A densitometer is
used to quantitatively measure the size and abundance of the telomere/ telomere
restriction fragments. However the DNA extracted for Southern Blot analysis needs to
be un-fragmented and pure and this is not only technically difficult to obtain but is also
difficult to handle due to the high viscosity of un-fragmented DNA. Accuracy is also an
issue with Southern Blot since the telomeric restriction fragments could include
unknown amounts of the subtelomeric region as well. Also the relatively low sensitivity
of this technique means a large number of cells would be required to prepare samples
for analysis.
28
Hybridization Protection Assay (HPA) was used by the Nakamura lab to detect
telomeres61
. In this method genomic DNA from cell lysate are hybridized with
acridinium-ester labeled telomeric probe and detected by chemiluminiscence. HPA is
less time consuming, may not include subtelomeric sequences and requires fewer cells
for sample preparation. However HPA cannot give detailed information of the telomere
at the cell-level or chromosome level and cannot measure the telomere directly.
Fluorescence in situ Hybridization (FISH) involves labeling telomeric sequences
with oligonucleotide probes at individual cell level62
. DNA from metaphase
preparations of cells are denatured and hybridized with synthetic telomere-specific
probes containing fluorescein isothiocyante (FITC) or Cy3 and counterstaining the
DNA with 4', 6'-diamidino-2-phenylindole (DAPI) or propidium iodine (PI). This is
visualized by fluorescence microscopy or with a digital imaging system. Quantifying
the telomere length by FISH is called Q-FISH (quantitative FISH).
In Flow-FISH (flow cytometry-fluorescence in situ hybridization)63
the cell-sorting
by flow-cytometry is combined with fluorescence in situ hybridization. However the
cells don‟t need to be fixed in the metaphase stage and different cell populations can be
processed at the same time, making it more time-efficient than Q-FISH. But compared
to Q-FISH it requires a much larger number of cells and cell-permeability of the
telomere probes could be an issue.
29
Primed in situ (PRINS) is an effective method for detecting long repetitive sequences
like telomeres64
. In this method synthetic oligonucleotide primers with complementary
sequences are annealed and hybridized to metaphase of interphase spreads. In the
presence of thermostable DNA polymerase and fluorescence labeled nucleotides these
primers are elongated and fluorescence signals are analyzed by a fluorescence
microscope. However for short telomeres uneven primer annealing could lead to poor
telomere detection. In fact some of the modified probes used in FISH are also used in
PRINS detection.
Quantitative Polymerase Chain Reaction (Q-PCR) has also been used to determine
telomere length65
. The problem of amplification using complementary primers has been
overcome by using modified primers composed of repeated pattern of six bases
containing four consecutive paired bases followed by two mismatched bases. These
prevents the two primers from hybridizing with each other giving PCR amplified
products that are free of primer-derived products. One advantage of this method is that
it doesn‟t include the subtelomeric region.
Single Telomere Length Analysis (STELA)66
is another PCR based method which
involves annealing a linker called „telorette‟ containing repeats of TTAGGG followed
by a non-complementary tail to the G-rich telomere overhang which is ligated to the
5‟end C-rich strand of telomere. PCR amplification is performed by a primer identical
to the non-complementary telorette tail together with a chromosome specific upstream
30
primer in the subtelomeric region. Thus this method measures telomeres at individual
telomere level but can be used only when telomere adjacent sequences are known.
Besides these there are several methods available to determine the length of the
telomere 3‟-overhang. These include primer-extension/nick translation (PENT)67
,
telomeric-oligonucleotide ligation assay (T-OLA)68
, and electron microscopy69
.
2.17 Quantitative Fluorescence in situ Hybridization (Q-FISH)
Compared to Southern Blot, which provides an estimate of the average telomere length
only, Quantitative Fluorescence in situ Hybridization (Q-FISH) is a much more
sensitive method of telomere detection. Q-FISH provides an estimation of telomere
length in each chromosome to a resolution of 200bp. Unlike Southern Blot it could also
be used to measure telomere length in species containing interstitial telomeric site in
their genomes. In 1996 Lansdorp group replaced the oligonucleotide probes with
peptide nucleic acid (PNA) probes and showed that the fluorescence signals resulting
from the PNA/DNA hybridization could be effectively used in quantitative
measurement of telomere lengths62
. Although they produced higher background
compared to conventional oligonucleotide probes, the PNA probes exhibited more
intense staining of most telomeres and hence improved the sensitivity. Moreover, since
hybridization of the PNA probes to DNA was faster, the procedure was faster compared
to conventional FISH. In conventional FISH the hybridization of oligonucleotide
probes competes with the renaturation of complementary strands of the denatured
genomic DNA. Unfortunately the conditions that favor binding of small oligonucleotide
31
probes to repetitive telomeric DNA also result in efficient renaturing of genomic DNA.
This problem is overcome by using PNA probes. However Q-FISH is time consuming
procedure and the necessity of metaphase spreads means that only actively dividing
cells can be analyzed.
Q-FISH requires a fluorescence microscope equipped with a sensitive digital camera.
Samples are prepared by staining metaphase spreads of cells with Cy3/Fluorescein
labeled PNA probes specific for telomere sequences and the DNA dye DAPI51
. In a
typical Q-FISH experiment two separate images, one of the DAPI stained metaphase
chromosomes and the other of the telomere signals are acquired. They are then
processed with a dedicated computer program (TFL-TELO) which combines the
images and assigns telomeres to individual chromosomes. The program then provides
the user with the integrated fluorescence intensity value for each telomere, which is
proportional to the number of hybridized probes70
.
The study discussed in this chapter involved the measurement of telomere length in
zebrafish embryos by Q-FISH method to investigate the telomere elongating potential
of circular telomere encoding DNA.
32
2.18 Optimization of the metaphase preparation from zebrafish
embryos
In order to perform Q-FISH analysis metaphase spreads needed to be obtained from
zebrafishes. Zebrafish embryos which were 6hrs old, 1 day old, 2 days old and 3 days
old were used as sources of cellular DNA. While 6 hr old zebrafish embryos were
arrested in metaphase on treatment with 0.1% colchicine, a reagent which arrests
dividing cells in metaphase, direct treatment of the 1/2/3 days old zebrafish embryos
with colchicine, failed to provide any metaphase spreads. Hence the zebrafish embryos
were trypsinated with 0.25% Trypsin-EDTA solution to dechorionate them, loosen the
tissues and make them more permeable to colchicine. Following 5 minutes of
trypsination the zebrafish, the zebrafish were still seen to be alive as evinced by the
twitching of their tails. The trypsin was neutralized using a trypsin neutralizing medium
and then the embryos were incubated with 0.1% colchicine for 2.5 hrs. Although the
embryos were dead by this time, this period of colchicine treatment didn‟t generate
enough metaphases. The optimum time for colchicine incubation was found to be 4
hours. The embryos were then triturated to separate the cells from yolk and other extra-
cellular material. The cells which were lighter floated to the surface and were decanted
off. They were then incubated for 30 minutes at room temperature in 1mL of lysis
medium (60mM KCl). The solution was centrifuged and the cells resuspended in a
fixative solution made of 3:1 (methanol: acetic acid), gently mixed and incubated for 10
minutes. The cell suspensions were precipitated by centrifuging at 1000 rpm for 10
min, supernatant was removed and the cells were resuspended in 1mL fixative. This
step was repeated 3 times and finally the cells were suspended in appropriate amount of
33
fixative. At the end of this process all the intracellular and extra-cellular material
except for nuclear chromatin are removed from the solution. For the purpose of this
study 100µL was found to be the appropriate volume for having enough metaphases
(15-20) per slide when these fixed cells were dropped onto the slides for analysis. Since
the procedure of metaphase generation was found to be most efficient for 24hr old
embryos compared to 6hr old embryos or older embryos it was decided to determine
post-injection telomere length in 1 day old embryos.
2.19 Preparation of slides for Q-FISH analysis
Published methods of slide preparation were used for this study71
. Pre-cleaned glass
slides were washed with 0.5ml of fixative solution and 5-6 drops of cell suspensions
were dropped onto the slides. After another wash with fixative solution, the glass slides
were placed face-up on stacks of paper towel moistened with warm water to make the
rate of drying slow. Following complete drying, the glass slides were then aged
overnight in a fume hood. Best efforts were made to prepare slides of consistent quality
over different experiment sets. These slides were then subjected to further washing and
fixing and hybridized with PNA probes for Q-FISH analysis.
34
Figure 7. Steps involved in obtaining metaphase spreads from zebrafish for Q-FISH analysis
35
Fig 10. Metaphase spreads of zebrafish in Gray-scale format (A) The DAPI stained
chromosomes (B) The telomeres are seen as bright spots superimposed on the
chromosomes
36
2.20 Dosage of circular DNA and mortality rate
Although the zebrafish embryos are relatively large (approximately 1.2 mm including
the chorion) they are highly deformable and care needs to be taken during injection to
avoid damage. The post-injection survival rate depends upon a number of factors.
While a healthy embryo can survive the injection better, unhealthy or weak embryos
have much poorer chances of survival. Hence it is essential to maintain a healthy and
productive breeding stock of fish which are mated at least periodically. Fishes which
have not been mated for weeks often produce no eggs or eggs of poor quality. Post-
injection care and maintenance also plays a crucial role in affecting the survival rate.
Greater survival of the embryos post-injection was not only important for dosage and
toxicology studies but also necessary to get more living cells from which enough
metaphases could be harvested to produce statistically acceptable Q-FISH studies. In
order to compare toxicity profiles the zebrafish embryos were divided into three groups
and injected with HT54 (the telomere encoding circular DNA), SCR54 (the scrambled
DNA) and 0.25% phenol-red respectively. All together, approximately 250 embryos
were injected in each experimental set (all the three groups taken together). On an
average we observed slightly lower survival rate 24hr post-injection for the embryos
that were injected with DNA compared to the control group injected with phenol-red.
However there was no significant difference in survival rate between the groups
injected with telomere-encoding DNA and scrambled DNA. We also observed a
concentration dependence on the survival rate. Higher concentration of injected DNA
was found to lower the survival rate. Based on these studies we determined that 0.2µM
final concentration of DNA within the zebrafish was the maximum concentration of
37
DNA that could be injected without significantly affecting the survival and generation
of sufficient metaphases for subsequent Q-FISH studies
Final Concentration of
Circular DNA within the
embryo (µM)
Survival Percentage of
one day old embryos
post-injection
Average number of
metaphase spreads
obtained per slide
0.05 62 % 17
0.1 59% 15
0.2 58% 15
0.4 47% 8
0.5 30% 3
Table 1. Concentration dependent survival rate and success at generating
metaphases for subsequent Q-FISH analysis. The survival rates calculated here are
for 80 embryos for each set of experiments.
2.21 Q-FISH on zebrafish metaphase spreads
In order to determine telomere length using Q-FISH, the metaphase spreads fixed on
glass slides were hybridized with telomere specific PNA probes. Unbound probes were
washed away and the slides seen under microscope. Only slides that were washed and
hybridized on a single day under identical conditions were compared. In order to reduce
photo-bleaching of probes an antifade reagent was used. Since the image acquisition
time was kept constant over all the experiments any errors due to photo-bleaching were
38
not expected. The data from the images were processed by a software called TFL-Telo
provided by the Lansdorp lab.
The following steps were used for Q-FISH analysis of all the metaphase spreads
obtained from zebrafish. After the slides containing metaphases have been dried and
aged they were treated with 1(x) PBS for 5 min and then fixed with 4% formaldehyde
in PBS for 2min. They were then washed with 1(x) PBS again for two times over a
period of 5min each and then stored in a jar containing pepsin solution for 10 min at
370C. The slides were removed from the chamber and fixed again in 4% formaldehyde
and then dehydrated for 2min with cold (-200C) solutions of ethanol: water (75:25)
followed by ethanol: water (85:15) and finally with 100% ethanol. 200µL of probe
solutions were made by mixing 140µL deionized formamide, 37µL of water, 20µL of
Sigma Blocking Buffer (casein-based 10x), 1µL of Tris-HCl (pH 7.4) and 2µL of stock
PNA probe (300µg/mL). 15µL of the probe solution was applied to a cover slip and a
slide was placed over the hybridization solution and incubated at 860C for 4min. After
gradually cooling the slides to room temperature the cover slips were removed by
dipping the slides in a wash buffer I (50mL of 1M Tris-HCl, pH 7.4 + 50mL 1.5M
NaCl + 0.5mL Tween-20 + 400mL water) for 10min . This was repeated and then the
slides were washed twice for 10 min each in a wash buffer II (5mL 1M Tris-HCl, pH
7.4 + 350mL of deionized formamide + 5mL 10% BSA +140mL water). After they
were washed the slides were once again dehydrated with cold ethanol in the same way
as before. Once the slides were dry, 15µL of Vectashield Antifade/DAPI solution
(Molecular Probes) were added to each slide. The slides were then covered with thin
coverslips and seen under the microscope.
39
The Q-FISH analysis was performed following guidelines recommended by Lansdorp
lab70
. A Nikon fluorescence microscope was used to acquire images of the slides. FITC
filters were used to capture the green fluorescence of the telomere probes and DAPI
filters were used to capture the blue signal of DAPI. Since the telomere signals were
weak they were captured over a longer period of time (30s) compared to the DAPI
signals (2s). The captured images were saved in 8-bit grayscale TIF format and
processed by the TFL-Telo software provided by the Lansdorp lab.
DAPI signals that didn‟t co-localize with telomere signals were ignored as non-specific
binding events. It was assumed that the lengths of the telomeres were linearly related to
the integrated fluorescence intensity values70
. Since each slide contained 10 to 15
metaphases one would expect 2000 to 3000 telomere signals since zebrafish have 25
pairs of chromosomes. However we always observed lower number of telomere signals
because of irregular spreading of chromosomes wherein some telomere signals were
not accounted for. The median telomere lengths were used for comparison instead of
the mean lengths in order to avoid errors introduced by extreme values.
Previous studies as well as our own experience had revealed significant differences
between measurements of same metaphases performed on different days. To avoid the
day to day error that could have been introduced due to variations at different stages of
the protocol, only metaphase spreads fixed and incubated on the same day were
compared. In order to overcome inaccuracies introduced by variations in lamp
40
intensities the fluorescence signals could be calibrated against fluorescence of beads of
defined size or plasmids containing defined number of telomeric sequences. However
for our studies it was not necessary since we were comparing the telomere lengths and
not measuring their absolute values.
2.22 Telomere length of 24hr old zebrafish
In order to estimate the telomere length in 24 hour old zebrafish, they were compared
with cell-lines of known telomere lengths. Two mouse lymphoma cell lines, LY-R and
LY-S, with long and short telomeres respectively were used as standards of
comparison. It is known that LY-R cell lines have telomere lengths representative of
mouse chromosomes and estimated to be about 48kb long. LY-S cells on the other
hand, have much shorter telomeres in the range of 7kb. It has been found that telomere
lengths in these cell lines are quite stable over a period of many months72
. These cell
lines were obtained from cell cultures maintained in the lab (Lucian Orbai) and
subjected to Q-FISH analysis using the protocol mentioned earlier. Further validation
of the method was obtained by performing Southern Blot on these cell lines.
Both Q-FISH and Southern Blot showed that one day old zebrafishes have telomere
lengths in between the two cell lines. In other words the telomere length was
somewhere between 7kb and 48kb. This data was consistent with later reports on
zebrafish telomere lengths which determined the mean zebrafish telomere length to be
15-20kb long in embryos and larval fish as well as young adult fishes73
.
41
Fig. 11. Top: Q-FISH fluorescence distribution of murine lymphoma cells, LY-S (7Kb), LY-R
(48Kb) and 24 hr old zebrafish embryos. Bottom: Southern blot showing the telomeric
distribution of the same cell lines (courtesy Jie Liu)
42
2.23 Telomere length after injection with telomere encoding
circular DNA
Single cell embryos were injected with HT54, the telomere encoding DNA, and their
telomere length 24 hr post injection determined using the Q-FISH protocol described
earlier. The control groups were injected with scrambled circular DNA, SCR54, which
is not expected to elongate the telomeres. Although we did notice some increase in
telomere length in some studies, they were neither substantial nor reproducible. Indeed
in some studies we actually noticed a decrease in telomere length of the HT54 injected
group compared to the control group. More importantly the observed differences were
very small and within the statistical error for this technique, which according to
established literature is about 10%70
. Since we didn‟t notice any reliable dependence of
the telomere elongation on the concentration of injected DNA all subsequent studies
were conducted at a final concentration of 0.2µM, the maximum concentration with
significant survival rate. At higher concentration the increased mortality made the
generation of good metaphase spreads challenging probably because of lower number
of dividing cells to begin with.
43
Fig 12. Concentration dependence of telomere elongation. The red, blue and green
bars represent the difference between the median fluorescence intensities of HT54
injected embryos and those injected with the control SCR54, in 5 sets of
experiments conducted using 0.05, 0.1, 0.2µM concentrations of HT54
respectively. No clear concentration dependence was observed.
44
Fig 13. Q-FISH fluorescence distribution from two different experiments
conducted with 0.2µM circular DNA.
45
Fig 14. Q-FISH determination of median fluorescence intensity using 0.2µM
circular DNA. No clear trend is observable from 5 sets of data comparing the
telomere length of HT54 injected embryos with SCR54 injected embryos.
46
2.24 Discussion of telomere determination experiments
The absence of telomere elongation in the zebrafish embryos paralleled the finding of
similar studies on human cell lines performed in the lab50
. In these studies, telomere
encoding circular DNA transfected into primary human cell lines, were unable to
produce significant telomere elongation. Although compared to transfection,
microinjecting the DNA into the embryos reduces some of the cellular uptake issues,
the distribution and localization of the DNA could still be significant impeding factors
in the success of these molecules. There is a possibility that the molecules were not
localized in the nucleus in sufficient concentration to interact with the endogenous
telomeres and elongate them. Although the fluorescein-labeled circular DNA seemed to
be uniformly distributed amongst the cells, microscope use could resolve the
distribution in the cellular cytoplasm and nucleus. Such a resolution could be possible
using confocal microscopy which could enable one to determine the intra-nuclear
concentration of the molecules.
However the presence of these molecules in the nucleus does not ensure their telomere
elongation capability in vivo. They have to overcome the capping of telomere by
telomere binding proteins and the secondary structures of G-rich telomeres before they
could anneal to the free 3‟-overhang. Higher nuclear concentration is also desirable
because that would help in competing with alternative structures and complexes at the
telomere ends. It has also been observed that the accessibility of the telomeres to
telomerase mediated elongation is dependent upon the stage in the cell cycle. Late S
and G2 phases have been found to be the only phases when telomeres are elongated74
.
47
In other words the molecules have to be there not only at the right place but at the right
time in order to be able to interact with telomeres.
Even when the circular DNA anneal to the zebrafish telomere chromosome, they would
still need suitable polymerases to reach them and facilitate the elongation of the
telomeres. The availability of polymerases would be dependent among other factors on
the cell cycle stage.
Another important factor is the stability of the circular DNA inside the zebrafish
embryos. The Kool group had found that compared to linear DNAs which are degraded
within minutes in 100% human serum, the circular DNA were stable after 48hrs
(unpublished results). No stability studies have been done with zebrafish plasma but it
would not be surprising to find some endonuclease facilitated cleavage of the circular
DNA within the embryos. Both the stability and accessibility of the circular DNA could
be improved by using different circle sizes and by suitable chemical modifications.
Another complicating factor may be the constitutive expression of telomerase in
zebrafish. It has been reported that telomerase expression gradually increases post-
fertilization and although a 24 hr old zebrafish embryo has significantly lower
telomerase expression than a fully adult fish it is still higher than that observed in mice
and human somatic cells75
. Hence the DNA nano-circles have to not only compete
against endogenous telomerase for binding the telomeres but also had to produce
significant elongation in order to be observable over the telomerase expressed
48
elongation. However in-vitro elongation enabled by these DNA nano-circles had
extended telomeres by several kilo-bases. Hence if significant elongation is caused by
these molecules it should theoretically be possible to detect the difference. Smaller
differences on the other hand, may need much more sensitive techniques of
measurement. Since the DNA circles elongate the 3‟ overhang, a recent method for
quantitative measurement of telomere of the 3‟-overhang called primer/extension nick
translation (PENT)76
could be used to measure small telomere lengthening. This
method can measure telomere length with an error of about 10 bases and has been
shown to measure telomeres as short as 130 bases. Another method called telomeric-
oligonucleotide ligation assay (T-OLA)77
enables the detection of telomeres as short as
24 bases. These methods may prove useful in future studies on both cell cultures as
well as model organisms.
