minimal residual disease in chronic myeloid leukaemia ... · around 50% of chronic myeloid...
TRANSCRIPT
i
Minimal Residual Disease
in Chronic Myeloid Leukaemia
After Imatinib Treatment
David Morrall Ross
School of Medicine University of Adelaide
May 2009
ii
iii
Table of Contents
1 Chronic myeloid leukaemia ................................................................................................1
1.1 Aims of the study........................................................................................................1
1.2 Clinical features and diagnosis ...................................................................................1
1.2.1 Current management of CML.............................................................................1
1.2.2 Risk scores ..........................................................................................................3
1.2.3 Cytogenetics........................................................................................................3
1.2.4 Molecular biology...............................................................................................4
1.2.5 Pathophysiology..................................................................................................5
1.2.6 Aetiology ............................................................................................................5
1.3 Monitoring disease response.......................................................................................6
1.3.1 Clinical and haematological response.................................................................6
1.3.2 Cytogenetic response ..........................................................................................6
1.3.3 BCR-ABL RQ-PCR.............................................................................................6
1.3.4 Nested RT-PCR ..................................................................................................8
1.4 Treatment of CML......................................................................................................8
1.4.1 Hydroxyurea .......................................................................................................8
1.4.2 Interferon-α .........................................................................................................8
1.4.3 Imatinib...............................................................................................................8
1.4.4 Dasatinib and nilotinib........................................................................................9
1.4.5 Allogeneic stem cell transplantation...................................................................9
1.5 Minimal residual disease ............................................................................................9
2 Patients, materials and methods........................................................................................11
2.1 Patients......................................................................................................................11
2.2 Materials ...................................................................................................................11
2.2.1 Cell lines ...........................................................................................................11
2.2.2 Oligonucleotide primers and TaqMan® probes ...............................................11
2.2.3 Non-proprietary reagents ..................................................................................14
2.3 Methods ....................................................................................................................14
2.3.1 Thawing of cryopreserved cells........................................................................14
2.3.2 DNA extraction.................................................................................................14
2.3.3 RNA extraction .................................................................................................15
2.3.4 Spectrophotometry............................................................................................15
2.3.5 Restriction enzyme digestion............................................................................16
iv
2.3.6 Purification of nucleic acids .............................................................................16
2.3.7 DNA polymerase chain reaction.......................................................................16
2.3.8 Reverse transcriptase PCR................................................................................17
2.3.9 Agarose gel electrophoresis..............................................................................17
2.3.10 Real-time fluorescence PCR.............................................................................17
2.3.11 Dideoxynucleotide sequencing.........................................................................18
2.3.12 Statistical methods ............................................................................................18
3 Optimization of RT-PCR methods for the detection of BCR-ABL mRNA ......................19
3.1 Introduction...............................................................................................................19
3.1.1 Removal of PCR inhibitors...............................................................................19
3.1.2 Optimized priming of reverse transcription......................................................20
3.1.3 RQ-PCR using plasma RNA ............................................................................20
3.2 Omission of dithiothreitol from RT-PCR.................................................................21
3.2.1 Omission of DTT did not increase BCR-ABL copy number.............................21
3.3 Purification of cDNA................................................................................................22
3.4 Random pentadecamer primers for RT-PCR............................................................23
3.4.1 Experimental approach .....................................................................................23
3.4.2 Increased BCR-ABL and BCR transcript copy numbers using R15 primers ....23
3.4.3 RQ-PCR detection of BCR-ABL mRNA in patient samples ............................26
3.4.4 Alternative control genes..................................................................................27
3.4.5 Nested RT-PCR detection of BCR-ABL mRNA in patient samples.................28
3.5 Development of an optimized nested RT-PCR method for BCR-ABL ...................30
3.5.1 Assay design .....................................................................................................30
3.5.2 Positive control .................................................................................................30
3.5.3 Negative controls ..............................................................................................31
3.5.4 Improved sensitivity of real-time nested RT-PCR in cell line dilutions ..........31
3.6 Detection of BCR-ABL mRNA in plasma ...............................................................33
3.6.1 Extraction of plasma RNA................................................................................33
3.6.2 Quantification of BCR and BCR-ABL mRNA in plasma..................................33
3.6.3 Extraction of RNA from CML patients in a CMR ...........................................33
3.7 Discussion.................................................................................................................34
3.7.1 Removal of potential inhibitors of PCR ...........................................................34
3.7.2 Pentadecamer primers for reverse transcription ...............................................34
3.7.3 Nested RT-PCR for BCR-ABL..........................................................................36
3.7.4 Plasma BCR-ABL mRNA .................................................................................37
3.7.5 Future directions ...............................................................................................37
v
3.8 Publication of findings and contributions of co-authors...........................................38
4 Identification and characterization of the BCR-ABL breakpoint sequences of CML
patients ......................................................................................................................................39
4.1 Introduction...............................................................................................................39
4.1.1 Juxtaposition of BCR and ABL1 .......................................................................40
4.1.2 DNA repair and recombination.........................................................................40
4.1.3 Methods for the detection of BCR-ABL breakpoints ........................................41
4.2 BCR-ABL breakpoint screening by long range PCR ...............................................43
4.2.1 Sequencing of long range PCR products ..........................................................45
4.2.2 Specific examples of the sequencing approach ................................................46
4.2.3 Success rate of the long range PCR method .....................................................49
4.3 Alternative strategies for the detection of BCR-ABL breakpoints...........................49
4.3.1 Identification of BCR-ABL breakpoints from the reciprocal ABL-BCR fusion
gene ..........................................................................................................................50
4.3.2 Inverse PCR screening for BCR-ABL breakpoints ...........................................50
4.3.3 Short PCR screening method for BCR-ABL breakpoints – external
collaboration .....................................................................................................................50
4.4 Distribution of BCR-ABL breakpoints.....................................................................51
4.4.1 Numbering of breakpoints in BCR and ABL1...................................................51
4.4.2 Analysis of breakpoint clustering .....................................................................54
4.4.3 Association of breakpoints with DNA topology...............................................54
4.5 ABL-BCR reciprocal breakpoints ............................................................................55
4.5.1 Detection of genomic ABL-BCR breakpoints ...................................................55
4.5.2 Cytogenetic deletions of der(9) – a negative control for ABL-BCR .................55
4.5.3 Expression of ABL-BCR mRNA – a positive control for ABL-BCR ................55
4.5.4 Concordance of detection of ABL-BCR in cDNA and gDNA ..........................56
4.5.5 Distribution of breakpoints in ABL1 and BCR..................................................57
4.6 Characteristics of the fusion sequences of BCR-ABL and ABL-BCR ....................58
4.6.1 Microhomology at the BCR-ABL breakpoint is indicative of DNA repair by
non-homologous end-joining............................................................................................58
4.6.2 Nucleotide insertions at the breakpoint are uncommon....................................58
4.6.3 Translocation t(9;22) is usually ‘unbalanced’ at a molecular level ..................59
4.7 Conservation of the fusion sequence in amplified BCR-ABL genes .......................59
4.7.1 Cytogenetic and molecular characterization of BCR-ABL cell lines...............59
4.8 Discussion.................................................................................................................61
4.8.1 Methods for the detection of genomic BCR-ABL .............................................61
vi
4.8.2 Clustering of breakpoints in BCR and ABL1 ....................................................63
4.8.3 Deletions, duplications, microhomology, and DNA repair ..............................64
4.8.4 The ABL-BCR gene...........................................................................................65
4.8.5 Implications for the detection of MRD.............................................................66
4.9 Publication of findings and contributions of co-authors...........................................67
5 Development of a quantitative PCR method for the detection of BCR-ABL DNA ..........69
5.1 Rationale ...................................................................................................................69
5.1.1 Established methods for the quantification of CML cells ................................69
5.1.2 BCR-ABL mRNA expression levels .................................................................71
5.1.3 BCR-ABL DNA PCR monitoring .....................................................................71
5.1.4 DNA Q-PCR for the monitoring of MRD in other types of leukaemia............71
5.2 Real-time Q-PCR for BCR-ABL DNA ....................................................................71
5.2.1 Design of primers and probes for real-time Q-PCR .........................................71
5.2.2 Details of patient-specific amplicons................................................................72
5.2.3 Real-time DNA PCR method ...........................................................................72
5.2.4 Restrictions on primer design related to the breakpoint sequence ...................74
5.3 Preliminary experiments with nested DNA PCR .....................................................76
5.3.1 Time-release PCR method................................................................................76
5.3.2 Non-specific amplification ...............................................................................77
5.3.3 Sensitivity .........................................................................................................78
5.3.4 Preliminary conclusions....................................................................................78
5.4 Genomic DNA control gene for Q-PCR...................................................................78
5.4.1 Design of quantitative primers and probe for GUSB........................................78
5.4.2 Establishment of a GUSB standard...................................................................79
5.4.3 DNA quantification by spectrophotometry and real-time PCR........................79
5.5 Development of a nested DNA Q-PCR method .......................................................81
5.5.1 Number of first round amplification cycles......................................................81
5.5.2 Non-linearity of standards with high levels of BCR-ABL ................................82
5.5.3 Calculation of nested DNA Q-PCR results ......................................................83
5.5.4 Negative threshold for nested DNA Q-PCR.....................................................84
5.5.5 Estimation of assay detection limit based on amplifiable DNA.......................84
5.6 Alternative materials for the patient-specific standards ...........................................84
5.6.1 Amplified DNA versus genomic DNA in real-time PCR ................................84
5.6.2 Patient-specific DNA standards diluted in human DNA versus diluent solution.
..........................................................................................................................85
5.7 DNA versus RNA for the monitoring of chronic phase CML..................................86
vii
5.7.1 Calculation of quantitative results ....................................................................87
5.7.2 The level of BCR-ABL mRNA falls more rapidly than BCR-ABL DNA early in
imatinib treatment .............................................................................................................87
5.7.3 Two patients with undetectable BCR-ABL using real-time DNA PCR ............87
5.8 Discussion.................................................................................................................89
5.8.1 Detection limit of BCR-ABL DNA ...................................................................89
5.8.2 Accuracy and precision of quantification .........................................................89
5.8.3 Comparison with other DNA Q-PCR methods.................................................90
5.8.4 Kinetics of response to imatinib treatment .......................................................92
5.9 Publication of findings and contributions of co-authors...........................................92
6 Clinical trial of imatinib withdrawal in CML patients with a stable complete molecular
response ....................................................................................................................................93
6.1 Rationale ...................................................................................................................93
6.1.1 Hypotheses........................................................................................................93
6.2 Design of the clinical trial.........................................................................................93
6.2.1 Contribution of the author.................................................................................93
6.2.2 Inclusion and exclusion criteria ........................................................................94
6.2.3 RQ-PCR monitoring of BCR-ABL mRNA .......................................................94
6.2.4 Definition of relapse .........................................................................................94
6.2.5 Treatment of relapse .........................................................................................95
6.2.6 Study stopping rules..........................................................................................95
6.3 Interim results of the clinical trial.............................................................................95
6.3.1 Patient characteristics .......................................................................................95
6.3.2 Sensitivity and specificity of RQ-PCR monitoring ..........................................96
6.3.3 Molecular relapse-free survival ........................................................................96
6.3.4 Relapse and response to imatinib re-treatment .................................................99
6.4 Sensitive detection of BCR-ABL mRNA to predict relapse ..................................102
6.4.1 Bone marrow versus peripheral blood RQ-PCR.............................................102
6.4.2 Nested real-time RT-PCR for BCR-ABL ........................................................103
6.5 Patient-specific BCR-ABL DNA Q-PCR...............................................................103
6.5.1 BCR-ABL breakpoint characteristics of the study patients .............................103
6.5.2 BCR-ABL DNA PCR identified MRD in patients in CMR ............................104
6.5.3 The detection of BCR-ABL DNA prior to imatinib withdrawal did not predict
subsequent relapse ..........................................................................................................104
6.5.4 BCR-ABL DNA levels increased at or before relapse.....................................104
6.5.5 Comparison of DNA PCR and nested real-time RT-PCR for BCR-ABL .......107
viii
6.6 Discussion...............................................................................................................107
6.6.1 Minimal residual disease burden in stable CMR............................................107
6.6.2 Kinetics of response to imatinib treatment as a predictor of relapse when
treatment was withdrawn................................................................................................108
6.6.3 Absence of the ABL-BCR gene and the response to imatinib treatment.........108
6.6.4 Optimizing the detection of MRD in CML patients.......................................109
6.6.5 Effect of prior interferon-α on relapse risk.....................................................110
6.6.6 Immune surveillance of CML.........................................................................111
6.6.7 Clinical implications of the study findings, and future directions..................112
6.7 Presentation of results and contribution of co-authors ...........................................113
7 Publications arising.........................................................................................................115
8 Bibliography ...................................................................................................................117
ix
Abstract Around 50% of chronic myeloid leukaemia (CML) patients who remain on imatinib treatment for more than 5 years will achieve a complete molecular response (CMR), defined by undetectable BCR-ABL mRNA in a sensitive reverse transcriptase real-time quantitative PCR (RQ-PCR) assay. Given the increasing importance of CMR on imatinib therapy the primary aim of this study was to improve the accuracy and sensitivity of MRD detection to allow a more accurate estimation of relapse risk when therapy is withdrawn. Firstly, we investigated ways of improving the sensitivity of RT-PCR methods for the detection of BCR-ABL mRNA. Secondly, we investigated the use of the patient-specific BCR-ABL gene for the detection of MRD. Thirdly, we conducted a multi-centre clinical trial of imatinib withdrawal in selected CML patients in a stable CMR. This clinical trial provided patient samples that could be used to test our optimized MRD assays, and provided clinical data on the risk and patterns of relapse after withdrawal of imatinib therapy. The trial is ongoing, but an interim analysis of the study data was performed. In 22 patients the estimated probability of molecular relapse after imatinib withdrawal was 54%, and 60% of relapses occurred within the first 4 months. The average detection limit of BCR-ABL mRNA by RQ-PCR is estimated at around 4.5 log below the level of BCR-ABL prior to commencing treatment. The number of leukaemic cells at diagnosis is around 1012, so the number of residual leukaemic cells in CMR might vary from zero to over a million. We hypothesized that the amount of residual leukaemia in CMR is variable between patients, and that this heterogeneity is a determinant of the risk of relapse when treatment is withdrawn. We developed more sensitive methods for the detection of BCR-ABL and tested these methods in samples from our study patients. We showed that random pentadecamer (15-mer) primers improved the efficiency of reverse transcriptase PCR (RT-PCR), and resulted in a lower detection limit of BCR-ABL mRNA. We also developed a novel nested RT-PCR method using real-time PCR for the second round of the reaction, and this resulted in a lower detection limit of BCR-ABL in patient samples. The utility of this nested RT-PCR method was limited by a false positive rate of 2-3% in the HeLa cell line that we used as our negative control. Consequently, we examined the detection of the patient-specific genomic BCR-ABL sequence as an alternative to RT-PCR. Breakpoints in BCR and ABL1 in CML patients are widely dispersed over 3 kb and 150 kb, respectively. Therefore, the BCR-ABL genomic sequence is essentially unique to each patient. We sequenced the genomic breakpoints of 43 CML patients. We showed that the distribution of breakpoints in BCR and ABL1 was non-random, but we were unable to identify any genomic feature that determined the specific location of individual breakpoints. We developed a novel BCR-ABL DNA Q-PCR method for 12 of the study patients, and in 11 of the patients BCR-ABL DNA was detected when the patient was in a CMR, confirming that this method was more sensitive than RQ-PCR. Contrary to our hypothesis, the detection of BCR-ABL DNA was not predictive of relapse. In most patients who relapsed there was a significant increase in BCR-ABL DNA prior to mRNA relapse. Two patients had stable levels of BCR-ABL DNA measurable on multiple occasions, but remained in remission after 6 months and 15 months, respectively. We have shown that a stable CMR after the withdrawal of imatinib therapy does not necessarily indicate the eradication of leukaemia.
x
Declaration of Originality This work contains no material which has been accepted for the award to me of any other degree or diploma in any university or other tertiary institution and, to the best of my knowledge and belief, contains no material previously published or written by another person, except where due reference has been made in the text. I give consent to this copy of my thesis, when deposited in the University Library, being made available for loan and photocopying, subject to the provisions of the Copyright Act 1968. I also give permission for the digital version of my thesis to be made available on the Worldwide Web via the University’s digital research repository, the Library catalogue, the Australasian Digital Theses Program (ADTP), and also through web search engines. David Morrall Ross
xi
Acknowledgements The Leukaemia Foundation of Australia awarded me a PhD scholarship. Research funding was provided by Novartis Pharmaceuticals, and by the Contributing Haematologists’ Committee of the Royal Adelaide Hospital. At the end of each chapter I have listed the people who provided assistance. My supervisors were Timothy Hughes, Susan Branford and Junia Vaz de Melo. Additional guidance for the laboratory work came from Deborah White (IMVS), and Alexander Morley (Flinders University). Nicholas Cross and Joannah Score (Salisbury), and Junia Vaz de Melo and Manuel Simões (Hammersmith) provided details of their DNA breakpoint detection methods and contributed additional patient data. Dennis Lo (Chinese University of Hong Kong) provided details of his plasma RNA extraction method. Many people were involved in the CML8 study of the Australasian Leukaemia and Lymphoma Group at the 7 participating hospitals in Adelaide, Melbourne, Sydney and Brisbane, and at the ALLG trial centre. The staff of the Leukaemia Unit (IMVS Molecular Pathology) and the Melissa White Laboratory (IMVS Haematology) processed the trial samples. Some assays were performed by Dale Watkins and Lisa Schafranek of the Melissa White Laboratory. David Morrall Ross
xii
Abbreviations % per centum ABL1 Abelson murine leukaemia virus human homologue 1 gene aDNA Amplified DNA ALLG Australasian Leukaemia & Lymphoma Group AP Accelerated Phase BC Blast Crisis BCR Breakpoint Cluster Region gene BCR-ABL BCR-ABL1 fusion oncogene BM Bone Marrow bp Nucleotide base pairs C Degrees Celsius CCR Complete Cytogenetic Response cDNA Complementary DNA CHR Complete Haematological Response CML Chronic Myeloid Leukaemia CMR Complete Molecular Response CP Chronic Phase Ct Fluorescence threshold cycle number CTL Cytotoxic T Lymphocyte DNA Deoxyribonucleic Acid EAC Europe Against Cancer collaborative group EDTA Ethylenediaminetetra-acetic acid e.g. exempli gratia et al. et alia g Grams g Gravity gDNA Genomic DNA GUSB β glucuronidase gene h Hours i.e. id est IFN Interferon-α IM Imatinib mesylate IMVS Institute of Medical & Veterinary Science IS International Standard (BCR-ABL mRNA level) Kb Kilo base pairs L Litres log Logarithm10m Milli (10-3) MCR Major Cytogenetic Response min Minutes MMR Major Molecular Response MRD Minimal Residual Disease mRNA Messenger RNA μ Micro (10-6) n Nano (10-9) NHEJ Non-homologous end-joining nt Nucleotide PB Peripheral Blood PCR Polymerase Chain Reaction Ph Philadelphia
xiii
p Pico (10-12) Q-PCR Quantitative PCR R6 Random hexamer oligonucleotide R15 Random pentadecamer oligonucleotide RNA Ribonucleic Acid rpm Revolutions per minute RT-PCR Reverse Transcriptase PCR s Seconds UV Ultraviolet V Volts vs versus
xiv
1
1 Chronic myeloid leukaemia
1.1 Aims of the study Increasing numbers of chronic myeloid leukaemia (CML) patients will achieve a complete molecular response (CMR) with prolonged imatinib treatment. Given the increasing importance of CMR on imatinib therapy the primary aim of this study was to improve the accuracy and sensitivity of MRD detection to allow a more accurate estimation of relapse risk when therapy is withdrawn. We aimed to develop more sensitive methods for the detection of BCR-ABL in treated CML patients. Firstly, we investigated ways of improving the sensitivity of RT-PCR methods for the detection of BCR-ABL mRNA. Secondly, we investigated the use of the patient-specific BCR-ABL gene for the detection of MRD. Thirdly, we conducted a multi-centre clinical trial of imatinib withdrawal in selected patients with a low level of MRD. This provided patient samples that could be used to test our optimized MRD assays, and provided clinical data on the risk and patterns of relapse after withdrawal of imatinib therapy.
1.2 Clinical features and diagnosis Chronic myeloid leukaemia is a myeloproliferative disorder characterized by myeloid hyperplasia in the bone marrow, leukocytosis and splenomegaly. Most patients with CML are diagnosed in the chronic phase (CP), which is asymptomatic in around one-third of patients, but may be associated with constitutional symptoms and abdominal discomfort due to splenomegaly. Most CP CML patients present with a characteristic blood picture showing increased and left-shifted granulopoiesis with a predominance of neutrophils and myelocytes. Eosinophils and basophils are increased. Confirmation of the diagnosis relies on the cytogenetic identification of the Philadelphia (Ph) chromosome or the molecular identification of the BCR-ABL fusion gene in leukaemic cells (Jaffe et al. 2001). After a variable interval the disease may transform to an advanced phase that is associated with increasing leukocytosis and splenomegaly, constitutional symptoms, and chloroma. Advanced phase is divided into blast crisis (BC), which is clinically indistinguishable from acute leukaemia, and an intermediate accelerated phase (AP). An adverse prognosis is seen in patients with excess blasts, excess basophilia, or cytopenia unrelated to therapy (Kantarjian et al. 1988). Response to therapy and overall survival in advanced phase CML are relatively poor, so the main aim of treatment in CP CML is to prevent progression to the advanced phase. In the past most patients progressed within 5-7 years (Guilhot et al. 2004), but imatinib therapy has significantly improved the natural history of CP CML in recent years.
1.2.1 Current management of CML Imatinib is an orally-available small molecule ATP-competitive inhibitor of the BCR-ABL tyrosine kinase (Buchdunger et al. 1996; Druker et al. 1996). The International Randomised Study of Interferon and STI571 (IRIS) in newly-diagnosed CP CML demonstrated the superiority of imatinib over the previous best drug therapy, interferon-α (IFN) and cytarabine (O'Brien et al. 2003; Druker et al. 2006). The aim of treatment is to reduce the leukaemic burden as this is associated with improved overall and progression-free survival. Within the first 12 months over 95% of patients treated with imatinib 400 mg daily achieved a complete haematological response (normalization of blood counts and organomegaly). Approximately 70% of patients achieved a complete cytogenetic response (CCR; no detectable Ph chromosome on bone marrow metaphase karyotyping) within 12 months, and in this sub-group of patients with a CCR molecular monitoring was performed using real-time
quantitative reverse transcriptase PCR for BCR-ABL (RQ-PCR). The study identified a more stringent reduction in leukaemic burden, of approximately one order of magnitude below the threshold for CCR, as conferring a superior prognosis with 100% freedom from advanced phase disease (Hughes et al. 2003). This was termed a major molecular response (MMR), and represents a 3 log reduction from the median pre-treatment baseline BCR-ABL level (Figure 1.1). The BCR-ABL level that defines MMR is 0.1% on the proposed International Scale (BCR-ABLIS), the details of which are discussed below in Section 1.2.3. Five year follow-up data from IRIS have been published, showing that the estimated overall survival of imatinib-treated patients was 89%, with progression to AP/BC in only 7% (Druker et al. 2006).
Figure 1.1 CML treatment response and the estimated number of leukaemic cells remainingThe estimated number of leukaemic cells at diagnosis is around 1012. MCR = Major cytogenetic response (≤35% Ph+ metaphases on bone marrow karyotyping); CMR = Complete molecular response; no detectable BCR-ABL mRNA by RQ-PCR with a calculated detection limit of 4.5 log below baseline.
Estimated num
ber of leukemic cells (log
10 )0
1
2
3
4
5
6
7
8
9
10
11
0
0.01
0.1
10
100
BC
R-A
BL
leve
l (%
Inte
rnat
iona
l Sca
le)
Leukocytosis
MCR1
CCR
MMR
CMRundetectable BCR-ABL
2
3
1.2.2 Risk scores The development of clinical risk scores in the 1980s and ‘90s was driven by the availability of allogeneic stem cell transplantation as a potentially curative treatment for CML patients. There was therefore a need to distinguish patients for whom the risk-benefit ratio of the allograft procedure was most favourable. Sokal and colleagues (Sokal et al. 1984) performed a multivariate analysis and developed a scoring system that distinguished high risk patients (median survival 32 months) from intermediate (median survival approximately 45 months) and low risk patients (median survival 60 months). The factors incorporated in the Sokal score are: age, palpable spleen size (in centimetres below the costal margin), platelet count, and blast percentage in the peripheral blood at the time of diagnosis. It is noteworthy that the elements of the Sokal score overlap with those that are used to define accelerated phase so that there is a continuum between high risk chronic phase and accelerated phase disease, and the definitions that are used to classify patients are somewhat arbitrary. Although the Sokal score was developed in patients treated with hydroxyurea and busulphan, it retains prognostic value in patients treated de novo with imatinib (Hughes et al. 2003; Druker et al. 2006). Other scoring systems using similar clinical variables have been proposed (Kantarjian et al. 1985), the most widely used of which is the Hasford score (Hasford et al. 1998), developed in interferon-treated patients. The Hasford score incorporates the same four variables as the Sokal score, as well as the eosinophil count and basophil count in the peripheral blood at diagnosis.