2.24 Summary
In this section, we described our studies on the effect of telomere-encoding circular
DNA on telomere lengths in zebrafish embryos. The circular DNA were microinjected
into single-cell embryos and their dosage and distribution were optimized. Methods for
generating metaphase spreads from 24hr old embryos were optimized and Q-FISH
(Quantitative Fluorescent in situ Hybridization) was used to analyze the telomere
lengths of the zebrafish embryos. Within the errors of margin for our technique, no
clear difference was observed between the treated zebrafish embryos and the untreated
controls.
49
Chapter 3
Investigating the potential of radio-iodinated non-polar
nucleoside analogs in tumor detection and therapy
3.1 Introduction
Radionuclides have been widely used in oncology for treatment and diagnosis. They
are not only useful for evaluating new therapy but also augment conventional
biological therapy when used in combination. While γ-emitters and positron emitters
have been largely employed to detect tumors through CT scan and PET scan
respectively, α and β-emitters have been mostly developed for therapy78a
. Positron
emission Tomography (PET) is particularly useful as most metabolic and tumor-
targeting molecules can easily be labeled with positron emitting isostopes78b
like C11
,
N13
, O15
and F18
. Current clinically useful therapeutic agents are mainly β-emitters.
Molecules containing radioisotopes of I131
, P32
, Sr89
, Y90
either by themselves or
conjugated to antibodies are used to target tumors for systemic therapy78c,f
.
While for large solid tumors the highly penetrating β-emissions would still be highly
preferable, they may not be ideal for targeting small clusters of tumor cells78b.d
. Auger
emitting radionuclides have recently emerged as an attractive alternative to β-
emitters. The auger effect arises when rearrangement of an inner-shell vacancy in
these nuclides results in a loss of orbital electrons and low energy X-rays. Auger
electrons provide high linear energy transfer (LET) of 4-26 keV within a very short
range of less than 1µm78e
. Hence, in contrast to α and β-emitters, auger emitters have
low toxicity but strong potency once they get in close proximity to the DNA or get
50
incorporated into the DNA of the target cells. Compared to β-rays the auger effect is
also less sensitive to hypoxic environment which is a major cause of radiotherapeutic
failure of β-rays. Since they introduce more double strand breaks in DNA, their
biological efficacy is higher than that of β-emission. Besides producing DNA double
strand breaks the auger energy also produces radicals. These freely diffusing
intracellular radicals could further damage the DNA.
Another advantage of using auger emitters is that increased mutation and decreased
survival rates in cells which are themselves not irradiated but have irradiated neighbors
have been observed in vivo with I125
treated cells. Such an effect is called the by-stander
effect and would be beneficial even if all the cancer cells are not treated with a
radiopharmaceutical.
Besides their potential in diagnosis and treatment of cancer, the auger electron emitters
have also been used to characterize molecular structures. I125
labeled oligonucleotides
of telomeric repeat sequences have been used to determine the structure of the G-
quadruplexes formed by them from the correlation between the double-strand breaks
and the distance from radionuclides80
. The study indicated that both parallel and
antiparallel conformations coexisted in solution, their relative abundance depending
upon the ionic concentration.
3.2 Therapeutically useful Auger emitters
While there are a large number of auger electron emitters, so far only I125
, I123
and Tl201
have been identified as therapeutically useful because of their pharmacologically
suitable half-lives and the amount of auger energy released by them. Auger emitters
51
like Fe55
, for example, have higher radiation energy but their half-life of 2.7 years make
them unsuitable for being used in therapy. On the other hand, In111
which has a half life
of 67 hrs releases only 8% of its energy in the form of auger energy, the rest being
released as photons. Since photons have low energy deposition per µm of penetration,
they are not as significant for therapy. Other than radionuclides, the auger process can
be induced artificially by external beams of ionizing radiation. Ultra-soft X-rays have
been used to create inner-shell vacancies of oxygen atoms in thin films of components
of DNA such deoxy-ribose, thymine, thymidine and thymidine 5‟-monophosphate and
it has been observed that the sugar is more sensitive to auger effect than the base
thymine79
.
3.3 Auger emitters targeting tumor
Since auger emitters are most effective when they are either covalently bound to DNA
or are in very close vicinity, various strategies have been used to target DNA with these
molecules. DNA intercalating agents labeled with I125
have been used to promote
cytotoxicity via the induction of double stranded breaks89
. Dosage and cytotoxicity
profiles of I125
-Hoechst 33258, a bis-benzimidazole which preferentially binds A+T
rich sequences in the minor groove of B-DNA have also been studied90
. Auger emitting
sequence specific triple helix forming oligonucleotides have been used to target MDR1,
a carcinogenic gene in purified DNA and intact nuclei91
. Studies with In111
/I125
-labeled
internalizing antibodies have established that with some carrier molecules internalized
in the nuclei of the tumor cells, incorporation into DNA is not necessary for an
effective therapy92
. Similarly radio-iodinated noradrenaline analog meta-
52
iodobenzylguanidine (MIBG) has been used for imaging and radiation therapy93
.
Although in case of MIBG the therapeutic efficacy of auger emitters is modest and beta
emitting I131
is still the radioisotope of choice.
Fig. 1. Some of the molecules iodinated with I125/ I123 for imaging and therapy. (A) Iodo-
Hoechst 33258 binds DNA in the minor groove (B) Meta-iodobenzylguanidine is used for
imaging and therapy
3.4 Radiolabeled 5-Iodo-2’-deoxyuridine (*IdU)
Auger emitting nucleoside analogs have been developed taking advantage of the fact
that nucleosides get incorporated into DNA during the synthesis phase of cell. Of these
I125
/I123
labeled iodo-deoxyuridine is probably the most widely studied. The compound
where the 5-methyl group is replaced by iodine, behaves remarkably similar to
thymidine and is efficiently incorporated into the nuclear DNA of synthesizing cell.
Early studies involving incubation of I123/125
dU with mammalian cells in vitro has
shown them to be highly cytotoxic when localized in cellular DNA84
. Compared to the
β-emitter I131
dU these molecules were found to be 6-fold more toxic. It has been
observed that mice injected with I125/123
dU containing intraperitonial ascites of ovarian
cancer show 5-log reduction in tumor growth81,82
. When injected intracerebrally into
mice bearing intraparenchymal gliosarcoma these molecules were able able to image
53
tumors very sensitively allowing the visualization of tumors as small as 0.5mm in
diameter85
. Furthermore the survival of the animals was significantly enhanced by
injection of these molecules. Formulations are available of the radiolabeled nucleoside
along with its stannyl-precursor which can be manipulated to maximize the tumor to
non-tumor uptake by up to 6-7fold83
. Methotrexate (MTX), a thymidylate synthase
inhibitor has also been found to substantially enhance the uptake of human cancer cells
in vitro (9-fold) and also improves the tumor to non-tumor ratio in tumor bearing
rats86,87
. Intra-arterial injection of I123
dU in patients with liver metastases from
colorectal cancer has resulted in rapid accumulation of radiolabeled IdU in tumor cells
and metastases being clearly visualized by scintigraphy. More importantly no
significant uptake was observed in bone marrows or other normal dividing tissues88
.
However the use of radiolabeled iodo-deoxyuridine in vivo is problematic for a number
of reasons. Rapid hepatic dehalogenation reduces their physiological half-life and
therapeutic distribution in cancer cells94
. There is also the possibility of uptake of the
radiolabeled nucleoside by actively dividing normal cell renewal systems like bone
marrow and gut resulting in unwanted cytotoxicity. The cell-cycle dependent
incorporation of the nucleoside means only tumor cells in the S-phase would
incorporate these molecules into their DNA, precluding the labeling of the entire tumor
cell population. This restriction is generally overcome by using osmotic pumps
delivering IdU continuously over several days covering at least two or three cell cycles.
Other than catabolism, the competition from endogenous thymidine could also reduce
the rate of DNA incorporation. Thymidine synthesis inhibitors have been used with the
aim of augmenting the DNA incorporation of radio IdU through salvage pathway.
54
Different thymidylate synthase inhibitors like 5-fluoro-2‟-deoxyuridine (FdU) and
methotrexate have been used to improve the incorporation rates of IdU up to five
fold95,96
.
Fig 2. The structures of (A) 5-Iodo-2’-deoxyuridine, IdU (B) 5-Fluoro-2’-deoxyuridine, FdU
Other than reducing competition from endogenous thymidine, the inhibition of
thymidylate synthase has been found to trigger an up-regulation of nucleoside
transporter proteins as well97
. This should further favor the uptake and incorporation of
exogenous nucleosides. This was observed when pre-treatment of patients with liver
metastases of colorectal cancer with FdU and folinic acid98
enhanced the uptake of IdU
by 72%. Some authors have suggested locoregional administration for overcoming the
stability and distribution issues but this approach is impractical for most clinical
settings.
55
3.5 Non-polar nucleoside analogs
C-aryl nucleoside mimics have been studied as potential therapeutic reagents as well.
Designed and developed by the Kool lab99,100
, non-polar hydrophobic isosteres of
nucleosides are close structural, steric and isoelectronic mimics with the natural
nucleosides. The nucleobases are replaced by benzene rings in these analogs, while the
hydrogen-bonding functionalities are replaced by non-hydrogen bonding groups like
halogens and methyl groups. For example, a thymidine mimic would have the carbonyl
groups at 2 and 4-position of the base replaced by halogens such that the shapes of the
bases are maintained. A number of C-nucleosides with a variety of 5-substituted
derivatives (H, I, F, CF3, CH=CHI, -C≡CH, -C≡C-I) of 1-(2-deoxy-β-D-ribofuranosyl)-
2,4-difluorobenzene have been synthesized since, for evaluation as thymidine
analogs101,102
. Such modifications of the pyridine nucleobases can bestow new
pharmacokinetic properties and alter the oral bioavailability and metabolic stability.
When incorporated into nucleic acids by enzymatic process these molecules could alter
their structure and function in a way which could be therapeutically beneficial.
Fig. 3. Structures of thymidine (2) and its non-polar nucleoside mimic 1-(2-deoxy-β-D-
ribofuranosyl)-2,4-difluoro-5-methylbenzene (1)
56
It was observed that despite being strongly destabilizing to DNA helices when paired
against natural bases, the triphosphates of the difluoro-analog of thymidine, dF (1) were
inserted into replicating DNA strands opposite adenine by the Klenow fragment (Kf
exo- mutant) of E. Coli DNA Polymerase I with nearly as high selectivity as natural
thymidine triphosphate and only 40-fold lower efficiency103
. It was therefore
anticipated that derivatives of 1 may be cytotoxic to highly proliferating cancer cells
and act as a radiopharmaceutical agent for both imaging and chemotherapy. The C-
nucleosides were also expected to be more stable to pyrimidine phosphorylases
compared to natural nucleosides since they lack the N-glycosidic bond. Compared to 5-
iodo-2‟-deoxyuridine (IdU) which underwent extensive catabolism under physiological
conditions these analogs were expected to be more resistant to deiodination. Moreover
the greater lipophilicity of these molecules could potentially facilitate their blood-brain
barrier penetration improving their bio-availability and distribution profile such that
unreachable targets like brain-tumors could be treated or imaged.
Fig. 4. The structures of (A) 5-iodouracil, IdU (B) 1-(2-deoxy-β-d-ribofuranosyl)-2,4-difluoro-
5-iodobenzene, IdF
57
3.6 Pharmacokinetics and metabolism of IdF (5-iodo-dF)
To assess the potential of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-difluoro-5-iodobenzene
(IdF) as a potential alternative to IdU studies have been conducted to determine its
enzyme stability and physicochemical properties. As expected, compared to IdU (Log
P= -0.95) the C-nucleoside mimic is much more lipophilic (Log P= 2.8)104
. IdF did not
undergo deglycosidation in the presence of E.Coli thymidine phosphorylase compared
to thymidine which underwent 28% phosphorylsis and IdU which underwent 38%
phosphorylation under the same incubation conditions104
. Only 10% degradation was
observed when IdF was incubated in rat plasma at 370C for 24hrs. Thus compared to
IdF, the aryl mimic is stable to both deglycosidation and dehalogenation. IdF had a
short half-life of elimination of 9-12min after intravenous and oral administration to
rats compared to shorter half-life of IdU (7min). It has been shown to have a very high
oral bioavailability of 96%. In order to be incorporated into DNA the nucleoside analog
would have to be converted to triphosphates by cellular kinases first. Hence a study of
their phosphorylation by human kinases was also conducted. IdF underwent
phosphorylation by human cytosolic thymidine kinase (TK1) to about 5% and by
mitochondrial thymidine kinase (TK2) by about 45% relative to thymidine105
.
3.7 Effect of IdF on cancer cells
Since it was envisioned that IdF could replace IdU as a thymidine mimic which gets
incorporated and then destabilizes the DNA and inhibits polymerization, its potential
use in killing cancer cells was also studied. However initial in vitro studies against a
variety of cancer cell lines proved to be disappointing. It exhibited negligible
58
cytotoxicity in the MTT assay (CC50= 10-3
to 10-5
M) compared to thymidine (CC50=
10-3
to 10-4
M)101
. The authors suggested that the failure of the compound to undergo
phosphorylation to 5‟-monophosphate could be a reason for their lack of anti-cancer
activity. In order to bypass the kinase mediated mono-phosphorylation step they
designed 5‟-O-cycloSal-pronucleotides. This lipophilic uncharged inactive masked 5‟-
O-phosphate derivative of the nucleoside was expected to penetrate the cell and release
Fig. 5 The cyclosaligenyl-phosphotriester undergoes hydrolysis under physiological
pH conditions to produce the mono-phosphate of IdF
the bio-active mono-phosphate via a pH driven mechanism. However this compound
continued to exhibit weak cytotoxicity against cancer cells and showed marginal
improvement in potency (CC50= 10-5
to 10-6
M) compared to the reference compounds
IdF and IdU which exhibited CC50 in the range of 10-3
to 10-5
M106
.
59
There could be a couple of reasons why this kinase-bypass strategy failed to work. It is
possible that subsequent phosphorylations of the monophosphate to di- and
triphosphate is rate limiting. Alternatively, the triphosphates may not be incorporated
into the DNA efficiently enough to cause chain-termination and cytotoxicity. In this
respect a study conducted by the Kool lab about the size-dependence of the polymerase
facilitated incorporation of the non-polar thymidine mimics could explain the latter
hypothesis. Using a series of gradually expanding thymidine analogs (Fig. 6) by using
halogens of increasing size, F, Cl, Br, I instead of oxygen the Kool group was able to
probe the steric effects on efficiency and fidelity of polymerase107
.
Fig 6. The series of non-polar analogs of thymidine with increasing size from dF to dI [Ref
107: Proc. Natl Acad. Sci. 2005; Reproduced with Permission]
Conducting kinetic studies with DNA Polymerase I (Klenow fragement, exo-) the
group observed that the polymerase was very sensitive to even sub-angstrom difference
in sterics. The replication efficiency against adenine increased from dH to dF and
60
peaked at dL (the dichloro derivative) and then decreased as the size of the base
increased further. Interestingly both fidelity and efficiency showed the same trend with
maximum fidelity observed with the dichloro-analog.
Fig.7. Histogram of nucleotide insertion efficiencies vs. varied base pair size. Steady-state
efficiencies (as Vmax/KM) using DNA Pol I (exonuclease-deficient) are shown on a log
scale.[Ref 107: Proc Natl Acad Sci 2005; Reproduced with Permission]
Based on these observations one could postulate that a dichloro-analog would be a
better thymidine mimic to be incorporated into DNA by polymerase than the
corresponding difluoro-analog. Hence we decided to study the effectiveness of
radiolabeled 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene (ICl2PhdR) in
cancer therapy and imaging.
61
3.8 Preparation radiolabeled ICl2PhdR
It is desirable to have a method of synthesis for any radiolabeled therapeutic compound
that is efficient and readily reproducible with minimum exposure to radioactive
reagents in the process of synthesis. Hence ideally the radiolabeling step should be the
last step of the synthesis and it should be rapid, quantitative and the desired product
easily separable. Facile preparation of radiolabeled IdU has been reported in the
literature and involves the demercuration of the corresponding chloromercury
compound ClHgdU108
or destannylation of the corresponding stannyl precursor109
.
However because of the toxicity of any trace mercury that might be contaminating the
product demetallation of the stannyl precursor is preferred.
Fig 8. Pathways of synthesizing radioiodinated nucleosides (PBS=phosphate buffered saline)
62
3.9 Synthesis of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-
iodobenzene
Following the Kool lab precedence of synthesizing a series of thymidine analogs110
, IdL
was synthesized by coupling the iodo-arene with syloxy-lactone. The 2-deoxy-D-ribose
was oxidized with bromine for 5 days to the corresponding lactone. After neutralization
with AgCO3 the crude oil was reacted with 1,3-dichloro-1,1,3,3-
tetraisopropyldisiloxane for 24 hours. Purification by flash-chromatography produced
3′,5′-O-((1,1,3,3-Tetraisopropyl)disiloxanediyl)-2′-deoxy-D-ribono-1′,4′-lactone as a
colorless oil. In order to couple the 2,4-dichloro-iodo-benzene to the siloxy-protected
lactone it was first lithiated with n-BuLi and then allowed to react with the lactone at -
780C for 3.5 hrs. Following quenching with NH4Cl, extraction with diethyl ether and
concentration in vacuo the crude oil was used used without further purification. It was
reduced with Triethylsilane in the presence of Lewis acid BF3.OEt2 at -780C for 6 hrs to
yield 11% of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichlorobenzene after column
purification. The coupling reaction yielded the desired β-isomer as the major product
with about 10% of the α-isomer. The siloxane 3‟, 5‟- protecting group was removed
smoothly with tetrabutylammonium fluoride to provide the nucleoside analog.
Iodination of the free nucleoside to produce the 5-iodo-analog however, required very
forceful conditions. The dichloro-analog was treated with 10 equivalents of N-
iodosuccinimide in the presence of CF3CO2H to produce the 5-iodo-analog in 63%
yield after column purification. In order to convert this to the stannyl-precursor needed
for radioiodination, the iodo-analog was heated with tributyl-tin in the presence of
63
catalytic amount of Pd(PPh3)4 for 2 days. Column purification provided the stannyl-
compound in 78% yield. Radioiodination was done by the Kassis lab by treating the
stannyl-compound with radioactive NaI125
in the presence of Iodogen. (Synthetic
scheme is shown in the next page)
Fig 9. Synthetic scheme for the synthesis of radiolabeled 1-(2-deoxy-β-d-ribofuranosyl)-2,4-
dichloro-5-iodobenzene ( ICl2PhdR)
64
3.10 Stability and pharmacology of ICl2PhdR
The Kassis group studied the stability of the radiolabeled ICl2PhdR and found both the
labeled and the unlabeled iodo-compound quite stable in mouse and human serum (Fig
10, 11). Male nude mice (n = 10) were injected subcutaneously with 2 x 106 LS174T
cells. Once the tumors became ~0.5 cm in diameter (within ~10 days), each mouse
received an intravenous injection (tail vein) of 100 µl saline containing ~5 µCi of
125ICl2PhdR. The animals were killed 1 h (5 mice) or 24 h (5 mice) later. The tumours
and blood, as well as various organs and tissues (heart, lungs, liver, stomach, spleen,
small intestine + content, large intestine + content, kidneys, thyroid, skin, muscle, and
tail), were dissected, weighed, and their radioactive contents determined in a gamma
counter. The percentage injected dose per gram (%ID/g) of tissue was then calculated
and plotted. However as shown in Fig 12 and 13 on the basis of %ID/g it was observed
that the radiolabeled analog didn‟t localize preferentially into the tumor. Instead as is
observed for most iodinated compounds significant localization took place in the
thyroid gland.
65
Fig. 10 125ICl2PhdR(15 μL) was incubated in 100 μL of human serum at 370C (courtesy Kassis
lab)
66
Fig. 11 125ICl2PhdR(15 μL) was incubated in 100 μL of human serum at 370C (courtesy Kassis
lab)
67
Fig 12. Distribution of 125
ICl2PhdR in tumor-bearing nude mice 1hr after a single
intra-venous injection (courtesy Kassis lab)
68
Fig 13. Distribution of 125ICl2PhdR in tumor-bearing nude mice 1hr after a single intra-venous
injection (courtesy Kassis lab)
69
3.11 Discussion of tumor-imaging experiments
As indicated by the radioactivity measurement studies, the dichloro-analog failed to show
significant localization into the mouse tumor. The increase in radioactivity in thyroid
from 4% ID/g at 1hr to approximately 400% ID/g at the end of 24hrs could indicate
metabolic dehalogenation of the compound. However given the initial stability studies in
human and mouse serum where it was found to be 100% stable this would be unexpected.
In a recent study on the biodistribution of the difluoro-analog IdF persistent stomach and
thyroid radioactivity was observed in Balb/C mice111
. The authors suggested that the
actual amounts in thyroid and stomach were indicative of deiodination. Another
interesting observation made in this study was the time-dependence of tumor retention.
Although the retention of IdF in tumor was low, it peaked to 5% ID at 1-2hrs and then
dropped to half in 4 hrs and was negligible in 24 hrs. In comparison the tumor uptake of
IdU was steady at 5% ID for the entire study period. Dehalogenation of C-nucleosides
have been observed previously with 1-(2-deoxy-β-d-ribofuranosyl)-2,4-difloro-5-
[F18
]fluoromethyl-benzene which was rapidly and extensively defluorinated in vivo
yielding high radioactivity concentrations in bone112
. However the mechanism of
dehalogenation of C-nucleosides in vivo is still not clear. Compared to 5-iodo-uracil
which could facilitate dehalogenation by directing the uracil-ring electrons to the C-5
position, the 5-iodo-C-nucleosides are fully aromatic and therefore expected to be much
more resistant to C-I cleavage.
The low uptake of the dichloro-analog could also be a consequence of low
phosphorylation by cellular kinase in the proliferating tumor cells. In a recent study
70
conducted by the Kool lab113
it was observed that although TK1 doesn‟t efficiently
phosphorylate the C-nucleosides, the difluoro-analog of thymidine was much preferred
over the dichloro-analog as a substrate for the mitochondrial enzyme, TK2 and was
comparable in efficiency to natural thymidine. Hence a kinase-bypass strategy involving
prodrugs could be much more successful in case of the dichloro-analogs which are much
better substrates for DNA polymerase.
3.12 Summary
In this section we described our studies evaluating the potential of non-polar isostere of
thymidine 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene as a tumor tracer.
Studies conducted in nude mice following intravenous injection showed that these
molecules are not selectively taken up by the tumor cells. Although these observations
appear to preclude the future of this molecule as a cellular proliferation imaging agent its
toxicity against proliferating cells and viruses should still be further ascertained. Targeted
prodrugs strategies involving this molecule might prove to be useful in tumor therapy.
71
Chapter 4
Investigating the steric and electronic discrimination of
deaminated and oxidized bases by a novel binding site of
polymerase from Pyrococcus Furiosus (Pfu)
4.1 Introduction
The stability and integrity of DNA is constantly threatened by environmental agents
like UV light or irradiation or by chemical oxidants or alkylating reagents. An accurate
read-out of DNA is necessary for the generation of mRNA and ultimately the proper
production of proteins. Hence DNA mutation is an important factor inducing
carcinogenesis and ageing. It is estimated that each day a human cell faces about 104
depurination events and hundreds of deamination events114
. However DNA is the
principle carrier of genetic information and hence the cellular machinery is constantly
at work to protect it from unwanted mutagenesis. The significant rates of hydrolysis,
oxidation and non-enzymatic alkylation are countered by specific DNA repair
processes.
4.2 Deamination of nucleobases
In addition to the inherent instability of the glycosidic bond, the DNA bases are also
vulnerable to hydrolytic deamination mostly targeting cytosine and 5-methyl-cytosine
bases114b,c
. The mechanism involves attack of hydroxide on the neutral base or by water
attacking the N3-protonated base115
(Fig 1). The resulting formation of uracil/thymine
upon replication, leads to the incorporation of adenine producing a G-C to A-T/U
72
transmutation in half the progeny. It has been revealed by using sensitive genetic assays
that cytosine deamination in double-stranded DNA has a half life of 35,000-80,000
years at a pH of 7.4 at 370C while a more solvent accessible base in single stranded
DNA is deaminated faster (t1/2=200 yrs)115
. At 700C the deamination occurs at a much
faster rate, making it very significant factor for hyperthermophilic archaea (t1/2=18yrs).
Interestingly, 5-methy-cytosine bases are deaminated 2-3 times faster than unmodified
cytosine115
. The effect is further magnified by the disparate rates of repair. In bacterial
and eukaryotic genomes the deaminated cytosine is rapidly excised by the abundant
uracil-DNA glycosylase to generate an abasic site which is efficiently corrected. This
enzyme however cannot act on thymine and the G-T mismatch is instead repaired by
the mismatch-correction process which is slower than the uracil correction process.
Thus methyl-cytosine residues end up becoming mutational hotspots. Sequencing of
tumor suppressor p53 gene illustrates this very well. It was observed that the cytosine
residues that were methylated had undergone mutation both in the normal and tumor
tissues, indicating that 5-methyl-cytosine may act as an endogenous mutagen and
carcinogen116
.
Fig 1. Mechanism of deamination of cytosine and 5-methyl-cytosine [Ref 115: Chemical
Research in Toxicology 2009; Reproduced with Permission]
73
Compared to cytosine, adenine is deaminated much slower at about 2-3% the rate of
cytosine deamination115
. The resulting hypoxanthine prefers to pair with cytosine rather
than thymine causing a mutagenic transition. The rate of deamination of guanine has
not been accurately determined yet but is assumed to be similar in rate or even slower
than adenine deamination. Xanthosine also encodes for cytosine although with reduced
specificity. In addition the xanthosine glycosyl bond with deoxyribose is particularly
susceptible to spontaneous hydrolysis116
.
Fig 2. The DNA nucleobases and their deaminated products
74
4.3 Oxidation of bases
Cells, particularly those growing aerobically are constantly exposed to endogenous
oxygen and free radical species. The hydrogen atoms on the deoxy-ribose sugar are
susceptible to abstraction by the hydroxide free radical based on their steric
accessibility117
which is H5‟ > H4‟ » H3‟ ~ H2‟ ~ H1‟. While the addition of hydroxide
radical to the C-5 of thymine produces various thymine derivatives like thymine glycol,
guanine is the major target of oxidative damage. The C-8 position is the primary
position of attack yielding a redox-ambivalent nucleobase radical that can undergo
either one electron reduction to produce formamidopyrimidine or one-electron
oxidation to produce 8-oxo-7,8-dihydroguanosine (Fig 3). 8-oxo-7,8-dihydroguanosine
base pairs with adenine preferentially over cytosine and hence is mutagenic. While 8-
oxo-7,8-dihydroguanosine and formamidopyrimidine are produced in equal quantities
by reaction with hydroxide radicals, the former is of greater interest because of its
direct mutagenic effect.
Fig 3. The mechanism of attack of guanosine by hydroxide radicals [Ref 115: Chemical
Research in Toxicology 2009; Reproduced with Permission]
75
4.4 DNA repair
Given the implications of DNA damage in metabolic disorders and carcinogenesis the
stability of the genome is under constant surveillance. To counter the continuous threat
posed to DNA by endogenous and environmental agents, cells have evolved several
systems that detect DNA damage, signal their presence and facilitate their repair.
Although the responses differ according to the lesion being remedied they do have a
common general program. While some lesions are fixed directly by a single protein
mediated repair most have to be remedied by a sequence of events catalyzed by
multiple proteins. In mis-match repair (MMR)118a
the mis-match base on the daughter
strand is recognized which is followed by its excision and repair by nuclease,
polymerase and ligase enzymes. Nucleotide excision repair (NER)118b
systems
recognize UV induced damages like thymine dimers and 6-4 photoadducts and work in
two sub-pathways that differ in the mechanism of lesion recognition: transcription
coupled pathways which specifically recognize lesions blocking transcription and
global-genome nucleotide excision repair. DNA double strand breaks are by-passed by
either homologous recombination or non-homologous end joining mechanisms118c,d
.
Base excision repair (BER) pathways, on the other hand, target bases recognized by
specific enzymes called DNA glycosylases115
. The lesions removed from DNA by BER
include uracil, N-alkylated purines, 8-oxo-7,8-dihydroguanine, thymine glycol and
many others. Besides repair pathways, the cells also protect their nuclear genome from
oxidative damages by maintaining poor oxygenation of the nucleus. The delegation of
oxygen metabolism to mitochondria has probably been evolved to protect the nuclear
DNA from damaging oxidative metabolism.
76
4.5 Base excision repair (BER)
Both modified bases and AP (apurinic/apyrimidinic) sites are removed by base excision
repair pathways which follow a general scheme shown in Fig. 4. AP sites can be
introduced into DNA by either non-enzymatic hydrolysis of sugar-base bond or by the
various DNA glycosylases which recognize different modified bases116
. For example,
excision of deaminated cytosine( uracil) by DNA glycosylase produces a base-free
deoxyribose-phosphate moiety. This is followed by an endonuclease mediated single-
strand break. After the generation of the 3‟-hydroxyl and 5‟-phosphate ends by the
phosphodiesterase DNA polymerase uses the opposite strand to template the insertion
of the proper base. Ligase then joins the two segments of the strand.
The inactivation of E. Coli fpg (Mut M) gene encoding the DNA glycosylase which
recognizes 8-oxo-7,8-dihydroguanine leads to a 10-fold increase in the spontaneous
mutation frequency118
. The same relative increase in mutation is observed in E. Coli
ung mutants which are unable to cleave uracil from DNA. It seems that hydrolytic
deamination of cytosine and oxidation of guanine to 8-oxo-guanosine are spontaneous
directly premutagenic events in the living cells and they occur at similar frequencies.
4.6 Stability and repair of DNA in hyperthermophilic archaea
The existence of microorganisms at high temperatures raises interesting questions about
the temperature limits of life sustaining metabolic processes. Since the intracellcular
contents of these microbes cannot be insulated from the environmental temperature
they must have adapted to function under these extreme conditions. In fact most of the
77
enzymes isolated from the hyperthermophiles have been found to be highly
thermostable. While enzymes that function at temperatures of 1300C are now well
established, some small proteins can even function at temperatures as high as 2000C
119.
Hence it appears that intrinsic enzyme stability may not be a limiting factor to the
survival of these hyperthermophiles. A more relevant question might be the capacity of
these organisms to cope with the extensive degradation of DNA primary structures that
could occur at such high temperatures. The rates of hydrolytic depurinations and
cytosine deaminations are significantly enhanced at higher temperatures. From in vitro
experiments it has been estimated that DNA above 1000C undergoes depurinations and
cytosine deaminations 3000-fold faster than DNA at 370C
114. In other words the
ordinary problems of DNA maintenance are magnified in hyperthermophiles. Hence in
order to maintain their genomic integrity hyperthermophiles need to have some passive
protective mechanisms against DNA damage or a highly efficient DNA-repair system.
Histones are known to provide some passive protection to the archaeal genome from
radiation induced DNA breaks but even at very high histone and salt concentration,
22Gy of irradiation, a relatively small dose, has been found to generate one single-
strand break per 4.36 kbp plasmid124
. It has also been hypothesized that reverse gyrase
enzymes maintain the DNA in positively supercoiled topological conformation
providing it some resistance to uncoiling at high temperature. But these factors by
themselves are not sufficient to maintain the genomic integrity of hyperthermophiles.
Thus evolutionary and physiological considerations argue that studying the
hyperthermophilic archaea would enable us to learn new molecular aspects of DNA
stabilization and repair. So far, the investigation of these prokaryotes has revealed a
78
number of genes and enzymes consistent with the known mechanisms of base excision
repair and trans-lesion repair. The enzymes related to the base excision repair include a
number of glycosylases including a uracil-glycosylase120
whereas trans-lesion synthesis
repair enzymes include a number of Y-family DNA polymerase enzymes121
. Unusual
and novel enzyme functions have also been observed. For example, type 1B DNA
Polymerase has been found to exhibit AP lyase activity122
. A new class of polymerase
was discovered when it was found that a single sub-unit polymerase from Sulfolobus
exhibited both ATPase and DNA primase activities123
. What is very surprising is that
all the genomes of the hyperthermophilic archaea that have so far been sequenced lack
key genes of both nucleotide excision repair and base mismatch repair pathways which
are otherwise highly conserved in biology.
4.7 Archaeal polymerases are inhibited by uracil
It was observed that when UTP was used instead of TTP to minimize carry-over
contamination in PCR, archaeal polymerases showed very poor performance.
Compared to the archaeal polymerases bacterial thermostable polymerases like the
enzymes from Thermus aquaticus were unaffected by UTP. It was later discovered that
archaeal polymerases are inhibited by DNA containing uracil which bound tightly to
such enzymes125
. It was recognized that archeal polymerases were unable to replicate
beyond the template strand uracil and were stalled 4 bases ahead of them126a
. Similarly
recognition of hypoxanthine, which is the deaminated product of adenine, was later
reported first with polymerase from Sulfolobus solfataricus126b
and then with
polymerase from Pyrococcus furiosus which was inhibited but to a lesser extent than by
79
uracil. There could be two ways of explaining this stalling. The „blocking model‟
envisages an actively extending polymerase molecule blocked by another polymerase
molecule bound tightly to the uracil in the template. Alternatively, the „read-ahead
model‟ entails a uracil binding site in the polymerase molecule upstream from the
primer-template junction which upon binding the uracil signals the stalling of the
polymerase. Given that DNA polymerases have a foot-print of at least 10-12 template
nucleotides and the stalling was observed only 4 bases ahead the latter model was
proposed by the Connolly lab to be likely occurring126c
. It was proposed that the N-
terminal domain typically found in archaeal polymerase contained a site responsible for
uracil binding. Using site directed mutagenesis of Pfu-Pol a binding pocket was
identified in the N-terminal domain127
. A Val93Q mutant of Pfu-Pol was found to have
completely lost the uracil recognition capacity while still maintaining the polymerase
activity128
. This mutant could be successfully used in PCR applications using UTP.
Fig. 4. Read-ahead uracil detector. (a) Blocking of a running polymerase actively extending a primer, by a second polymerase bound to deoxyuridine in the single-stranded segment of the template, would give a gap between the last incorporated nucleotide (arrowed) and thetemplate deoxyuridine (U), larger than the ‘‘footprint’’ of the polymerase. (b) In the read-ahead model, specific stalling of a running polymerase at a deoxyuridine upstream in the single-stranded segment of the template would give a gap between the last incorporated nucleotide (arrowed) and the template deoxyuridine (U), smaller than the ‘‘footprint’’ of the polymerase, as is observed (Ref 126a).
80
4.8 Structure of archaeal polymerase bound to uracil containing
DNA
The key question is how does the polymerase binding site discriminate uracil from the
four natural bases including thymidine which differs from it by just a methyl group.
Previously studied enzymes like uracil glycosylases and dUTPases serves as good
models of uracil recognition. Both these enzymes present a binding pocket with specific
hydrogen bonding to uracil and sterical exclusion of other bases. Although features of
the uracil binding pocket seemed to be similar to those of the glycosylases and the
dUTPases, a co-crystal structure of an archeal polymerase with uracil-containing DNA
further detailed the binding site structure and interactions. The crystal structure of
Fig 5. X-ray structural details of the interaction between Tgo-Pol and a primer–template
containing uracil at the +4 position in the template.
The DNA used has the sequence AAUGGAGACACGGCTTTTGCCGTGTC, which forms a snap-
back primer–template containing a (T)4 loop. The single-stranded template region is
underlined. (A) Overall structure with the polymerase domains colour-coded and the DNA
shown in red. Uracil is located in the N-terminal domain (yellow). (C) Amino acids lining the
uracil-binding pocket of Tgo-Pol. The amide nitrogens of Ile114 and Tyr37 form hydrogen
bonds (broken lines) with uracil O-2 and O-4 respectively. Val93 stacks over the heterocyclic
ring of uracil and Pro36, Pro90 and Phe116 are adjacent to the uracil C-5. [Ref 129: Connolly
B.A. Biochem Soc Trans (2009) 37, 1, 65-68. Reproduced with Permission]
81
polymerase from Thermococcus gorganarius with a primer-template containing uracil
at +4 position in the template shows the uracil bound to the predicted binding site in the
N-terminal domain128
. As in uracil glycosylases, the uracil was flipped into the binding
site. Strong interactions are seen with the 3‟ and 5‟-phosphates flanking the uracil and
there are putative hydrogen bonding groups for the O2 and O4 groups as well. Steric
blocking near the C-5 of uracil by Pro and Phe residues provide selectivity against
thymine. A Val93
residue was found to be placed in a position such that a stacking
interaction between its isopropyl side chain and the uracil heterocycle was possible.
This further substantiated the explanation provided by the site-directed mutagenesis
experiments where a V93Q mutant of Pfu-Pol was found to lack the uracil recognition
property. The uracil was found to be recognized in the anti-position.
4.9 Role of hydrogen bonding and shape in base recognition
As mentioned earlier, it is of interest to determine the structural and electronic features
which lead to uracil recognition and flipping. In this respect a comparison with other
well studied uracil recognizing enzymes like uracil DNA glycosylases (UDG) might be
insightful. Extensive structural and biophysical studies have determined that the
pathway of uracil recognition and flipping in UDG consist of three steps130a,b
. The first
step involves the formation of a quick encounter complex with the enzyme in which
uracil is still intrahelical which is followed by a metastable state in which the DNA is
bent but still largely stacked within the DNA. In the last step the base docks into the
enzyme active site and is clamped in place. Previous studies with UDG have shown that
82
the two factors which are important in determining whether an enzyme flips a base into
the active site are its shape and hydrogen bonding properties. To probe the role of these
factors the Stivers lab had studied the interaction of UDG with a synthetic DNA duplex
containing a single difluorophenyl nucleotide(F), which is an excellent isostere of uracil
but contains no hydrogen bonding functionality130c
. They observed that UDG was able
to partially unstack this base from the duplex but due to the lack of hydrogen-bonding
stabilization the enzyme couldn‟t undergo a conformational transition from open to
closed. While the F/A base pair showed just 5 fold lower affinity to the enzyme
compared to the U/A base pair, the T/A base pair showed 28 fold lower affinity. It was
proposed that the difluorophenyl nucleotide attained a metastable unstacked state that
mimicked a previously identified intermediate in the base-flipping pathway of uracil.
While the purine and thymine bases are sterically rejected cytosine is discriminated on
the basis of specific hydrogen bonding in these enzymes.
4.10 Non-polar analogs in investigating the importance of
hydrogen-bonding
In order to determine the role of hydrogen bonding and shape in base recognition by the
uracil/ hypoxanthine binding pocket of archaeal polymerase, non-polar analogs of these
nucleotides developed by the Kool lab were employed. The C-nucleoside, 1-(2-deoxy-
β-d-ribofuranosyl)-2,4-difluorobenzene (Fig 6B),which replaced the C=O bonds
83
Fig 6. Uracil analog difluorobenzene(F) and Hypoxanthine analog fluorobenzimidazole
(Fbim) were used as their shape mimics
of uracil with C-F bonds and the pyrimidine ring with benzene, was considered a very
good shape mimic of uracil. The non-polar mimic of hypoxanthine was designed by
similarly replacing the C=O bond with a C-F bond and the pyrimidine ring by
benzene(Fig 6D). The bond lengths of C-F (1.36 A0) are quite close to that of C=O(1.22
A0) in uracil and hence these analogs are expected to very well maintain the shape of
the nucleosides they are mimicking but lack the Watson-Crick hydrogen bonding
groups.
4.11 Dual recognition of both uracil and hypoxanthine
The fact that the archaeal polymerase recognizes both uracil and hypoxanthine
perplexed scientists because there were not many precedents of an enzyme which
bound hypoxanthine but rejected other purine bases like adenine, guanine and xanthine.