1.2.3 Cytogenetics The cytogenetic basis of CML was revealed in 1960 by the recognition of the Ph chromosome, an abnormally shortened chromosome 22 resulting from a balanced reciprocal translocation, t(9;22)(q34;q22) (Nowell and Hungerford 1960; Rowley 1973). CML is associated with the classical Ph chromosome on G-banded karyotypic examination in at least 90-95% of cases. In a further 5% a variant BCR-ABL rearrangement, often involving other chromosomes in addition to chromosomes 9 and 22, may be identified by karyotyping or by fluorescence in situ hybridisation (FISH). Rare cases of CML have a cytogenetically cryptic BCR-ABL rearrangement that can be detected only by PCR (Jaffe et al. 2001). In all of these instances there is fusion of the Breakpoint Cluster Region (BCR) gene on chromosome 22 with the Abelson murine leukaemia viral oncogene homologue (ABL1) tyrosine kinase gene on chromosome 9 (Groffen et al. 1984; Heisterkamp et al. 1985). In most cases the reciprocal ABL1-BCR translocation is formed on der(9), the derivative chromosome 9.
1.2.3.1 Variant BCR-ABL rearrangements Variant BCR-ABL rearrangements, involving additional chromosomes as well as 9 and 22, appear not to influence prognosis, but may be associated with an increased rate of deletions in der(9) (Huntly et al. 2001; El-Zimaity et al. 2004). In very rare cases, a syndrome clinically indistinguishable from CML may arise from translocations that fuse BCR to alternative tyrosine kinase partners (e.g. PDGFRA, JAK2, FGFR1) (Demiroglu et al. 2001; Baxter et al. 2002; Griesinger et al. 2005), or that fuse ABL1 to alternative regulatory partners (e.g. TEL) (Papadopoulos et al. 1995). Unless otherwise specified, the diagnosis of CML is taken to refer only to the classical form of the disease characterized by the BCR-ABL oncogene.
1.2.3.2 Derivative chromosome 9 deletions Deletions of der(9) were identified by FISH studies in which it was noted that a der(9) hybridisation signal is lost in around 10-15% of CML patients (Dewald et al. 1999; Herens et al. 2000; Sinclair et al. 2000). Most of these deletions are large (several megabases) and span the reciprocal ABL-BCR fusion on der(9). It is thought that the der(9) deletion arises during the formation of BCR-ABL. Deletions have been found with a similar prevalence in chronic and advanced phase disease, arguing against the process of clonal evolution (Huntly et al.
4
2001; Quintas-Cardama et al. 2005). In most studies there is no mixed population of Ph-positive cells with and without the deletion, suggesting that the deletion is a primary event in the Ph-positive clone (Cohen et al. 2001; Huntly et al. 2001; Kolomietz et al. 2001) Cases with mosaicism for the der(9) deletion have been reported, indicating that rare acquired deletions in the breakpoint region do occur (Rudduck-Sivaswaren et al. 2005; Xinh et al. 2006). Most, but not all, studies have found an adverse prognosis in CML patients with der(9) deletions undergoing treatment with hydroxyurea or IFN (Cohen et al. 2001; Huntly et al. 2001; Kolomietz et al. 2001; Yoong et al. 2005). This adverse prognosis is independent of clinical risk score (Huntly et al. 2001). Deletions have also been associated with an adverse prognosis after allografting patients in chronic phase (Kolomietz et al. 2001; Kreil et al. 2007). Two studies in patients treated with imatinib have found no difference in overall survival in patients with der(9) deletions (Huntly et al. 2003; Quintas-Cardama et al. 2005). A recent study using multiplex ligation-dependent probe amplification for the detection of deletions found a much higher proportion of deletions confined either to the centromeric or to the telomeric side of the ABL-BCR breakpoint (Kreil et al. 2007). The adverse prognosis of der(9) deletions in this study of interferon-treated patients was confined to those with breakpoint-spanning deletions. Remarkably, deletions not spanning the breakpoint were associated with significantly better overall survival in comparison with undeleted der(9). There was no apparent difference in survival between centromeric and telomeric deletions. As the location of the ABL1 breakpoint location is highly variable, it is difficult to understand why the breakpoint-spanning region should be so important. The pathophysiology underlying any prognostic effect of der(9) deletions remains speculative. Deletions result in failure to express the reciprocal ABL-BCR fusion. In acute promyelocytic leukaemia, characterized by the PML-RARA fusion oncogene, it has been shown in animal models that expression of the reciprocal RARA-PML plays a role in the disease phenotype (Rego and Pandolfi 2002), yet animal models of CML in which ABL-BCR is not expressed recapitulate the phenotype of CML patients. ABL-BCR mRNA is expressed in around 60-70% of CML patients (Melo et al. 1993; Melo et al. 1996; de la Fuente et al. 2001), but no ABL-BCR protein has ever been detected, and ABL-BCR is clearly not necessary for the disease phenotype in the remaining 30-40%. Another attractive hypothesis to explain the effect of deletions is the loss of a tumour suppressor gene or the loss of a regulatory region that influences BCR-ABL expression (Huntly et al. 2003). There is no clear-cut region that is universally deleted from der(9), and the recent evidence regarding breakpoint-spanning deletions is hard to reconcile with loss of a single, specific locus. A third possible explanation is that the breakpoint deletion is an epiphenomenon reflecting perturbation of DNA repair mechanisms in the leukaemic cell. Expression of BCR-ABL results in genomic instability, at least in part due to generation of reactive oxygen species and up-regulation of unfaithful DNA repair mechanisms (Nowicki et al. 2004; Koptyra et al. 2006), but no pre-leukaemic lesion predisposing to the Ph rearrangement and CML has been reported (Neumann et al. 2005).
1.2.4 Molecular biology
1.2.4.1 Genomic BCR-ABL DNA Breakpoints in BCR are clustered in a region of approximately 3 kb in the majority of CML patients. This region spans from intron 13 to the end of exon 15. Breakpoints can occur in other regions of BCR, particularly in intron 1 and intron 19. These alternative breakpoints are typically associated with phenotypic variants of CML with prominent monocytosis and neutrophilia, respectively (Melo et al. 1994; Ravandi et al. 1999; Pane et al. 2002). In Ph-positive acute lymphoblastic leukaemia BCR exon 1 is fused to ABL1 exon 2, and this
5
condition is associated with a very poor prognosis. Breakpoints in chromosome 9 occur across a much wider range of approximately 160 kb from upstream of exon Ib (outside ABL1) to the end of the first ABL1 intron (Melo 1996). Rare ABL1 breakpoints outside this region have been described, but no phenotypic associations are known.
1.2.4.2 BCR-ABL messenger RNA Whereas the genomic breakpoints in BCR and ABL1 show considerable diversity virtually all CML patients express the same mRNA transcripts, e13a2 (BCR exon 13 fused to ABL1 exon 2, also termed b2a2) or e14a2 (also termed b3a2) or both (10%) (Rozman et al. 1995; Shepherd et al. 1995; de la Fuente et al. 2001). Patients who express both e13a2 and e14a2 express the primary transcript e14a2, but due to the presence a polymorphic splice site a proportion of the e14a2 is converted to e13a2 by the splicing out of exon 14 (Saussele et al. 2000; Branford et al. 2002).
1.2.5 Pathophysiology BCR-ABL plays a central role in activating a number of pathways that confer pro-survival and increased proliferative function on the leukaemic cells, and in animal models the ABL1 kinase domain of BCR-ABL is essential to recapitulate a CML-like disease (Ren 2005). A consequence of BCR-ABL kinase activity within the leukaemic cell is an increased rate of mutagenicity, mediated by increased levels of reactive oxygen species (Nowicki et al. 2004; Dierov et al. 2009). The accumulation of mutations subsequent to the initiating BCR-ABL translocation is probably critical to the development of advanced phase disease.
1.2.6 Aetiology The only known cause of CML is exposure to ionizing radiation. Following the atomic bomb blasts over Hiroshima and Nagasaki in 1945 there was a significant increase in a variety of haematological neoplasms, including CML (Ichimaru et al. 1991). In vitro exposure of cells to ionizing radiation has been used to induce t(9;22) (Kozubek et al. 1999), but in one study the rate of t(9;22) was no greater in irradiated cells than in controls (Bose et al. 1998). Rare BCR-ABL transcripts have been found in normal individuals using highly sensitive nested RT-PCR methods (Biernaux et al. 1995; Bose et al. 1998). The BCR-ABL transcripts identified included both the typical transcripts seen in CML patients and other atypical transcripts (Bose et al. 1998). Therefore it is likely that t(9;22) occurs at a much higher rate than previously suspected, but that most of these translocations never result in disease. There are at least three reasons why translocations might not result in disease: 1) the translocation does not generate a functional BCR-ABL protein; 2) BCR-ABL arises in a cell that cannot be transformed; 3) immune surveillance deletes the abnormal clone. If there is any inherited predisposition to CML the risk is small. An epidemiological study of over 10,000 patients with myeloproliferative neoplasms found that the risk of CML in first-degree relatives was increased approximately 2-fold (relative risk 1.9; 0.9-3.8; p=0.09) (Landgren et al. 2008). Several patients have been reported with both BCR-ABL CML and other myeloproliferative neoplasms (Curtin et al. 2005; Kramer et al. 2007; Cambier et al. 2008; Hussein et al. 2008). In a patient with JAK2 V617F it was shown that the JAK2 mutation did not co-exist with BCR-ABL on the same clone, but defined a separate clone that was apparent when CML was suppressed by BCR-ABL kinase inhibition (Kramer et al. 2007). While such cases are uncommon, the number of reported cases seems to suggest that the incidence is more than would be expected by chance, and it is possible that there is some common predisposing abnormality that favours the acquisition of CML and other myeloid neoplasms (Curtin et al. 2005). The genes that might be involved in familial susceptibility have not yet been investigated in detail. The BCL2 tumour suppressor gene is involved in apoptosis, and polymorphisms in this gene may confer a slightly increased risk of CML (Kim
6
et al. 2009). Another candidate locus is that encoding the human leukocyte antigens (HLA) (Posthuma et al. 1999; Posthuma et al. 2000; Oguz et al. 2003).
1.3 Monitoring disease response The way in which CML treatment response is monitored is inevitably driven by the prevalent treatment and its efficacy. Treatment with IFN typically induces an incomplete cytogenetic response (Guilhot et al. 1997), so conventional karyotyping provides useful information on the majority of CML patients receiving IFN. After allografting a CCR is usual, and RT-PCR can be used to detect residual disease (Cross et al. 1993; Radich et al. 1995; Lange et al. 2005). On imatinib treatment the majority of patients achieve a CCR within the first year (O'Brien et al. 2003), so RQ-PCR is the main method of monitoring for most imatinib-treated patients. The frequent achievement of CMR (defined below in section 1.2.3) with prolonged ABL kinase inhibitor therapy provides the rationale for the body of work in this thesis.
1.3.1 Clinical and haematological response Clinical assessment of treatment response in CML is based primarily on resolution of hepatosplenomegaly and extramedullary disease (if present), and the disappearance of any associated constitutional symptoms. A complete haematological response (CHR) requires resolution of splenomegaly, and normalization of peripheral blood counts and the white cell differential.
1.3.2 Cytogenetic response The proportion of Ph-positive metaphases on conventional G-banded karyotyping of at least 20 bone marrow cells provides important prognostic information and enables a quantitative assessment of disease burden. At diagnosis most patients have 100% Ph-positive cells. A minor cytogenetic response is defined as 36-95% Ph-positive cells. A major cytogenetic response (MCR) is ≤35% Ph-positive cells, and can be further divided into a complete (no Ph-positive cells) or partial (1-35%) cytogenetic response (Kantarjian et al. 2002). Fluorescence in situ hybridization (FISH) for BCR-ABL can also be used to estimate the proportion of Ph-positive cells. FISH is usually performed on interphase cells and can be helpful in cases with a low yield of metaphases. In addition it is feasible to examine a much larger number of cells, which may increase both the accuracy and lower detection limit of the analysis. Early FISH studies had a lower detection limit that was determined by the background rate of false positivity due to chance spatial co-localization of the BCR and ABL1 signals. The use of break-apart and dual fusion methods increases the specificity of FISH and enables a lower detection limit of around 0.5% (1/200 cells) (Landstrom and Tefferi 2006). There is a good correlation between the proportion of BCR-ABL-positive cells determined by karyotyping and by FISH (Cuneo et al. 1998; Lesser et al. 2002). In some newly-diagnosed patients FISH under-estimates the proportion of Ph-positive metaphases, perhaps due to variable clonality of B and T lymphocytes (Tefferi et al. 1995; Haferlach et al. 1997).
1.3.3 BCR-ABL RQ-PCR Quantitative real time RT-PCR for BCR-ABL forms the backbone of CML monitoring in many centres around the world. The level of BCR-ABL mRNA in the peripheral blood by RQ-PCR shows excellent concordance with karyotyping. We and others have shown that 10% BCR-ABLIS is approximately equivalent to MCR, while 1% BCR-ABLIS is approximately equivalent to CCR (Branford et al. 1999; Merx et al. 2002; Wang et al. 2002; Ross et al. 2006). In 320 samples in which RQ-PCR and bone marrow karyotyping were performed together no patient in MMR was not also in CCR (Ross et al. 2006). RQ-PCR is to some extent replacing conventional cytogenetics as an indicator of residual disease burden and
7
progression-free survival. For patients in MMR bone marrow karyotyping provides little or no additional information about the Ph-positive clone. RQ-PCR methodology varies between laboratories, but the principles are similar (Branford et al. 1999; Gabert et al. 2003). RNA is extracted from peripheral blood or bone marrow cells and mRNA is amplified using a reverse transcriptase enzyme; RT-PCR primers may be random oligonucleotides (amplify all sequences), oligo-dT primers (amplify all mRNA sequences from the polyA tail), or sequence-specific primers (amplify a single gene). An aliquot of the cDNA product is then used in real-time fluorescence quantitative PCR to quantify both the target transcript, BCR-ABL, and a control gene transcript. The RQ-PCR result is expressed as a ratio of BCR-ABL to its control gene. Many different control genes have been used for BCR-ABL RQ-PCR, but the ideal control gene should have expression levels and degradation characteristics similar to BCR-ABL, and should be stable in its expression regardless of the disease state and treatment (Beillard et al. 2003; van der Velden et al. 2004). The Europe Against Cancer collaborative group has recommended the use of the control genes ABL1, BCR, and GUSB. There is significant variation in the BCR-ABL/control gene (CG) ratio between patients prior to treatment with imatinib, but this does not seem to have any prognostic importance (Lange et al. 2004; Hughes and Branford 2006). As part of the IRIS study the median BCR-ABL/CG ratio prior to commencing study treatment was determined in 30 newly-diagnosed CML patients whose samples were tested in all three study laboratories (Hughes et al. 2003). Each laboratory used its own RQ-PCR methodology and the median baseline level was different in each, but when follow-up RQ-PCR results were expressed relative to the median baseline BCR-ABL/CG ratio the results were consistent between the three laboratories. The median pre-treatment BCR-ABL/CG ratio is therefore used as a standardized baseline for RQ-PCR, and assigned a value of 100% on the proposed BCR-ABL International Scale (Hughes et al. 2006). After 12 months of treatment approximately 40% of patients in the imatinib arm of the IRIS study achieved a 3 log reduction in BCR-ABL from the standardized median baseline level (≤ 0.1% BCR-ABLIS), termed a major molecular response (Hughes et al. 2003). MMR confers an increased rate of freedom from progression to AP or BC, even over the good prognosis group of CCR without MMR. Efforts have been made to standardize the performance and reporting of BCR-ABL RQ-PCR in laboratories around the world (Gabert et al. 2003; Branford et al. 2006). Standardization is essential for the development of national and international treatment guidelines that incorporate molecular end-points, and for the interpretation of clinical trial data. An RQ-PCR assay can be standardized with a reference laboratory if an adequate number of samples is tested in both laboratories. Using the method of Bland and Altman the bias between the two methods can be determined (Bland and Altman 1986). If the bias is consistent across the range of clinically important values, then a mathematical conversion factor can be applied to remove the bias and align the values from those two laboratories. Numerous laboratories around the world have performed standardization of RQ-PCR by exchange of samples with the original IRIS trial molecular laboratories. The value corresponding to MMR in each laboratory is determined and assigned a value of 0.1%. All other results can then be expressed relative to this absolute value (Hughes et al. 2006; Branford et al. 2008). This standardization method uses the same principles that were used to establish the International Normalized Ratio for anticoagulant therapy, except that at present there is no standardized reference material to calibrate BCR-ABL RQ-PCR. Values on the proposed BCR-ABL International Scale show good agreement below the clinically important level of 10% BCR-ABLIS (equivalent to MCR), but may not agree above this level due to methodological differences (Cross et al. 2007). All BCR-ABL/CG ratio values in this thesis are reported using the proposed International Scale.
8
Another use of the control gene copy number is to estimate the detection limit of BCR-ABL in each individual sample (Gabert et al. 2003). The number of control gene transcripts detected in an individual sample is a reflection of specimen quality, and enzymatic efficiency. If BCR-ABL and its control gene are detected with similar efficiency then a sample with more copies of the control gene has a lower detection limit of BCR-ABL (a more sensitive assay). In order to standardize the level of MRD signified by CMR a proposed definition of CMR requires an assay with a calculated sensitivity of at least 4.5 log below the standardized baseline BCR-ABL level (Branford et al. 2007).
1.3.4 Nested RT-PCR Qualitative nested RT-PCR for BCR-ABL is performed in some laboratories on samples in which BCR-ABL is not detectable by RQ-PCR (Muller et al. 2003; Hughes et al. 2006). The most commonly used nested RT-PCR method for BCR-ABL mRNA was first described by Cross and colleagues (Cross et al. 1993). In our laboratory we were unable to demonstrate an improvement in sensitivity of this nested RT-PCR method in comparison with our optimized RQ-PCR assay (Ross et al. 2008).
1.4 Treatment of CML
1.4.1 Hydroxyurea Hydroxyurea (also known as hydroxycarbamide) inhibits ribonucleotide reductase, and thereby functions as an anti-metabolite in DNA synthesis. It is useful as a cytoreductive agent and prolongs survival in comparison with busulphan alkylating chemotherapy (Hehlmann et al. 1993). Treatment with hydroxyurea rarely induces MCR (<5%) and has little effect on the risk of transformation to advanced phase (Benelux CML Study Group 1998).
1.4.2 Interferon-α IFN is a naturally-occurring polypeptide, and is involved in regulating immune responses (Guilhot et al. 2004). The use of recombinant IFN enables the administration of supra-physiological doses. Immature CML cells exposed to IFN in vitro show reduced proliferation and survival (Neumann and Fauser 1982). Immunological effects of IFN treatment include up-regulation of leukaemia-associated antigens (Burchert et al. 2003), and the emergence of cytotoxic T cells with specific activity against leukaemic cells (Molldrem et al. 2000; Burchert et al. 2003). Among CML patients treated with IFN the rate of MCR is around 20% (Guilhot et al. 1997; Baccarani et al. 2002; O'Brien et al. 2003), and the achievement of a cytogenetic response is associated with prolonged overall survival. The addition of cytarabine to IFN was associated with higher rates of MCR and an improvement in overall survival (Guilhot et al. 1997). At the doses used to treat CML the non-haematological toxicity of IFN is considerable, and this limits the utility of IFN treatment in a significant proportion of patients (Guilhot et al. 1997). In the IRIS study approximately 25% of patients randomized to receive IFN and cytarabine crossed over to imatinib because of intolerance (O'Brien et al. 2003).
1.4.3 Imatinib The IRIS study demonstrated the superiority of imatinib over the previous best medical therapy, IFN and cytarabine (O'Brien et al. 2003). Five year follow-up data from this study demonstrated freedom from progression to advanced phase in 93% of patients remaining on study (Druker et al. 2006). Importantly, only 69% of the initial imatinib cohort remained on imatinib on study. Available data on the remaining 31% of patients suggest that around 20% may have been removed from the study due to sub-optimal treatment response, and one
9
quarter of those patients who discontinued the study have since died (Guilhot et al. 2007). Higher dose imatinib (600 or 800 mg daily) has been shown to increase response rates early in therapy, but has not yet been shown to affect progression-free survival (Kantarjian et al. 2004; Hughes et al. 2008).
1.4.4 Dasatinib and nilotinib Dasatinib is a dual SRC/ABL kinase inhibitor with an estimated potency approximately 300 times that of imatinib. Nilotinib is a derivative of imatinib with approximately 20 to 30 times the potency of the parent compound. Both kinase inhibitors are active against many of the BCR-ABL kinase domain mutants (Bradeen et al. 2006; von Bubnoff et al. 2006), and both have significant clinical efficacy after imatinib failure or intolerance (Kantarjian et al. 2002; Kantarjian et al. 2006; Kantarjian et al. 2007). More recent studies have begun to investigate the use of these more potent kinase inhibitors for first-line therapy of CML (Pavlovsky et al. 2009).
1.4.5 Allogeneic stem cell transplantation Allogeneic haematopoietic stem cell transplantation is the only proven curative treatment for CML, but its toxicity and treatment-related mortality are considerable (Gratwohl et al. 2006). A German study has demonstrated the superiority of drug therapy over allografting for newly diagnosed CML patients with a biological randomization according to donor availability. There was a 73% 5-year survival probability for patients with no suitable sibling donor receiving drug therapy versus 62% for those with a donor, 91% of whom actually received an allograft (Hehlmann et al. 2007). The study commenced in 1995, and patients were treated initially with IFN, but may subsequently have crossed over to imatinib. Extrapolating from the available data comparing responses to IFN and imatinib it is likely that, if the study were to be repeated with imatinib treatment de novo, the survival advantage for drug therapy would remain, despite improvements in the survival of allograft patients in the interim. Allografting remains an important option for CP patients with a poor response to imatinib, and for patients in the advanced phases of the disease. At present most CP patients will receive an initial trial of drug therapy, as there are no prognostic factors at diagnosis that reliably identify patients having a 5 year overall survival as low as that associated with allografting.
1.5 Minimal residual disease The probability of CMR on imatinib therapy is very low in the first 2-3 years of treatment, but thereafter there is ongoing recruitment of patients to CMR so that around 40-50% of first-line imatinib–treated patients will have undetectable BCR-ABL mRNA after 5 years on treatment (Branford et al. 2007). Assuming a leukaemic burden of 1012 cells at diagnosis, CMR could be associated with a variable burden of residual disease ranging from zero to more than 106 CML cells (Figure 1.1). With increasing numbers of CML patients in this category better understanding of the biological and clinical relevance of imatinib-induced CMR is needed. Undetectable BCR-ABL mRNA is common after allogeneic stem cell transplantation for CML, in which setting it is associated with long-term disease-free survival (Cross et al. 1993; Radich et al. 1995; Mughal et al. 2001), and many of these patients are effectively cured. In the allograft setting it is possible that ongoing immune surveillance is essential to suppress a pool of residual CML cells. Lange and colleagues found that CMR induced by allogeneic stem cell transplantation was more stable than CMR induced by imatinib treatment (Lange et al. 2005). Similarly, for the minority of patients who achieve durable disease control on IFN therapy, ongoing immune surveillance might be important (Molldrem et al. 2000; Burchert et al. 2003).