Also considering a tight pocket necessary to reject thymine it was difficult to
84
hypothesize a sterically larger base like hypoxanthine being accepted by the same
binding site. The best characterized enzyme which discriminates both a purine and a
pyrimidine is orotidine 5‟-monophosphate decarboxylase which recognized both 6-aza-
uridine monophosphate and xanthine monophosphate131b
. It accomplished this by
binding them in syn and anti conformations respectively. Hence the Connolly group
proposed that the archaeal polymerases might be using similar mechanism to identify
both uracil and hypoxanthine131a
. By overlapping molecular models of anti-uracil
monophosphate(dUMP) and syn-hypoxanthine monophosphate(dHMP) they showed
that the O4 and O
6 and C
5 and C
2 of dUMP and dHMP were each located within 0.1nm
of each other and could potentially be recognized by the same polymerase elements
(Fig. 7). The cystal structure128
later confirmed that uracil bound in the anti-
conformation in the binding pocket with appropriately located amino acids putatively
forming hydrogen-bonds with O2 and O
4 and providing steric exclusion at C
5.
Fig.7 Structures of anti-dUMP and syn-dHMP drawn with sugar and phosphate overlapped.
dUMP (yellow) dHMP (blue) [Ref 131a: J Mol Biol 2007; Reproduced with Permission]
85
The syn-anti hypothesis also brought up other interesting questions. It is well known
that oxidation of guanine to oxo-guanine occurs at a similar rate as the deamination of
cytosine to uracil and like deamination would be expected to be aggravated at higher
temperature. The translesional incorporation of adenine against oxo-guanine is based on
the rational that 8-substituted purines prefer to adopt syn-conformation over anti. The
steric repulsion between the 8-substituent and the 4‟-oxygen in the anti conformation
makes the syn conformation energetically favorable. Syn-oxoG forms a Hoogsteen base
pair with adenine without affecting the overall structure of duplex DNA132
. Hence it is
intuitive to wonder whether this unique hypoxanthine/uracil recognition pocket has
evolved to recognize more than just deaminated bases but can be also used by the
archaea to identify other mutagenic lesions like oxoguanosines.
In fact overlapping the energy-minimized molecular models (SPARTAN) of syn-
oxoguanosine with anti-uracil, along the C-N glycosidic bond, it is seen that the O6 and
O8 of oxo-guanosine are quite close to O
2 and O
4 of uracil so that they can potentially
hydrogen-bond with the same polymerase amino acids (Fig 8). However there is
additional steric bulk of the amino group at C2
position which could either hinder the
recognition of oxo-guanosine or could facilitate hydrogen bond formation with some
polymerase element. One way of probing the interaction of the 2-substituted amine in
oxoG is by studying a molecule which lacks it. 7,8-dihydro-8‟-oxo-2‟-oxoinosine
(oxoI) is a structural analog of oxoG which lacks the amino group at C2 position. It has
been used to study the interactions of damaged DNA and repair enzymes. These studies
have shown that the exocyclic amine at the C2 position is not essential for repair by
enzymes133,134
. 8-oxo-inosine, on the other hand overlaps very well with hypoxanthine
86
and even provides the additional hydrogen bonding group at O8 position which
hypoxanthine lacked. If hypoxanthine did bind in syn-conformation then syn-oxoI is
very likely to be recognized by the same polymerase elements which recognize uracil
and hypoxanthine. Hence in order to ascertain the validity of the syn-anti hypothesis
and also to determine whether the archaeal polymerase recognized more mutagenic
lesions than just uracil and hypoxanthine we decided to study the interaction of the
archaeal polymerases with oxo-guanosine and oxo-inosine.
Fig. 8 Overlap of molecular models (SPARTAN) of the molecules along the C-N glycosidic
bond (A) Overlap of anti-uridine and syn-inosine (B) Overlap of anti-uridine and syn-
oxoguanosine (C) Overlap of anti-insoine and anti-oxoinosine (D) Overlap of anti-uridine
with syn-oxoinosine
87
4.12 Preparation of DNA sequences for polymerase extension
assays
For primer extension assays, a 24 bases long primer and 44 bases long template
containing the base of interest either 6 or 10 bases upstream of the primer-template
junction were synthesized. Following are the sequences of the oligonucleotides
synthesized:
Primer (24mer): 5‟-GGGGATCCTCTAGAGTCGACCTGC-3‟
Template(44mer):5‟GGAGACAAGCTTGCXTGCCTGCAGGTCGACTCTAGAGGA
TCCCC-3‟ (where the underlined portion is the part of the template complementary to
the primer and X= F, Fbim)
5‟-GGAGACAAGCXTGCTTGCCTGCAGGTCGACTCTAGAGGATCCCC-3‟
(Where X= F, U, Fbim, oxoG, oxoI)
Oligonucleotides were synthesized on an Applied Biosystems Incorporated 394 DNA
synthesizer using standard protocols. Phosphoramidites for the incorporation of oxoG
were purchased from Glenn research while the phosphoramidites of the other modified
nucleotides (F, Fbim, oxoI) were synthesized in the Kool lab. The Fbim containing
sequences were provided by Samuel S. Tan. The oligonucleotides were purified by
polyacrylamide gel electrophoresis and quantitated by UV absorption. Molar extinction
coefficients were calculated by the nearest neighbor method. Values of the extinction
coefficients of the oligonucleotides containing unnatural residues were calculated by
adding the extinction coefficient of the unnatural nucleoside to that of the natural
sequence.
88
4. 13 Synthesis of F-phosphoramidite
Previously developed C-nucleoside synthesis for thymidine isosteres110
was used to
synthesize the difluorobenzene (F) nucleoside. Commercially available 2,4-difluoro-
bromobenzene was converted to its Grignard reagent by treating with Iodine/Mg and
then reacted with siloxy-protected ribonolactone. As in the previously discussed
reaction involving the coupling of aryl-lithiums, the aryl-grignards produced the β-
anomer with high selectivity and comparable yield. The siloxane was deprotected using
tetrabutyl- ammonium fluoride and the free nucleoside was tritylated using standard
conditions. The phosphoramidite was produced by reacting the tritylated nucleoside
with 2-cyanoethyl-N,N,N‟N‟-tetraisopropylphosphoramidite in the presence of
tetrazole (Synthetic scheme shown in Fig 9)
4.14 Synthesis of oxoI-phosphoramidite
A facile one-pot synthesis of 8-oxo-7,8-dihydro-(2‟-deoxy)adenosine in water was
achieved using mercaptoethanol in the presence of triethylamine, following a published
procedure135
. The amino group of oxo-adenosine was then removed by an enzyme
called adenosine deaminase, an essential enzyme in purine metabolism which converts
adenosine to inosine132
. The oxo-inosine thus produced was tritylated at the 5‟-position
using standard tritylating conditions. As in the synthesis of F-phosphoramidite, the 2-
cyanoethyl-N,N,N‟N‟-tetraisopropylphosphoramidite was used to generate the oxo-I
phosphoramidite (Synthetic scheme shown in Fig. 10)
89
Fig. 9. Synthetic scheme for the synthesis of F-phosphoramidite
90
Fig.10. Synthetic Scheme for the synthesis of oxo-I phosphoramidite
91
4.15 Primer extension assays with the polymerase enzyme
The primer (10nM) and the template (20nM) were mixed with hot primers (0.5nM) in
the polymerase reaction buffers provided by the suppliers of each polymerase. They
were heated to 900C and then slowly allowed to cool down to room temperature in
order to facilitate annealing. 0.5 units of polymerase enzyme and dNTPs (1.25mM)
were then added to the reaction mixture to give a final volume of 20µL. The reaction
mixtures were incubated at 720C, the optimal temperature for archaeal polymerasee.
Aliquots of reaction mixtures were taken out at regular intervals and analyzed by
denaturing gel electrophoresis and detected by phosphorimaging.
For positive control, we compared the templates containing the modified bases with
templates containing uracil. If the templates containing modified nucleotides were
recognized then like uracil they should give rise to bands 4 nucleotides downstream of
the modified nucleotide. Negative control was provided by polymerase Thermus
aquaticus(Taq) an enzyme which doesn‟t have the type of read-ahead uracil recognition
property demonstrated by Pfu polymerase but is stalled at the site of incorporation of
the non-polar isostere136
. Both Taq and Pfu are however expected to give full length
products with thymidine and guanosine containing templates which are used as controls
showing full-length extension.
4.16 Results
Difluorobenzene analogs of uracil: When templates containing F at +10 and +6
positions from the primer-template junctions were compared with templates containing
92
uracil we did see some recognition of F by Pfu. Faint bands corresponding to stalled
products 4 bases downstream were evident particularly at shorter time points of the
polymerase reaction but the recognition was not as profound as for uracil (Fig 11).
Compared to thymidine however, Pfu recognizes F (the shape mimic of uracil) better
(Fig 13).
Fluorobenzimidazole analogs of hypoxanthine: When templates containing Fbim at +10
and +6 position from the primer-template junction were compared to templates
containing uracil we observed some stalling 4 nucleotides downstream but even lesser
than that observed with F and significantly lesser than uracil (Fig 12).
Oxo-inosine: Comparing oxo-I containing templates with U containing templates where
the concerned base is 10 nucleotides ahead of the primer-template junction we again
see some faint stalling 4 nucleotides downstream but again it is observed only at lower
time-points of polymerase reaction and is nowhere as profound as the recognition of
uracil by Pfu (Fig 14). As expected control sequences containing thymidine were
extended to full length products under the similar reaction conditions.
Oxo-guanosine: Templates containing oxo-guanosine also demonstrated slight read-
ahead recognition by Pfu polymerase(Fig 15).
93
Fig. 11. Primer-extension assays. Phosphorimaging of radiolabled primer on denaturing
polyacrylamide gel shows extension products on templates F(+10) and F(+6) containing F 10
bases and 6 bases upstream of the primer-template junction, respectively. U(+10) is used as
a control template containing uracil 10 bases upstream of the primer-template junction. As
expected Taq does not show any read-ahead recognition but is stalled by the uracil isosteres
at the site of incorporation. Pfu shows weak stalling as shown by faint bands 4 bases
downstream.
94
Fig 12. Primer-extension assays. Phosphorimaging of radiolabled primer on denaturing
polyacrylamide gel shows extension products on templates Fbim(+10) and Fbim(+6)
containing Fbim 10 bases and 6 bases upstream of the primer-template junction,
respectively. U(+10) is used as a control template containing uracil 10 bases upstream of the
primer-template junction. As expected Taq does not show any read-ahead recognition but is
stalled by the uracil isosteres at the site of incorporation. In fact we also see some full-
length extension products with Taq at longer time points. Pfu shows weak stalling as shown
by faint bands 4 bases downstream at shorter time points.
95
Fig 13. Primer-extension assays. Phosphorimaging of radiolabled primer on denaturing
polyacrylamide gel shows extension products on templates U(+10) ,F(+6), T(+10) containing
U, F and T 10 bases upstream of the primer-template junction, respectively. F, the shape
mimic of uracil is better recognized than T.
96
Fig 14. Primer-extension assays with Pfu. Phosphorimaging of radiolabeled
primer on denaturing polyacrylamide gel shows extension products. Oxo-I(+10),
U(+10) and T(+10) are templates containing oxo-inosine, uracil and thymidine 10
bases ahead of the primer-template junction respectively. While uracil is clearly 4
bases recognized ahead of the primer-template junction, thymine allows full-
length extension. Oxo-I containing template on the other hand shows some
pausing at initial time points but then is then elongated until it reaches the
modified base where it is inhibited strongly. Longer time points (not shown) show
some full-length extension of this template.
97
Fig 15. Primer-extension assays. Phosphorimaging of radiolabeled primers on
denaturing polyacrylamide gel shows the extension products with Pfu. U(+10),
oxo-G(+10), G (+10) are templates containing uracil, oxo-guanosine and guanosine
10 bases upstream of the primer-template junction, respectively. While guanosine
containing template shows rapid full-length extension the template containing
uracil shows profound read-ahead recognition. Oxo-guanosine containing
template doesn’t show significant read-ahead stalling.
98
4.17 Discussion
The weak recognition of the F analog by the uracil-binding pocket compared to the
recognition of uracil as well as the weaker recognition of fluorobenzimidazole analog
demonstrates that hydrogen-bonding is an important discriminating factor in the
recognition of bases by this binding site. Considering that hypoxanthine bound to the
enzyme 1.5-4.5 fold less than uracil131
, the weaker recognition of Fbim compared to F
was not surprising. However compared to the natural bases (T) we do see some stalling
4 bases ahead of the primer-template junction with the difluorobenzene analog (F)
which proves that shape recognition is important but not sufficient for discriminating
the nucleobases from each other (Fig 13)
What is more perplexing is the minimal recognition of oxo-inosine which is exactly the
same as hypoxanthine except for an additional an additional hydrogen bonding
functional group at the C8 position close to the C
2 oxygen of uracil. If uracil binds in
the anti-position as shown in the crystal structure then the syn-anti hypothesis
explaining the dual binding of uracil and hypoxanthine would require hypoxanthine to
bind in the syn-conformation. In such a scenario one would expect syn-oxoinosine to be
bound even better than syn-hypoxanthine since it is sterically almost identical and has
the additional hydrogen-bonding stabilization lacked by hypoxanthine. However if
contrary to the hypothesis hypoxanthine is recognized in the anti-conformation then
this would be thermodynamically unfavorable for oxo-inosine and oxo-guanosine both
of which prefer to be in their syn-conformations. The barrier involved in the syn to anti
transformation may be too high to be compensated by the putative hydrogen bonding
99
stabilization. In fact subsequent crystal structures (unpublished results Connolly lab)
confirmed that hypoxanthine bound in the anti-conformation rather than the proposed
syn-conformation. This clearly explains why we see no recognition of 8-oxo-bases by
this binding site.
4.18 Summary
In this section we studied the steric and electronic features which a novel binding site in
archaeal polymerase Pfu uses to distinguish deaminated bases from natural bases. We
used non-polar isosteric base analogs of uracil and hypoxanthine to determine the
importance of hydrogen-bonding in this binding site. The study shows that hydrogen-
bonding is an important factor in base identification by this binding site. We further
investigated whether the binding site could recognize oxidized bases as well. Using
oxo-guanosine and oxo-inosine we demonstrated that oxidized bases are not very well
recognized by this binding site since it appears to recognize both purines and
pyrimidines in anti-conformation. This makes it thermodynamically unfavorable for
oxidized purines with 8-oxo-groups to be bound in this pocket. It will be of interest to
determine what follows the stalling of replication by the capture of uracil and
hypoxanthine in these enzymes. More structural information and kinetic data is needed
to elucidate how the polymerase active site is switched off by this read-ahead
recognition.
100
Chapter 5
Investigating the importance of shape and hydrogen
bonding in base recognition by DNA dependent RNA
polymerase II
5.1 Introduction
While hydrogen-bonding is a significant contributor to the stability of DNA, its
importance in DNA replication was challenged about a decade ago when it was
observed by the Kool lab that non-hydrogen bonding shape mimics of nucleobases
were able to pair with complementary bases with significant fidelity and efficiency136
.
When thymine analog, difluorotoluene(dF) was used in DNA template, DNA Pol I
(Klenow fragment) was able to incorporate adenine base opposite to it with a specificity
similar to the natural base. dF-triphosphates were similarly inserted against adenine in
the DNA template with high selectivity and efficiency103
. Other high fidelity DNA
polymerases like Taq and T7 DNA polymerases also efficiently incorporated non-polar
bases. Based on these observations, it was proposed that steric-matching was a more
important factor in DNA replication than hydrogen-bonding137
.
5.2 Hydrogen-bonding in RNA polymerases
While the structural aspects underlying fidelity has been extensively investigated in
DNA polymerases, the RNA polymerase fidelity mechanisms remain poorly
understood. As with DNA polymerases it was originally thought that the primary
process ensuring fidelity of transcription was the Watson-Crick base pairing between
101
the incoming nucleotide triphosphate and the DNA base to be copied. However it was
observed that the stability provided by hydrogen-bonding was not sufficient to account
for the observed fidelity in RNA polymerases142
. Consequently it was realized that
there must be other factors which are critical to the fidelity of RNA polymerases.
In the recent past, studies involving hydrophobic base pairs have extended the paradigm
of shape complementariy to RNA Polymerases as well. The Hirao lab used unnatural
base pairs which neither hydrogen bond with natural bases nor with their synthetic
counterpart138
. They are however perfect shape complements of each other. The Ds-Pa
pair was designed to have shapes different from natural bases but have some proton
acceptor groups capable of interacting with the polymerases. In templates containing
these unnatural nucleotides the Ds-Pa complementarity mediated site specific
incorporation of Ds-triphosphates, Pa-triphosphates and modified Pa-triphosphates into
RNA by T7 RNA Polymerase.
Fig 1. The unnatural base pair Ds-Pa is a good shape complementary pair like natural
nucleobase pairs
The Romesberg group also developed base pairs which were selectively transcribed by
T7 RNA polymerase. These bases had complementary shape and packing rather than
complementary hydrogen-bonding140
. When present in a DNA template these unnatural
102
bases produced full-length extension products only in the presence of the cognate
nucleotide triphosphates. Although their fidelity of incorporation was comparable to
natural nucleobases, their efficiency was 20 times lower. Interestingly when dMMO2
and dNaM (Fig 2) were in the template they observed that extension was more efficient
than the synthesis of the unnatural base pairs. This was in contrast with the behavior
generally observed with DNA polymerases which appeared to depend upon the
presence of minor groove hydrogen bond acceptors for extension141
.
Preliminary studies in the Kool lab, also indicated that shape complementarity may play
an important role in base selectivity in RNA polymerases. It was found that
triphosphates of difluorobenzene ribonucleosides which are very good shape mimics of
uracil were incorporated against adenine by E. Coli RNA Polymerase139
.
5.3 RNA Polymerase II
RNA polymerase II is responsible for all mRNA precursor synthesis in eukaryotic cells
and hence is one of the most studied of all the DNA dependent RNA
polymerases145a,b,d
. As the enzyme controlling the first step of gene expression it
essentially regulates all activities of cellular differentiation and development. The
importance of understanding its structure and function was vindicated by the Nobel
prize recognition of Kornberg‟s seminal work in this field145c
. A recent crystal structure
published by the group145d
clearly shows the presence of a trigger-loop unit which
contains a network of NTP recognition elements including an asparagine residue which
helps discriminate deoxyribose triphosphates from ribose-triphosphates by at least
1000-fold. However it is still not very clear how individual bases are paired against the
103
corresponding bases in the template. We believe that structural and kinetic studies
involving modified bases would help in shedding some light on the electronic and
structural features which dictate fidelity and efficiency in RNA Polymerase II. To the
best of our knowledge, there have been no studies investigating RNA Polymerase II
activity using modified nucleobases. Hence we decided to study the importance of
shape and hydrogen bonding in base discrimination by RNA Polymerase II by using
non-polar isosteric mimics of nucleobases.
5.4 Hydrophobic analogs of adenine and thymine
9-methyl-1-H-imidazo[(4,5)-b]pyridine nucleoside analog (denoted as dQ) was
synthesized by the Kool lab as an isoelectronic and isosteric mimic of deoxyadenosine.
It lacked Watson-Crick hydrogen bonding groups but had a minor groove hydrogen
bonding acceptor N, analogous to N3 in adenine and was useful in demonstrating the
importance of minor groove hydrogen bond in extension of the 3‟-end of the primer by
DNA polymerase. While both Q and Z (4-methylbenzimidazole-deoxynucleoside,
which differed from Q by the absence of N3) were both inserted with similar efficiency
the extension rate of the former was significantly higher when placed at the 3‟-end of
the primer143
. In order to study the importance of shape and hydrogen bonding in RNA
Polymerase II we and our collaborator (Dong Wang) decided to study dQ as a non-
polar mimic of deoxy-adenosine. The analog difluorotoluene deoxyriboside (dF) which
is a non-hydrogen bonding isostere of thymidine was used as a thymidine mimic144
.
104
Fig 2. Non-polar nucleoside analogs (dF and dQ) used in this study. Natural nucleosides
shown above for comparison
5.5 Synthesis of sequences for RNA polymerase studies
The Kornberg lab had previously obtained the crystal structure of a transcribing
complex of yeast RNA polymerase II with a 29-residue DNA template, 10 residue
RNA and 14 residue DNA complementary to the template downstream to the RNA.
This structure showed the importance of a key polymerase element called trigger loop
in controlling nucleotide addition to the growing RNA145d
. A similar template
containing the modified base, 2 bases downstream of the RNA-DNA junction was
designed for the studies.