10
Imatinib, on the other hand, is generally not considered to be an immunomodulatory therapy: it induces apoptosis and suppresses proliferation of CML cells (Druker et al. 1996). Evidence from kinetic modelling of RQ-PCR data (Michor et al. 2005; Roeder et al. 2006), and from in vitro studies of CML stem cells (Holyoake et al. 1999; Jiang et al. 2007) indicates that quiescent stem cells may be resistant to imatinib and retain proliferative potential. This has been supported by prior clinical experience of imatinib cessation in CMR: in most reported cases relapse has occurred rapidly (Michor et al. 2005; Rousselot et al. 2007). It is postulated that stem cells in the body exist in dynamic equilibrium with the potential for cells to move between quiescence and cell cycle. Over time a fraction of quiescent stem cells may again enter cell cycle and become susceptible to imatinib, resulting in a slow progressive depletion of residual disease. Mathematical modelling using BCR-ABL RQ-PCR data from the German cohort of the IRIS trial has supported this hypothesis (Roeder et al. 2006). If this proves to be correct, there is at least a possibility that ABL kinase inhibition could lead to cure of CML. Evidence from the population exposed to high level ionizing radiation in the bombing of Hiroshima and Nagasaki indicated that the average latency period for CML was around 5 to 7 years (Ichimaru et al. 1991). If imatinib treatment can turn back the biological clock of CML to the pre-clinical phase of disease, then perhaps we will not know whether any imatinib-treated patients are cured until after 5 years without therapy.
11
2 Patients, materials and methods
2.1 Patients Samples and relevant clinical data were obtained from 52 patients with chronic phase CML: 22 patients were enrolled in the ALLG CML8 study (imatinib cessation in CMR); 26 patients were enrolled in the ALLG CML9 study (newly-diagnosed CML commencing treatment with imatinib 600 mg daily); 4 additional patients were treated at the Royal Adelaide Hospital and received a variety of different treatments. Additional RNA samples were obtained from the Leukaemia Unit, Division of Molecular Pathology, IMVS. The clinical studies were approved by the ethics committees of the Royal Adelaide Hospital, and of other participating hospitals elsewhere in Australia and New Zealand. Written informed consent to the clinical intervention and laboratory studies was obtained for all study patients. For non-study patients the use of clinical diagnostic samples remaining after completion of clinical testing was permitted by the IMVS, on condition of anonymity, for the purposes of quality assurance and assay improvement.
2.2 Materials
2.2.1 Cell lines Five BCR-ABL positive cell lines (K562, KU812, KCL22, MEG-01, and MOLM-1) and one BCR-ABL-negative cell line (HeLa) were used. Cell lines were grown in RPMI-1640 culture medium (Sigma) in a humidified incubator at 37 C in 5% CO2.
2.2.2 Oligonucleotide primers and TaqMan® probes All primers and probes were ordered from Sigma. Except where otherwise indicated all oligonucleotides were designed for this study using Primer Express software (Applied Biosystems). The sequences of unpublished oligonucleotides are contained in Tables 2.1 to 2.3. Table 2.1 Primers used for the detection of BCR-ABL and ABL-BCR cDNA
Name Gene Orientation Sequence Start End
ABcDNAF ABL1 F GGCAGCAGCCTGGAAAAGTA 2444 2463
NestedR ABL1 R TCAAAGTCAGATGCTACTGGCC 142205 142226
ABcDNAR BCR R TCTTTGCTTTATTCACAAAATACCCA 126650 126675
NestedF BCR F CAGCAGAAGAAGTGTTTCAGAAGC 122238 123605*
All primers are shown 5’to 3’. F=forward; R=reverse.
* This primer spans the exon 12 –exon 13 junction.
12
Table 2.2 Primers used for the detection of genomic BCR-ABL and ABL-BCR
Name Gene Orientation Sequence Start End PreABLF ABL1 F TGGTGGTCTGTTTATGGTTGGTT -8247 -8225
ABL1BF ABL1 F TGCGACAGTTCCTTCCAATTCCA 2658 2680
ABL1CF ABL1 F GCGACAGTTCCTTCCAATTCCAC 2659 2681
ABLe8insR ABL1 F TCCTCGTTGATGAAGCTTTCATC 3190 3212
MOLM_ABLF ABL1 F AAATTCACTTTTGGGAGAGTTGGTAC 8125 8150
ABL1DF ABL1 F TTTTAGCCTTGGCACACCAGTCA 13008 13030
ABL1AF ABL1 F AAACCTTTTCCCCAGCTTGTGGT 20803 20825
ABL6CF ABL1 F TTGCTCAAAGCCCCAGTTTC 26856 26875
ABL2CF ABL1 F AGAGCGCCTGCTGTTTGATTTTC 33557 33579
ABL2BF ABL1 F GTTATGGGGAGGGCTGAAAAAGC 39617 39639
ABL2DF ABL1 F GGAGACCATGTCTCAGTGGTGGA 47832 47854
ABL2AF ABL1 F CCAAAGACAAGTTCCTCCACCCTT 53134 53157
ABL3CF ABL1 F ACATCGGAACACTGGTCTGGTCA 60334 60356
ABL3AF ABL1 F CCACTTTCAGATCCCCCAGTTTG 66775 66798
ABL3DF ABL1 F GCTGTGTGTTCCTGTGGAGCTGT 73540 73562
ABL3BF ABL1 F GGCCTACCTTTTTCCCAGGACAC 80303 80325
ABL_BTF2 ABL1 F GTTTCTTCAGCACTGCTTGATATGAC 83161 83186
ABL_BTF ABL1 F ATGCAACTCATTAAGAACTTTTTGGC 84340 84365
ABL4CF ABL1 F TGGACGCTACCTTGACAGAGTGTG 87926 87949
ABL4BF ABL1 F GGACCGAGTGTGGTAAAATGCAC 98131 98153
ABL4AF ABL1 F TTACAGCAGGAGGTGTTTCTGCT 107996 108018
ABL4DF ABL1 F TTTGTTGTTTCTTCGCCATCAGC 113999 114021
BM_ABLF ABL1 F TCCCAGTGAAAATAAGCAACTCTTC 119688 119712
ABL5CF ABL1 F AGCACAAGGCAAGCAAATATCTG 121259 121281
ABL5AF ABL1 F TTCCACAGCCTCAAACGTGAAAA 128524 128546
ABL5DF ABL1 F TTCTGGGGAAATTGCCTGTCATT 130737 130759
ABL5BF ABL1 F GGGGAATCTTGCTTCCTGACAGA 135537 135559
ABL1CR ABL1 R AAGCCACTGGCACACTTCATACG 3482 3504
ABL1BR ABL1 R GATCTGAAGCACAAGCACGGTTC 11042 11064
ABL1DR ABL1 R AGCCATAACCATTCTCCCAAGCA 20432 20454
AluR ABL1 R AAAAAAAAAAAAAAAAAAAAATC 28938 28960
ABL1AR ABL1 R AACACGGAGAAGTGGCAAACCTC 29260 29282
ABL2CR ABL1 R TGGACCAGGCTTTAGCCCTATCA 37595 37617
ABL2BR ABL1 R GGAACAGGAATCCTAATGGCCAAC 48439 48462
ABL2DR ABL1 R ACCAAAGCCTCCCCTTGTACCTC 53380 53402
ABL2AR ABL1 R TAAGGCAGTTACCAGGAAGCATTT 60194 60217
ABL3CR ABL1 R CCCGCAGTATCCCTCAAAATCAG 67948 67970
ABL3AR ABL1 R GGAAGGAGGAGGAAATGACAGCA 74801 74823
ABL3DR ABL1 R TCATGGAGAAAGGGGGAGAACTG 80611 80633
ABL3BR ABL1 R ACATGGGGCACAGTCTCTTGATG 86034 86056
ABL4CR ABL1 R ACATGAGGTTTGCAGAAGCACCA 94224 94246
ABL4BR ABL1 R AGGAATGGGTATGCTGGGGTTG 104639 104660
ABL4AR ABL1 R ACTGTTCACTAAGTGGCACTGTG 112889 112911
ABL4DR ABL1 R CCAGAAGAACACCCCAAGAAGGA 120904 120926
ABL5AR ABL1 R CATGATGTGCTTTGCAGGGTAGC 132146 132168
13
Name Gene Orientation Sequence Start End ABL5DR ABL1 R AAACATTCTGCCGCATCTGGATT 136105 136127
ABL5BR ABL1 R ATGGAATGACTCCCACCTGAAAG 143341 143363
BCRB2F BCR F ACTCGTGTGTGAAACTCCAGACT 123643 123665
RsaB2+ BCR F CTTTGGTTCAGAAGGAAGAGCTA 123805 123827
BCRB3F BCR F TGGGTTTCTGAATGTCATCGTCC 124439 124461
RsaB3+ BCR F GGGGAAACAGGGAGGTTGTTCA 124571 124592
BCR B3F1 BCR F CCCAGCTACTGGAGCTGTCAG 124935 124955
AluF BCR F AAAAAAAAAAAAAAAAAGTTCC 125286 125307
BCR B3F2 BCR F CCCTGTCTCTGGCTGCCT 125553 125570
BCR B3F3 BCR F CCTGCACCCCACGACTTC 126110 126127
RsaB2- BCR R CCCATCAAAAGTGCTAACAGGAA 123773 123795
RsaB3- BCR R CGATGAGTCCTTCCTGGGTGGAGA 124537 124560
BCRB3R2 BCR R GTGCACTGCTGACAGCCCT 124827 124845
BCRAluR BCR R TTTTTTTTTTTTTTTTGAGGCGG 125279 125301
MspB3- BCR R GACATAAGAGGAACAAGTTTGGGG 125778 125801
BCRB3R1 BCR R AAGCCCCTACGATGAGAAGGG 126319 126339
Intron15R BCR R CACGTCACCTACTGGCCCC 126855 126873
The Start and End nucleotide positions are relative to DQ145721 (ABL1) and U07000 (BCR). Table 2.3 Patient-specific BCR-ABL DNA primers and probes
Name Gene Orientation Sequence Start End CLF BCR F TCCACCGGATGGTTGATTTT 124323 124342
CLqF* BCR F GAAGCTGACCTCTTTGGTCTCTTG 124388 124411
CLqProbe spans break Probe TGATGAGTCATCAGCTTATAGTCAGTCTTGTTTTCTTACA x x
CLqR ABL1 R CCTAATGGCTTTGAAACTGTAACTTTATT 129046 129074
CLR ABL1 R CCCAAGACAATTTTTCTCCCAAT 129188 129210
CML8AJRF BCR F GGGAGGGCAGGCAGCTA 123736 123752
CML8AJRqF BCR F TGATGGGACTAGTGGACTTTGGT 123789 123811
CML8AJRqProbe spans break Probe CAGAAGGAAGAGCTATGCTTGTTCATATTCTCAGAACT x x
CML8AJRqR ABL1 R AGAGCCTATCTTAAAGTACCTCATTCTCA 45264 45292
CML8AJRR ABL1 R CCAGGAGTCAGAGGAGCTCTTC 45319 45340
CML8DLF BCR F CML8JJF 125300 125325
CML8DLqF BCR F GCGCTCACATTTACATTTCCTAAA 125448 125471
CML8DLqProbe spans break Probe TTCTTTAAACACGGATTATAGGCATGAGCCACC x x
CML8DLqR ABL1 R GGAAGAAAATGTGGAAATATCTACCAA 24400 24426
CML8DLR ABL1 R GATGGGACTGTAAACTAGAATGATGTCT 24429 24456
CML8EHF BCR F AGCCCAGCCCACTCTTCTC 126067 126085
CML8EHqF BCR F GCCTGGAGTCCCCTTTGC 126162 126179
CML8EHqProbe BCR Probe TAACTCTTTGCCCCATAGTACAGCG 126182 126206
CML8EHqR spans break R TGTGGTACGCGATTTCATCAG x x
CML8EHR ABL1 R CAGATTCCAACCAAGCAAAAGG -7332 -7311
CML8FBF BCR F CML8EHF 126067 126085
CML8FBqF BCR F CCTTAACTCTTTGCCCCATAGTACA 126179 126203
CML8FBqProbe spans break Probe CTGCTCTGATTGTTCCTTTTGGGTTTGTAATAGAA x x
CML8FBqR ABL1 R CAACAGATTTCTTGTTTCAATCAGTAATG 48499 48527
CML8FBR ABL1 R ACTTGGAAGGGTCTATGTTAAGATAACTG 48543 48571
*This primer contains a deviation from the BCR reference sequence, 124404A>G.
14
2.2.3 Non-proprietary reagents
2.2.3.1 Thaw medium Warm 500 mL Hanks’ balanced salt solution to 37 C, then add 25 mL newborn calf serum, 25 mL adenine citrate dextrose, and 5 mL hydroxyethylpiperazine-ethanesulphonic acid.
2.2.3.2 Back extraction buffer Add guanidine thiocyanate 118.2 g, sodium citrate 3.68 g, tris(hydroxymethyl)-aminomethane (TRIS) free base 30.29 g, and water to total volume 250 mL.
2.2.3.3 Standard diluent solution Prepare 100 μL TRIS-HCl buffered to pH 8.0. Add 3.7 mg ethylenediaminetetra-acetic acid (EDTA) and 5 mg salmon sperm DNA. Add water to a total volume of 100 mL and refrigerate until use.
2.3 Methods
2.3.1 Thawing of cryopreserved cells Thaw medium was pre-warmed to 37 C and an ampoule of cryopreserved cells was thawed at 37 C. The cell suspension was transferred to a small volume of thaw medium. Additional thaw medium was added drop by drop, agitating continuously. When 50 mL thaw medium was added the cell suspension was centrifuged at room temperature at 1200 rpm for 10 min. The supernatant was discarded and the cell pellet was resuspended in 50 mL thaw medium and again centrifuged as above. The cell pellet was resuspended in 2 mL thaw medium.
2.3.2 DNA extraction
2.3.2.1 From cell suspensions The High Pure DNA extraction kit (Roche) was used. A cell suspension was prepared with 2 x106 cells in a volume of 200 μL. Proteinase K 40 μL and binding buffer 200 μL were added to the cell suspension. The mix was shaken vigorously and then incubated at 70 C for at least 30 min. Isopropanol 100 μL was added, and the mixture was transferred to the silica column. The column was centrifuged at 13500 rpm for 1 min and the flow-through discarded. The column was washed once with inhibitor removal buffer and twice with wash buffer. DNA was eluted in 100 μL elution buffer after incubation at 70 C for 5 min. The DNA yield determined by spectrophotometry was around 10 μg from 2 x 106 cells.
2.3.2.2 From Trizol® preparations After processing of Trizol® preparations for the extraction of RNA (see 1.3.2.1) the remaining interphase and aqueous phase were stored at 4 C until DNA extraction. While the aqueous phase contains mostly RNA, it may also contain some DNA, so the remnant aqueous phase was not removed prior to DNA extraction. Back extraction buffer 750 μL was added and the mixture was shaken vigorously by hand for 3 min, and then centrifuged at maximum speed for 30 min at room temperature. The upper aqueous phase was collected and added to 600 μL isopropanol. The aqueous mixture was incubated at room temperature for 5 min, and then centrifuged at maximum speed for 15 min at 4 C. A DNA pellet was identified, the supernatant was discarded, and the pellet was washed with 75% ethanol. The ethanol was carefully removed after centrifugation, and the pellet was air dried at 37 C to remove remaining traces of ethanol. The dry pellet was suspended in 100-200 μL TRIS-EDTA (TE) buffer, depending on the size of the pellet.
15
2.3.2.3 From fixed slides The High Pure DNA extraction kit was used. DNA was extracted from fixed blood and bone marrow slides prepared for morphological assessment. Where necessary the cover slip was removed by soaking for 1-3 days in organic solvent. A drop of tissue lysis buffer was placed on the slide and a pipette tip was used as a scraper to remove the fixed cells from the slide. The suspension of cells in lysis buffer was aspirated and transferred to an Eppendorf tube. The procedure was repeated until 200 μL tissue lysis buffer was used to enable collection of as much cellular material as possible. Proteinase K 40 μL was added and the mixture was incubated at 55 C for at least one hour. Binding buffer 200 μL was added and the mixture was incubated for at least 10 min at 70C. Isopropanol 100 μL was added and any insoluble material was removed. The remaining mixture was transferred to a silica extraction column and DNA was bound and eluted, as described in 2.3.1.1.
2.3.3 RNA extraction
2.3.3.1 From cells Blood or bone marrow collected in EDTA anticoagulant was treated with ammonium chloride to lyse red cells and the leukocytes were centrifuged to give a pellet. Trizol® solution (Invitrogen) was added at 1.6 mL per 10 mL whole blood. The mixture was drawn up and down through a blunt needle 6-10 times to shear DNA and to help break up any remaining white cell pellet. Additional Trizol® was added, if necessary, to ensure that the white cells were fully dissolved. The mixture was usually then frozen at –70 C for later extraction. To extract RNA from the Trizol® preparation, 350 μL chloroform was added and the mixture was shaken vigorously by hand for 15 s. The mixture was chilled in ice for 3 min and then centrifuged at 13000 rpm to separate the 3 layers. The upper, aqueous, phase contains mostly RNA, and the interphase contains mostly DNA. A 350 μL aliquot of the aqueous phase was collected and an equal volume of cold isopropanol was added. The mixture was inspected for strands of contaminating DNA, and these were removed, if present. The mixture was chilled on ice for 10 min and then centrifuged at 13000 rpm for 10 min to yield an RNA pellet. The pellet was identified and the supernatant discarded. The pellet was washed with 75% ethanol and then dried at room temperature to ensure that no contaminating ethanol remained. Ribonuclease-free water (treated with diethylpyrocarbonate) was added (20-40 μL, depending on the size of the RNA pellet) and the RNA concentration was determined by spectrophotometry.
2.3.3.2 From plasma Blood was collected in EDTA anticoagulant and centrifuged at 1600 g for 10 min. For each 1 mL plasma 1.25 mL Trizol LS® was added. Liquid Strength Trizol® is a formulation of the reagent with a higher concentration to compensate for dilution in liquid samples. The extraction procedure as far as collection of the RNA-containing aqueous phase was the same as for cell samples, with the volumes of reagent adjusted to ensure the same proportion of reagents as in the cell method. The volume of aqueous phase obtained from plasma is larger than from cell samples, but the RNA concentration is very low, and no visible RNA pellet is formed. Consequently, the entire volume of aqueous phase was loaded in a single RNeasy (Qiagen) silica column, according to the manufacturer’s specifications, and eluted in 20 μL ribonuclease-free water.
2.3.4 Spectrophotometry A NanoDrop 2000 spectrophotometer (Thermo Scientific) was used according to the manufacturer’s recommendations. A blank reading was taken using the diluent solution in which the nucleic acid was suspended (usually water or elution buffer). The nucleic acid was quantified using the appropriate instrument settings for DNA or RNA. For quantification of single stranded DNA (PCR primers and TaqMan® probes) a correction factor of x 33/50 was
16
applied to account for the difference in extinction coefficient between single-stranded and double-stranded DNA.
2.3.5 Restriction enzyme digestion DNA 2.5-5.0 μg was suspended in a total volume of 50 μL 1x NE buffer with 10 U RsaI (Rhodopseudomonas sphaeroides) restriction enzyme (New England Biolabs) and incubated overnight at 37 C. Digestion was terminated by incubation at 70 C for 10 min. The digested DNA was purified by the column method (2.3.6.1).
2.3.6 Purification of nucleic acids
2.3.6.1 Column method UltraClean DNA columns and reagents (MoBio) were used. Five volumes of SpinBind buffer were added to one volume of PCR products. The mixture was transferred to a silica column and centrifuged. The column was washed with SpinClean buffer and the DNA was eluted in 30 μL elution buffer.
2.3.6.2 Gel excision method When a PCR product could not be adequately purified by the column method the QiaQuick gel extraction column and reagents (Qiagen) were used. The PCR product was resolved in agarose gel of the appropriate concentration, according to the size of the product. The duration of electrophoresis was increased to maximize the separation of bands. The gel was stained with ethidium bromide and examined under UV light at low wattage for a short time to minimize DNA damage. The target band was excised from the gel with a scalpel blade and weighed. 3 μL/mg Buffer QG was added and the gel was incubated at 50C until dissolved. 1 μL/mg isopropanol was added and the mixture was transferred to a column and centrifuged. The column was washed once with Buffer QG and once with Buffer PE. DNA was eluted in 30 μL elution buffer.
2.3.6.3 Isopropanol precipitation method Four volumes of 75% isopropanol were added to one volume of PCR products. The mixture was incubated at room temperature for 15 min, and then centrifuged at maximum speed for 20 min. The supernatant was discarded and the pellet was washed with 75% isopropanol. After centrifugation the isopropanol was removed carefully and the pellet was air-dried. The pellet was suspended in water.
2.3.7 DNA polymerase chain reaction All PCR reaction mixes were prepared in a dedicated clean room free of nucleic acid templates. DNA, RNA, and cDNA were added in a UV cabinet in a dedicated room free of PCR amplicons. PCR products used in nested reactions were added in a UV cabinet in a general laboratory area.
2.3.7.1 Standard DNA PCR AmpliTaq Gold® PCR reagents (Applied Biosystems) were used. Genomic DNA was amplified in a reaction mix containing 1x AmpliTaq buffer, 1.25 U TaqGold (Thermus aquaticus) DNA polymerase, 200 μM dNTPs, and 200 nM forward and reverse primers. The thermal cycling conditions were: 95 C for 10 min; 40 cycles of 94 C for 30 s, 59 C for 30 s, 72 C for 30 s; 72 C for 10 min. For nested PCR the number of cycles of amplification was modified, e.g. ‘Taq 30’ was a modification of the above method with 30 instead of 40 cycles of PCR.
17
2.3.7.2 Time-release PCR Time-release PCR was a modification of the standard DNA PCR using an identical reaction mix, but altered thermal cycling conditions: 95 C for 1 min; 60 cycles of 94 C for 45 s, 58 C for 30 s, 72 C for 30 s; 72 C for 10 min.
2.3.7.3 Long range PCR The Expand Long Template PCR kit (Roche) was used. A 20 ng aliquot of gDNA was amplified in a reaction mix containing 1x Buffer 2, 1U Thermus thermophilus DNA polymerase mix, 500 μM dNTPs, and 400 nM forward and reverse primers. Multiplex reactions (either one forward primer and 5 reverse primers, or one reverse primer and five forward primers) were performed with each of the primers at 400 nM. The thermal cycling conditions were: 95 C for 2 min; 10 cycles of 94 C for 20 s, 66 C for 30s, 68 C for 10 min; 25 cycles of 94 C for 20s, 66 C for 40s, 68 C for 10 min +10 s increment each cycle; 68 C for 9 min. The PCR products were resolved by electrophoresis in 0.6% agarose gel.
2.3.7.4 Inverse PCR DNA digested by a restriction enzyme was ligated overnight at 14C in a total reaction volume of 500 μL containing 500 ng DNA, 1x T4 DNA ligase buffer and 5U T4 DNA ligase (Invitrogen). The ligated DNA was purified using the column method (2.3.6.1). Inverse PCR was performed using 4 μL of the ligated DNA in a total volume of 50 μL containing 1x Pfu buffer, 250 μM dNTPs, 250 nM forward and reverse primers, and 1.25 U PfuTurbo (Pyrococcus furiosus) DNA polymerase (Stratagene). The thermal cycling conditions were: 96 C for 1 min; 64 C for 2 min; 72 C for 2 min; 35 cycles of 100 C for 10 s, 97 C for 20 s, 66 C for 30 s, 68 C for 10 min; 25 cycles of 94 C for 20 s, 62 C for 25 s, 64 C for 25 s, 78 C for 10 s, 74 C for 50 s, 72 C for 1 min; 72 C for 10 min. The PCR products were resolved by electrophoresis in 2% agarose gel.
2.3.8 Reverse transcriptase PCR The reaction mix contained 25 μM random oligonucleotide primers (hexamer or pentadecamer), 500 μM of each deoxynucleotide triphosphate, 1x First Strand buffer and 400 U SuperScriptII® (Moloney murine leukaemia virus) reverse transcriptase (Invitrogen) in a total volume of 20 μL. A fixed 2 μg amount of RNA was used in RQ-PCR, but in plasma RNA the amount of RNA was variable, and much lower than in RNA extracted from cells. The RNA and primers were added and annealed at 70 C for 10 min. The rest of the reaction mix (except the enzyme) was added and incubated at 42 C for 2 min. The reaction mix was placed on ice, and the enzyme was added. The final reaction mix was then incubated at 25 C for 10 min, 42 C for 50 min and 70 C for 15 min. The cDNA products were frozen at –20 C until analysis, or at –70 C for long-term storage.
2.3.9 Agarose gel electrophoresis Agarose in TE buffer was prepared at two concentrations: 0.6% for PCR products with a predicted length >1 kB; 2% for PCR products with a predicted length ≤1 kb. The appropriate amount of PCR grade agarose (1.2 g or 4.0 g, respectively) was dissolved in 200 mL TE buffer. Agarose gels were allowed to set at room temperature. Electrophoresis was performed with 5 μL DNA in 2 μL loading buffer at 65-80 V or 100-120 V, respectively. The gel was stained with ethidium bromide and photographed under UV light.
2.3.10 Real-time fluorescence PCR RQ-PCR was performed using the ABI Prism 7000 Sequence Detection System (Applied Biosystems) and associated software. DNA Q-PCR and nested Q-PCR were performed using the ABI Prism 7500 thermal cycler. The two instruments gave very similar results, and for practical reasons the newer machine (7500) was used predominantly for research assays. TaqMan® fluorescent oligonucleotide probes were used. The oligonucleotide probe
18
incorporates a fluorescence reporter and quencher. During the extension phase of PCR, when the probe is bound to its complementary sequence in the sample, the nuclease activity of AmpliTaq DNA polymerase cleaves the probe, separating the quencher and reporter so that fluorescence can be emitted. The PCR cycle number at which fluorescence intensity crosses the operator-determined threshold (Ct) is proportional to the number of copies of the target in the starting material. The background fluorescence was determined from cycle 3 to cycle 15, with few samples having a Ct of <18. In nested Q-PCR the amount of starting material was enormously increased, and the Ct was correspondingly early, so the baseline fluorescence was set from cycle 1 to cycle 2. This meant that virtually no background fluorescence was measured, and to compensate it was necessary to increase the fluorescence threshold at which the Ct was determined. A true positive sample showed linear amplification. All amplification curves were inspected visually. A standard curve was run with each Q-PCR, and analysed using the software accompanying the thermal cycler. Each real-time PCR contained 2.5 μL sample in a total volume of 25 μL with 1x Universal Master Mix (Applied Biosystems). The forward and reverse primers were used at 200 nM, and the probe concentration varied from 100-300 nM. The manufacturer’s recommendation was to use the probe at a concentration of 300 nM. Due to the cost of the probes, we performed optimization studies for probes that were used frequently, and showed that lower concentrations could be used. The thermal cycling conditions were: 50 C for 2 min; 95 C for 10 min; 40 cycles of 95 C for 15s and 60 C for 1 min. Fluorescence was measured during the 60 C extension phase of each PCR cycle.
2.3.11 Dideoxynucleotide sequencing Sanger sequencing was performed using BigDye Terminator reagents (Applied Biosystems). The sequencing primer was used at a concentration of 225 nM. The sequencing product was purified by isopropanol precipitation and the sample was sent to the IMVS Division of Molecular Pathology Sequencing Centre for analysis of the chromatograph. The chromatograph was viewed using Mutation Surveyor software.
2.3.12 Statistical methods Excel with Analyze-It software was used for graphing, correlation, and bias analysis. GraphPad Prism software was used for graphing and for Kaplan-Meier survival analysis. SigmaStat software was used for other statistical tests. A p-value of <0.05 was considered to be statistically significant.
19
3 Optimization of RT-PCR methods for the detection of BCR-ABL mRNA
3.1 Introduction Real-time reverse transcriptase quantitative PCR for BCR-ABL (RQ-PCR) is the method routinely used to quantify MRD in CML patients. Variability in the results of RQ-PCR may arise in any of the three component steps of the assay: RNA extraction, reverse transcription, and real-time PCR. There may be potential to improve the sensitive detection of MRD by modifying those steps of the assay that contribute the greatest variability: in day-to-day practice it is observed that RNA extraction and RT-PCR are the most variable. Real-time Q-PCR shows less variability than RT-PCR (Stahlberg et al. 2004). Alternatively, it might be possible to improve the detection of MRD by using established methods to detect BCR-ABL mRNA in patient samples other than unselected blood and bone marrow. For instance, several methods have been described for the detection of cancer-associated mRNA in the plasma of patients with solid tumours and haematological malignancies (Silva et al. 2002; El-Hefnawy et al. 2004; Ma et al. 2005). This chapter describes the assessment of a range of strategies, each employing a different variation of RT-PCR, with the aim of improving the sensitive detection of low levels of BCR-ABL mRNA. The most promising of these strategies were selected for more detailed assessment.
3.1.1 Removal of PCR inhibitors A potential cause of variability in RQ-PCR is the presence of PCR inhibitors. The co-extraction of endogenous (e.g. haemoglobin breakdown products, immunoglobulins, glycosaminoglycans) or exogenous substances (e.g. heparin anticoagulant, phenol) can inhibit downstream PCR (Beutler et al. 1990; Pardoe and Michalak 1995; Witt and Kemper 1999). All routine RQ-PCR samples in our laboratory are obtained in the anticoagulant solution, ethylenediaminetetraacetic acid (EDTA), to minimize the risk of heparin contamination. Silica-based purification of nucleic acids effectively removes most such inhibitory materials (Witt and Kemper 1999). The RT-PCR product contains not only cDNA but also RNA and any contaminants, as well as residual primers and spent reverse transcriptase enzyme. Reverse transcriptase enzyme added to cDNA resulted in inhibition of TaqMan® real-time PCR, but only at a concentration of 10 U/µL (Liss 2002). In our BCR-ABL RQ-PCR method the concentration of the enzyme carried over into the real-time PCR is 2 U/µL, significantly less than the concentration reported to cause significant inhibition. Dithiothreitol (DTT) is a reducing agent that is commonly added to RT-PCR to protect the enzyme and its nucleic acid template from oxidative damage, but DTT has been reported to reduce the measured yield of transcripts in RQ-PCR (Xiang et al. 2001; Varga and James 2006). In a study of RQ-PCR optimization there was a approximately a 2-fold increase in transcript copy number when 10 mM DTT was omitted from the RT-PCR (Lekanne Deprez et al. 2002). Dilution of the cDNA product was used to demonstrate that inhibition of the Q-PCR step of the assay did not account for the observed difference, suggesting that DTT primarily interferes with reverse transcription. Using SYBR green, a DNA intercalating fluorescence dye, for real-time PCR there was high background fluorescence and the slope of the amplification curve was reduced, indicating that DTT may also interfere with the real-time PCR step.
20
3.1.1.1 Hypotheses Purification of cDNA prior to real-time PCR may increase the sensitivity of RQ-PCR. Omission of DTT from the reverse transcription reaction may increase the sensitivity of RQ-PCR.
3.1.2 Optimized priming of reverse transcription The routine RQ-PCR assay for BCR-ABL uses random hexamer (R6) oligonucleotide primers for reverse transcription. This is a widely used method, adopted and optimized by the EAC collaborative group for the molecular monitoring of haematological malignancies (Beillard et al. 2003; Gabert et al. 2003). The use of a random primer has the advantage that all transcripts present are amplified, thus enabling quantification of both target genes (in this case, BCR-ABL) and control genes (in this case, BCR). Other recommended control genes for BCR-ABL RQ-PCR include ABL1 and GUSB. Random hexamers might be expected to prime all transcripts with similar efficiency, as all possible sequences should be represented with similar frequency. The EAC compared the efficiency of longer, random nonamer (R9) primers with R6 primers and found no significant difference (Beillard et al. 2003). However, a more recent study by Stangegaard and colleagues examined the priming of RT-PCR using random oligonucleotides of varying length up to 21-mer and found that the cDNA yield was greatest using a pentadecamer primer (R15) (Stangegaard et al. 2006).
3.1.2.1 Hypothesis The use of random pentadecamer primers for reverse transcription may increase the sensitivity of RQ-PCR for BCR-ABL.
3.1.3 RQ-PCR using plasma RNA
3.1.3.1 Plasma RNA The presence of circulating DNA and RNA in the cell-free fraction of peripheral blood has been recognized for decades (Kamm and Smith 1972). More recently there has been interest in exploiting this phenomenon for the assessment of disease states. Increased levels of circulating nucleic acids are found in a wide range of conditions, the best studied being cancer and pregnancy (Lo and Chiu 2004). Circulating tumour RNA is contained within membrane-bound vesicles, thought to be shed from tumour cells undergoing apoptosis (Halicka et al. 2000; Hasselmann et al. 2001; Ng et al. 2002; El-Hefnawy et al. 2004). The membrane vesicle protects the RNA from degradation by plasma ribonucleases. To date there have been only two studies of plasma RNA in CML, both from the same group. Ma and colleagues sequenced the ABL1 kinase domain of mRNA extracted from the plasma of CML patients on imatinib treatment. In most cases the results from cellular RNA and plasma RNA were concordant, but in several patients kinase domain mutations were identified in plasma, but not in peripheral blood cells (Ma et al. 2005). In a subsequent publication it was reported that a proportion of CML patients in CMR had detectable BCR-ABL mRNA in their plasma (Ma et al. 2007).
3.1.3.2 Hypothesis BCR-ABL mRNA may be detected in the plasma of CML patients in a complete molecular response defined by RQ-PCR on peripheral blood cells.
3.2 Omission of dithiothreitol from RT-PCR Two reverse transcription reactions, using the same template RNA, were performed in the same RT-PCR run, with and without the addition of 10 mM DTT to the reaction mix. A total of 18 RNA samples were used (16 CML patient samples, and 2 BCR-ABL cell line samples). Q-PCR was performed according to the standard procedure. Replicates (independent RT and Q-PCR; n=2 to 6) were performed and the mean values were compared. BCR transcript copy numbers were parametric and a paired t-test was used, while BCR-ABL values were non-parametric and a signed ranks test was used.
3.2.1 Omission of DTT did not increase BCR-ABL copy number The mean number of BCR transcripts was unchanged in the absence of DTT (523,000 vs 495,000; n=18; p=0.30). Similarly, the median BCR-ABL transcript numbers showed no difference in the absence of DTT (e14a2 28,100 vs 24,000; n=17; p=0.55; and e13a2 10,300 vs 10,700; n=9; p=0.30). The effect of omitting DTT was similar in samples with high and low copy numbers of BCR-ABL transcripts (Figure 3.1).
95% limits of agreement
95% limits of agreement
95% limits of agreement
95% limits of agreement
-0.4
-0.3
-0.2
-0.1
0
0.1
0.2
0.3
0.4
1 2 3 4 5 6 7
-0.4
-0.3
-0.2
-0.1
0
0.1
0.2
0.3
0.4
1 2 3 4 5 6 7
Diff
eren
ce b
etw
een
met
hods
(log
10)
Mean of methods (log10)
BCR
BCR-ABL
Actual bias
Actual bias
Figure 3.1 The omission of dithithreitol from the RT-PCR mix did not increase BCR-ABL transcript copy numbersAssay agreement for BCR and BCR-ABL transcripts was measured with and without DTT in RT-PCR. The average change in copy number without DTT was determined from the bias between methods (dotted line). For BCR the change was +8%, and for BCR-ABL +13%.
21
3.3 Purification of cDNA Complementary DNA was prepared from CML patient RNA following the usual RT-PCR method. Column purification was performed as described in Chapter 2. The purified eluate was used in real-time PCR following the usual procedure. Twenty-four cDNA samples were tested before and after column purification. There was no significant difference in the number of BCR control gene transcripts after column purification (1,007,000 vs 898,000), or in the number of e13a2 BCR-ABL transcripts (191 vs 189). There was a >10-fold increase in the median e14a2 BCR-ABL transcript number (3566 vs 340; signed rank test; p=0.33). The increased e14a2 transcripts were seen exclusively in those samples with fewer than 10,000 copies prior to purification. The inconsistent finding of increased e14a2 transcripts after purification was investigated further. A single cDNA sample (pooled from BCR-ABL cell line cDNA samples) was serially diluted in water. Ten-fold serial dilutions were prepared down to a dilution of 1/1,000 (3 log) and 5-fold dilutions down to 6.5 log. BCR and e13a2 BCR-ABL transcript numbers were slightly lower after purification. The detection limit of e13a2 BCR-ABL without purification was 5.0 log, and 4.5 log in purified DNA. In contrast, e14a2 BCR-ABL was non-linear below the 4 log dilution and was detectable at the lowest dilution of 6.5 log (Figure 3.2 a-c). The experiment
-7-6-5-4-3-2-10
-7-6-5-4-3-2-10
-7-6-5-4-3-2-10
-7-6-5-4-3-2-10
Log10 dilution of cell line cDNA
Log 1
0tra
nscr
ipt c
opy
num
ber
a.
BCR
b. e13a2
c. e14a2
d. e14a2
7
6
5
4
3
2
1
7
6
5
4
3
2
1
7
6
5
4
3
2
1
7
6
5
4
3
2
1
0
Figure 3.2 Purification of serial dilutions of cell line cDNAThe measured transcript numbers of BCR and e13a2 BCR-ABL were lower after purification (triangles) than before (squares), resulting in less sensitive detection of BCR-ABL (a-b). Column purification resulted in contamination of the cDNA with e14a2 BCR-ABL, shown by the non-linear transcript numbers at low dilutions (c). This was not seen when the experiment was repeated using fresh reagents in a clean work area (d).
22
23
was repeated in a different laboratory work area, where the column purification method had not previously been performed, using fresh, unopened stocks of purification buffers. In the repeat serial dilution experiment e14a2 BCR-ABL gave linear results, and the limit of detection was 4.5 log (Figure 3.2 d), as for e13a2. These results confirmed that the increase in e14a2 transcripts was due to contamination.
3.4 Random pentadecamer primers for RT-PCR
3.4.1 Experimental approach RQ-PCR for the BCR-ABL transcripts, e13a2 and e14a2; and the BCR control gene was performed as described in Chapter 2. Total RNA was isolated from Trizol® preparations of blood or bone marrow leukocytes, and 2 µg RNA and 400 U Superscript II® reverse transcriptase were added to two 20µL RT reactions containing either random hexamer (R6) or random pentadecamer (R15) primers at the same final concentration. The alternative control genes, GUSB and ABL1 were quantified in selected samples (Beillard et al. 2003; Gabert et al. 2003). Calculated assay sensitivity was determined based on the EAC formula (Gabert et al. 2003; Branford et al. 2007). Nested PCR using published primers (Cross et al. 1993) was performed on samples with sufficient cDNA. Archived RNA samples were obtained from 105 CML patients and from 10 individuals with BCR-ABL-negative haematological disorders (negative controls). In addition, we used 91 routine duplicate analyses (independent RNA extraction, RT and Q-PCR) performed in our laboratory using the standard R6 method to estimate the measurement error inherent in the assay. Agreement or bias between methods was compared according to Bland and Altman (Bland and Altman 1986).
3.4.1.1 R15 primer concentration The optimal concentration of R15 primers was determined by comparing the transcript copy numbers of BCR-ABL and BCR at 5, 25, and 125 µM. The optimal concentration was 25 µM, which is the same as the optimal concentration of R6 primers.
3.4.1.2 Volume of cDNA used in real-time PCR It is the routine practice of the laboratory to increase the volume of patient cDNA used in the real-time PCR if that patient has had undetectable BCR-ABL by RQ-PCR on a previous occasion. In-house assay validation several years ago indicated an improvement in sensitivity using 4.0 μL cDNA in a total reaction volume of 25 μL. Twenty RNA samples were reverse transcribed with R15 primers and Q-PCR was performed twice using either 2.5 or 4.0 μL cDNA. The mean BCR transcript copy number was 1,019,000 using 2.5 μL cDNA and 1,111,000 using 4.0 μL (n=20; p=0.43). In 5 selected samples with low levels of BCR-ABL (<100 transcripts) there was no difference in transcript copy number. All subsequent experiments used 2.5 μL cDNA.
3.4.2 Increased BCR-ABL and BCR transcript copy numbers using R15 primers
3.4.2.1 BCR-ABL copy number Of the 105 RNA samples of CML patients used for this study 68 had detectable BCR-ABL when analysed using both R6 and R15 primers, and the transcript numbers were compared. The bias between methods was calculated and expressed as fold-difference (Figure 3.3). The average increase in BCR-ABL copy number using R15 primers was 1.7-fold for e13a2 and
1.9-fold for e14a2. This increase was not explicable by inherent assay variability: the bias between 91 R6 duplicates was 0.9-fold for both BCR-ABL transcripts.
Figure 3.3 BCR and BCR-ABL transcript copy numbers increased using R15 primers in patient samplesThe average increase in BCR and BCR-ABL transcripts was around 2-fold using R15 instead of R6 primers. If there were no difference between the R6 and R15 measurements the fold change would be 1.0. The change observed in the duplicate R6 samples is considered within the assay variability, whereas the change with R15 primers is considered a true change. DUP = comparison of transcript number between first and second R6 duplicates; R15 = comparison of transcript number between R15 and R6 assays
3.4.2.2 BCR control gene copy number The BCR control gene copy number was measured in 105 CML patient samples using R6 and R15 primers. 103/105 samples had higher BCR copy numbers with R15 primers. The BCR copy number was >1.5-fold higher in 88 samples (84%) and >2-fold higher in 64 samples (61%). From the bias between the two methods the average change in copy number was a 2.3-fold increase using R15 primers (Figure 3.3). The observed increase was significantly greater than the bias in 91 duplicate R6 measurements of BCR, which was 0.9-fold. In our assay a BCR copy number of 400,000 indicates an EAC calculated sensitivity of 4.5 log below the standardized baseline (Branford et al. 2007). The median BCR copy number using R15 primers was 1,120,000 vs 494,000 using R6 primers; R15 primers increased median calculated sensitivity from 4.6 log to 5.0 log. Using R6 primers 42 of 105 samples (40%) had
24
control gene values below the sensitivity recommended for MRD analysis (<4.5 log) whereas using R15 primers 15 of 105 (14%) were deemed of inadequate sensitivity (Figure 3.4).
Figure 3.4 Calculated sensitivity using R15 and R6 primersThe median calculated sensitivity increased from 4.6 log below standardized baseline using R6 primers to 5.0 log using R15 primers (p<0.01). The number of samples deemed inadequate for MRD analysis was reduced by the use of R15 primers. CCR=complete cytogenetic response; MMR=major molecular response
3.4.2.3 BCR-ABL/BCR ratio The BCR-ABL RQ-PCR result is reported as a BCR-ABL/BCR ratio, and for the longitudinal monitoring of response to treatment it is important that a change in laboratory procedure should not affect interpretation of serial follow-up results. Assay agreement for ratio results using R6 and R15 primers was assessed using the method of Bland and Altman. (Figure 3.5) There was a mean bias of -0.1 log, indicating that the R15 ratio under-estimates the R6 ratio by approximately 20% (dotted line). This is consistent with the observation that the average increase in BCR is greater than the increase in BCR-ABL. When the assay agreement comparison was performed separately for e14a2 and for e13a2 BCR-ABL the bias was -24% and -13%, respectively. There is currently no consensus regarding what constitutes acceptable
25
method difference for the measurement of BCR-ABL. The 95% limits of agreement of values for the R6 and R15 assays (broken lines) were within 2.5-fold (± 0.4 log). This is comparable with the limit of variability of our established RQ-PCR assay, which is up to 2-fold (± 0.3 log) for values down to 3 logs below the standardized baseline BCR-ABL level (Branford et al. 2004).
Figure 3.5 BCR-ABL/BCR ratio agreement using R15 and R6 primersAssay agreement for reported BCR-ABL/BCR ratio results using R6 and R15 primers was assessed. The average bias (dotted line) was -20% (-24% for e14a2 and -13% for e13a2) and the 95% limits of agreement of values (broken lines) for the R6 and R15 assays were within 2.5-fold. This is comparable with the limit of variability of our established RQ-PCR assay, which is up to 2.0-fold.
3.4.3 RQ-PCR detection of BCR-ABL mRNA in patient samples In order to confirm that increased BCR-ABL transcript number resulted in a clinically useful difference in patient samples we selected 19 CML patients likely to have residual BCR-ABL close to the threshold of detection (undetectable BCR-ABL in index sample, but ≥1 positive RQ-PCR result within 6 months). 18/19 patients were treated with ABL kinase inhibitors; one patient with interferon-α. Archived RNA samples were re-tested with both R6 and R15 RQ-PCR in duplicate (two independent RTs with each primer and two Q-PCRs). For discordant
26
results a third RT was performed on the same sample and a consensus result determined, following the usual procedure of the laboratory. 9/19 samples had detectable BCR-ABL only with R15 primers; four with both R6 and R15; and one with R6 primers only. Thus, 13/19 samples (68%) that were previously reported as negative using our standard RQ-PCR method had measurable BCR-ABL using R15 primers. 5/19 samples (26%) were also positive using R6 primers, indicating that sensitivity is improved by repeated analysis. Ten negative control samples were tested in duplicate with R15 primers: BCR-ABL was not detected.
3.4.4 Alternative control genes Whereas our laboratory uses the BCR control gene for BCR-ABL RQ-PCR many laboratories use other appropriate control genes. For our findings to have broader applicability it was desirable to demonstrate that R15 primers result in increased transcript copy numbers of alternative control genes. We did not have an established reference material for absolute quantification of GUSB and ABL1 transcripts, but the fold-change in transcript copy number was calculated using the difference in real-time PCR threshold cycle number (ΔCt) between R6 and R15 primers, and the slope of the relevant standard curve. When transcript copy number (logarithmic x axis) is plotted against Ct (linear y axis) the fold-change in transcript copy number is described by the formula 10ΔCt/slope. When real-time PCR is performed with 100% efficiency (slope approximately 3.3) a ΔCt of 1 is equivalent to a 2-fold change in copy number. We prepared a cDNA standard, pooled from the cDNA of several patients. Ten-fold serial dilutions of the standard were assayed in triplicate for ABL1 and GUSB to generate standard curves. Using R15 primers the average fold-increase was 1.5 for GUSB, and for ABL1 1.3. BCR was quantified in the same 30 samples and showed an average 2.4-fold increase with R15 primers, confirming that this subset of samples gave comparable results to our overall data set. There was greater variability in the effect of R15 primers on the GUSB and ABL1 genes, indicated by wider confidence intervals and 20-30% of samples showing no increase in transcript number. (Figure 3.6)
BCR GUSB ABL1
Figure 3.6 ABL1 and GUSB control gene copy numbers increased using R15 primersABL1 and GUSB were quantified in a subset of 30 patient samples. The mean bias is indicated by the dotted line, and the broken lines indicate the 95% limits of agreement. The average fold-increase for GUSB was 1.5; and for ABL1 1.3. BCR was quantified in the same 30 samples and showed an average 2.4-fold increase with R15 primers, confirming that this subset of samples gave comparable results to our overall data set. There was greater variability in the effect of R15 primers on the GUSB and ABL1 genes, indicated by wider confidence intervals.
27
28
3.4.5 Nested RT-PCR detection of BCR-ABL mRNA in patient samples Nested RT-PCR is not a routine part of our laboratory testing for BCR-ABL, having been found not to improve the limit of detection in comparison with RQ-PCR in this laboratory (S Branford, unpublished data). Nevertheless, in many laboratories around the world RQ-PCR is performed first, and nested RT-PCR is used if RQ-PCR is negative. In order to assess whether R15 primers confer an improvement in sensitivity using a nested RT-PCR approach the commonly used nested RT-PCR method was established using the e13a2 cell line MOLM-1, and the e14a2 cell line, K562. The cDNA was amplified in a two round nested RT-PCR using published primers (Cross et al. 1993). Each round amplified 2.5 μL (cDNA or first round product) for 30 cycles. PCR products were separated by electrophoresis in 2% agarose gel, and stained with ethidium bromide. As described for RQ-PCR testing, a nested RT-PCR result required two concordant findings from 2-3 independent cDNA samples.
3.4.5.1 Limit of detection in cell line dilutions The nested RT-PCR results obtained in K562 using R6 primers for RT were comparable with those originally published (Cross et al. 1993). A dilution of 1/105 was reliably detected, but a dilution of 1/106 was not detected in 4 replicates. No false positive results were observed in the negative control samples. These results indicate that the sensitivity of the nested PCR assay was comparable to the published method. The limit of detection of BCR-ABL in dilutions of MOLM-1 was identical to that in K562. When the experiment was repeated using R15 primers for RT-PCR BCR-ABL was detected in 1/4 of the K562 1/106 dilution samples, but not in MOLM-1. RQ-PCR was performed on the same cDNA used for nested PCR. In RQ-PCR BCR-ABL was reliably detected in the 1/105 dilutions of both K562 and MOLM-1. BCR-ABL was not detected in the 1/106 dilution using R6 primers, whereas using R15 primers BCR-ABL was detected in the 1/106 dilution in 4/9 K562 replicates vs 1/9 MOLM-1 replicates. There was no significant difference in sensitivity between RQ-PCR and nested RT-PCR, consistent with the previous analysis in this laboratory.