5‟- AU CGA GAG G -3‟ (RNA)
3‟- GTA GCT CTC CTX GCA GAC GAA TAG CCA TC- 5‟ (Template)
5‟-CTG CTT ATC GGT AG-3‟ (Complementary DNA)
Where X= dQ, dF
105
Oligonucleotides were synthesized on an Applied Biosystems Incorporated 394 DNA
synthesizer using standard protocols. Phosphoramidites for the incorporation of dF
were purchased from Glenn research while the phosphoramidite of the other modified
nucleotide, dQ was synthesized in the Kool lab. The oligonucleotides were purified by
polyacrylamide gel electrophoresis and quantitated by UV absorption. Molar extinction
coefficients were calculated by the nearest neighbor method. Values of the extinction
coefficients of the oligonucleotides containing unnatural residues were calculated by
adding the extinction coefficient of the unnatural nucleoside to that of the natural
sequence.
5.6 Synthesis of the dQ-phosphoramidite
Following a previously published method143
, 9-methyl-1-H-imidazo[(4,5)-b]pyridine was
obtained by treating 2,3-diamino-4-methyl pyridine with formic acid in HCl. The base thus
generated was reacted with sodium hydride and coupled to benzyl-protected chlorosugar of
deoxyribose . The major product Q bis-benzoyl-ester was not separated from a minor product
but carried on to the next step where the benzoyl groups were removed using sodium
methoxide/ methanol. Purification using column chromatography provided the desired product
which was characterized by HMBC and by the characteristic intramolecular hydrogen-bond
(which is only possible in this isomer) between the OH 5’ and the N6 of the base. The 5’-DMT
protected nucleoside was obtained using standard reagents and the phosphoramidite was
generated by reacting with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite in the presence
of diisopropylethylamine.(Synthetic scheme in Fig 3).
106
5.7 Extension assays with Pol II enzyme
For addition of rNTPs, transcribing complexes were formed as described earlier with 10
pmol 10-subunit pol II, 120 pmol template, 240 pmol RNA, and 240 pmol downstream
nontemplate DNA, in transcription buffer (TB) . Complexes were incubated with 50
mCi α32
P-ATP (3000 Ci/mmol) to label active elongation complexes at room
temperature. The rNTP specified for incorporation at the subsequent template position
was then added at a final concentration of 25 µM or 500µM. The reaction products
were separated by 18% denaturing polyacrylamide gel and visualized using a
phosphorimager (Courtesy Dong Wang).
107
Fig 3. Synthetic scheme for the preparation of dQ-phosphoramidite
108
Fig. 4 RNA polymerase assays with adenine at the site of incorporation of modified
nucleobase (Courtesy Dong Wang). The reactions were carried out with different rNTP
concentrations of 25 µM and 500µM. The lanes correspond to different rNTP composition(
lane 0: no rNTP, lane 1: α32 P-ATP lane 2: α32 P-ATP, CTP, lane 3: α32 P-ATP, GTP, lane 4: α32
P-ATP, UTP, lane 5: α32 P-ATP, GTP, CTP, lane 6: α32 P-ATP, UTP, CTP, lane 7: α32 P-ATP, UTP,
CTP, GTP). Following are the sequences of the RNA and DNA template:
5’- AU CGA GAG G -3’
3’- GTA GCT CTC CTX GCA GAC GAA TAG CCA TC- 5’
5’-CTG CTT ATC GGT AG-3’
109
Fig. 5 RNA polymerase assays with dF at the site of incorporation of modified nucleobase
(Courtesy Dong Wang). The reactions were carried out with different rNTP concentrations of
25 µM and 500µM. The lanes correspond to different rNTP composition( lane 0: no rNTP,
lane 1: α32 P-ATP lane 2: α32 P-ATP, CTP, lane 3: α32 P-ATP, GTP, lane 4: α32 P-ATP, UTP, lane
5: α32 P-ATP, GTP, CTP, lane 6: α32 P-ATP, UTP, CTP, lane 7: α32 P-ATP, UTP, CTP, GTP).
Following are the sequences of the RNA and DNA template:
5’- AU CGA GAG G -3’
3’- GTA GCT CTC CTX GCA GAC GAA TAG CCA TC- 5’
5’-CTG CTT ATC GGT AG-3’
110
Fig. 6 RNA polymerase assays with dQ at the site of incorporation of modified
nucleobase(Courtesy Dong Wang). The reactions were carried out with different rNTP
concentrations of 25 µM and 500µM. The lanes correspond to different rNTP composition(
lane 0: no rNTP, lane 1: α32 P-ATP lane 2: α32 P-ATP, CTP, lane 3: α32 P-ATP, GTP, lane 4: α32
P-ATP, UTP, lane 5: α32 P-ATP, GTP, CTP, lane 6: α32 P-ATP, UTP, CTP, lane 7: α32 P-ATP, UTP,
CTP, GTP). Following are the sequences of the RNA and DNA template:
5’- AU CGA GAG G -3’
3’- GTA GCT CTC CTX GCA GAC GAA TAG CCA TC- 5’
5’-CTG CTT ATC GGT AG-3’
111
5.8 Results
When the non-polar analog of thymidine, dF was placed in the template strand of the
transcribing complex of yeast RNA polymerase II, we see that dA is incorporated
opposite it in the extending RNA (Fig 5). The efficiency of incorporation against the
unnatural base was lower than that against the natural base. The bands corresponding to
dF are visible strongly only at longer time points or higher concentration of rNTPs
(comparing the lanes in Fig 4 and 5). Under forcing conditions full-length extension
products were also visible. On the other hand, the isosteric analog of deoxyadenosine,
dQ was recognized to a much lesser extent. Some insertion and extension was observed
but only at higher concentrations and longer time points (Fig 6). However dF paired
significantly better with ATP than with GTP and CTP (lanes 2 and 3 Fig 4 & 5). This
clearly shows that shape of the nucleobase is an important factor in fidelity of RNA
Polymerase II.
5.9 Discussion
The observation that dF leads to the incorporation of dATP with moderate efficiency
suggests that shape is important but not sufficient to account for the efficiency of
transcription. The slow and inefficient incorporation against dQ in the template could
be explained on the basis that dQ is not a perfect shape mimic of dA. The steric bulk of
a C-H bond(1.1 A0) at the analogous N-1 position, lies in the base pair face of the
analog and may sterically clash with the N-3 of incoming thymidine base. Studies with
DNA polymerases have shown that sub-angstrom increase in the steric bulk at the base
pair face of the base could lead to significant drop in efficiency and selectivity107
.
112
Hence the lower efficiency with dQ could be due to steric effects. The observed
reduced efficiency with dQ is consistent with previous studies involving A-family
polymerases146
.
However these are preliminary studies and the efficiency inferences from them are at
best qualitative. More kinetic and structural information is needed. Studies need to be
performed to determine the efficiency of incorporation not only when the unnatural
base is in the template strand but also when it is an incoming nucleotide triphosphate.
Studies involving base discrimination need to be conducted to determine the
importance of shape and hydrogen bonding on the fidelity of RNA polymerases. Other
types of RNA polymerases including bacterial and human RNA Polymerases also need
to be studied to see if there is a generality in the observations. Indeed studies on T7
RNA polymerase and E. Coli RNA polymerases are currently going on in the Kool lab
and would be useful in furthering our understanding.
5.10 Summary
There are several factors which can affect the selectivity and efficiency of nucleotide
incorporation, including sterics, hydrogen boding and stacking interaction. In this
chapter we studied the importance of sterics and hydrogen bonding using two non-polar
analogs. We have demonstrated that yeast RNA pol II catalyzes the incorporation of
nucleotides against the thymidine analog, dF, with moderate efficiency and against the
adenine analog, dQ, with a much lower efficiency. From these preliminary studies we
conclude that although shape is an important factor, base-pair hydrogen bonding is also
a significant factor in transcription by RNA polymerases.
113
Chapter 6
Development of polyfluorophores on a DNA backbone that
could be used as sensors of small molecules in the vapor
phase
6.1 Introduction
There is an increasing need for convenient detection of gases and vapors. It is of
importance in environmental monitoring, industrial quality control, in medicine and at
security checkpoints161,162
. However conventional analytical techniques using optical
spectroscopy and gas chromatography are time-consuming, expensive and seldom used
for real-time detection163
. Although sensor molecules have been designed and studied
for decades for solution sensing, relatively few molecular approaches have been
developed for optical detection of small molecules in the vapor phase.
Conjugated polymers have emerged over the past decade as sensitive chemical and
biological sensors147-149
. Fluorescence quenching in conjugated polymers has been used
for the detection of nitro-aromatics150
. Dye-labeled DNA, a bio-polymer, has also been
used for solid phase detection of gases through the corresponding changes in
fluorescence properties upon interaction of the sensors with the analytes151
. At the same
time, colorimetric detection of vapors using arrays of cross-responsive nanoporous
pigments have also been demonstrated for the detection of ligating gases152
. One of the
main disadvantages of the currently available methods is the limited diversity of
sensing due to the use of only one type or a few types of sensor molecules. The
difficulty of synthesis, the lack of flexibility in attaching or conjugating molecules to
114
supports and potential difficulties in controlling the purity of polymer-based systems
also limit their usage.
6.2 Polychromophores of fluorescent nucleobases
Due to the ease of synthesis, water solubility and well defined backbone structure,
DNA is an attractive platform for assembling arrays of chromophores and fluorophores.
Using a small library of fluorophores as substitutes of natural nucleobases the Kool
group had constructed a library of fluorophores using the split and pool strategy on the
DNA synthesizer using phosphoramidite chemistry. The resulting library covered a
large spectrum of about 50 colors and hues from violet to orange153
. The large Stokes
shift and narrow excitation wavelength observed with these poly-fluorophores are
desirable characteristics for convenient detection systems using multiple sensors but
one excitation wavelength. The group further constructed a larger library of 14000
members consisting of tetramers made from 11 nucleosides157
. Some of these
oligodeoxyfluorosides demonstrated strong hypsochromic shift in their emission upon
UV excitation further enhancing their utility in detection154
.
6.3 Using oligodeoxyfluorosides for gas detection
When fluorophores are assembled on a DNA backbone, the DNA backbone arranges
them in a way that could facilitate multiple inter and intra-molecular interaction
between the assembled fluorophores as well as with other small molecules, thereby
significantly enhancing their optical profile. Fluorescent nucleobases have been used in
115
detecting DNA mismatches and hybridization using various modes of detection
including emission enhancement, quenching or changing of emission wavelength160a-c
.
We envisioned that such inter-molecular interactions would be greatly useful in the
detection of gases. Hence we constructed a library of 2401 polystyrene beads
containing ODF tetramers from seven monomers which included four fluorophores, a
potential quencher, a spacer and a spacer/hydrogen bonding unit (Fig 1).
Fig 1. a) Fluorescent and non-fluorescent monomers employed in the formation of the
library (b) Example of a typical bead coated with a tetrameric sequence 3’-DHT-DHT-E-I-5’
116
6.4 Synthesis of the library and screening (Courtesy Dr. F. Samain)
Synthesis of the four monomers Y, B, E, and K were carried out following previously
reported methods156,157
. The spacer phosphoramidite (S), the 5,6-Dihydro-dT-CE
phosphoramidite (DHT), the 5-nitroindole-CE phosphoramidite (I) were purchased
from Glen Research.
The previously mentioned split and pool synthetic strategy was used for the synthesis of
the tetramer library on the PEG-polystyrene beads157
. The assembly of the
oligodeoxyfluoroside was carried through an ABI 394 DNA synthesizer using the
phosphoramidite chemistry. The fluorophore sequences of each library member were
encoded by the binary encoding strategy with molecular tags. The tag synthesis,
tagging, and decoding procedure were done according to the published procedure by
Still 158
.
For screening of small molecules in the vapor phase, beads were placed on a small
microscope slide (1 mm X 3 mm X 4 mm) and one drop (0.004mL) of the selected
small molecule was placed beside the microscope slide and both were enclosed in a
sealed fluorescence QS cell. Fluorescence images were taken before, after 2 min, 7min,
and 30 min of exposure.
Screening of the library was carried out using an epifluorescence microscope (Nikon
Eclipse E800 equipped with a 4X objective, excitation 340 -380 nm; emission 400
nm). Fluorescence images were taken using a Spot RT digital camera and Spot
117
Advanced Imaging software. Beads which showed significant variation in optical
properties before and after exposure to the volatile material were selected with a flame-
pulled pipette and decoded. The changes included increase of fluorescence, quenching,
hypso-chromic and bathochromic shifts upon exposure to the small molecules. The
sequences were decoded by electron capture gas chromatographic analysis of tags
liberated from each individual bead that was selected in the screening.
6.5 Re-synthesis and characterization of the selected sequences
The selected tetramers were re-synthesized on an ABI 394 DNA/RNA synthesizer
using phosphoramidite chemistry. The synthesis was carried out on a 1µmol scale on
PEG-polystyrene beads and 3‟-Phosphate CPG. Cleavage from the 3‟-Phosphate CPG
support and final deprotection were done by treatment with 0.05 M potassium
carbonate in methanol. Beads were washed with a solution of EDTA. HPLC Analyses
of sequences were performed using a Shimadzu 10 Series HPLC machine with a C4
column and acetonitrile and water as eluents. The sequences were then characterized by
their masses.
6.6 Using the selected beads as sensors
The selected sensors on beads were once again exposed to the small molecules that they
were chosen to detect. As in the library screening method, the beads were placed on a
small glass slide and a drop of the volatile small molecule was added in a sealed
fluorescence QS cell. The vapors of the small molecule were expected to interact with
the ODFs on the beads and reproduce the fluorescence changes observed during the
118
screening process. The same fluorescence lamp that was used for the screening was
used and the excitation wavelength was maintained at 340-380nm and the emissions
below 400nm were filtered off. Images were taken before and after 2 min, 7 min, and
30 min of exposure. For display purposes, a grey color gradient was generated using
Photoshop. where the color changes are depicted by inverting color of the image taken
before exposure and merging it with the image taken after 30 min of exposure followed
by making it 50% transparent (Figure 2). The difference image provides us with an easy
color code for the detection of the small molecules with the ODFs.
119
120
Fig 2. Thirty sequences (FS 1-30) were selected from the library, characterized and re-
exposed to the analytes they were targeted to detect. The figure shows the beads before
and 30 min after exposure to the small molecules and the photoshop difference images
121
6.7 The sensing of gases
Except for the bead # FS-7 which was blue when selected from the library but red when
re-synthesized, all the other beads were of same color (with slight variations in intensity
or hue) as in the original screening. They also reproduced the expected trends when
exposed to the small molecules. For example, just as in the library, the bead # FS- 23
showed strong quenching upon exposure to nitrobenzene, while the bead#FS- 20
showed an increase in emission when exposed to propionic acid (Fig 2).
Encouraged by the positive correlation between the screening and the detection studies
we decided to explore the selectivity of these beads. Hence a cross-screening study of 8
beads against 4 small molecules having different structure and electronic properties was
then undertaken. In order to detect molecules of different structures and electronic
properties, nitrobenzene (electron deficient aromatic compound), acrolein (unsaturated
aldehyde), mesitylene (electron rich aromatic) and propionic acid (aliphatic carboxylic
acid) were chosen for this study. One could clearly see a color code emerging from this
study where each molecule produces a unique color foot-print on an array of 8 sensors
(Fig 3). Interestingly, sequences selected for their responses to individual analytes
demonstrated sensing of the other three analytes as well (eg sequences 2, 5 and 7). In
general we see a strong quenching of fluorescence with nitrobenzene and slight
quenching with mesitylene. Propionic acid, on the other hand, brought about blue-shift
with most of the sensors while acrolein showed some blue-shift and some quenching of
fluorescence. Also worth noting is that, sequences containing K display roughly no
color change except when exposed to nitrobenzene while sequences containing electron
122
rich aromatic fluorophores like Y and E, seemed to be more responsive and exhibited
strong quenching with NB, blue shift with propionic acid and acrolein and mild
quenching with mesitylene.
Fig 3. Cross-screening of some selected sequences against 4 different small molecules. The
photoshop image differences before and after exposure to the small molecules are shown
123
6.8 Discussion
Although some success has been achieved in detecting volatile materials using optical
methods, much of the power of fluorescence detection involving large signal and low
background still remains unharnessed. Fluorescent nucleobases have been used in the
recent past for the detection of DNA hybridization and single nucleotide
polymorphisms.160a,b,c
. To the best of our knowledge this is the first study reporting the
successful application of fluorescent nucleobases for the detection of gases. The library
of ODFs reported in this study greatly enhanced the repertoire of sensors which could
be used for detection of volatile material. Promising results are being shown by larger
cross-screening studies being currently carried out in the lab (Dr. F. Samain
unpublished results). One of the great advantages of this method is that the use of
narrow excitation wavelength range for the detection of multiple small molecules
enables parallel monitoring of a large number of analytes thus saving time and money.
This would be particularly useful in environmental monitoring of multi-component gas
samples. Moreover, solid-state detectors also come with the convenience of mobility
and ease of fabrication in micro-array. Being a fluorescence based detection method, it
would require just a source and detector to be incorporated into a handheld device for
field detection.
We hypothesize that the varied responses come from different electronic and/ steric
interactions between the analytes and the ODFs. However the mechanisms underlying
such interactions are not known and further studies need to be conducted in order to
investigate the mechanism behind the fluorescence changes. For example, a variety of
124
processes including excited state reactions, energy transfer, complex-formation and
collisional quenching could result in quenching of fluorescence. It has been postulated
that the fluorescence quenching of fluorophores generally observed with nitro-
aromatics involve the formation of excited state ion pair166
. Propionic acid on the other
hand could increase the flexibility of the DNA backbone167
by protonating the
phosphate groups which might enable the fluorophores to orient themselves into more
thermodynamically favorable conformers inducing hypsochromicity. Additionally,
acrolein and propionic acid also have the capacity of interacting with the ODFs via
hydrogen-bonding and inducing fluorescence changes.
6.9 Summary
We have demonstrated that a library of polyfluorophores on DNA backbone created by
a simple combinatorial strategy could be useful in developing gas sensors. Some of the
sensors selected from this library were able to detect small molecules of widely varied
molecular structure and electronic properties. This work is a “proof of concept” for
future rational modifications aimed at developing robust sensors for the reversible
detection of volatile materials.
125
Chapter 7
Material and Methods
7.1 Synthesis of 6-N-(l-(Dimethylamino)ethylene)-2’-
deoxyadenosine (dma-dA)
7.1
N6-dimethylacetamidine-dA (Dma-dA) phosphoramidite was prepared according to a
published method59
.
Synthesis of 6-N-(l-(Dimethylamino)ethylene)-2‟-deoxyadenosine (7.1)
2΄-deoxy-adenosine hydrate (1.6g, 6 mmol) was co-evaporated 3 times with pyridine.
N,N-Dimethylacetylamide (2.7mL, 18mmol) was added to it and the reaction was
stirred in 6mL of methanol at 400C for 18 hrs. The solution was then concentrated and
purified by column chromatography (silica: CH2Cl2/ MeOH: 1:0 to 20:1) to obtain the
pure compound in 70% yield.
126
A general procedure for 5‟-O-DMT protection and phoshoramidite synthesis is
described in section 7.6 of this chapter and is generally applicable to the
phosphoramidite synthesis of all the nucleosides made in this thesis.
7.2 General procedure for the synthesis of non-polar
thymidine/uracil analogs
The synthesis of pyrimidine analogs was performed by coupling the base analogs to
siloxy-protected ribonolactones following previously published methods110a,b
.
7.2
Synthesis of 3′,5′-O-((1,1,3,3-Tetraisopropyl)disiloxanediyl)-2′-deoxy-D-ribono-
1′,4′-lactone (7.2)
Bromine (9mL) was slowly added to a solution of 2-deoxy-D-riobse (4.50 g, 33.5
mmol) in water (30 mL). The flask was sealed, and the contents were stirred at room
temperature for 5 days. The excess bromine was blown away by a steady steam of air
and the solution was neutralized by adding Ag2CO3 until the pH of solution was 7.0.
The mixture was filtered through Celite 545 and the filtrate was concentrated under
reduced pressure to yield 2-deoxyribonolactone as yellow oil.