3.4.5.2 Detection of BCR-ABL mRNA in patient samples Nested RT-PCR was performed retrospectively on 85 stored cDNA samples from the 19 selected patients with BCR-ABL likely to be close to the limit of detection. On average each patient had 2-3 remaining R6 cDNA samples and 2-3 R15 cDNA samples available for nested RT-PCR (Table 3.1). For 13/19 patients there was sufficient remaining R6-primed cDNA to obtain a nested PCR result. RQ-PCR and nested PCR gave concordant results in 7 patients; BCR-ABL was detected only using RQ-PCR in 4 patients; and in 2 patients only using nested PCR. From the 6/19 patients who had an insufficient number of cDNA samples to complete testing there were 6 cDNA samples, and 3/6 samples had detectable BCR-ABL by nested RT-PCR. Using R6 primers 2/13 patients had detectable BCR-ABL using nested PCR versus 4/13 using RQ-PCR. For 13/19 patients there was sufficient remaining R15-primed cDNA to obtain a nested PCR result. RQ-PCR and nested PCR gave concordant results in 7 patients; BCR-ABL was detected only using RQ-PCR in 6 patients; and in no patients only using nested PCR. Among 6 patients with insufficient material to complete testing there were 11 cDNA samples, and 5/11 samples had detectable BCR-ABL by nested RT-PCR. Overall, using R15 primers 3/13 patients had detectable BCR-ABL using nested PCR versus 9/13 using RQ-PCR. The rate of detection of BCR-ABL by nested RT-PCR was similar using R6 and R15 primers (2 vs 3 of 13 samples, respectively). In the small number of samples available for this analysis nested RT-PCR did not increase sensitivity for BCR-ABL beyond the level achieved by RQ-PCR in our laboratory.
29
Table 3.1 Nested RT-PCR for BCR-ABL mRNA
a. Random hexamer primers
Patient no. RQ-PCR result Nested PCR result Assay agreement
1 Neg Neg Concordant 2 Neg Neg Concordant 3 Neg Neg Concordant 4 Neg Neg Concordant 5 Neg Neg Concordant 6 Neg Neg Concordant 7 Neg Neg Concordant 8 Neg Pos Nested pos RQ-PCR neg 9 Neg Pos Nested pos RQ-PCR neg 10 Neg Insuff Not assessable 11 Neg Insuff Not assessable 12 Neg Insuff Not assessable 13 Neg Insuff Not assessable 14 Neg Insuff Not assessable 15 Pos Neg RQ-PCR pos Nested neg 16 Pos Neg RQ-PCR pos Nested neg 17 Pos Neg RQ-PCR pos Nested neg 18 Pos Neg RQ-PCR pos Nested neg 19 Pos Insuff Not assessable
b. Random pentadecamer primers
Patient no. RQ-PCR result Nested PCR result Assay agreement
1 Neg Neg Concordant 2 Neg Neg Concordant 3 Neg Neg Concordant 4 Pos Neg RQ-PCR pos Nested neg 5 Pos Neg RQ-PCR pos Nested neg 6 Neg Insuff Not assessable 7 Pos Insuff Not assessable 8 Pos Pos Concordant 9 Pos Pos Concordant 10 Neg Neg Concordant 11 Pos Neg RQ-PCR pos Nested neg 12 Pos Neg RQ-PCR pos Nested neg 13 Neg Insuff Not assessable 14 Pos Insuff Not assessable 15 Neg Insuff Not assessable 16 Pos Neg RQ-PCR pos Nested neg 17 Pos Neg RQ-PCR pos Nested neg 18 Pos Pos Concordant 19 Pos Insuff Not assessable Neg = negative; Pos = positive; Insuff = insufficient cDNA
30
3.5 Development of an optimized nested RT-PCR method for BCR-ABL
In the conventional nested RT-PCR method for the detection of BCR-ABL mRNA two rounds of PCR are performed using nested primers, which will amplify both e13a2 and e14a2 BCR-ABL. The simultaneous amplification of both BCR-ABL transcripts is convenient, but has the disadvantage that the e14a2 amplicon is relatively large, and the PCR may therefore be relatively inefficient in the two-thirds of CML patients who express e14a2 BCR-ABL. In order to improve the sensitive detection of BCR-ABL mRNA a novel assay was designed that amplified both e13a2 and e14a2 in the first round, with transcript-specific primers in the second round. The conventional nested RT-PCR method uses gel electrophoresis as the endpoint. If the second round PCR products are small a larger number of copies must be amplified to give a visible band in an ethidium bromide stained gel. The use of real-time fluorescence PCR for the second round should overcome this potential limitation. The risk of false positive results due to non-specific PCR products similar in size to the BCR-ABL amplicon is also avoided because a TaqMan® probe specific for either the e13a2 or e14a2 junction can be used.
3.5.1 Assay design The first round forward primer was located immediately upstream of the e13a2 RQ-PCR forward primer in BCR exon 13, and the reverse primer was located in ABL1 exon 2, immediately downstream of the exon 2 RQ-PCR reverse primer. The e13a2 and e14a2 second round primers and TaqMan® probes were those used in our standard RQ-PCR method. The conventional nested RT-PCR method used 5 µL cDNA in a total volume of 25 µL, but in the modified method that was used for the R15 primer comparison 2.5 µL cDNA (in a total volume of 25 µL) was used to be consistent with the cDNA volume used in RQ-PCR. Nested RT-PCR was performed using either 2.5 µL or 5 µL of cDNA (in a total PCR volume of 25 µL or 50 µL, respectively) to determine whether the cDNA volume affected the detection limit of the assay. The rate of detection of BCR-ABL in replicate nested RT-PCR assays using cDNA from serial dilutions of K562 was 1/4 using 2.5 µL and 1/4 using 5 µL. Similar results were obtained using cDNA from dilutions of MOLM-1 cells (1/4 using 2.5 µL vs 0/4 using 5 µL). The testing of a larger volume should reduce sampling error, so subsequent experiments were performed using 5 µL cDNA.
3.5.2 Positive control As most of the samples tested were expected not to contain detectable BCR-ABL it was necessary to include in each run a positive control cDNA to control for variation in PCR efficiency. If the number of BCR-ABL transcripts in the positive control sample is known, the Ct of this sample can be used to estimate the Ct at the lower limit of detection of the assay. For example, the low positive control cDNA in our routine RQ-PCR assay contains approximately 500 copies each of e13a2 and e14a2 BCR-ABL (laboratory quality control data). The mean nested Ct from the low positive control samples was 8.9 for e13a2 and 11.7 for e14a2 BCR-ABL. Assuming optimal PCR efficiency (ΔCt of 3.32 for each 10-fold change in transcript number) the Ct that would be predicted to result from a single copy of BCR-ABL is 17.8 for e13a2, and 20.6 for e14a2. This information was used in determining the cut-off between positive and negative samples.
31
3.5.3 Negative controls
3.5.3.1 ‘No template’ cDNA Reverse transcription was performed using water in place of RNA to make NTC cDNA. The NTC is used to detect contamination of the PCR mix with BCR-ABL. 48 NTC samples were prepared in separate RT-PCR runs, each of which also contained CML patient samples and positive control samples. The NTC were used in nested PCR (4 independent nested PCR batches, each containing 12 samples) for both e13a2 and e14a2 transcripts. Transcript e13a2: there was no signal in 46/48 samples. Amplification in two samples gave a Ct in the range of 35-40 cycles, far below the signal that would be predicted to result from efficient amplification of a single copy of BCR-ABL. It is possible that this signal resulted from low-level cross contamination with BCR-ABL amplicons during the setting up of the real-time PCR (not during the first round amplification). Transcript e14a2: there was no signal in 46/48 samples. Amplification in two samples (not the same two samples as for e13a2) gave a Ct in the range of 35-40 cycles.
3.5.3.2 HeLa cDNA RNA was extracted from the BCR-ABL-negative HeLa cell line and reverse transcribed. The HeLa negative control is used to detect contamination with BCR-ABL during the RNA extraction process (or subsequently), and also to detect non-specific amplification resulting from the amplification of RNA transcripts other than the specific target genes. In total 88 cDNA samples were prepared, each in an independent RT-PCR run, each run also containing CML patient samples and positive control samples. These HeLa cDNA products were used in nested PCR (in 4 independent nested PCR runs, each run containing 22 samples). Transcript e13a2: there was no signal in 32/88 samples. BCR-ABL was detected in two samples (2.3%) with Ct values of 16 and 19, comparable to the predicted Ct of 18 for a single copy of e13a2. Amplification at the level seen in the NTC samples was observed in 54/88 HeLa samples. This level of amplification is below the level considered to indicate a true positive. Transcript e14a2: there was no signal in 11/88 samples. BCR-ABL was detected in four samples (4.5%), including the 2 samples with detectable e13a2 BCR-ABL. The e14a2 Ct values were 15-19, slightly earlier than the predicted Ct of 21 for one copy of e14a2. Amplification at the level seen in the NTC samples was observed in 73/88 HeLa samples.
3.5.3.3 Normal blood cDNA RNA was extracted from the blood of 48 patients with disorders other than CML. BCR-ABL mRNA was not detected by nested RT-PCR.
3.5.4 Improved sensitivity of real-time nested RT-PCR in cell line dilutions The same serial dilutions of K562 and MOLM-1 cells that were used to test the conventional nested RT-PCR assay for BCR-ABL were also used to test the sensitivity and linearity of the novel nested PCR assay.
3.5.4.1 Assay linearity Whilst the conventional nested PCR assay is qualitative, there is the potential for a real-time assay to give quantitative results. Dilutions of K562 (e14a2) and MOLM-1 (e13a2) from 1/1,000 to 10-7 cells were tested (Figure 3.7). There was a log-linear relationship between the cell dilution and the Ct down to a dilution of 10-5 cells. Below this level there was a plateau in Ct values, and increased measurement error.
3.5.4.2 Limit of detection The limit of detection of BCR-ABL was tested in serial dilutions of the K562 and MOLM-1 cell lines. BCR-ABL was reliably detected down to a dilution of 10-6. Ten nested PCR replicates (independent RT-PCR and real-time PCR) were performed using the 10-7 dilution: e13a2 BCR-ABL was detected in 2/10 samples (Ct 18 and 19); e14a2 was detected in 6/10 samples (Ct 18-24). The range of Ct values observed in the 10-7 dilution was consistent with the extrapolated Ct value for one amplified copy of BCR-ABL. The detection of BCR-ABL in only a proportion of samples indicates that 10-7 is the limit of detection of this method for these two cell lines. This is up to 1 log lower than the detection limit of the conventional nested RT-PCR assay. The higher frequency of positive results in K562 is most likely a reflection of the abundance of the BCR-ABL transcript in that particular cell line.
Figure 3.7 Nested real-time RT-PCR for BCR-ABL mRNARNA was extracted from K562 (e14a2) and MOLM-1 (e13a2) cells diluted in BCR-ABL-negative HeLa cells. Quantitative results were obtained down to the 10-5 dilution. Near to the limit of detection the measurement error was increased and some of the samples were negative. Ct= threshold cycle number
K562 nested PCR
0
5
10
15
20
25
30
2 3 4 5 6 7 8
Log dilution K562 cells
Ct
MOLM-1 nested PCR
0
5
10
15
20
25
30
2 3 4 5 6 7 8
Log dilution MOLM-1 cells
Ct
32
33
3.6 Detection of BCR-ABL mRNA in plasma
3.6.1 Extraction of plasma RNA Peripheral blood was collected from normal individuals (n=4); from patients with disorders other than CML (n=8); and from CML patients (n=5). The extraction method is described in Chapter 2. Briefly, plasma was separated from anticoagulated whole blood by centrifugation. Trizol LS® (a more concentrated formulation of the Trizol® reagent, designed for use with liquid samples) was added to the plasma and RNA was extracted by loading the entire volume of the Trizol® aqueous phase on to a single column in order to maximize the RNA concentration. After spectrophotometry the RNA was frozen at -70 C until cDNA synthesis.
3.6.2 Quantification of BCR and BCR-ABL mRNA in plasma The mean spectrophotometric yield of RNA in 17 samples was 64 ng/μL (range 7-142 ng/μL). The maximum volume of 9 μL RNA was used for cDNA synthesis, and Q-PCR was performed according to the usual procedure of the laboratory. The volume of plasma used for RNA extraction varied from 0.8 to 8 mL. The number of copies of the BCR control gene ranged from 0 – 50,400 per mL plasma, with the majority of samples containing fewer than 1,000 copies of BCR per mL (median 830 copies). In contrast, the median copy number from peripheral blood cells in our standard RQ-PCR was 494,000 using R6 primers. There was no correlation between the amount of RNA (measured by spectrophotometry) and the number of BCR transcripts (R2=0.03). The RNA yield varied significantly between replicates and between extraction runs. BCR-ABL was detectable in the plasma of 4/5 CML patients, all of whom also had BCR-ABL detectable by conventional RQ-PCR.
3.6.3 Extraction of RNA from CML patients in a CMR Many of the blood samples from patients in a CMR are sent to the laboratory from other centres. Delayed processing of samples for plasma RNA poses two problems: plasma may become contaminated with RNA derived from fragmented or apoptotic cells (Tsui et al. 2002); and cell-free RNA is rapidly degraded by plasma ribonucleases. In order to use plasma samples obtained from CML patients in other centres it was necessary to process the plasma into Trizol LS® at the site of collection, prior to freezing for transportation. RNA extraction was performed in our laboratory at a later date. RQ-PCR was performed plasma samples collected from CML patients in a CMR, as defined by RQ-PCR on peripheral blood cells, in order to compare the sensitivity achievable in blood cells and plasma. Ten peripheral blood samples were collected from 7 CMR patients, and RNA was extracted from plasma and from blood cells. Plasma (0.8 mL) from CML patients in a CMR was processed into Trizol LS®, as described above, and the Trizol® preparation was frozen at -70 C until extraction. The Trizol® preparation was thawed and RNA was extracted, and the mean RNA concentration determined by spectrophotometry was 17 ng/μL. There were 4 samples in which the BCR control gene was not detectable. The median BCR copy number in the remaining 6 samples was 18 (range 3-210). The positive control RNA sample in the same RT-PCR contained 237,000 BCR transcripts. BCR-ABL was not detected in any sample. The recovery of RNA from plasma after freezing and thawing was poor. No further experiments were performed using plasma RNA.
34
3.7 Discussion
3.7.1 Removal of potential inhibitors of PCR In RT-PCR it was found that the omission of dithiothreitol from the reaction mix made no difference to the sensitivity of RQ-PCR for BCR-ABL. As DTT does not seem to be required its omission from the reaction mix would enable the addition of an extra 2 µL of RNA solution, an increase of 22%. An increase in input RNA might improve sensitivity, but a 22% change would be difficult to demonstrate in an assay where the intrinsic variability is up to 100%. Any true difference attributable to the omission of DTT is unlikely to be of a magnitude sufficient to give a clinically meaningful improvement in the sensitivity of RQ-PCR. Varying the RNA input in the RQ-PCR assay could potentially complicate the interpretation of serial quantitative assays for a single patient, where the starting amount of RNA varies from sample to sample (Stahlberg et al. 2004). The purification of cDNA prior to real-time PCR did not improve the sensitivity of the RQ-PCR assay for BCR-ABL. On the contrary, the recovery of BCR-ABL after purification was incomplete, and this reduced the sensitivity of the assay in serial dilutions of cell line cDNA. Moreover, the purification step was found to have introduced contamination of the patient samples with e14a2 BCR-ABL products. The source of the contamination was not identified. Cross-contamination of samples with cDNA from another patient would be the most obvious source of BCR-ABL transcripts, but the absence of increased levels of BCR and e13a2 BCR-ABL in the contaminated samples argues strongly against this explanation. When the elution buffer was assayed for BCR-ABL there was no evidence of contamination, but it was not possible reliably to assay the binding buffer and wash buffer due to their high concentrations of alcohol, which would effectively inhibit amplification. Contamination of either the silica columns or the purification buffers was the most likely explanation for the discrepant increase in e14a2 BCR-ABL. This problem highlights the importance of preventing PCR contamination in order to generate reliable measurements of MRD. In general, the addition of an extra post-PCR processing step to the RQ-PCR assay would seem to introduce an unacceptable risk. Whilst extensive precautions for the avoidance of contamination (e.g. physical separation of each step in the assay) could in theory be adopted, such a system may be impractical for use in a routine diagnostic laboratory.
3.7.2 Pentadecamer primers for reverse transcription The use of R15 primers in our established RQ-PCR assay for BCR-ABL resulted in an increase in copy number for both BCR-ABL and the BCR control gene. Importantly, this resulted in the detection of BCR-ABL in 68% of selected samples that were previously reported as undetectable. This indicates an increase in sensitivity for BCR-ABL measurement, which was approximately 2-fold. This should be confirmed in an expanded number of samples, but this finding may be useful for laboratories dealing with increasing numbers of CML patient samples with MRD close to the limit of detection. The incremental improvement in sensitivity using R15 primers may be sufficient to extend significantly the period of measurable disease in imatinib-treated patients with a slow decline in BCR-ABL levels (Branford et al. 2007). It is comparable to the improvement in assay sensitivity achieved by using an increased concentration of reverse transcriptase enzyme (Beillard et al. 2003), but considerably cheaper. We examined the effect of substituting R15 for R6 primers on the alternative control genes, ABL1 and GUSB. Using R15 primers there was an increase in copy number for ABL1 and GUSB, as for BCR-ABL and BCR. However, the increases were not proportionate, with lesser increases noted for ABL1 and GUSB than for BCR. The increase in GUSB, ABL1, and BCR-ABL was independent of the increase in BCR. These findings on the variability of RT-PCR
35
efficiency are consistent with published reports. One would have anticipated that the use of a longer random primer would result in a proportional change in all genes measured, but this was not the case in our study, nor in the original report of Stangegaard and colleagues (Stangegaard et al. 2006). They noted three genes the expression of which differed by greater than 2-fold between R6 and R15 assays. The effect of R15 primers on the efficiency of priming ABL1 and GUSB mRNA should be validated in laboratories that have established RQ-PCR assays for these transcripts. Methods of priming RT-PCR other than random oligonucleotides were not examined. There are several reasons why alternative primers were not studied. Sequence-specific primers can be used for RT-PCR, but may be undesirable where it is necessary for BCR-ABL transcripts and control gene transcripts to be amplified with near-identical efficiency. Each pair of sequence-specific primers would need to be optimized carefully to ensure that no bias was introduced. Oligo-dT primers bind to the 3’ polyA tail of mRNA to initiate RT in a 5’ direction, and could be a more suitable alternative to random oligonucleotide primers. Two studies compared the cDNA yield of RT-PCR after priming with oligo-dT and R6 primers (Lekanne Deprez et al. 2002; Stahlberg et al. 2004). Overall, the two methods gave comparable results, with R6 being more efficient for some genes, and oligo-dT more efficient for others. The efficiency of detection of a target sequence by RQ-PCR using oligo-dT primers should be greatest for 3’ target sequences, where the target is closer to the oligo-dT primer. No comparison of random oligonucleotides and oligo-dT primers specific to BCR-ABL RQ-PCR has been published, but the BCR exons 13 and 14 which are fused to ABL1 are at a considerable distance from the poly-A tail. A further theoretical disadvantage of oligo-dT primers is that a strand break in an mRNA molecule would result in the synthesis of cDNA representing only the 3’ RNA sequence. If the region of interest were 5’ to the break it would not be detected, even if the region containing the target sequence were intact. For the longitudinal follow-up of CML patients it is important that the reported BCR-ABL/control gene ratio should not be affected by changes in assay methodology. We found a small bias in the overall BCR-ABL/BCR ratio using R15 instead of R6 primers indicating that BCR-ABL levels will be under-estimated relative to our established method. Whether this small bias is clinically relevant has not been established. An acceptable bias is one which would not affect clinical decision-making and, as an example, we use an increase in BCR-ABL levels of greater than 2-fold as a trigger to screen for BCR-ABL kinase domain mutations as a cause of resistance to treatment (Branford et al. 2004). The bias due to R15 primers is well within this limit. If the bias between methods is consistent across the dynamic range of the assay, a mathematical conversion factor can be applied to improve assay agreement. The method used for the standardization of BCR-ABL RQ-PCR between laboratories derives a laboratory-specific mathematical conversion factor from the measured assay bias between the two methods (Hughes et al. 2006; Branford et al. 2008). The same procedure can be used to ensure agreement of BCR-ABL values after a methodological change within a laboratory. Our findings demonstrate than any change in RQ-PCR assay conditions might affect the results observed, underscoring the importance of assay validation in each individual laboratory. As increasing numbers of patients treated with ABL kinase inhibitors have undetectable BCR-ABL there is a growing need to establish a consensus method for the inter-laboratory comparison of assay sensitivity. The EAC calculated sensitivity formula for RQ-PCR is a useful means of assessing the quality of individual results produced within a single laboratory using one uniform method. Calculated sensitivity reflects variation in the quality of the samples from which RNA was extracted, the efficiency of extraction, and the efficiency of reverse transcription and real-time PCR (Gabert et al. 2003). Our data demonstrate that this formula cannot be used accurately to compare the sensitivity of RQ-PCR performed with different control genes in different assay systems. The measured sensitivity of an assay for
36
detecting BCR-ABL should ideally be based on the measured change in BCR-ABL. Various methods could be proposed for the inter-laboratory measurement of BCR-ABL sensitivity. The feasibility of using RNA calibration standards in RNA extraction, reverse transcription, and real-time quantitative PCR has already been demonstrated in virological assays (Donia et al. 2005; Hietala and Crossley 2006). An alternative approach would be for each laboratory to calibrate its calculated sensitivity measurement by the exchange of patient samples with a reference laboratory and to apply a mathematical correction factor to the EAC calculated sensitivity, similar to the process for standardization of BCR-ABL ratio reporting (Branford et al. 2008). Our data highlight the importance of replicate testing to ensure sensitive detection of MRD. Replicate testing in selected patient samples resulted in a proportion of samples that were negative when initially tested becoming positive on repeat analysis, in keeping with similar observations using other assays (Melo et al. 1996; Bose et al. 1998; Lange et al. 2005). A deficiency of our existing method for calculating sensitivity is that it does not take into account the effect of replicate testing. In order to standardize the reporting of sensitivity it would be necessary to standardize the number of replicate analyses performed. This study demonstrated that R15 primers increased the sensitivity of RQ-PCR for BCR-ABL in CML patients. Transcript copy numbers increased for all five mRNA species examined, indicating that these findings may have broader applicability in other assays for low abundance RNA transcripts, such as monitoring of viral load and antenatal diagnostics.
3.7.3 Nested RT-PCR for BCR-ABL The novel real-time nested RT-PCR assay for BCR-ABL mRNA had a lower limit of detection better than that of RQ-PCR, and better than that of the widely used qualitative nested RT-PCR. These findings were demonstrated using artificial dilutions of cell lines. A further study of nested real-time PCR in clinical samples was performed in the Australasian Leukaemia & Lymphoma Group CML8 clinical trial, the results of which are presented in Chapter 6. Apparent low level amplification of BCR-ABL was commonly detected in real-time nested RT-PCR using cDNA derived from BCR-ABL-negative cells. This is likely to reflect non-specific amplification, rather than contamination, as amplification was rarely observed in the ‘no template’ negative controls. The Ct estimated to result from the amplification of a single copy of BCR-ABL was determined by 2 methods: experimentally by limiting dilution, and by mathematical extrapolation from the Ct of a sample with a known BCR-ABL copy number. The difference between the latest true positive Ct and the earliest false positive Ct was approximately 10 cycles, sufficient to ensure that ambiguous results are rare. In our laboratory the threshold between positive and negative results in the RQ-PCR assay is arbitrarily set at 10 transcripts (the lowest transcript number in the BCR-ABL standard curve). A result of 11 transcripts would be considered positive, and a result of 9 transcripts would be considered negative, even though there is certainly no verifiable difference between two such results, the intrinsic variability of the assay being at least 2-fold. In qualitative nested RT-PCR the reliance on a somewhat arbitrary threshold is avoided. BCR-ABL mRNA was detected in <3% of negative control samples, all of which were HeLa cDNA samples. It is most likely that these samples were contaminated with BCR-ABL at a very low level during the process of cell culture, or during RNA extraction. The absence of BCR-ABL in the ‘no template’ cDNA samples argues against contamination at a later stage in the process. An alternative explanation is that rare BCR-ABL transcripts might arise more frequently in the genetically unstable environment of the HeLa cancer cell line than in normal individuals (Deininger et al. 1998). This hypothesis could be tested by the use of non-human cells as the negative control for contamination during the RNA extraction step.