127
The crude oil was dissolved in anhydrous DMF (60 mL) without further purification
and imidazole (5.72 g, 84.0 mmol) was added. Then 1,3-dichloro-1,1,3,3-
tetraisopropyldisiloxane (15 g, 47.6 mmol) was slowly added to the solution via
dropping funnel for a period of 1 hour. The resulting solution was stirred at the room
temperature for 24 h, and extracted with ether. The organic layer was washed with
water, saturated aqueous NaHCO3, and brine, was dried over anhydrous Na2SO4, and
was concentrated under vacuum. Flash chromatography of the crude product (silica gel,
CH2Cl2) produced the desired product as a colorless oil (9.00 g, 24.0 mmol, 72 %).
7.2 (a) [X=F]
7.2 (b) [X=Cl]
Synthesis of 3′,5′-O-((1,1,3,3-tetraisopropyl)disiloxanediyl)-1′,2′-dideoxy-β-1-aryl-
D-ribofuranoses [7.2 (a),(b)]
The iodoarenes were coupled to the sugar either following their lithiation (as in the
dichloro analog dL) or as their Grignard reagents (in case of the difluoro analogs).
7.2 (a) Reaction of disiloxane-protected deoxyribonolactone with the Grignard
reagent of bromo-arene
Magnesium turnings (0.24 g, 9.9 mmol) and a few crystals of iodine were dissolved in
5mL of anhydrous THF. Bromo-arene (2.1 g, 10 mmol) was added dropwise to the
128
mixture. Slight heating was needed (40C) to drive the reaction to completion. After 1
hr, siloxy-lactone 7.2 (2.1 g, 5.6 mmol) dissolved in 2.5 mL THF was added dropwise
to the Grignard reagent. The solution was stirred at room temperature for 2 hours. The
reaction mixture was quenched with saturated aqueous NH4Cl and was then extracted
with diethyl ether. The combined ether phases were washed with saturated aqueous
NH4Cl, water, and brine, and were dried over anhydrous Na2SO4. The organic solvent
was evaporated to produce an oil that was used without further purification.
7.2 (b) Reaction of disiloxane-protected deoxyribononlactone with lithiated arenes
To a solution of the iodoarene (~4.2 mmol) in anhydrous THF (5 mL) under Ar and at –
78C was added n-BuLi (~1.6 M in hexanes, 1.0 equiv.) and the mixture was stirred at
–78C for 30 min. A solution of the disiloxane-protected deoxyribonolactone 7.2 (1.0 g,
2.7 mmol) in anhydrous THF (5 mL) was added slowly to this solution at -78C. After
2-3 h, the reaction mixture was quenched at –78C with sat. aqueous NH4Cl and was
then extracted with ether. The combined ether phases were washed with sat. aqueous
NH4Cl, water, and brine, and were dried over anhydrous Na2SO4. The extract was
concentrated under vacuum to give an oil which used without further purification.
Reduction with Triethylsilane
The crude oil from both the above steps were then dissolved in CH2Cl2 under Ar and at
–78 C and treated with Et3SiH (3 equiv.) and BF3OEt2 (3 equiv.). The resulting
solution was stirred at –78 C for 3 h, and then the reaction was quenched at –78 C by
the addition of satd. NaHCO3. The resulting mixture was extracted with diethyl ether.
The combined organic phases were washed with saturated NaHCO3, water, and brine.
129
This solution was dried over anhydrous Na2SO4 and was concentrated under vacuum.
The resulting oil was purified by column chromatography (silica gel, hexane/
dichloromethane; 10:1 to 1:1) to obtain the pure β-anomers from a mixture of β and α
anomers in yields around 10-11%
7.2 (a΄) [X=F]
7.2 (b΄) [X=Cl]
Removal of the disiloxane protecting group [7.2 (a΄), (b΄)]
Tetrabutyl ammonium fluoride (1 M in THF, 3.0 equiv.) was added to a solution of the
disiloxane-protected nuclecosides (~0.5 mmol) in 10mL of anhydrous THF. The
resulting mixture was stirred at the room temperature for 2 h, and then 5% aqueous
NH4HCO3 solution was added to quench the reaction. The mixture was extracted with
diethyl ether, and the combined organic extracts were washed with 5% aqueous
NH4HCO3, water, and brine. The organic portion was dried over anhydrous Na2SO4 and
concentrated in vacuo. The crude material was purified using column chromatography
(silica gel, CH2Cl2/MeOH 1:0 to 20:1).
130
7.3 Synthesis of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-
iodobenzene and the corresponding stannyl-analog
7.3 (a) 7.3 (b)
Synthesis of 7.3 (a)
1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichlorobenzene (0.2 M)was iodinated by dissolving
in trifluoroacetic acid and adding 10 eqv of N-iodosuccinimide and allowing the
reaction to stir at room temperature for 11 days. At the end of 11 days the reaction was
quenched with ice-cold water, extracted with CH2Cl2 and washed with saturated
NaHCO3 and excess iodine neutralized with saturated Na2S2O3. After washing the
organic extract with brine it was dried over Na2SO4 and evaporated under vacuum. The
resultant mixture was column purified (silica, CH2Cl2/MeOH 1:0 to 20:1) to yield 63%
of the product.
H1 NMR (400MHz; CD3OD) ppm : 8.21 (s, 1H, Ar-H), 7.54 (s, 1H, Ar-H), 5.27 (dd,
1H, 10.1, 5.6 Hz, H-1΄ ), 4.26 (m, 1H, H-3΄ ), 3.98 (m, 1H, H-4΄ ), 3.77 (m, 2H, H-5΄),
2.42 (m, 1H, H-2΄α), 1.77 (m, 1H, H-2΄β) . C13
NMR (400 MHz; CD3OD) ppm: 44.2,
63.3, 73.4, 77.3, 87.2, 96.5, 129.7, 132.5, 137.6, 138.2, 139.9
HRMS m/z: Calculated for C11H12Cl2IO3 (M+H+) = 388. 91, found 388.7
131
Synthesis of 7.3 (b)
Following published procedure109
the 0.1g (0.257mmol) of the product obtained from
the previous step was dissolved in 4mL of dioxane at 500C. Once the entire product has
completely dissolved the temperature is cooled to room temperature and 0.13mL
Sn2Bu6 (1eqv) and 5 mg of Pd(PPh3)4 (catalytic) was added and the reaction was
heated to 1050C under argon and run for 12 hrs. The dioxane is evaporated and the
reaction mixture is purified using column chromatography (silica; CH2Cl2/MeOH 1:0 to
20:1) to yield 87% product.
H1 NMR (400 MHz; CD3OD) ppm : 7.52 (s, 1H, Ar-H), 7.33 (s, 1H, Ar-H), 5.42 (dd,
1H, 9.8, 5.9 Hz, H-1΄ ), 4.42 (m, 1H, H-3΄ ), 4.05 (m, 1H, H-4΄ ), 3.82 (m, 2H, H-5΄),
2.47 (m, 1H, H-2΄α), 1.83 (m, 1H, H-2΄β), 0.868-1.548 (m, 27H, 3 x C(CH3)3). C13
NMR (500 MHz; CD3OD) ppm: 10.9, 14.0, 27.7, 29.3, 42.9, 63.8, 74.1, 77.4, 87.2,
128.9, 133.1, 135.0, 137.1, 142.1
HRMS m/z: Calculated for C23H39Cl2O3Sn (M+H+) = 552.12, found 552.1
132
7.4 Synthesis of 7,8-dihydro-8-oxo-2’-deoxyinosine
Synthesis of oxo-inosine was achieved by converting 8-bromo-adenosine to 8-oxo-
adenosine (7.4 (a)) following a published procedure135
and oxidizing it further
following another published method132
.
Synthesis of 8-oxo-7,8-dihydro-2‟-deoxyadenosine [7.4 (a)]
To a 1.0 mM suspension of 8-Bromo-deoxyadenosine in water 3 M equiv of 2-
mercaptoethanol and 10 M equiv of triethylamine (TEA) were added. The resulting
solution was then heated at 1000C for 2 h. After evaporation of water under vacuum the
compound was column purified (silica gel; CH2Cl2: MeOH 1:0 to 10:1) to yield 95% of
the pure compound.
Synthesis of 8-oxo-7,8-dihydro-2‟-deoxyinosine [7.4 (b)]
A solution of 7,8-dihydro-8-oxo-2‟-deoxyadenosine 7.4 (a) (0.387 g, 1.45 mmol) and
adenosine deaminase (562.5 U) in water (5 ml) was stirred at room temperature for 10 h
and concentrated under reduced pressure. The residue was triturated with MeOH (3 ml)
under reflux and the resultant solid was collected by suction filtration and dried under
vacuum over P 2O5 to afford the compound as an off-white solid in a high yield of 94%.
133
H1 NMR (400MHz, DMSO-d6) ppm: 7.94 (s, 1H), 6.12 (dd, J = 8.0, 6.8 Hz, 1H), 4.36
(m, 1H), 3.78 (m, 1H), 3.58 (dd, J = 11.8, 4.6 Hz, 1H), 3.44 (dd, J = 11.8, 4.6 Hz, 1H),
2.94 (m, 1H), 1.99 (ddd, J = 12.9, 6.5, 2.8 Hz, 1H). C13
NMR (500MHz, DMSO-d6)
ppm: 152.5, 151.6, 145.8, 144.2, 108.4, 87.5, 81.5, 71.3, 62.4, 36.2.
HRMS (m/z) Calculated C10H13N4O5 (M+H+)= 269.08, found= 269.1
7.5 Synthesis of 1-[2-Deoxy-β-D-erythro-pentofuranosyl]-9-methyl-
imidazo[(4,5)-b]pyridine (dQ)
The synthesis of dQ was achieved following a previously published procedure143
where the
base is coupled to Hoffer‟s α-chlorosugar.
The base 9-methyl-1-H-imidazo[(4,5)-b]pyridine [7.5 (a)] was produced by dissolving
0.5g of 2,3-diamino-4-methyl pyridine in 15mL of 4(N) HCl and adding 1.6mL Formic
134
acid (10eqv; 41mmol) to the solution. The reaction was run for 18hrs at 100-1050C and
then cooled down to room temperature and neutralized with 2(N) NaOH. The mixture
was extracted with ethyl acetate 8 times and purified by column chromatography
(silica; CH2Cl2: MeOH 1:0 to 9:1) to produce the compound in 55% yield.
Hoffer‟s α-chlorosugar [7.5 (b)] was synthesized by adding acetyl chloride (0.3 mL) to
a solution of 2-deoxy-D-ribose (6.7 g, 0.05 mol) in MeOH (100 mL) and the resulting
solution was stirred at 250C for 45 min. Pyridine (10 mL) was added to this solution
and the solvents were removed in vacuo. The residue was dissolved in dry pyridine (30
mL), and the pyridine was removed in vacuo. The resulting syrup was dissolved in dry
pyridine (30 mL), and the solution was cooled in an ice-water bath. A catalytic amount
of 4-dimethylaminopyridine was added, and then 4-chlorobenzoyl chloride (14 mL,
0.11 mol) was added drop wise for 20 min. After stirring at 00C for 1 h, the reaction
was allowed to proceed at 250C overnight. The reaction was quenched with water (100
mL), and CH2Cl2 (120 mL) was added. The organic phase was separated, and the
aqueous fraction was extracted with CH2Cl2 (50 mL). The combined organic extracts
were washed with saturated aqueous NaHCO3 (2 × 100 mL), 15% aqueous H2SO4 (2 ×
100 mL), water and then brine, prior to drying (Na2SO4). Removal of the solvent in
vacuo gave a syrup that was dissolved in ether (100 mL), and the white crystalline solid
that formed was removed by suction filtration. filtrate was evaporated to dryness, and
toluene (50 mL) was added and evaporated repeatedly to remove moisture. The
resulting syrup was dissolved in ether (20 mL), cooled to 0C, and this solution was
added to a cold solution of a mixture of acetic acid and acetyl chloride (80:20:5) and
stirred in ice-bath for 15 min till a white precipitate appears. The precipitate is filtered
135
and washed with cold ether:hexane (1:1 v/v) and dried under vacuum in the presence of
P2O5 to obtain a white powder in 82% yield.
[2-Deoxy-3,5,-bis-O-(4-chlorobenzoyl)-β-D-erythro-pentofuranosyl]-9-methyl-1-H-
imidazo[(4,5)-b]pyridine. [7.5 (c)]
9-methyl-1-H-imidazo[(4,5)-b]pyridine 7.5 (a) (375 mg, 2.81 mmol), was dissolved in
dry acetonitrile (92 mL) and the solution was cooled to 0 °C under argon. Sodium
hydride 60% oil suspension (135 mg, 3.38 mmol) was added in one portion to the
solution and stirred for 30 min. Benzoyl-protected Hoffer‟s α-chlorosugar , 7.5 (b)
(1.78 g, 4.37 mmol) was added to the reaction mixture at 00C and 10 min later the
temperature was allowed to increase to room temperature. After 90 min the reaction
was quenched by addition of saturated sodium bicarbonate solution and the aqueous
layer was washed with ethyl acetate. The organic layers were washed with brine and
dried over anhydrous magnesium sulfate. The solution was filtered, concentrated, and
purified by silica column chromatography, eluting with hexanes-ethyl acetate (3:5 to
4:5) to obtain 685 mg (53%) of a mixture of the main product (Q bis-benzoyl ester) and
a minor product (these compounds were not separated at this step except for
characterization of Q bis-benzoyl ester.
1-[2-Deoxy-b-D-erythro-pentofuranosyl]-9-methyl-imidazo[(4,5)-b]pyridine [7.5 (d)]
The mixture of [2-Deoxy-3,5,-bis-O-(4-chlorobenzoyl)-b-D-erythro-pentofuranosyl]-9-
methyl-1-H-imidazo[(4,5)-b]pyridine, 7.5 (c) and the minor product (685 mg, 1.48
mmol) was suspended in dry methanol (14 mL) and a 0.5 M solution of sodium
136
methoxide in methanol (4 mL) was added. The reaction mixture was stirred at room
temperature for 2 h. Solid ammonium chloride (2.0 g) was added and stirring was
continued for 10 more min. The mixture was filtered, washed with methanol and
concentrated. The crude product was purified by silica column chromatography
(chloroform-methanol, 20:1) to obtain 65% of nucleoside Q. The desired isomer
(nucleoside Q) was confirmed by NOE experiments and by a characteristic intra-
molecular hydrogen bond (only possible for this isomer) between OH 5' and the N6 of
the base, observed in CDCl3.
H1-NMR (400 MHz, CDCl3 ) ppm: 8.20 (1H, d, J=5.5 Hz), 8.10 (1H, s), 7.12 (1H, d,
J=5.5 Hz), 6.96 (1H, d, J=12.2 Hz), 6.48-6.40 (1H, m), 4.28 (1H, s), 4.00 (1H, d, J=12.2
Hz), 3.82 (1H, t, J=12.2 Hz), 3.43 (1H, broad s), 3.24-3.14 (1H, m), 2.70 (3H, s), 2.34
(1H, dd, J=6.4 Hz, J=13.5 Hz); C13
-NMR (500 MHz, CDCl3) ppm: 146.38, 144.82,
144.35, 141.64, 136.78, 121.07, 89.84, 87.31, 73.11, 63.71, 41.39, 16.26;
HRMS (m/z) calculated d. for C13 H16O3N2 (M+H
+) 250.1192, found 250.12
137
7.6 General Procedure for DMT protection and preparation of
phosphoramidites
Standard procedure was used for 5‟-O- DMT protection of the nucleoside. The free
nucleosides were dissolved in CH2Cl2 (or pyridine in case of dQ) and 1.1 eqv of DMT-
Cl was added in the presence of an activating base. After 2hrs of stirring an additional
portion of DMT-Cl (0.2 eqv) was added to the reaction mixture. The reaction was
stirred at room temperature from 2 hrs to 12hrs (depending upon the substrate) after
which it was quenched with methanol, concentrated under vacuum and purified by
column chromatography (silica; CH2Cl2: MeOH 1:0 to 20:1). The 5‟-O-DMT-protected
nucleosides were obtained in 72-88% yields.
To a 0.1 (M) solution of the DMT-protected nucleoside in acetonitrile was added 1.1
eqv of tetrazole and 1.1 eqv of 2-cyanoethyl-N,N,N‟,N‟-tetraisopropylamino phosphine
and the reaction was stirred at room temperature for 1hr. Acetonitrile was evaporated
and the mixture purified by column chromatography (silica; CH2Cl2: MeOH 1:0 to
40:1) to obtain the pure phosphoramidites in 58-78% yields.
138
7.7 Primer extension assays with archaeal DNA polymerases
enzymes
Primers were labeled using [γ32
-P] ATP (Amersham Bioscience) and T4 Polynucleotide
kinase (Invitogen). 50pmoles of primers were reacted with 50µCi of [γ32
-P] ATP in the
presence of 10U of the enzyme. The reaction was allowed to run at 370C for 45min.
Labeled primers were purified by using Illustra microspin G-25 columns (GE). The
primer (10nM) and the template (20nM) were mixed with hot primers (0.5nM) in the
polymerase reaction buffers provided by the suppliers of each enzyme. They were
heated to 900C for 15 min and then allowed to slowly cool down to room temperature
to facilitate annealing of the primers to the template. dNTPs (1.25mM) and the
polymerase enzymes (0.5 U) were added to the reaction mixture to give a final volume
of 20.0µL. The reactions were allowed to run at 720C and aliquots of the reaction
mixture were taken out at regular interval and quenched with stop buffer (95%
formamide containing 10Nm EDTA, 0.05% xylene cyanol and 0.05% bromo-phenol
blue). The products were resolved by using 20% denaturing polyacrylamide gel
electrophoresis and detected by using a phosphorimager.
7.8 Oligodeoxyfluoroside (ODF) library synthesis methods
Syntheses of the four deoxyriboside monomers Y, B, E, and K (Fig. 1, main text) were
carried out as previously reported156,157
. The spacer phosphoramidite (S), the 5,6-
Dihydro-dT-CE phosphoramidite (H), and the 5-nitroindole-CE phosphoramidite (I)
were purchased from Glen Research.
139
The synthesis of the tetramer library was carried out using previously described
methods157
using a split-and-pool synthetic strategy on 60 mm amine-functionalized
PEG-polystyrene beads, NovaSyn TG amino resin (Nova biochem). The assembly of
the oligodeoxyfluorosides was performed on an ABI 394 DNA synthesizer using
standard phosphoramidite chemistry, but with extended coupling step times of 15 min.
The fluorophore sequences of each library member were recorded by the binary
encoding strategy with molecular tags. The tag synthesis, tagging, and decoding
procedures were done according to the published procedure of Still158
. The sequences
were decoded by electron capture gas chromatographic analysis of tags liberated from
each individual bead that was selected in the screening (see examples below).
For vapor phase screening of potential sensors, beads were laid down on a small
microscope slide (1 mm thick X 3 mm wide X 4 mm long). They were spaced sparsely
to allow for easier identification and picking. One drop (0.004 mL) of the selected
small molecule was placed beside the microscope slide and both were enclosed in a
sealed 3.5 mL quartz fluorescence QS 111 cell (Hellma Küvetten für
Fluoreszenzmessungen ). Fluorescence images were taken before, after 2 min, 7 min,
and 30 min of exposure in air at room temperature.
Screening of the library was carried out using an epifluorescence microscope (Nikon
Eclipse E800 equipped with a 4X objective, excitation 340 -380 nm; emission 400
nm). Fluorescence images were taken using a Spot RT digital camera and Spot
Advanced Imaging software. Beads whose responses were among the strongest were
picked up with a flame-pulled pipette and transferred into a capillary tube for decoding.
140
For further analysis, the selected ODF tetramers were prepared via automated
oligonucleotide synthesis by standard phosphoramidite synthetic procedures on an ABI
394 DNA/RNA synthesizer. The synthesis was carried out on a 1µmol scale in a
normal column containing both PEG-polystyrene beads and 3‟-Phosphate CPG (Glen
Research). In this way we could use the same synthesis to prepare new samples of the
ODF sensors on beads, and confirm full-length synthesis and identity of tetramers by
MS and spectra (see below). Cleavage from the 3‟-Phosphate CPG support and final
deprotection were done by treatment with 0.05 M potassium carbonate in methanol for
24 h at room temperature. Beads were washed with a solution of EDTA. Purification of
sequences was performed using a Shimadzu 10 Series HPLC with a C4 column (Altech
Platimun EPS) with acetonitrile and 0.05(M) tetraethylammonium acetate as eluents.