37
The replicate nested RT-PCR analysis using the lowest dilution of K562 cells (1 cell per 107 HeLa cells) detected BCR-ABL in 6/10 replicates. A 10-8 dilution was not tested, but it is possible that with large numbers of replicates an even lower detection limit might have been achieved. Near the limit of detection the results are strongly influenced by sampling error. It has been shown that in this situation PCR replicates conform to the Poisson distribution (Melo et al. 1996; Rawer et al. 2003). The confidence interval of a quantitative estimate narrows as the number of replicates is increased. It follows that it should be possible to produce an accurate quantitative result if sufficiently large numbers of PCR replicates are performed (Ross et al. 2009). This point re-emphasizes the importance of systems to prevent contamination and exclude false-positive results, which would otherwise render impractical the use of high numbers of PCR replicates. Developments in real-time PCR technology, such as the use of microfluidics (Beer et al. 2007), may make practical the performance of very large numbers of replicate analyses in which the signal from a single target transcript is distinct from the non-specific background, without the need for a secondary amplification step.
3.7.4 Plasma BCR-ABL mRNA In solid tumours it is not practical to perform serial biopsies of the cancer tissue, and radiological surveillance of residual disease has limited sensitivity. Several studies in different cancer types have identified tumour-related RNA in the plasma, (Kopreski et al. 1999; Lo et al. 1999) even in some patients with limited stage disease (Chen et al. 2000; Silva et al. 2002). The situation in CML is somewhat different because the malignant cells circulate in the peripheral blood, and existing methods can accurately quantify the level of residual disease over a range of around 4 log. Nevertheless, it is plausible that in an MRD setting the residual leukaemic cells might, for example, be present in the bone marrow or spleen, and not circulating in the peripheral blood. Leukaemic mRNA produced in tissue sites of residual disease could be shed into the circulation. The preliminary experiments undertaken to extract RNA from the plasma of CML patients demonstrated that it was possible to quantify BCR-ABL and BCR at low levels in plasma. BCR-ABL was not detected in any of 10 samples from CML patients in a CMR, but poor recovery of RNA after thawing of frozen Trizol® samples almost certainly reduced the sensitivity of the method. Specimen processing was apparently more critical for plasma RNA than for conventional cellular RQ-PCR. The aim of the initial series of experiments was to determine whether the plasma RNA method showed promise for the study of MRD in CML patients. It was clear that extensive optimization of the plasma RNA extraction method would be required in order to proceed with definitive studies in CML patient samples. Following the negative results of plasma RNA RQ-PCR in CMR samples this project was not pursued further. The potential of plasma RNA for the monitoring of MRD remains uncertain.
3.7.5 Future directions The strategies investigated for the optimization of RT-PCR at best resulted in a gain of sensitivity of around 10-fold. In order to extend further the limit of detection of BCR-ABL by RT-PCR it would be necessary to increase the amount of RNA sampled, most readily achieved by replicate testing. The rigorous exclusion of false positive results is essential to the development of a clinically useful method of detecting low level MRD. One solution to the problem of cross-contamination with BCR-ABL mRNA transcripts (or low level transcripts in normal individuals) is to use genomic DNA as the MRD marker. In genomic BCR-ABL the breakpoints are so variable as to ensure that each patient has a virtually unique fusion sequence, so that contamination can occur only between two samples belonging to the same patient. The development of patient-specific DNA PCR is the subject of the following two chapters of this thesis.
38
3.8 Publication of findings and contributions of co-authors The use of random pentadecamer primers for RT-PCR can improve the limit of detection of BCR-ABL mRNA transcripts by RQ-PCR (Ross et al. 2008). This work was published in Clinical Chemistry, a leading journal for diagnostic laboratory science (2007 Impact Factor 4.8). David Ross conceived the project, planned and conducted the experiments, analysed the data and wrote the manuscript. Dale Watkins performed the experiments examining the GUSB and ABL1 control genes. Timothy Hughes oversaw the project and was involved in writing the manuscript. Susan Branford oversaw the project and was involved in planning the experiments, analysing the data and writing the manuscript. A letter concerning the definition of ‘sensitivity’ in MRD analysis was published in Leukemia (2007 Impact Factor 6.9) (Ross et al. 2009). The letter was based on an extensive review of the literature, and the experiments reported here. David Ross planned and wrote the manuscript. Susan Branford, Junia Vaz de Melo, and Timothy Hughes critically reviewed the text.
4 Identification and characterization of the BCR-ABL breakpoint sequences of CML patients
4.1 Introduction On the Ph chromosome the centromeric portion of BCR on the long arm of chromosome 22 is fused to ABL1 on the end of the long arm of chromosome 9 to create the chimaeric BCR-ABL gene on the derivative chromosome 22. Virtually all CML patients express the p210 isoform of the BCR-ABL protein, translated from mRNA transcripts with either an e13a2 (b2a2) or e14a2 (b3a2) junction. In contrast the genomic sequence of BCR-ABL is highly diverse due to the spread of breakpoints over approximately 3.0 kb in BCR, and over approximately 150 kb in ABL1 (Figure 4.1). Thus, the possible number of unique BCR-ABL fusion genes is in excess of 108.
Figure 4.1 Schematic representation of the BCR and ABL1 breakpoint regionsThe BCR (red) and ABL1 (blue) breakpoint regions of BCR-ABL are shown approximately to scale. Arrows indicate exons. Repeat regions in BCR only are shown in green.
e15
a2
IaIb
BCR 1cm = 125 bp
ABL1 1cm = 6667 bp
e13 e14
Putative met gene
BCR gene
ABL1 gene
Broadly, there are four requirements for the formation of leukaemogenic BCR-ABL. Firstly, chromosomes 9 and 22 must be in close physical proximity within the nucleus of the cell when the chromosomal breaks occur. Secondly, double strand breaks must occur contemporaneously in both chromosomes. Thirdly the strand breaks must be unfaithfully repaired to result in crossover recombination. Finally, the novel BCR-ABL gene must result in the expression of an active BCR-ABL tyrosine kinase in an appropriate cell type in order to confer a biological advantage resulting in the outgrowth of an immortalized leukaemic clone. The principal purpose of the studies described in this chapter was to develop a patient-specific marker for the detection of minimal residual disease. Secondarily, it was possible to study the distribution of the breakpoints in BCR and ABL1. A better understanding of the distribution of breakpoints will enable refinement of the breakpoint detection strategy, and can provide insights into the biology of the BCR-ABL recombination event. The precise location of the BCR and ABL1 breakpoints might also reveal predisposing factors for DNA breakage or
39
40
recombination in the surrounding DNA (e.g. topoisomerase consensus sites), while the fusion sequence might provide information concerning the mechanism of DNA repair.
4.1.1 Juxtaposition of BCR and ABL1 The nucleus has a complex higher order structure. Chromosomes are not free-floating within the nuclear volume, but lie within defined territories that may vary with the cell cycle (Soutoglou et al. 2007). Chromosomes 9 and 22 lie within close physical proximity in the late synthetic phase (Anastasi et al. 1995; Neves et al. 1999). Neutron irradiation of normal human lymphocytes generated recombination events involving BCR and ABL1 (Kozubek et al. 1999). The predicted frequency of recombination events was estimated based on the relative size of each chromosome (two larger chromosomes having a greater chance of being damaged and recombining) and compared with the actual rate of damage observed. Aberrations involving chromosomes 9 and 22 were 11 times more frequent than predicted, and this increase in frequency correlated with the estimated increased probability of interaction based on overlapping chromosome territories within the volume of the nucleus. In another study radiation-induced BCR-ABL fusions were identified, but their frequency was not increased over control, non-irradiated cells (Bose et al. 1998). Various BCR-ABL fusion products were found, including non-functional products. This parallels the finding of variant BCR-ABL cDNA in normal individuals (Biernaux et al. 1995), with some of these variants having never been reported in association with leukaemia (Biernaux et al. 1995; Bose et al. 1998). Additional factors may contribute to the juxtaposition of 9q34 and 22q11 where the ABL1 and BCR genes are located. In 2002 a single patient with an unusual BCR-ABL transcript was reported: the transcript contained an insertion of genomic material from elsewhere on chromosome 9 (Verstovsek et al. 2002). This finding led to the identification of a 76 kb duplicon (i.e. a duplicated segment of DNA sequence) 150 kb telomeric of BCR on chromosome 22 and 1400 kb centromeric of ABL1 on chromosome 9. The authors speculated that this duplicon might be involved in initiating an interaction between 9 and 22 that could ultimately lead to the formation of BCR-ABL. The largest reported series of BCR-ABL genomic breakpoints contained 27 breakpoints, 10 of which were newly detected, and 17 collated from 5 prior publications (Mattarucchi et al. 2008). The BCR-ABL breakpoints were significantly associated with interspersed repeat elements in over 50% of patients. An association of breakpoints with Alu repeats has been proposed by other groups (Morris et al. 1991; Zhang et al. 1995; Jeffs et al. 1998). Over 50% of the chromosome 9 ABL1 breakpoint region is made up of genomic repeat elements (Genetic Information Research Institute repeat masker, available at www.girinst.org, July 2008). The chance of finding breakpoints in, or near, repeat elements must therefore be very high, and in small series the likelihood of false positive associations must also be high. Some DNA elements are associated with physiological strand breakage: topoisomerase enzymes cleave DNA at sites of torsional stress, while the immunoglobulin gene rearrangement and class switch mechanisms use CpG dinucleotides and heptamer recombination signals. DNA elements that might be associated with breakpoint localization have been investigated in small numbers of patients, but there is no definitive evidence that any particular genomic element influences the probability or site of recombination events resulting in BCR-ABL (Chissoe et al. 1995).
4.1.2 DNA repair and recombination Double strand breaks in DNA occur commonly, and in most cases it is likely that faithful DNA repair mechanisms are able to restore intact sequences. Homologous recombination repair (HRR) uses the undamaged sister chromatid as a template to replicate across the strand break. HRR virtually always results in faithful repair. Single strand annealing (SSA) resects
41
broken dsDNA ends in a 5’-3’ direction until there is sufficient homology between the exposed single strands to repair the break. Non-homologous end-joining (NHEJ) is used to ligate dsDNA ends with little or no homology and is prone to unfaithful repair. Small insertions or deletions adjacent to the breakpoint are common after NHEJ-mediated recombination (McVey and Lee 2008).
4.1.3 Methods for the detection of BCR-ABL breakpoints All of the reported PCR approaches to the isolation of p210 BCR-ABL breakpoints are based on the relatively tight clustering of breakpoints in the BCR gene. The methods can be sub-divided into two broad groups. The first approach uses a forward primer in BCR and a series of reverse primers in ABL1 to achieve selective amplification of the unknown region containing the breakpoint. This method should be successful if the following conditions are met: 1) the BCR breakpoint is downstream of the forward primer and the ABL1 breakpoint is upstream of one of the ABL1 primers; and 2) the quality of the DNA and the efficiency of the PCR are such that the DNA fragment containing the breakpoint can be amplified. This second condition is problematic, due to the dispersal of ABL1 breakpoints over a distance of at least 150 kb. The use of long range PCR makes it possible to cover the ABL1 breakpoint region in a practical number of reactions (Waller et al. 1999; Score et al. 2007). A second approach is to sequence a DNA fragment commencing from a BCR primer located at the start of the BCR breakpoint region. The DNA must first be cleaved into smaller fragments, one of which may (or may not) contain the BCR-ABL breakpoint. The first such method, termed ‘bubble’ PCR, was described in 1995 (Zhang et al. 1995). Genomic DNA from leukaemic cells was digested with the Rhodopseudomonas sphaeroides restriction endonuclease, RsaI, and a synthetic ‘bubble’ oligonucleotide was ligated to the digested DNA fragments. Part of the normal BCR gene and, in 40-50% of cases, the BCR-ABL fusion could then be amplified by PCR using a forward primer adjacent to the RsaI cleavage site in BCR, and a reverse primer complementary to the bubble oligonucleotide. Using a modified approach based on the same principle the success rate was increased by using a panel of restriction endonucleases to generate a more diverse range of DNA fragments, and by using nested PCR primers (Mattarucchi et al. 2008). Inverse PCR (Figure 4.2) uses the same principle, but instead of ligating a synthetic oligonucleotide to the DNA fragment, the fragment is circularized by intramolecular ligation, and then amplified using a pair of forward and reverse primers both located in the gene where the breakpoints are most tightly clustered (Wiemels and Greaves 1999; Sobrinho-Simoes et al. 2007).
Figure 4.2a Inverse PCR screening for BCR-ABL breakpointsSchematic representation of restriction fragment and inverse PCRproduct containing BCR-ABL breakpoint with primers indicated by arrows (BCR red; ABL1 blue). The inverse PCR product contains two fusion products: BCR-ABL and the ligation junction of the RsaIrestriction fragment.
RsaI
Inverse PCR product
breakpoint
RsaI
BCR ABL1
Ligated restriction fragment
BCR-ABL
42
ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAA
GCAGAGTTCAAGTAAGTACTGGTTTGGGGAGGAGGGTTGCAGCGGCCGAGCCAGGGTCTCCACC
CAGGAAGGACTCATCGGGCAGGGTGTGGGGAAACAGGGAGGTTGTTCAGATGACCACGGGACAC
CTTTGACCCTGGCCGCTGTGGAGTGT
AGGT
ACAG GGGT
TTGTGCTGGTTGATGCCTTCTGGGTGTGGAATTGTTTT
TCCCGGAGTGGCCTCTGCCCTCTCCCCTAGCCTGTCTCAGATCCTGGGAGCTGGTGAGCTGCCC
CCTGC GGATCGAGTAATTGCAGGGGTTTGGCAAGGACTTTGACAGACATCCCCAGGGGTG
CCCGGGAGTGTGGGGTCCAAGCCAGGAGGGCTGTCAGCAGTGCACCTTCACCCCACAGCAGAGC
AGATTTGGCTGCTCTGTCGAGCTGGATGGATACTACTTTTTTTTTCCTTTCCCTCTAAGTGGGG
GTCTCCCCCAGCTACTGGAGCTGTCAGAACAGTGAAGGCTGGTAACACATGAGTTGCACTGTGT
AAGTTTCTCGAGGCCGGGCGCAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGGC
AGGTGGATCGCTTGAGCTCAGGAGTTGGAGACCAGCCTGACCAACATGGTGAAACCCTGTGTCT
ACTAAAAATACAAAGATTAGCCGGGCTAGGCAGTGGGCACCTGTAATCACAACTGCTTGGGAGG
CTGAGGGAAGAGAATCGCTTGAACCCAGGAGGCGGAGGTTGCAGTGAGCCGAGCTTGTGCCACT
GCATTCCAGCCTGGGCGACAGAGCAAGACTCCGCCTCAAAAAAAAAAAAAAAAAGTTCCTAGAA
ACAGCAAAATGTGGAGACAGAAAGCTTACCAGGGATTGTTGGGGAATGGGGTTGGGAGAGAGGA
CTAACTGCAGATGAACCCAAGGGGGACTTTTTAGGTGAGAGCAGTGTCGTGAAAAGACTGTGGT
GCTGTTTGCGCTCACATTTACATTTCCTAAAATTCTTTAAACCCTACACTTGGAATGGATGAAT
TACATGACATGCAGATTGCACCTTCATAACATAATCTTTCTCCTGGGCCCCTGTCTCTGGCTGC
CTCATAAACGCTGGTGTTTCCCTCGTGGGCCTCCCTGCATCCCTGCATCTCCTCCCGGGTCCTG
TCTGTGAGCAATACAGCGTGACACCCTACGCTGCCCCGTGGTCCCGGGCTTGTCTCTCCTTGCC
TCCCTGTTACCTTTCTTTCTATCTCTTCCTTGCCCCGTGCACTCAACCTTGCATCCCCAAACCA
AACCTATTATTCATGGACCCCAAACTTGTTCCTCTTATGTCCTGTCCCTTTGAGGGGCACCACC
ATCCACCCGCATGGCCAAGCCAGAAACCGTGGTCTGCTCTCCCTCCGTTAAATGCCATTCTCCA
TCAGTGAGGCTTCTTAGTCATCTCTGGCTGCCTGGCCAGGCCCTGGCTGTGGCCTCCTCCCTGG
TCTTTGTAGCTCTGGATATCCCTGCAGAAAGGGTCCCCACTACCAGGCCTCTCCATCCCCAGTC
TCAGGTAGTTTTTCTAAAATGCAAACCCCACCCTGCAACTTACCGCCCACAGCCCAGCCCACTC
TTCTCCAGGCCTCGCCTCCCTCCCTTCCCCCTGCACCCCACGACTTCTCCAGCACTGAGCTGCT
TCCTGTGCCCCACAGTGGCCTGGAGTCCCCTTTGCCTTAACTCTTTGCCCCATAGTACAGCGGG
GTCTGCTCTGATTGTAGGGGCTTCCCACATCCCCCAGGATGGCTGCCCTCTGCTGTGGCATCAC
TGTGTAACAATGGCGTGTACACCTCTCTGTCCCCACCAGTGCAGGGCCCTTCTCATCGTAGGGG
CTTTAGCTGGGGTTTGTGGATCGACTGAGTGAACGAATGTTGTGGGAAGTCCCGTTTCCCAGCC
GCACCCAGGGAAATTCCACAGAGCGGGCAGGGGCATCGCATGAGGTGCTGGTGTTCACGCCAGA
CCACAATTAGGTGTTTAATTTTTAAAAAGAAAGTTACAACCTTTTTTTTTTATTTTTATTTTTT
CTGATTCTGCAAATAACACCTGCTCTT ACCATGT GATGTGGAAAAGACCTGTGACC
TTCTCCATGTCCACTTCTCCCCACAGATCTGTACTGCACCCTGGAGGTGGATTCCTTTGGGTAT
TTTGTGAATAAAGCAAAGACGCGCGTCTACAGGGACACAGCTGAGCCAAACTGGAACGAG
K562
CGMRT
KU812
Figure 4.2b Inverse PCR screening for BCR-ABL breakpointsBCR genomic sequence from exon 14 to exon 15 (exons in blue, inverse PCR primers in green). Cleavage sites for RsaI shown as ( ). Breaks of K562 and KU812, and patients MRT and CG shown in red.
BCR-ABL breakpoint screening by long range PCR The primary screening approach used in this study for the detection of BCR-ABL breakpoints was long range PCR using Thermus thermophilus DNA polymerase, a proof-reading enzyme capable of amplifying fragments in excess of 10 kb under optimal conditions. The BCR exon (13 or 14) that was fused to ABL1 exon 2 was known from the results of RQ-PCR. There were 19 primers in ABL1, spaced so as to cover the entire predicted breakpoint region in fragments of 5-10 kb. The appropriate BCR forward primer was used in a multiplex reaction containing 4-5 ABL1 reverse primers. Thus, it was possible to screen the entire ABL1 region in 4
43
44
multiplex reactions. The multiplexed ABL1 primers were referred to as groups A-D (see Table 4.1). Each long range PCR used approximately 10-20 ng genomic DNA. Eighteen ABL1 forward primers were used in positive control PCRs to give fragments of varying lengths (845 to 8845 bp) to control for DNA integrity and the efficiency of PCR. The initial set of primers was designed by Dr JC Score and Prof NCP Cross (Wessex Regional Genetics Laboratory, Salisbury, UK), who kindly provided details of the method prior to its publication. Table 4.1 Primers for long range PCR detection of BCR-ABL
a. BCR screening primers
Start position End position
Exon 13 Forward 123643 123665
Exon 14 Forward 124439 124461
b. ABL1 screening primers
Forward Reverse
Primer Start End Start End Control band size
A1 20803 20825 29260 29282 8479
A2 53134 53157 60194 60217 7083
A3 66775 66798 74801 74823 8048
A4 107996 108018 112889 112911 4915
A5 128524 128546 132146 132168 3644
B1 2658 2680 11042 11064 8406
B2 39617 39639 48439 48462 8845
B3 80303 80325 86034 86056 5753
B4 98131 98153 104639 104660 6529
B5 135537 135559 143341 143363 7826
C1 use B1 3482 3504 845
C2 33557 33579 37595 37617 4060
C3 60334 60356 67948 67970 7636
C4 87926 87949 94224 94246 6320
D1 13008 13030 20432 20454 7446
D2 47832 47854 53380 53402 5570
D3 73540 73562 80611 80633 7093
D4 113999 114021 120904 120926 6927
D5 130737 130759 136105 136127 5390
The nucleotide positions of the primers are numbered according to the GenBank reference sequences U07000 (BCR) and DQ145721 (ABL1).
At the commencement of the project the only sample in the laboratory with a known genomic BCR-ABL breakpoint was the cell line, K562. Varying amounts of K562 DNA were tested with the BCR exon 14 forward and ABL1 A multiplex reverse primers. Initially, the reaction mix was prepared containing primers, deoxynucleotides, buffer, and enzyme and the template DNA was added to this mix. These reactions failed, and subsequently the PCR was set up in two steps: first the primers, deoxynucleotides and template DNA were added, and then the DNA polymerase in buffer was prepared on ice and added to the template mix. This minor modification resulted in the successful amplification of a 9.6 kb BCR-ABL product, confirmed by sequencing. Patient and cell line samples were screened using this approach, as illustrated by the results for the KU812 cell line (Figure 4.3).
Figure 4.3a Sequencing of the BCR-ABLbreakpoint of KU812 - Long range PCR gel showing KU812 BCR-ABL product of 4.6 kb. Each PCR contained 20 ng KU812 DNA with the BCR exon 14 forward primer and an ABL1 primer reverse primer (as indicated). A1-5 are the ABL1 screening primers, see Table 4.1 for details.
6106489936392799
1953
99211641515
710
492
A2 A3 A4 DNA ladderA1
ABL1 reverse primer
A5 ABL1+
4.1.4 Sequencing of long range PCR products Dideoxyterminator sequencing was performed as described in Chapter 2, using a panel of BCR forward primers designed at intervals of approximately 500 bp. Each sequencing reaction provided up to 1 kb of genomic sequence. Using this strategy the BCR breakpoint was detectable in all cases. In most of these cases the ABL1 breakpoint was also identifiable from the BCR forward sequencing data. Due to the larger interval between ABL1 reverse primers the ABL1 breakpoint could not, in most cases, be sequenced from the ABL1 screening reverse primer. Therefore, ABL1 reverse sequencing of long range PCR products was performed only for e13a2 products of <2 kb and e14a2 products of <4 kb in length. The sequence of the BCR-ABL long PCR product was compared with the GenBank reference sequences U07000 (BCR); DQ145721 (ABL1); and AH005332 (start of ABL1 and sequence upstream of ABL1). Deviation from the reference sequence was used to identify the breakpoint (see example in Figure 4.3b), and also to identify single base substitutions (presumed polymorphisms or errors in the reference sequence). DQ145721 contains 2.4 kb upstream of exon 1b, but AH005332 was needed when a breakpoint was found in intronic
45
sequences upstream of the start of DQ145721 near to the last exon of the putative M8604 Met protein gene.
Figure 4.3b Sequencing of the BCR-ABL breakpoint of KU812
KU812 chromatograph vs BCR reference
KU812 chromatograph vs ABL1 reference
4.1.5 Specific examples of the sequencing approach In the majority of cases sequencing forward from the BCR exonic primer into either intron 13 or intron 14 revealed both the BCR and the ABL1 breakpoints. The following cases illustrate examples in which confirmation of the breakpoint required a more complex approach.
4.1.5.1 Microhomology at the breakpoint The sequencing results of patient RAF are shown in Figure 4.4. Six bp (GCTCTT) of sequence at the breakpoint matched both the BCR and ABL1 reference sequences. In this case DNA repair had occurred at a region of minimal homology between the two sequences, and it was not possible to determine whether the homologous bases were derived from BCR or from ABL1. The last base of this patient’s BCR-ABL gene derived from BCR could be anywhere from nucleotide position (nt) 126549 to 126555, and the first base derived from the ABL1 gene could be from nt 57485 to 57491.
4.1.5.2 Breakpoint in or near a polypyrimidine repeat Patient AM expressed e13a2 BCR-ABL. A PCR product of approximately 4.8 kb was detected in the D multiplex reaction containing the exon 13 forward primer and 5 ABL1 reverse primers. In simplex PCR the BCR-ABL product was shown to arise from the D2 reverse primer (ABL1 53380-402). Sequencing into intron 13 revealed the BCR breakpoint before nt
46
123904. The following divergent sequence commenced with a polyT repeat, which terminated the sequencing reaction. Based on the length of the PCR product the ABL1 polyT repeat was putatively identified as commencing either at nt 48789 or nt 49064. Two new ABL1 reverse primers were designed: one between the two polyT repeats, and one downstream of both. A BCR-ABL product was amplified only with the downstream primer, indicating that the ABL1 breakpoint was in the polypyrimidine repeat after nt 49064.
Figure 4.4 Microhomology at the BCR-ABL junctionPatient RAF had six nucleotides of homology between the BCRsequence 3’ of the junction and the ABL1 sequence 3’ of the junction (boxed), so that it was not possible to determine the precise nucleotide position of the breakpoint.
BCR ACCTGCTCTTACAGACCATGACCTGCTCTTACCT
gtccaggctggctcttgtccaggctg
ABL1 tttcgctcttgtccaggctg
BCR-ABL
There is only one long polypyrimidine repeat in the p210 BCR breakpoint region. Because of the problem of sequencing breakpoints close to polypyrimidine repeats a new sequencing primer (5’-AAAAAAAAAAAAAAAAAGTTCC-3’) was designed to bind to the BCR polypyrimidine. Five bases of sequence after the end of the polyA repeat were included because of melting temperature requirements, and to confer a degree of specificity. It was not practical to design additional polypyrimidine sequencing primers for ABL1 due to the very large number of repeats in that gene.
4.1.5.3 Breakpoint upstream of ABL1 Patient EH expressed e14a2 BCR-ABL. A PCR product of approximately 10 kb was detected in the multiplex reaction containing the exon 14 forward primer and 4 ABL1 group C reverse primers. Sequencing forward into intron 13 revealed the BCR breakpoint before nt 126221. The BCR forward sequence matched ABL1 upstream of nt 2150, indicating that the ABL1 breakpoint was upstream of exon 1b. The divergent sequence immediately downstream of BCR was aligned with reference sequence AH005332 (CLC Free Workbench software version 4.0.3, CLCBio A/S, Aarhus, Denmark) and it was confirmed that the breakpoint on chromosome 9 was at position -7415 relative to the DQ145721 reference sequence, 10 kb upstream of exon 1b. For simplicity this was referred to as ABL-BCR even though the chromosome 9 sequences were outside the ABL1 gene. A new ABL1 reverse primer approximately 5 kb upstream of exon 1b was added to the panel of screening primers after this breakpoint upstream of the ABL1 gene was identified. Six samples in which BCR-ABL was not detected were re-screened with this new primer, but no additional breakpoints were identified. Breakpoints upstream of the first ABL1 exon are uncommon.
47
4.1.5.4 Breakpoints in BCR exons Patients CL and KH, identified as having e13a2 BCR-ABL mRNA, were found to have breakpoints in BCR exon 14, whereas the breakpoints were predicted to be in intron 13. The corresponding ABL1 breaks were in intronic sequences downstream of exon 1a and between exon 1b and exon 1a, respectively. The real-time primers for RQ-PCR span the BCR-ABL exon-exon boundaries, so if any of the broken exon were present these patients would not have detectable BCR-ABL mRNA in our routine RQ-PCR assay. In patient CL the BCR-ABL cDNA was sequenced to confirm that e13a2 BCR-ABL mRNA was expressed. There was no insertion derived from exon 14. The partial exons lack their 3’ splice sites and must be spliced out of the mRNA.
4.1.5.5 Samples containing low levels of BCR-ABL The purpose of the breakpoint detection studies was to determine a patient-specific marker for the study of minimal residual disease. In many patients of interest the lack of good quality DNA samples from the time of diagnosis was a major limitation. The detection limit of the long range PCR strategy was tested in a patient with a known breakpoint in stored samples containing different levels of residual disease, according to RQ-PCR. BCR-ABL was amplified in all of the samples, except for the sample collected while the patient was in a CMR (Figure 4.5).
Figure 4.5 Long range PCR can detect low levels of BCR-ABL in the DNA of a treated CML patientA 4.9 kb fragment of BCR-ABL was amplified by long range PCR using the DNA of patient GRS in a sample collected in MMR (RQ-PCR 0.02%).
855774276106
4899
3639
2799
1953
9921164
1515
710
492
4.6% 0.02% 0% ABL1+DNA
ladder1/1000
BCR-ABL mRNA levelDilution
48
49
Two CML patients were screened for BCR-ABL using DNA collected when the BCR-ABL mRNA level by RQ-PCR was around 0.1% (the level of MMR). In patient FB (e14a2 mRNA) a PCR product was seen at around 600 bp after long range PCR using the ABL1 D1 reverse primer. Genomic DNA was amplified using Thermus aquaticus DNA polymerase, and an intense band was seen. Forward sequencing from the exon 14 primer revealed only normal BCR sequence. Reverse sequencing from the D1 primer also revealed normal BCR. The region where the BCR sequence terminated was scanned for homology with the ABL1 D1 primer. When the D1 primer was inverted 6 bases at the 3’ end were homologous to BCR. The ABL1 D1 primer was functioning as a slightly inefficient BCR reverse primer. In long range PCR faint bands due to non-specific amplification were very common. Non-specific products could usually be identified because they occurred in the samples of multiple patients in the same run. Occasional more intense, apparently specific, bands required further investigation, as in this case.
4.1.5.6 ABL1 inversion Patient FHA expressed e14a2 BCR-ABL. A PCR product of approximately 1.2 kb was detected in the B multiplex reaction containing the exon 14 forward primer and 5 ABL1 reverse primers. Sequencing forward into intron 14 revealed the BCR breakpoint before nt 124298. The BCR forward sequence matched the complement of ABL1 from nt 48070 to nt 48000, and was then divergent. The divergent sequence after nt 48000 was identified as ABL1 from nt 48080 in a sense orientation. Hence, BCR was fused to ABL1 with an intervening inversion of 70 bp of contiguous ABL1 sequence. The ABL1 breakpoint was associated with an Alu repeat region, and terminated in a polyT repeat. Using primers approximately 200 bp from the predicted reciprocal breakpoints the ABL-BCR fusion was not detectable in genomic DNA, indicating a likely deletion of at least 200 bp in either BCR or ABL1, or both.
4.1.6 Success rate of the long range PCR method In 39/49 samples (74%) with good quality presentation DNA (extracted from viable cells) a BCR-ABL product was identified in multiplex PCR. Non-specific PCR products were very commonly encountered, but in virtually all cases BCR-ABL products gave distinct, intense bands when stained with ethidium bromide. In the remaining 10 samples each primer pair was tested in a series of 19 simplex reactions. Seven samples yielded a BCR-ABL product in the simplex PCR, leaving only 3/49 samples (8%) in which no BCR-ABL product was identified using the long range PCR approach. Seven patients had no suitable cell sample (with a high leukaemic burden) available for DNA extraction. DNA was obtained from: cytogenetic nuclear preparations stored in methanol and glacial acetic acid (n=3); stained or unstained peripheral blood or bone marrow slides (n=3); Trizol® preparations (n=1); extracted DNA stored in a refrigerator for 3 years or more (n=3). More than one sample was tested for several of the patients. The BCR-ABL breakpoint was detected in 2/7 patients. A 1.5 kb BCR-ABL product was found in DNA from a fixed bone marrow slide, and a 3.2 kb BCR-ABL product was identified in DNA from a cytogenetic nuclear preparation. The maximum length of the ABL1 positive control fragments in the five failed cases ranged from 845 – 7446 bp, with only two samples yielding control fragments of >5 kb in length.
4.2 Alternative strategies for the detection of BCR-ABL breakpoints The BCR-ABL breakpoints were detectable in 92% of patients with good quality DNA using the long range PCR approach. For the patients in whom the breakpoint could not be detected it was desirable to have an alternative method of breakpoint screening in order: 1) to
50
determine the causes of failure of the long range PCR method; and 2) to maximize the number of breakpoints discovered.
4.2.1 Identification of BCR-ABL breakpoints from the reciprocal ABL-BCR fusion gene
BCR reverse primers in intron 14 and intron 15 were used to screen for the reciprocal ABL-BCR translocation product. Additional ABL1 forward primers were designed to ensure that the maximum interval between ABL1 forward primers was <10 kb. Three patients with good quality DNA had no detectable BCR-ABL, and were screened for ABL-BCR. Genomic ABL-BCR was not detected in 2/3 patients. An ABL-BCR product of approximately 7 kb was amplified in patient CML9JT, and confirmed by sequencing (ABL1 113155-6 – BCR 125409-10). The nearest ABL1 reverse primer was D4 (120904-26), approximately 8 kb away from the expected BCR-ABL breakpoint. The BCR-ABL screening strategy presumably failed because the amplicon was too large for efficient amplification. Using this information a new ABL1 reverse primer was designed nearer to the predicted breakpoint. A BCR-ABL product was identified and the sequence was confirmed (BCR 125404-6 – ABL1 113157-9) with a balanced translocation.
4.2.2 Inverse PCR screening for BCR-ABL breakpoints Inverse PCR is a useful method for the detection of translocations in which the breakpoints in one of the involved genes are tightly clustered (Wiemels and Greaves 1999). An inverse PCR method for BCR-ABL breakpoint detection was developed by Dr MA Sobrinho-Simões and Prof JV Melo (Sobrinho-Simoes et al. 2007), and slightly modified for use in our laboratory (for details see Chapter 2). The maximum predicted length of BCR-ABL fragments using this method is around 2 kb, so the inverse PCR method might offer an advantage in cases where long range PCR has failed due to partial degradation of the genomic DNA. The RsaI restriction endonuclease cuts at GT/AC (or complementary CA/TG) to yield blunt-ended DNA fragments with an average length of around 1 kb. Digested DNA was ligated under low concentration conditions optimized to favour intra-molecular ligation. Depending on the precise location of the breakpoint, a circularized fragment containing either BCR (normal control) or BCR-ABL may be formed. The K562 and KU812 cell lines have known e14a2 breakpoints predicted to be detectable by the RsaI inverse PCR strategy (Figure 4.2). In both cases a single BCR-ABL product of the predicted length (429 and 587 bp, respectively) was identified. However, no normal BCR control band was seen. The PCR products were purified for direct sequencing to confirm the BCR-ABL breakpoint. In both cases the sequencing results agreed with those obtained using long range PCR. The intron 14 BCR control band has a predicted length of 1.7 kb, so the shorter BCR-ABL products may have competitively inhibited amplification of the longer BCR control band. Eight patients were screened with inverse PCR. PCR products were identified in four patients. The normal BCR control band was amplified in two patients. Possible BCR-ABL products were identified in two patients, but only one breakpoint was identified (patient CW: BCR 124639). The second product contained BCR intron 14 fused to a sequence not derived from BCR or ABL1, and probably due to a DNA ligation artefact. In the remaining 4 patients no product was amplified, indicating a problem due either to DNA quality or technical failure. The breakpoint was subsequently identified by the long range PCR screening method in 2/7 patients whose breakpoint was not detected by inverse PCR. The BCR breakpoints of these 2 patients were at nt 126498 and nt 126566, outside the fragment amplified by inverse PCR.
4.2.3 Short PCR screening method for BCR-ABL breakpoints – external collaboration An alternative BCR-ABL breakpoint detection method was developed by Dr P Bartley and Prof AA Morley at the Flinders University of South Australia, and tested in collaboration with
51
our laboratory (Morley et al. 2008). Briefly, this nested PCR method used in the first round 6 forward primers in BCR and 282 reverse primers in ABL1, positioned approximately every 500 bp so that no breakpoint should be more than 1 kb from the nearest primer. The reaction was highly multiplexed with all 288 first round primers combined in a single PCR. Theoretically, this method should be more successful in cases where the quality of the genomic DNA is sub-optimal, and long fragments cannot be amplified. Seven samples in which the BCR-ABL breakpoint was not detected were sent to the Flinders group for screening. The BCR-ABL breakpoint was detected in 2/7 patients. The ABL1 breakpoint of patient FB was at nt 48456-60, and resulted in loss of the binding site for the B2 reverse primer at nt 48439-62. The next ABL1 screening primer was 4.9 kb downstream, giving a predicted amplicon length of 6.7 kb. The longest ABL1 control gene fragment amplifiable in this sample was 6.3 kb. Similarly, the ABL1 breakpoint for patient WO resulted in the loss of a primer binding site, and the next ABL1 primer was 8.0 kb downstream. The longest ABL1 control gene fragment amplifiable in this sample was 7.4 kb. In the other samples from 5 different patients BCR-ABL was not amplified by either method. One of these samples was severely degraded, with the maximum amplifiable ABL1 control fragment only 0.8 kb, whilst in the other samples the maximum amplifiable was 4.0-7.4 kb.
4.3 Distribution of BCR-ABL breakpoints The validity of any analysis of breakpoint distribution is dependent on the number of patients included. The same breakpoint detection methods described in this chapter were used by Dr MA Sobrinho-Simões and Prof JV Melo in London, and by Dr JC Score and Prof NCP Cross in Salisbury. In order to maximize the number of patients available for analysis they provided the co-ordinates of their breakpoints (London, n=19; Salisbury, n=33).
4.3.1 Numbering of breakpoints in BCR and ABL1 The breakpoint nucleotide positions and the sequence immediately adjacent to the breakpoints are detailed in Table 4.2. The nucleotide positions relate to GenBank accession numbers U07000 (BCR) and DQ145721 (ABL1). Chromosome 9 breakpoints can occur upstream of DQ145721, in which case the nucleotide position is denoted by a negative number relative to the first base of DQ145721. In the BCR-ABL gene the BCR breakpoint was numbered as the last nucleotide retained in BCR 5’ to the break, and the ABL1 position was the first nucleotide retained in BCR-ABL 3’ to the point of fusion. In cases where the precise breakpoint could not be determined (due to microhomology) the range of possible BCR and ABL1 nucleotide positions is indicated. In tabulation and statistical analysis the last possible BCR base and the corresponding ABL1 base were used. Conversely, in ABL-BCR fusions the last possible ABL1 base was used, with the corresponding BCR base. The breakpoints obtained from our collaborators in the United Kingdom were checked and re-numbered according to this system before the results were combined. Cases were excluded if the breakpoint location could not be determined with precision (e.g. the ABL1 breakpoint of patient AM in a polyT repeat). The combined set of breakpoints numbered 100 for BCR-ABL: 95 CML patients and 5 cell lines. The inclusion of the cell line breakpoints was considered appropriate, as each cell line was originally derived from a CML patient sample.
52
Table 4.2 BCR-ABL breakpoints of 95 CML patients and 5 cell lines Patient ID BCR after BCR before ABL1 after ABL1 before 1810 123725 123726 50705 50706 495 123791 123793 20034 20036 MOLM-1 123799 123801 10093 10095 CML9LK 123799 123802 34627 34630 CML9DL 123811 123815 76494 76498 MS31 123820 123822 47684 47686 248 123823 123824 9379 9380 CML8AJR 123832 123836 45240 45244 317 123835 123838 137516 137519 CML9PG 123840 123843 13423 13426 483 123843 123846 110294 110297 CML9JES 123881 123883 27577 27579 CML8GRS 123902 123903 55604 55605 CML9AM 123903 123904 49065 approx MS2 123960 123961 38731 38732 NP241 123960 123961 102810 102811 CML9KV 123965 123967 40155 40157 MEG-01 123974 123975 33299 33300 CML8JM 123990 123991 73732 73733 545 124004 124005 3730 3731 KCL22 124006 124008 76938 76940 403 124022 124023 128829 128830 MS9 124033 124034 -4431 -4429 MS24 124041 124042 131447 131448 CML9TDB 124082 124083 114940 114941 MS10 124094 124098 93441 93445 CML9RKF 124096 124097 15162 15163 316 124099 124101 98640 98642 440 124128 124131 41345 41348 266 124167 124170 57696 57699 BT 124215 124217 85008 85010 CML9RB 124222 124223 4222 4223 MS12 124230 124234 58971 58975 MS30 124239 124240 45234 45235 CML9RL 124259 124263 103121 103124 CML9FHA 124295 124298 48066 48069 1578 124301 124302 107787 107788 MS29 124304 124307 50925 50928 446 124372 124375 24891 24894 CML8JEM 124373 124375 103970 103972 MS15 124383 124384 87959 87960 MS19 124411 124413 108615 108617 CL 124426 124427 129013 129014 MS33 124465 124466 19522 19523 CML9KH 124478 124480 75580 75582 E656 124515 124516 140180 140181 287 124520 124522 78731 78733 1538 124578 124579 49657 49658 K562 124628 124634 19879 19885 CML9KAL 124635 124637 71238 71240
53
Table 4.2 BCR-ABL breakpoints of 95 CML patients and 5 cell lines (contd.)
Patient ID BCR after BCR before ABL1 after ABL1 before CW 124639 124640 11265 11266 MS18 124735 124737 140240 140242 KU812 124741 124742 55931 55932 MS1 124748 124749 84852 84853 MS16 124773 124775 133201 133203 MS13 124778 124780 93652 93654 389 124796 124797 78020 78021 291 124804 124805 90806 90807 230 124866 124871 124413 124418 MS11 124918 124919 76752 76753 282 124952 124957 62747 62752 386 125037 125038 14626 14627 CML9HK 125117 125118 97675 97676 CML8WO 125145 125147 112890 112892 PD 125146 125150 16120 16124 MS20 125154 125155 110772 110773 CML9BM 125211 125214 120228 120231 CML8MRE 125269 125272 28969 28972 1569A 125285 125303 42632 42650 1460 125285 125297 33595 33607 CML9JD 125304 125305 125046 125047 CML9JT 125404 125407 113156 113159 CML8JJ 125427 125430 28356 28359 CML9HA 125446 125448 82722 82724 CML8DL 125484 125485 24338 24339 286 125690 125691 1847 1848 1716 125710 125711 106697 106698 436 125805 125806 42397 42398 524 125920 125921 117012 117013 CML9DP 125945 125948 17098 17101 375 126014 126016 86065 86067 MSInvA 126021 126024 5131 5132 MB 126037 126038 57163 57164 MS14 126080 126081 99790 99791 CML8EH 126219 126221 -7416 -7414 CML8FB 126220 126224 48456 48460 470 126290 126291 54195 54196 CML9IEW 126313 126314 29554 29555 CML9SJK 126374 126375 96813 96814 CML8MP 126375 126379 136822 136826 CML9SRM 126407 126408 51966 51967 1349 126451 126453 27756 27758 CML9EG 126472 126474 49915 49917 CML8MRT 126498 126500 131774 131776 CML9RAF 126549 126556 57485 57492 CG 126566 126567 15528 15529 CML8JT 126591 126592 102447 102448 300 126594 126599 99661 99666 CML9DMO 126609 126612 105223 105226 1103 126610 126613 106111 106114
54
4.3.2 Analysis of breakpoint clustering In BCR there was an average of one break every 30 bp. Using the probability mass function (Colton 1974) the probability of finding more than 3 breaks within a window of 30 bp is <0.02 (Figure 5.1). We calculated the distance between each breakpoint and its nearest neighbour. A cluster was defined as a series of n breakpoints, each no more than 30 bp from the preceding breakpoint. A cluster was considered significant if the probability of finding n breakpoints was <0.05, assuming a random distribution. Clusters were significant if more than 3 breaks occurred in a window of 30 bp, more than 4 breaks in 60 bp or more than 6 breaks in 90 bp. There were 7 BCR clusters containing 46 breakpoints spread over 380 bp (average 8 bp apart). There were 5 clusters in the e13a2 region and 2 clusters in the e14a2 region, possibly reflecting the smaller number of e14a2 breaks and the larger size of the e14a2 breakpoint region. In ABL1 there was an average of one break every 1.5 kb. Using the same method we identified 7 clusters containing 43 breakpoints spread over 26 kb (average 620 bp apart). Only 18 patients were represented in clusters in both BCR and ABL1.
4.3.3 Association of breakpoints with DNA topology The CpG dinucleotide is a site of DNA strand breakage caused by activation-induced deaminase (AID), as occurs in the process of immunoglobulin gene rearrangement (Robbiani et al. 2008). There are 233 CpG dinucleotides in the 3017 bp major breakpoint region of BCR from the start of intron 13 to the end of exon 15. Assuming a normal distribution of CpG dinucleotides the mean interval between CpGs would be 12.9 bp and the average interval between each breakpoint and its nearest CpG would be approximately 3.2 bp. We determined the interval between each breakpoint and its nearest CpG. For 100 breakpoints in BCR the median interval was 3 bp. The breakpoint occurred in or directly adjacent to a CpG in 26 patients, no more than would be predicted by chance. There was no excess of breakpoints 5’ of the nearest CpG (5’ n=48 vs 3’ n=41; p=0.71). There was no association between breakpoints and CpG dinucleotides. The immunoglobulin recombination signal sequence is a heptamer beginning CAC (or complement GTG) (Tsai et al. 2008). The CAC trinucleotide occurs 126 times in the 3017 bp region of BCR. Assuming a normal distribution the average interval between CAC trinucleotides would be 23.9 bp, and the average interval between each breakpoint and its nearest CAC trinucleotide would be approximately 6 bp. For 100 breakpoints in BCR the median interval was 7 bp. There was no excess of breakpoints 5’ of the nearest CAC trinucleotide (5’ n=37 vs 3’ n=49; p=0.45). The full heptamer signal (CACAGTG) occurs 4 times in the major breakpoint region of BCR and only once in ABL1. Assuming a random distribution of breakpoints the median distance from a BCR breakpoint to the nearest heptamer was calculated at 232 bp. Precisely 50% of BCR breakpoints were found within 232 bp of the nearest heptamer, suggesting that there was no association between the immunoglobulin recombination signal and BCR-ABL recombination. The χ octamer (5’-GCTGGTGG-3’) and related χ-like octamers (ACTGGTGG, GTTGGTGG, GCTAGTGG) are involved in DNA cleavage during homologous recombination (Cheng and Smith 1987). There is one χ-like octamer in the p210 breakpoint region of BCR, and 11 χ or χ-like octamers in ABL1. The single χ-like octamer in BCR was not associated with a cluster of breakpoints. Two χ-like octamers were located within breakpoint clusters in ABL1 (13921-8, and 54530-7). Three other clusters had χ-like octamers
55
in close proximity (2.5 kb, 0.9 kb, 1.9 kb). The median interval between χ-like octamers in ABL1 was approximately 4.7 kb. The median interval between each breakpoint and its nearest octamer was 4.5 kb, suggesting no significant association.
4.4 ABL-BCR reciprocal breakpoints The BCR-ABL fusion gene is only one of two products of t(9;22). Any duplication or deletion of genetic material can only be identified by comparison of the BCR-ABL gene with its reciprocal ABL-BCR fusion sequence.
4.4.1 Detection of genomic ABL-BCR breakpoints Using the known ABL1 and BCR breakpoints of BCR-ABL the balanced reciprocal ABL-BCR fusion gene sequence was predicted. The most appropriate available primers were used to amplify the predicted product in genomic DNA using long range PCR. A panel of 18 ABL1 forward primers (the ABL1 positive control primers) was used, with additional ABL1 primers added as the work progressed. There were 3 reverse primers in BCR. A new primer was designed in intron 15 to amplify across exon 15 into intron 14. The reverse primer of the RsaI inverse PCR was used to amplify across exon 14 into intron 13. The third primer was in intron 14, approximately halfway between the other two BCR reverse primers. If the location of the BCR-ABL breakpoint was unknown the appropriate BCR reverse primer was used with the panel of ABL1 forward primers, as described in section 4.3.1. ABL-BCR products were sequenced primarily from the panel of BCR primers, in a manner similar to that described for BCR-ABL.
4.4.2 Cytogenetic deletions of der(9) – a negative control for ABL-BCR Cytogenetic deletions of der(9) are reported to occur in 10-20% of CML patients (Dewald et al. 1999; Herens et al. 2000; Sinclair et al. 2000). Screening for der(9) deletions is not a routine part of clinical practice, and in only 8 of the patients (or cell lines) studied was the deletion status known: 5 patients had a cytogenetic deletion of der(9). A sixth patient had a t(1;9;22) variant translocation likely to result in a der(9) deletion (Huntly et al. 2001; El-Zimaity et al. 2004). None of these 6 patients had an identifiable ABL-BCR fusion gene in cDNA or gDNA.