7.9 Image processing methods for screening
Fluorescence images taken during screening were analyzed using Adobe Photoshop
(version 10.01, Adobe Inc, CA). Raw color images (jpg format) were taken under
identical camera exposures before analyte exposure and (without moving the sample)
after 7 min of exposure to the analyte vapor. We used the “invert” function in
Photoshop to invert the r,g,b values of the image before exposure. This was copied and
overlaid onto the raw image after exposure, and adjusted to 50% transparency, giving a
50% blend of the two images. This is the final difference image. Since inverting the
original black background yields white, the final blended (difference) image yields 50%
gray for the background, and 50% gray for any beads that showed no change with the
analyte. The difference image highlights beads that changed by variations in
141
brightness/darkness (where darker than 50% gray shows quenching and lighter,
fluorescence enhancement) and in color (where the color of the difference image shows
color shifts that occurred upon exposure). Color changes can result from quenching of
selected parts of the combined emission bands or from shifts of emission peaks (Fig 1)
a) Blank (before exposure) b) after 7 min with NB
c) Difference image
Fig 1. Fluorescence images of library before and after exposure to nitrobenzene.
142
References:
1. Klobutcher LA, Swanton MT, Donini P, Prescott DM, (1981) All gene-sized DNA
molecules in four species of hypotrichs have the same terminal sequence and an
unusual 3′ terminus. Proc Natl Acad Sci USA 78:3015–3019
2. Makarov VL, Hirose Y, Langmore JP, (1997) Long G tails at both ends of human
chromosomes suggest a C strand degradation mechanism for telomere shortening.
Cell 88:657–666
3. Chai W, Du Q, Shay JW, Wright WE, (2006) Human telomeres have different
overhang sizes at leading versus lagging strands. Mol Cell 21:427–435
4. Wellinger RJ, Wolf AJ, Zakian VA, (1993) Saccharomyces telomeres acquire
single-strand TG1-3 tails late in S phase. Cell 72:51–60
5. Blackburn EH, Gall JG, (1978) A tandemly repeated sequence at the termini of the
extrachromosomal ribosomal RNA genes in Tetrahymena. J. Mol. Biol. 120, 33-53
6. Crabbe L, Karlseder J, (1931) In the end, Its all structure. Curr Mol. Med. 5, 135-
143
7. Olovnikov AM, (1971) Principle of marginotomy in template synthesis of
polynucleotides. Dokl, Akad. Nauk. SSSR 201, 1496-1499
8. Harley CB, Vaziri H, Counter CM, Allsopp RC, (1992) The telomere hypothesis of
cellular aging. Exp. Gerontol. 27 375-382
9. Forsyth NR, Evans AP, Shay JW, Wright WE, (2003) Developmental differences
in the immortalization of lung fibroblasts by telomerase. Aging Cell 2, 235-243
10. (a)Shay JW, Bacchetti S, (1997). A survey of telomerase activity in human cancer.
Eur. J. Cancer 33, 787–791 (b) Chantal Autexier and Neal F. Lue, (2006) Annu.
Rev. Biochem. 75, 493–517 (c) D. M. Shcherbakova, M. E. Zvereva, O. V.
Shpanchenko, and O. A. Dontsova (2006) Molecular Biology. 40, 4, 514-527
11. Lingner J, Hughes TR, Shevchenko A, Mann M, Lundlab V, Cech TR, (1997)
Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276 561-
567
143
12. Strahl C, Blackburn EH, (1996) Effects of reverse transcriptase inhibitors on
telomere length and telomerase activity in two immortalized human cell lines. Mol.
Cell. Biol. 16 53 -65
13. Damm K, Hemmann U, Garin-Chesa P, Hauel N, Kauffmann I, Priepke H, Niestroj
C, Daiber C, Enenkel B, Guilliard B, Lauritsch I, Mu¨ller E, Pascolo E, Sauter G,
Pantic M, Martens UM, Wenz C, Lingner J, Kraut N, Rettig WJ, Schnapp A, (2001)
A highly selective telomerase inhibitor limiting human cancer cell proliferation.
EMBO J. 20, 6958-6968
14. Rangarajan S, Friedman SH, (2007) Design, synthesis, and evaluation of
phenantridine derivatives targeting the telomerase RNA/DNA heteroduplex.
Bioorg. Med. Chem. Lett. 17, 2267-2273
15. Dikmen ZG, Gellert GC, Jackson S, Gryaznov S, Tressler R, Dogan P, Wright WE,
Shay JW, (2005) In vivo inhibition of lung cancer by GRN163L: a novel human
telomerase inhibitor. Cancer Res. 65, 7866-7873
16. Hochreiter AE, Xiao H, Goldblatt EM, Gryaznov SM, Miller KD, Badve S, Sledge
GW, Herbert BS, (2006) Telomerase template antagonist GRN163L Disrupts
telomere maintenance, tumor growth, and metastasis of breast cancer. Clin. Cancer
Res. 12, 3184-3192
17. Djojosubroto MW, Chin AC, Go N, Schaetzlein S, Manns MP, Gryaznov S, Harley
CB, Rudolph KL, (2005) Telomerase antagonists GRN163 and GRN163L inhibit
tumor growth and increase chemosensitivity of human hepatoma. Hepatology 42,
1127-1136
18. Falchetti ML, Fiorenzo P, Mongiardi MP, Petrucci G, Montano N, Maira G,
Pierconti F, Larocca LM, Levi A, Pallini R, (2006) Telomerase inhibition impairs
tumor growth in glioblastoma xenografts. Neurol. Res. 28, 532-537
19. Shammas MA, Kolev H, Batchu RB, Bertheau RC, Protopopov A, Munshi NC,
Goval RK, (2005) Telomerase inhibition by siRNA causes senescence and
apoptosis in Barett‟s adenocarcinoma cells: mechanism and therapeutic potential.
Mol. Cancer 4, 24
144
20. Li Y, Li H, Yao G, Li W, Wang F, Jiang Z, Li M, Inhibition of telomerase RNA
(hTR) in cervical cancer by adenovirus-delivered siRNA. Cancer Gene Ther., in
press
21. Zglinicki, Serra TV, Lorenz V, Saretzki M, Lenzen- GroBimlighaus G, Gebner R,
Risch R, Steinhagen- Thiessen AE, (2000) Lab. Invest., 80, 1-9
22. Cawthon RM., Smith KR., O'Brien E, Sivatchenko A, Kerber RA, (2003) Lancet,
361, 359-395
23. (a)Marrone A, Dokal I, (2004) Expert. Rev. Mol. Diagn., 6, 1-23 (b) I. Ta´rka´nyi, J.
Aradi (2008) Biochimie 90 , 156-172
24. Rowe-Rendleman C, Glickman RD, (2004) Possible therapy for age-related
macular degeneration using human telomerase. Brain Res. Bull, 62, 549-553
25. Serenicki N, Hoare SF, Kassem M, Atkinson SP, Keith WN, (2006) Telomerase
promoter reprogramming and interaction with general transcription factors in the
human mesenchymal stem cell. Regen. Med, 1, 125-131
26. http://www.tasciences.com/ta65molecule.html
27. Bryan TM, Reddel RR, (1997), Eur. J. Cancer, 33, 767-773
28. Bryan TM, Englezou A, Gupta J, Bacchetti S, Reddel RR, (1995) EMBO J., 14,
4240 - 4248
29. Hodges M, Tissot C, Howe K, Grimwade D, Freemont PS, (1998) Am. J. Hum.
Genet, 63, 297 - 304.
30. Dunham MA, Neumann AA, Fasching CL, Reddel RR, (2000) Nat. Genet., 26, 447
- 450
31. Murnane JP, Sabatier L, Marder BA, Morgan WF, (1994) EMBO J., 13, 4953 -
4962
32. McEachern MJ, (2001), Recombinational telomere elongation in the yeast K. lactis.
In Telomeres and telomerases: cancer and biology, Krupp G (ed). Landes
Bioscience: Georgetown, TX, USA (in press)
33. Yeager TR, Neumann AA, Englezou A, Huschtscha LI, Noble JR, Reddel RR,
(1999) Cancer Res., 59, 4175 - 4179
34. Regev A, Cohen S, Cohen E, Bar-Am I, Lavi S, (1998) Oncogene, 17, 3455 - 3461
145
35. Ogino H, Nakabayashi K, Suzuki M, Takahashi E-I, Fujii M, Suzuki T, Ayusawa
D, (1998) Biochem. Biophys. Res. Commun., 248, 223 - 227
36. Jeremy D Henson et al, (2002) Oncogene 21, 598 -610
37. (a) Colgin LM, Reddel RR, (1999) Curr. Opin. Genet. Dev., 9, 97-103 (b). Strahl C,
Blackburn EH, (1996) Mol. Cell. Biol., 16, 53 – 65 (b) Telomere uncapping and
alternative lengthening of telomeres (2008) Mechanisms of Aging and
Development. 129, 99-108
38. Shay JW, Bacchetti S, (1997) Eur. J. Cancer, 33, 787 - 791
39. (a) Mrinal K. Bhattacharyya and Arthur J. Lustig (2006) TRENDS in Biochemical
Sciences, 31, 2, 114-122. (b) Di Giusto DA, Wlassoff WA, Gooding JJ, Messerle
BA, King GC, (2005) Nucleic Acids Res., 33, 64/1
40. Zhang DY, Liu B, (2003) Detection of target nucleic acids and proteins by
amplification of circularizable probes. Expert Rev. Mol. Diag, 3, 237-248
41. Perler FB, Kumar S, Kong H, (1996) Thermostable DNA polymerases. In:
Advances in Protein Chemistry, 48, 377-435
42. Ausubel FM, Brent R, Kingstion RE et al, (1995) (Eds) Current Protocols in
Molecular Biology (Vol. 1), John Wiley & Sons, Hoboken, NJ, USA
43. Yeager TR, Neumann AA, Englezou A, Huschtscha LI, Noble JR, Reddel RR,
(1999), Cancer Res., 59, 4175 - 4179
44. Johnson FB, Marciniak RA, McVey M, Stewart SA, Hahn WC, Guarente L, (2001)
EMBO J., 20, 905 - 913
45. Wu G, Lee W-H, Chen P-L, (2000) J. Biol. Chem., 275, 30618 - 30622
46. Yankiwski V, Marciniak RA, Guarente L, Neff NF, (2000) Proc. Natl. Acad. Sci.,
USA, 97, 5214 - 5219
47. Lindstrom U.M. et al., (2002) Artificial human telomeres from DNA nanocircle
templates. Proc. Natl. Acad. Sci., U. S. A. 99, 15953–15958
48. Jörg Hartig, Eric Kool, (2004) Small circular DNAs for synthesis of the human
telomere repeat: varied sizes, structures and telomere-encoding activities, Nucleic
Acids Res., 32 (19):e152
49. Natarajan S, McEachern MJ, (2002) Mol. Cell. Biol., 22:4512–21
50. Wang RC, Smogorzewska A, de Lange T, (2004), Cell, 119:355–68
146
51. Orbai L, (2007) Using Nucleic Acid chemistry to probe telomeric DNA function
and structure. Ph.D. Dissertation, Stanford University
52. Gornung E, Gabrielli I, Sola L, Genome, Vol. 41, 1998; 136-138
53. Experimental Gerontology 38 (2003) 1333–1341
54. (a) Thisse C, Zon LI, (2002) Science, 295, 457-62 (b) Amatruda, James F et al,
(2008) International Review of Cell and Molecular Biology, VOL 271, pg 1-34
55. Zebrafish model organism database (ZFIN) http://zfin.org/cgi-
bin/webdriver?MIval=aa-ZDB_home.apg
56. Culp P et al, (1991) High frequency germline transmission of plasmid DNA
sequences injected into fertilized zebrafish eggs. Proct. Natl. Acad. Sci U.SA. 88,
7953-7957
57. Qiling Xu, Microinjection into Zebrafish Embryos Methods in Molecular Biology,
Vol. 127: Molecular Methods in Developmental Biology: Xenopus and Zebrafish,
125-132
58. Lindstrom UM, Kool ET, An orthogonal oligonucleotide protecting group strategy
that enables assembly of repetitive or highly structured DNAs. Nucleic Acids
Research, 2002, Vol. 30 No. 19, 101
59. McBride LJ, Kierzek R, Beaucage SL, Caruthers MH, (1986) Amidine protecting
groups for oligonucleotide synthesis. J. Am. Chem. Soc., 108, 2040-2048
60. (a) Kah-Wai Lin, Ju Yan, (2005) The telomere length dynamic and method of its
assessment. J. Cell. Mol. Med. Vol 9, No 4, 977-989. (b) Southern EM, (1975)
Long range periodicities in mouse satellite DNA. J Mol Biol. 94: 51–69
61. Nakamura Y, Hirose M, Matsuo H, Tsuyama N, Kamisango K, Ide T, (1999)
Simple, rapid, quantitative, and sensitive detection of telomere repeats in cell lysate
by a hybridization protection assay. Clin Chem. 1999; 45: 1718–24
62. Lansdorp PM, Verwoerd NP, van de Rijke FM, Dragowska V, Little MT, Dirks
RW, Rapp AK, Tanke HJ, (1996) Heterogeneity in telomere length of human
chromosome. Hum Mol Genet., 5: 685–91
63. Rufer N, Dragowska W, Thornbury G, Roosnek E, Lansdorp PM, (1998) Telomere
length dynamics in human lymphocyte subpopulations measured by flow
cytometry. Nat Biotechnol., 16: 743–7
147
64. Therkelsen AJ, Nielsen A, Koch J, Hindkjaer J, Kolvraa S, (1995) Staining of
human telomeres with primed in situ labeling (PRINS). Cytogenet Cell Genet., 68:
115–8
65. Cawthon RM, (2002) Telomere measurement by quantitative PCR. Nucleic Acids
Res., 30: e47
66. Baird DM, Rowson J, Thomas DW, Kipling D, (2003) Extensive allelic variation
and ultrashort telomeres in senescent human cells. Nat Genet., 33: 203–7
67. Huffman KE, Levene SD, Tesmer VM, Shay JW, Wright WE (2000) Telomere
shortening is proportional to the size of the G-rich telomeric 3'-overhang. J Biol
Chem., 275: 19719–22
68. Cimino-Reale G, Pascale E, Battiloro E, Starace G, Verna R, D'Ambrosio E, (2001)
The length of telomeric G strand 3'-overhang measured by oligonucleotide ligation
assay. Nucleic Acids Res., 29: e35
69. Greider CW, (1999) Telomeres do d-loop-t-loop. Cell, 97: 419–22
70. Poon SS, Martens UM, Ward RK, Lansdorp PM, (1999) Telomere length
measurements using digital fluorescence microscopy. Cytometry, 36: 267–78
71. Bauman JG et al, (1980) A new method for Fluorescence microscopic localization
of specific DNA sequences by in situ hybridization of Fluorochromelabeled RNA,
Exp. Cell Res., 128, 485-490
72. Wong HP, Slijepcevic P, (2004) Cytogenet Genome Res 105:464–470
73. Shintaro Imamura et al, (2008) Plos, One October 2008, Volume 3, Issue 10, e3364
74. Frank CJ, Hyde M, Greider CW, (2006) Mol. Cell, 24, 423–432
75. Shuji Kishi et al, (2003) Experimental Gerontology 38, 777–786
76. Huffman KE, Levene SD, Tesmer VM, Shay JW, Wright WE, (2000) Telomere
shortening is proportional to the size of the G-rich telomeric 3'-overhang. J Biol
Chem., 275: 19719–22
77. Cimino-Reale G, Pascale E, Battiloro E, Starace G, Verna R, D'Ambrosio E, (2001)
The length of telomeric Gstrand 3'-overhang measured by oligonucleotide ligation
assay. Nucleic Acids Res., 29: e35
78. (a) Larson SM, Krenning EP, (2005) A pragmatic perspective on molecular targeted
radionuclide therapy. J Nucl Med, 46 Suppl 1:1S–3S (b) J Cancer Res Clin Oncol
148
(1993) 119:320-322 (c) Harbert JC (1987) Nuclear medicine therapy. Thieme, New
York (d) Juweid ME, (2002) Radioimmunotherapy of B-cell non-Hodgkin‟s
lymphoma: from clinical trials to clinical practice. J Nucl Med, 43:1507–1529 (e)
Kassis AI, Adelstein SJ, (2005) Radiobiologic principles in radionuclide therapy. J
Nucl Med, 46:4S–12S (f) Franz Buchegger et al, (2006) Auger radiation targeted
into DNA: a therapy perspective. European Journal of Nuclear Medicine and
Molecular Imaging Vol. 33, No. 11
79. Fujii K, Akamatsu K, Yokoya A, (2004) Ion desorption from DNA components
irradiated with 0.5 keV ultrasoft X-ray photons, Radiation Research, 161:435–441
80. He Y, Neumann RD, Panyutin IG, (2004) Intramolecular quadruplex conformation
of human telomeric DNA assessed with 125I-radioprobing. Nucleic Acids Research
32:5359–5367
81. Bloomer WD, Adelstein SJ, (1977) 5-125I-iododeoxyuridine as prototype for
radionuclide therapy with Auger emitters. Nature, 265:620–621
82. Baranowska-Kortylewicz J, Makrigiorgos GM, Van den Abbeele AD, BermanRM,
Adelstein SJ, Kassis AI, (1991) 5-[123I]iodo-2‟-deoxyuridine in the radiotherapy of
an early ascites tumor model. Int J Radiat Oncol Biol Phys., 21:1541–1551
83. Semnani ES, Wang K, Adelstein SJ, Kassis AI, (2005) 5-[123I/125I]iodo-2‟-
deoxyuridine in metastatic lung cancer: Radiopharmaceutical formulation affects
targeting. Journal of Nuclear Medicine, 46:800–806
84. Hofer KG, Prenkv W, and Hiiris. W. I., (1969) Death and metastatic distribution of
tumor cells in mice monitored with 'I-iododeoxy-uridine. Joumal of the National
Cancer Institute, 43, 763-773
85. Kassis AI, Adelstein SJ, (1993) Therapeutic potential of internally administered
radionuclides. Cintemporary issues in Neurorological Surgery: Diagnosis,
Treatment, and Biology, pp. 290-299
86. Kassis AI et al., (2003) In vivo therapy of neoplastic meningitis with methotrexate
and 5-[ I125
]-iodo-2'-deoxyuridine. Acta Oncologica, 39, 731 73
87. Kassis AI et al, (2004) Therapeutic potential of 5-[I125
]-iodo-2'-deoxyuridine and
methotrexate in the treatment of advanced neoplastic meningitis. Intemationai
Joumal of Radiation Biology, 80, 941 -941
149
88. Mariani. G et al (1993) Intra-arterial infusion of 5-[ I123
]iodo-2'-deoxyuridine in
patients with liver metastases from colon cancer. Journal of Nuclear Biology and
Medicine, 37, 157-158
89. Martin RF et al, (1979) Cytotoxicity of an I125
-Iabeled DNA-binding compound that
induces double-stranded DNA breaks. Cancer Research, 39, 3244 3247
90. Walicka MA et al, (1999) Cytotoxicity of [ I125
]- iodoHoechst 33342: contribution
of scavengeable effects. International Joumal of Radiation Biology, 75,1579-1587
91. Panyutin IG et al, (2000) Development of DNA-based radiophamaceuticals
carrying Auger-electron emitter for anti-gene radiotherapy. The Quarterly Journal
of NuclearMedicin., 44, 256-267
92. Ammin I. Kassis, (2004) Int. J. Rad. Biol., Vol 80, No 11-12, 789-803
93. Sisson JC, Shapiro B, Hutchinson RJ, Shulkin BL, Zempel S, (1996) Survival of
patients with neuroblastoma treated with 125-I MIBG. Am J Clin Oncol, 9:144–148
94. Calabresi P et al, (1961) Initial clinical studies with 5-iodo-2'-deoxyuridine. Cancer
Research 21, 550-559
95. Mester J, DeGoeij K, Sluyser M. Modulation of [5-I125
]iododeoxyuridine
incorporation into tumour and normal tissue DNA by methotrexate and thymidylate
synthase inhibitors. Eur J Cancer 1996;32A:1603–1608
96. Kassis AI, Guptill WE, Taube RA, Adelstein SJ. (1991) Radiotoxicity of 5-
[I125
]iodo-2′-deoxyuridine in mammalian cells following treatment with 5-fluoro-2′-
deoxyuridine. J Nucl Biol Med, 35. 167–173
97. Pressacco J, Mitrovski B, Erlichman C, Hedley DW. (1995) Effects of thymidylate
synthase inhibition on thymidine kinase activity and nucleoside transporter
expression. Cancer Res, 55, 1505–1508
98. Mariani G. et al (1996) Biochemical modulation by 5-fluorouracil and l-folinic acid
of tumor uptake of intra-arterial 5-[I123
]|iodo-2'-deoxyuridine in patients with liver
metastases from colorectal cancer. Acta Oncologica. 35, 941-945
99. Chaudhuri NC, Ren RX-F, Kool ET. (1997) C-Nucleosides derived from simple
aromatic hydrocarbons. Synlett, 4, 341–347.
100. Schweitzer BA, Kool ET. (1994) Aromatic nonpolar nucleosides as hydrophobic
isosteres of pyrimidine and purine nucleosides. J Org Chem, 59, 7238–7242.
150
101. Wang Z. X, Duan W, Wiebe LI, Balzarini J, De Clercq E, Knaus EE. (2001)
Synthesis of 1-(2-deoxy-b-D-ribofuranosyl)-2,4- difluoro-5-substituted-benzene
thymidine mimics, some related a-anomers, and their evaluation as antiviral and
anticancer agents. Nucleosides Nucleotides Nucleic Acids, 20, 11–40.
102. Wang Z. X, Duan W, Wiebe LI, Balzarini J, De Clercq E, Knaus EE. (2001)
Synthesis of 1-(2-deoxy-b-D-ribofuranosyl)-2,4-difluoro-5-substituted benzenes:
„thymine replacement‟ analogs of thymidine for evaluation as anticancer and
antiviral agents. Nucleosides Nucleotides Nucleic Acids, 20, 41–58
103. Moran S, Ren RX-F, Kool ET.(1997) A thymidine triphosphate shape analog
lacking Watson–Crick pairing ability is replicated with high sequence selectivity.
Proc Natl Acad Sci USA. 94, 10506–10511.
104. Panteha Khalili, Ebrahim Naimi, Edward E. Knaus and Leonard I. Wiebe (2002)
Biopharm. Drug Dispos. 23: 105–113
105. Wiebe L.I. et al (2004) Nucleosides, Nucleotides and Nucleic Acids. 23, 12, 1865–
1874
106. Wiebe L.I. et al (2003) Nucleosides, Nucleotides and Nucleic Acids. 22, 12, 2121–
2132
107. Kim, T. W.; Delaney, J. C.; Essigmann, J. M.; Kool, E. T. (2005) Proc. Natl.
Acad. Sci. U.S.A. 102, 15803-15808
108. Kassis, Amin I.; Foulon, Catherine F.; Adelstein, S. James. (1996) Rapid synthesis
of radiolabeled pyrimidine nucleosides or nucleotides. PCT Int. Appl. 43 pp.
109. Foulon CF, Zhang YZ, Adelstein SJ, Kassis AI.(1995) Instantaneous preparation
of radiolabeled 5-iodo-2‟-deoxyuridine. Appl Radiat Isot. 46, 1039 –1046.
110.(a) Kim, Tae Woo; Kool, Eric T.(2004) A Set of Nonpolar Thymidine Nucleoside
Analogues with Gradually Increasing Size. Organic Letters, 6(22), 3949-3952.(b)
Jacob S. Lai, Jin Qu, Dr., Eric T. Kool, (2003) Fluorinated DNA Bases as Probes of
Electrostatic Effects in DNA Base Stacking. Angewandte Chemie 42, 48, 5973
111. Stahlschmidt, Anke, Khalili, Panteha, Sun, William, Machulla, Hans-Jürgen,
Knaus, Edward E. and Wiebe, Leonard I.(2009) Biodistribution and Imaging of 1-
(2-Deoxy-β-D-Ribofuranosyl)-2,4-Difluoro-5-[123/125
I]Iodobenzene(RF[123/125
I]IB),
151
A Nonpolar Thymidine-Mimetic Nucleoside, in Rats and Tumor-Bearing Mice.
Nucleosides, Nucleotides and Nucleic Acids, 28: 5, 379 -393
112. Issa, W.; Tochon-Danguy, H.J.; Lambert, J.; Sachinidis, J.I.; Achermann, U.; et al.
(2004) Synthesis and evaluation of a thymidine analogue for positron emission
tomography study of tumor proliferation in vivo. Nucl. Med. Biol. 31, 839–849.
113. Jarchow-Choy, Sarah K.; Sjuvarsson, Elena; Sintim, Herman O.; Eriksson,
Staffan; Kool, Eric T.(2009) Nonpolar Nucleoside Mimics as Active Substrates for
Human Thymidine Kinases. Journal of the American Chemical Society, 131(15),
5488-5494.
114. (a) Lindahl, T. (1993) Instability and decay of the primary structure of DNA.
Nature 362, 709–715 (b) Shapiro, R., and Danzig, M. (1972) Acidic hydrolysis of
deoxycytidine and deoxyuridine derivatives. The general mechanism of
deoxyribonucleoside hydrolysis. Biochemistry 11, 23–29. (c) Shapiro, R., and
Klein, R. S. (1966) The deamination of cytidine and cytosine by acidic buffer
solutions. Mutagenic implications. Biochemistry 5, 2358–2362
115. Kent S. Gates (2009) Chem. Res. Toxicol. 22, 1747–1760
116. Lindahl, T. (1993) Nature (London) 362, 709–715
117. Balasubramanian, B., Pogozelski, W. K., and Tullius, T. D. (1998) DNA strand
breaking by the hydroxyl radical is governed by the accessible surface areas of the
hydrogen atoms of the DNA backbone. Proc. Natl. Acad. Sci. U.S.A. 95, 9738–
9743.
118 (a) Modrich, P., Lahue, R., (1996)Mismatch repair in replication fidelity, genetic
recombination, and cancer biology. Annu. Rev. Biochem. 65, 101–133 (b) Hanawalt,
P.C., (2001) Controlling the efficiency of excision repair. Mutat. Res. 485, 3–13. (c)
Johnson, R.D., Jasin, M., (2000) Sister chromatid gene conversion is a prominent
double-strand break repair pathway in mammalian cells. EMBO J. 19, 3398–3407
(d) Takata, M., Sasaki, M.S., Sonoda, E., Morrison, C., Hashimoto, M., Utsumi, H.,
Yamaguchi-Iwai, Y., Shinohara, A., Takeda, S., (1998) Homologous recombination
and non-homologous end-joining pathways of DNA double-strand break repair
have overlapping roles in the maintenance of chromosomal integrity in vertebrate
cells. EMBO J. 17, 5497–5508
152
118. Michaels, M.L., Cruz, C., Grollman, A.P. & Miller J.H. (1992) Proc. Natn. Acad.
Sci. USA. 89, 7022-7025
119. Hiller RZH, Zhou AMWW, Englender SW (1997) Stability and dynamics in a
hyperthermophilic protein with melting temperature close to 200°C. Proc Natl Acad
Sci USA. 94, 11329–11332
120. Yang, H., Fitz-Gibbon, S, Marcotte, E.M., Tai, J.H., Hyman, E.C., and Miller, J.H.
(2000) Characterization of a thermostable DNA glycosylase specific for U/G and
T/G mismatches from the hyperthermophilic archaeon Pyrobaculum aerophilum. J.
Bacteriol. 182, 1272-1279.
121. Grüz, P., Pisani, F.M., Shimizu, M., Yamada, M., Hayashi, I., Morikawa, K. and
Nohmi, T. (2001) Synthetic activity of Sso DNA polymerase Y1, an archaeal DinB-
like DNA polymerase, is stimulated by processivity factors Proliferating Nuclear
Antigen and Replication Factor C. J. Biol. Chem. 276, 47397-47401.
122. Belova, G.I., Prasad, R., Kozyavkin, S.A., Lake, J.A., Wilson, S.H. and Slesarev,
A.I. (2001) A type IB topoisomerase with DNA repair activities. Proc. Nat. Acad.
Sci. USA. 98, 6015-6020.
123. Lipps, G., Rother, S., Hart, C., and Strauss, G. (2003) A novel type of replicative
enzyme harbouring ATPase, primase, and DNA polymerase activity. EMBO J. 22,
2516-2525
124. Isabelle V, Franchet-Beuzit J, Sabattier R, Laine B, Spotheim-Maurizot M,
Charlier M (1993) Radioprotection of DNA by a DNA-binding protein: MC1
chromosomal protein from the archaebacterium Methanosarcina sp. CHTI55. Int J
Radiat Biol 63:749–758
125. Lasken, R.S., Schuster, D.M. and Rashtchian, A. (1996) Archaebacterial DNA
polymerases tightly bind uracil-containing DNA. J. Biol. Chem. 271, 17692–17696
126. (a) Greagg, M.A., Fogg, M.J., Panayotou, G., Evans, S.J., Connolly, B.A. and
Pearl, L.H. (1999) A read-ahead function in archaeal DNA polymerases detects pro-
mutagenic template-strand uracil. Proc. Natl. Acad. Sci. U.S.A. 96, 9045–9050 (b)
Savino, C., Federici, L., Johnson, K.A., Vallone, B., Nastopoulos, V., Rossi, M.,
Pisani, F.M. and Tsernoglou, D. (2004) Insights into DNA replication: the crystal
structure of DNA polymerase B1 from the archaeon Sulfolobus solfataricus.
153
Structure 12, 2001–2008 (c) Martin A. Greagg et al A read-ahead function in
archaeal DNA polymerases detects promutagenic template-strand uracil (1999)
Proc. Natl. Acad. Sci. USA. 96, 9045–9050
127. Fogg, M.J., Pearl, L.H. and Connolly, B.A. (2002) Structural basis for uracil
recognition by archaeal family B DNA polymerases. Nat. Struct. Biol. 9, 922–927
128. Firbank, S.J., Wardle, J., Heslop, P., Lewis, R.L. and Connolly, B.A. (2008) Uracil
recognition in archaeal DNA polymerases captured by X-ray crystallography. J.
Mol. Biol. 381, 529–539
129. Connolly B.A. (2009) Recognition of deaminated bases by archaeal family-B
DNA polymerases. Biochemical Society Transactions 37, 1, 65-68
130. (a) Jiang, Y. L., Song, F., and Stivers, J. T. (2002) Base flipping mutations of
uracil DNA glycosylase: substrate rescue using a pyrene nucleotide wedge.
Biochemistry 41, 11248-11254. (b) Jiang, Y. L., and Stivers, J. T. (2002) Mutational
analysis of the base flipping mechanism of uracil DNA glycosylase. Biochemistry
41, 11236-11247 (c) James T Stivers et al (2004) Biochemistry 43, 15429-15438
131(a) Sukhvinder Gill, Rory O‟Neill, Richard J. Lewis, Bernard A. Connolly (2007)
Interaction of the Family-B DNA Polymerase from the Archaeon Pyrococcus
furiosus with Deaminated Bases. J. Mol. Biol. 372, 855–863 (b) Wu, N. & Pai, E.
F. (2002). Crystal structure of inhibitor complexes reveal an alternate binding mode
in orotidine-5′-monophosphate decarboxylase. J. Biol. Chem. 277, 28080–28087
132. Natsuhisa Oka and Marc M. Greenberg (2005) The effect of the 2-amino group of
7,8-dihydro-8-oxo-2‟-deoxyguanosine on translesion synthesis and duplex stability.
Nucleic Acids Research, 33, 5, 1637–1643
133. Zharkov,D.O., Rosenquist,T.A., Gerchman,S.E. and Grollman,A.P. (2000)
Substrate specificity and reaction mechanism of murine 8-oxoguanine-DNA
glycosylase. J. Biol. Chem, 275, 28607–28617.
134. Tchou,J., Bodepudi,V., Shibutani,S., Antoshechkin,I., Miller,J., Grollman,A.P.
and Johnson,F. (1994) Substrate specificity of Fpg protein. Recognition and
cleavage of oxidatively damaged DNA. J. Biol. Chem. 269, 15318–15324
154
135. Chryssostomos Chatgilialoglu, Maria Luisa Navacchia, and Al Postigo (2006) A
facile one-pot synthesis of 8-oxo-7,8-dihydro-(20-deoxy)adenosine in water.
Tetrahedron Letters, 47, 711–714
136. Kool, Eric T.; Sintim, Herman O. (2006) The difluorotoluene debate-a decade
later. Chemical Communications (Cambridge, United Kingdom), 35, 3665-3675
137. Kool, E.T. Biopolymers (Nucleic Acid Sciences) 1998, 48, 3-18
138. Hirao I, Kimoto M, Mitsui T, et al. (2006) An unnatural hydrophobic base pair
system: site-specific incorporation of nucleotide analogs into DNA and RNA.
Nature Methods Volume: 3 , 9 ,729-735
139. Kevin. M. Guckian. Doctoral Dissertation, University of Rochester.
140. Seo YJ, Matsuda S, Romesberg FE. (2009) Transcription of an Expanded Genetic
Alphabet. JACS. 131, 14, 5046
141. Juan C. Morales‡ and Eric T. Kool.(2000) Functional Hydrogen-Bonding Map of
the Minor Groove Binding Tracks of Six DNA Polymerases. Biochemistry 39,
12979-12988
142. Gunther L. Eichhorn et al (1994) A structural model for fidelity in transcription.
Proc. Nati. Acad. Sci. USA. 91, 7613-7617
143. Juan C. Morales and Eric T. Kool (1999) Minor Groove Interactions between
Polymerase and DNA: More Essential to Replication than Watson-Crick Hydrogen
Bonds? J. Am. Chem. Soc. 121, 2323-2324
144. Schweitzer, B. A., and Kool, E. T. (1994) J. Org. Chem. 59, 7238–7242
145. (a) Kornberg R (1999). Eukaryotic transcriptional control. Trends in Cell Biology
9: M46 (b) Sims RJ 3rd, Mandal SS, Reinberg D (Jun 2004). Recent highlights of
RNA-polymerase-II-mediated transcription. Current opinion in cell biology 16 (3):
263–271. (c) Cell Death and Differentiation (2007) 14, 1989–1997 (d) Dong Wong
et al (2006) Structural Basis of Transcription: Role of the Trigger Loop in Substrate
Specificity and Catalysis. Cell 127, 941–954
146. Potapova, O., Chan, C., DeLucia, A. M., Helquist, S. A., Kool, E. T., Grindley, N.
D. F., and Joyce, C. M. (2006) Biochemistry 45, 890–898
147. Swager, T. M.(1998) Acc. Chem. Res. 31, 201.
148. Toal, S. J.; Trogler, W. C. (2006) J. Mater. Chem. 16, 2871.
155
149. Pinto, M. R.; Schanze, K. S.(2004) Proc. Natl. Acad. Sci. U.S.A. 101, 7505
150. Aditya Narayanan, Oleg P. Varnavski, Timothy M. Swager, and Theodore
Goodson (2008) Multiphoton Fluorescence Quenching of Conjugated Polymers for
TNT Detection. J. Phys. Chem. C, 112 (4), 881-884
151. Joel White et al (2008) Solid-State, DNA-Based Sensors for Volatiles. Plos Bio.
6, 1, 9
152. Sung H. Lim, Liang Feng, Jonathan W. Kemling, Christopher J. Musto and
Kenneth S. Suslick (2009) An optoelectronic nose for the detection of toxic gases.
Nature Chemistry, 1, 562
153 J. Gao, C. Str¨assler, D. Tahmassebi and E. T. Kool,(2002) J. Am. Chem. Soc.,
2002, 124, 11590–11591;
154. James N. Wilson and Eric T. Kool (2006) Fluorescent DNA base replacements:
reporters and sensors for biological systems. Org. Biomol. Chem., 4, 4265–4274
155. Teo, Y. N.; Kool, E. T.(2009) Bioconjugate. Chem. 20, 2371-2380.
156. Gao, J.; Watanabe, S.; Kool, E. T.(2004) J. Am. Chem. Soc. 126, 12748-12749.
157. Teo, Y. N.; Wilson, J. N., Kool, E. T.(2009) J. Am. Chem. Soc. 131, 3923-3933.
158 Ohlmeyer, M. H. J.; Swanson, M.; Dillard, L. W.; Reader, J. C.; Asouline, G.;
Kobayashi, R.; Wigler, M.; Still, W. C. (1993) Proc. Natl. Acad. Sci. U.S.A. 90,
10922-10926.
159. Teo, Y. N.; Wilson, J. N.; Kool, E. T. (2009) Chem. Eur. J. 15, 11551-11558
160. (a) K. Fujimoto, H. Shimizu and M. Inouye (2004) J. Org. Chem. 69, 3271–3275
(b) R. X.-F. Ren, N. C. Chaudhuri, P. L. Paris, S. Rumney, IV and E. T.
Kool,(1996) J. Am. Chem. Soc. 118, 7671–7678. (c) A. Okamoto, K. Tainaka, Y.
Ochi, K. Kanatani and I. Saito, (2006) Mol. BioSyst. 2, 122–127.
161. Chemical Sensors and Biosensors for Medical and Biological Applications (Ed.:
U. E. Spichiger-Keller), Wiley-VCH, Weinheim,1998
162. P. Simon, F. Kvanik in Optical Sensors for Industrial, Environmental and Clinical
Applications (Eds.: R. Narayanaswamy, O. S. Wolfbeis), Springer, Heidelberg,
2003, pp. 441 –465.
163. D.D. Lee, D.S. Lee, (2001) Environment Sensors, IEEE Sensors Journal 1, 214–
224.
156
164 (a) Thomas, S. W.; Joly, G. D.; Swager, T. M.(2007) Chem. Rev, 107, 1339–1386;
(b) Langhals, H.; Krotz, O.; Polborn, K.; Mayer, P. (2005) Angew. Chem., Int. Ed.
2, 16, 2427–2428; (c) Samuel, I. D. W.; Turnbull, G. A. (2007) Chem. Rev. 107,
1272–1295.
165. Shincheol Kang et al. (2009) Tetrahedron Letters 50, 2010–2012
166. J.V. Goodpaster, V.L. McGuffin (2001) Anal. Chem. 73, 2004.
167. H.A. Tajmir-Riahi et al. (1995) FEBS Letters 370, 105-108
169 (a) Michelson, A. M. and Todd A. R (1955) J. Am. Chem. Soc. 2632–2638 (b)
Khorana, H. G (1979) Science 203, 614–625 (c) Letsinger, R. L. and Mahadevan,
V.: (1965) J. Am. Chem. Soc. 80, 6212–6222 (d) Reese, C. B.(1978), Tetrahedron
34, 3143–3179
170. Beaucage, S. L. and Caruthers, M. H (1981) Tetrahedron Lett. 22, 1859–1862
171. Caruthers, M. H., Barone, A. D., Beaucage, S. L.et al.(1987) Methods Enzymol.
154, 287–313
172. Sandeep Verma and Fritz Eckstein (1998) Annu. Rev. Biochem. 67, 99–134
173. (a) Angew. Chem. Int. Ed. Engl. 30 (1991) 613-629 (b) Current Topics in
Medicinal Chemistry ( 2008) 8, 1379-1404 (c) Clinical Chemistry (2009) 55, 4,
670–683
174. (a) Kool E.T.(2002) Accounts of Chemical Research, 35 , 11, 936-943 (b) Kool
ET, Sintim H.O. (2006) Chemical Communications, 35, 3665-3675 (c) Krueger
AT, Kool ET (2007)Current Opinion in Chemical Biology, 11, 6, 588-594
175. Shaohui Wang and Eric T.Kool (1994) Nucleic Acids Research,Vol. 22, No. 12,
2326-2333
176. Daubendiek, S. L.; Ryan, K.; Kool, E. T.(1995) J. Am. Chem. Soc. 117, 7818-
7819
177. Dongyu Liu, Sarah L. Daubendiek, Martin A. Zillman, Kevin Ryan, and Eric T.
Kool (1996) J. Am. Chem. Soc. 118, 1587-1594
178. U. Lindstrvm, R. Chandrasekharan, L. Orbai, S. Helquist, G. Miller, S. Fernandez-
Lopez, E. Oroudjev, H. G. Hansma, Eric T. Kool. "Artificial Human Telomeres
from DNA Nanocircle Templates"(2002) Proc. Natl. Acad. Sci. USA. 99, 15953-
15958.
157
179. Larry J. Kricka, Paolo Fortina. (2009) Clinical Chemistry 55:4 670–683
180. http://openpit.wordpress.com/2009/10/12/immortality/