4.4.3 Expression of ABL-BCR mRNA – a positive control for ABL-BCR In some patients the predicted genomic ABL-BCR could not be amplified by long range PCR. In these cases it was not possible to distinguish between failure due to technical factors (e.g. DNA quality, primer location) and those patients that truly lacked the ABL-BCR gene. ABL-BCR mRNA is expressed in around 60% of patients (Melo et al. 1996). ABL1 mRNA occurs in two forms, containing the upstream (Ib) with or without the downstream (Ia) alternative first exon. If the breakpoint is upstream of exon Ia then ABL1 Ib will be fused to BCR. If the ABL1 breakpoint is between exon Ia and exon 2 then alternative splicing will result in a proportion of ABL-BCR containing exon Ib. Hence, all patients who express ABL-BCR mRNA express the Ib variant. If ABL-BCR mRNA is expressed, then genomic ABL-BCR must be present. On the other hand, it is possible that genomic ABL-BCR might be present, but not expressed, so the absence of ABL-BCR mRNA is not an ideal negative control. In the minority of cases where the ABL1 genomic breakpoint is upstream of exon Ib (outside the ABL1 gene) then ABL-BCR will not be expressed, even though a reciprocal fusion product is present on der(9), as was found in patient EH (section 4.2.2.3). If the BCR breakpoint were in exon 15 (BCR b4) ABL-BCR mRNA would not be detected using a reverse primer in exon 15. We found breakpoints
56
in exon 14 (resulting in e13a2 BCR-ABL), and the Flinders group found 2 breakpoints in exon 15 resulting in e14a2 BCR-ABL (P. Bartley, personal communication).
4.4.3.1 ABL-BCR cDNA assay ABL-BCR was detected in random oligonucleotide-primed cDNA using a nested PCR assay. The cDNA samples had previously been used for BCR-ABL RQ-PCR, and all were of adequate quality as determined by the number of BCR transcripts. The first round ABL-BCR primers were those previously published with a forward primer in the 5’ untranslated region of ABL1 Ib, and a reverse primer in BCR exon 15 (Diamond et al. 1995). New nested primers were designed with a forward primer in ABL1 exon Ib and a reverse primer in BCR exon 15. The PCR conditions were the same as those used for the BCR-ABL cDNA nested PCR, and the PCR products were resolved in 2% agarose gel. In most patients with e13a2 BCR-ABL the predicted reciprocal product was Ibb3 (ABL1 exon Ib fused to BCR exon 14; 264 bp). In the two e13a2 patients with breakpoints in exon 14 the predicted reciprocal product was Ibb4. In patients with e14a2 the predicted reciprocal product was Ibb4 (ABL1 exon Ib fused to BCR exon 15; 189 bp). For assay validation the nested PCR was performed using RNA from the following cell lines: MEG-01 and MOLM-1 (e13a2); KU812 (e14a2); and K562 (e14a2 with der(9) deletion: negative control). MEG-01 and KU812 expressed ABL-BCR products of the expected length. Surprisingly, the MOLM-1 e13a2 cell line did not express Ibb3, but a longer ABL-BCR product was identified. All three ABL-BCR products were sequenced. The sequences of Ibb3 and Ibb4 were confirmed, while the longer ABL-BCR product in MOLM-1 was identified as Ibb2 (ABL1 exon Ib fused to BCR exon 13). This means that BCR exon 13 is present in both BCR-ABL and ABL-BCR. The MOLM-1 BCR breakpoint is early in intron 13, and there is a duplication of BCR upstream of the breakpoint, including exon 13 (b2).
4.4.4 Concordance of detection of ABL-BCR in cDNA and gDNA In order to estimate the overall frequency of the presence of the ABL-BCR gene and mRNA expression it was necessary to study an unselected group of CML patients. Samples from cell lines and from patients selected due to their treatment response were excluded, in case this might introduce a bias in the selected population. In 26 newly-diagnosed CML patients the BCR-ABL genomic breakpoint was known and both genomic DNA and cDNA were available. The ABL-BCR genomic sequence was detected in 14/26 patients (54%). ABL-BCR mRNA was expressed in 15/26 patients (58%), consistent with the largest reported series (Melo et al. 1996). In 11/26 patients ABL-BCR cDNA was not detected: in 2 of these patients genomic ABL-BCR was amplified (both with ABL1 breakpoints between exons Ib and Ia), confirming that ABL-BCR mRNA might not be expressed even if the ABL-BCR gene is present. This observation might reflect variant splicing patterns or the disruption of splice sites by the genomic rearrangement. Fifteen patients expressed ABL-BCR mRNA: in 12/15 patients (80%) genomic ABL-BCR was successfully amplified by long range PCR. The remaining 3 patients all expressed Ibb4 ABL-BCR and e14a2 BCR-ABL mRNA. The reason why genomic ABL-BCR could not be amplified in these samples is unclear. The genomic DNA was of good quality, and in each case the primers were positioned so that the predicted amplicon length was <6 kb. The genomic BCR reverse primer was close to exon 15. Exon 15 (b4) was present in the expressed ABL-BCR gene, so there could not have been a large deletion or inversion disrupting the primer site in these cases. On the other hand, these 3 patients all had ABL1 breakpoints at least 90 kb downstream of exon Ib, so there could have been a large (>2 kb) deletion or inversion in ABL1.
57
4.4.5 Distribution of breakpoints in ABL1 and BCR The ABL-BCR fusion gene was successfully sequenced in 21 patients in this laboratory. In combination with the ABL-BCR breakpoints from our UK collaborators the total number of ABL-BCR breakpoints was 36. The breakpoint co-ordinates are detailed in Table 4.3. In general, BCR-ABL and ABL-BCR breakpoints were close together (median 15 bp apart; range 0-1075 bp), so formal assessment of breakpoint clustering and topological associations was not performed for ABL-BCR. Six of 36 BCR breakpoints were in repeat regions (17%) vs 26/36 ABL1 breakpoints (72%). The most common repeat elements at the sites of ABL1 breaks were of the Alu family (n=15). Table 4.3 ABL-BCR breakpoints of 33 CML patients and 3 cell lines Patient BCR after BCR before ABL1 after ABL1 before CML9PG 123590 123591 13399 13400 266 123804 123807 58249 58252 CML9DL 123811 123815 76494 76498 248 123820 123821 9379 9380 483 123857 123861 110284 110288 CML9JES 123893 123894 27604 27605 CML9AM 123897 123898 49067 49068 CL 123964 123965 128812 128813 CML9KV 123966 123967 40135 40136 Meg-01 123982 123985 33300 33303 CML9RKF 123993 123994 15264 15265 KCL22 124008 124009 76941 76942 403 124024 124025 128832 128833 CML9TDB 124083 124084 114943 114944 CML9RB 124098 124101 4312 4315 316 124114 124115 98622 98623 KU812 124502 124504 55805 55806 BT 124530 124532 84602 84604 389 124804 124806 78003 78005 386 124848 124849 14957 14958 1716 125175 125177 106736 106738 PD 125298 125304 16040 16046 1569A 125363 125367 42564 42568 CML9JT 125408 125410 113155 113157 286 125522 125523 2922 2923 436 125806 125809 42392 42395 CML9DP 125917 125918 17070 17071 524 125922 125924 117007 117009 375 126021 126023 86053 86055 MB 126038 126039 57150 57151 470 126289 126291 54196 54198 CML8EH 126385 126386 -7360 -7359 CML8MRT 126498 126500 131768 131770 CML9RAF 126556 126558 57486 57488 CML9DMO 126608 126609 105220 105221 1103 126671 126672 106234 106235
4.5 Characteristics of the fusion sequences of BCR-ABL and ABL-BCR
4.5.1 Microhomology at the BCR-ABL breakpoint is indicative of DNA repair by non-homologous end-joining
The probability of matched nucleotides in BCR and ABL1 at the breakpoint is 25% for one base to 0.1% for 5 bases, assuming a random distribution of nucleotides. One or more matched nucleotides were identified in 58% of all fusions, which is significantly more than expected by chance (p<0.001). There was no difference between BCR-ABL (55/93) and ABL-BCR (18/32) in this analysis (59% vs 56%; p=0.94), so BCR-ABL and ABL-BCR fusions were combined (Figure 4.6). The proportion of breakpoints with one base of homology was not increased above the number expected by chance (actual 33, expected 31.3), suggesting that the end-joining process requires at least 2 bases of homology. Microhomology of 2 bp or more was detected in 40/125 (32%).
0
30
60
90
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 ins
Number of bases of homology
Num
ber o
f jun
ctio
ns
p=0.66
p=0.01
p=0.02
p<0.001
Figure 4.6 Microhomology of 2 or more nucleotides occurs at BCR-ABL and ABL-BCR junctionsThere were 127 BCR-ABL and ABL-BCR fusion genes evaluable for microhomology (after excluding cases with nucleotide insertions, ‘ins’). The number of bases of homology is shown on the x axis, with solid columns indicating the number of cases and hatched columns indicating the expected number of cases. The p-values relate to χ2 tests comparing the observed and expected values. The proportion of patients with >1 nucleotide of homology was significantly increased.
We examined whether the occurrence of breakpoints in repeat regions influenced the pattern of microhomology. Microhomology was present in 36/88 cases with BCR and/or ABL1 breaks in a repeat element (41%), but only in 6/39 cases (15%) if neither breakpoint was in a repeat element (p=0.009). Both cases with more than 6 bp of homology had breakpoints in polyA repeats. These findings suggest that the DNA repair process is altered when a break occurs in a repeat element.
4.5.2 Nucleotide insertions at the breakpoint are uncommon Small insertions, commonly of several bases, may sometimes be seen at recombination sites. The so-called ‘filler DNA’ does not belong to either BCR or ABL1 sequences immediately adjacent to the breakpoint. Ten of 135 fusions (7%) contained nucleotide insertions: 6/99 in BCR-ABL and 4/36 in ABL-BCR. The longest insertion was 11 bp in length, and matched an Alu consensus. The other 9 insertions were ≤ 5bp. No patient had insertions in both BCR-ABL and the reciprocal fusion. Most insertions occurred at breakpoints in repeat elements (8/10 insertions) but this was not statistically significant (8/94 in repeats vs 2/41 not in repeats; p=0.70). Four insertions were of a single nucleotide. In these cases it is possible that the unmatched nucleotide represents a polymorphism in either BCR or ABL1, rather than an insertion. None of the single ‘filler’ nucleotides was matched with a known polymorphism, either listed in the
58
59
annotations to the reference sequence or identified during the sequencing of other CML patients. Nevertheless, as the normal alleles were not sequenced it remains possible that some of these insertions were actually unrecognized polymorphic nucleotides occurring precisely at the breakpoint.
4.5.3 Translocation t(9;22) is usually ‘unbalanced’ at a molecular level Small, apparently random, deletions and insertions are not uncommon at repaired DNA ends. The loss of chromosomal material of up to 20 bases was considered here as ‘balanced’. In contrast, the random gain of material would not be expected to duplicate homologous sequence. In keeping with our definition of significant microhomology (≥2 nucleotides) any duplication of ≥2 nucleotides was considered significant. Seventeen of 36 (47%) translocations were unbalanced with respect to the BCR gene, and the median length of gain or loss was 166 bp. Five of the unbalanced translocations had deletions, and 12 had duplications. In the ABL1 gene there were 26/36 unbalanced translocations (72%): 9 deletions and 17 duplications, with a median gain or loss of 34 bp. There was a trend toward a higher prevalence of genetic imbalance in ABL1 translocations than in BCR (p=0.06), and the average size of the regions of duplication or deletion was smaller in ABL1 (34 vs 166 bp; signed rank test p=0.03). There was no association between the size of the genetic gain or loss and the occurrence of breakpoints in repeat elements. There was no evidence of co-ordinated occurrence of duplication or deletion in the two repaired genes. In the 9 patients with deletions of ABL1 there were 2 BCR deletions and 6 BCR duplications. In the 17 patients with duplications of ABL1 there were 3 BCR deletions and 5 BCR duplications. Among the 9 patients with ABL1 deletions there were 6 patients with one or both breakpoints located in a repeat element in BCR or ABL1. Twelve out of 17 patients with duplications of ABL1 had breakpoints in a repeat element, as did 9/10 balanced translocations. Four of 5 patients with BCR deletions had one or both breakpoints located in a repeat element, vs 10/12 patients with duplications, and 13/19 with balanced translocations. There was no evidence that unbalanced translocations were associated with breakpoints in genomic repeat regions in either BCR or ABL1 (p=0.45, p=0.39, respectively).
4.6 Conservation of the fusion sequence in amplified BCR-ABL genes Amplification of the BCR-ABL gene is associated with resistance to treatment in a minority of chronic phase CML patients. Genomic amplification is a sign of global genomic instability, and therefore such patients might harbour secondary alterations in the intronic breakpoint regions, acquired after the translocation event. If this were the case, a quantitative method based on the intronic breakpoint sequence might be insensitive to a rising number of leukaemic cells with clonal evolution, due to disruption of primer binding. In order to investigate whether the BCR-ABL breakpoint was commonly mutated in a setting of genomic instability the breakpoint sequences were determined in 5 BCR-ABL cell lines (MOLM-1, MEG-01, KCL22, KU812, and K562), all of which have amplified BCR-ABL genes. Quantitative DNA PCR was used to estimate the average number of copies of the BCR-ABL gene in the K562 cell line, chosen for its high BCR-ABL copy number and complex, unstable karyotype.
4.6.1 Cytogenetic and molecular characterization of BCR-ABL cell lines Karyotypic analysis was performed by M Nicola (IMVS cytogenetic laboratory) using standard cytogenetic procedures. The karyotype of each cell line is shown in Table 4.4.
Table 4.4 Karyotypes and breakpoint sequences of five BCR-ABL cell lines: Nucleotides in lower case are homologous in BCR and ABL1 at the breakpoint junction (not duplicated), and it is not possible to determine the precise nucleotide position of the break in these cases. Cell line Karyotype
BCR sequence 5’ of breakpoint
ABL1 sequence 3’ of breakpoint
MEG-01 97~100, <4n>, XX, -Y, -Y, -1, der(1)t(1;2)(p21;q21), der(2;14)(q10;q10)x2, +6, +6, -7, +8, +8, add(8)(p13), -9, t(9;22)(q34;q11.2)x3, -10, -10, -10, add(10)(p12), +11, del(11)(q13q23)x2, -12, -13, -13, add(13)(q34), +17, +19, +19, +19, +19, +19, add(19)(p13.1)x2, add(19)(q13.1), +21, +21, -22, +der(22)t(9;22), +9mar[cp8]
TCCTCAGATGCT gttcaagcgatt
MOLM-1 63,X, +1, der(1;8)(q10;q10), der(1)t(1;8)(q1?2;q22), add(2)(q32), inv(3)(q21q26)x2, add(5)(q11), -7, +9, add(9)(q13), t(9;22)(q34;q11.2), del(11)(p1?2), -12, -14, -16, add(17)(q?21),-18,der(19)t(11;19)(q13;p13.3), -20, der(22)t(9;22), +der(22)t(9;22). ish der (1)t(1;8)(c-MYC+), add(9)(ABL1-,BCR-), add(17)(wcp17-)[16]/63, sl, der(1)t(1;17)(q10;q10), -der(1;8)(q10;q10), add(8)(p21), +mar[cp4]
TTGATGGGACTAg gggtttCaccctg
K562 67~70, XX, -X, add(2)(q3?3), -3, +5, add(5)(q11.2), ins(6;?)(p21;?), +7, der(7)t(7;7)(p1?1.1;q22), -9, del(9)(p13), der(9)t(9;9)(p1?3;q22), der(10)t(3;10)(p21;q2?3), -13, add(13)(p11.2), -14, +17, der(17)t(10;17) (q11.2;q11.2)der(10)t(3;10),der(17)t(17;20)(p11.2;p11.2), +19, -20, ?der(21)t(1;21)(q21;p11.1),-22, +4mar.ish add(2)(BCR+, ABL1+, BCR con ABL1x1), add(5)(D5S23+,EGR1-), der(9)t(9;9)(ABL1++), der(17)t(17;20) (TP53-), der(17)t(10;17)der(10)t(3;10)(p53+), mar1(BCR+, ABL1+, BCR con ABL1++++), mar2(BCR+,ABL1+, BCR con ABL1++++)[cp7]
CTGGCCGCTGTGgagtg gagtgGGTTTTATCAGC
KU812 60, XYY, -2, -3, add(4)(p11), -5, +6, -7, +8, -9, t(9;22)(q34;q11.2)x2, -10, i(11)(q10), -12, -16, del(17)(q11.2q24), i(17)(q10), -18, +19, -20, -22. ish del(17)(TP53+), add(4) (p11)(wcp4-)[18]/60, sl, +19[2]
GCTGCCCCCTGC ttaaacagaaat
KCL22 48~50, XX, -X, +1, add(1)(p11), +6, der(6;13)(q10;p10), der(6;13)(q10;p10) del(13)(q12q34), +8, +8, der(8)t(8;21)(p23;q11.2), t(9;22)(q34;q11.2), inv(10)(p11.2q22), del(13)(q1?4q34), del(13)(q21q34), del(13)(q3?2q34), add(17)(p11.2), +der(22)t(9;22).ish der(8)t(8;21)(RUNX1T1+,RUNX1+), del(13)(D13S319+,13q34-), del(13)(D13S319+,13q34-)[cp10]
CACTCCCGTCCT attacagaagta
60
61
All were consistent (although not identical) with their original karyotypes (Kubonishi and Miyoshi 1983; Kishi 1985; Ogura et al. 1985; Matsuo et al. 1991; Naumann et al. 2001), likely reflecting the inherent genetic instability of the cell lines. The BCR-ABL gene was amplified in all cell lines, ranging from 2 copies in KU812 to at least 20 copies in K562. In the K562 cell line the precise number of copies of BCR-ABL could not be determined either by karyotyping or by FISH due to the presence of homogeneously staining regions of amplified BCR-ABL. Genomic DNA of each cell line was extracted from 2 x 106 cultured cells. Screening for the BCR-ABL breakpoint was performed using long range PCR. All five cell lines gave a BCR-ABL product ranging in size from around 2 to 10 kb. For each cell line a pair of breakpoint-specific primers was designed to amplify a region of 250-450 bases flanking the BCR-ABL fusion, and the product was sequenced for confirmation. The BCR and ABL1 breakpoints are shown in Table 4.2. Direct sequencing did not identify mutations in the breakpoint-flanking region in any of the five cell lines. The breakpoint in our K562 cell line was identical to that published over 10 years ago (Chissoe et al. 1995). The number of copies of BCR-ABL in K562 was estimated using real-time Q-PCR. Serial ten-fold dilutions of K562 DNA were prepared from 50 ng/µL to 0.5 pg/µL. A pair of K562-specific primers was designed to yield an amplicon of 76 bp with a TaqMan probe spanning the BCR-ABL fusion. A 2.5 µL aliquot of DNA was used in a total reaction volume of 25 µL, and the reaction was performed in triplicate. K562 BCR-ABL was detected at a limit of 1.25 pg. The average amount of DNA per K562 cell was estimated at 27.6 pg (based on spectrophotometry of DNA extracted from 2 x 106 K562 cells). Consequently, the lowest positive dilution contained the equivalent of 0.045 K562 genomes. Assuming that the Q-PCR assay can detect a single copy of BCR-ABL, this would yield an estimate of ≥22 copies of BCR-ABL per cell (Ross et al. 2009), which is consistent with the copy number estimated by FISH.
4.7 Discussion The detailed characterization of patient-specific BCR-ABL genes contained in this chapter is more extensive than any published series to date. These data 1) inform the design of strategies to improve the detection of BCR-ABL, and 2) provide information on the BCR-ABL recombination that may lead to new avenues of investigation of DNA repair mechanisms in CML.
4.7.1 Methods for the detection of genomic BCR-ABL When DNA was extracted from fresh or cryopreserved leukaemic cells the long range PCR method for the detection of BCR-ABL breakpoints had a success rate of over 95%. Overall, we were able to detect the breakpoints of 50 out of 56 patients studied. The principal methodological conclusion from this study was that the quality of the DNA is paramount: 5 of the 6 samples in which the breakpoint could not be identified by any method were from degraded sources of DNA. A considerable amount of time was invested in repeated attempts to detect BCR-ABL in partially degraded DNA, with limited success. It is not only the integrity of the DNA preparation that is important, but also the ratio of leukaemic to normal cells. A specific PCR requires that the target is amplified more efficiently than less specific regions to which the primers might share homology. If leukaemic targets are rare in the DNA mixture it may not be possible to amplify the region of interest. Inverse PCR is designed so that the normal BCR fragment should be amplified in all cases, unless there is a leukaemic amplicon smaller than the BCR control amplicon, and sufficiently abundant. In long range
62
PCR it was possible to amplify BCR-ABL even when it was present at a low level, so this would likely be the better approach if it were necessary to screen samples with a minority of leukaemic cells. Non-specific amplification is likely to be problematic in such samples. If this method were used in the long term it would be worthwhile to identify problematic primers (such as ABL1 D1, which also functioned as a BCR reverse primer) and re-design them. Computer software may aid in the design of more specific primers, but ideally each primer combination should be tested in normal DNA to select the combinations with the lowest rate of non-specific amplification. An alternative is to use nested PCR, as in the method of Morley and colleagues (Morley et al. 2008), to select the amplification of specific BCR-ABL products. As the number of patient-specific breakpoints increased it was possible to make a number of minor modifications to the long range PCR breakpoint screening method that should improve its overall success rate. Some of the findings that informed the breakpoint screening strategy were not strictly novel, but had perhaps been overlooked due to the relative paucity in recent years of studies focussing on genomic BCR-ABL. For instance, it was reported in 1991 that approximately 10% of chromosome 9 breakpoints occur upstream of the ABL1 gene (Morris et al. 1991), but our first ABL1 screening primer was downstream of exon Ib. In our 100 patients we identified only 2 breakpoints upstream of ABL1. This is fewer than would be predicted, suggesting that the addition of a reverse primer upstream of exon Ib might improve the success rate of detecting BCR-ABL. In order to understand the causes of failure of the breakpoint screening method it was necessary to find the breakpoint by an alternative method. In two cases the BCR-ABL breakpoint was identified only by the multiplex PCR method of the Flinders University group. The long range PCR method failed because the ABL1 breakpoints of those two patients were at sites of primer binding. Such failures could be overcome by increasing the density of primers in ABL1. If the number of ABL1 primers were doubled, so that the maximum amplicon length were around 6 kb, the rate of failure (in samples with good quality DNA) would have reduced from 3/49 to 1/49 (2%) or less. In addition, the smaller BCR-ABL amplicon size might prove helpful for those samples with partially degraded DNA in which longer fragments are not amplified efficiently. In one additional case it was possible to identify BCR-ABL only because ABL-BCR was identified. By chance there will be cases in which the ABL-BCR breakpoints lie closer to their respective primers than the BCR-ABL breakpoints. Apart from these 3 patients, there were no others in which the long range PCR BCR-ABL breakpoint screening method failed and another method succeeded. Consequently, it has not been possible formally to analyse the causes of method failure in most patients. A disadvantage of the inverse PCR method was the large amount of DNA required: whereas the long range PCR method used less than 1 μg genomic DNA in total, the inverse PCR method used at least 5 μg. In inverse PCR the BCR breakpoint cannot be detected unless it lies between the forward primer and the next restriction site. Additionally, if the breakpoint in the ABL1 gene lies more than about 1 kb from the nearest ABL1 restriction site the amplicon will not be amplified efficiently. Mattarucchi et al. used a restriction digestion method using a much smaller amount of DNA (Mattarucchi et al. 2008). It might be possible to adapt the inverse PCR method to use a smaller amount of DNA, and this would be of practical benefit. Such an approach is probably necessary to ensure that there is sufficient DNA to enable digestion of multiple DNA aliquots with different restriction endonucleases in order to increase the range of breakpoints that can be detected. Finally, any recombination identified by inverse PCR must be confirmed by an alternative method because inter-Alu recombination artefacts during DNA ligation may mimic true translocations (Barjesteh van Waalwijk van Doorn-Khosrovani et al. 2008).
63
4.7.2 Clustering of breakpoints in BCR and ABL1 Breakpoints in BCR and ABL1 are non-random, and we identified 7 putative clusters in BCR, and 7 in ABL1. Breakpoints were approximately 3 times more frequent in these clusters than elsewhere in the major breakpoint regions. The distribution of translocation breakpoints might be influenced by the method used for breakpoint detection. This must obviously be true for the inverse PCR method using restriction endonuclease digestion with the enzyme, RsaI. Breakpoints outside the restriction fragment can never be identified by this method. In contrast, if a method were able to detect all BCR-ABL breakpoints there would be no bias. The overall success rate of the long range PCR screening method was in excess of 90%, and therefore the distribution of breakpoints discovered by long range PCR should be representative of the overall distribution. It is inevitable that breakpoints will be under-represented in the areas where ABL1 reverse primers are situated, and immediately downstream of these sites where amplicon length may result in low PCR efficiency. Any conclusions concerning the distribution of breakpoints should be tested in an independent set of CML breakpoints, preferably identified using a different method. Genomic repeat elements in ABL1 are very common, so the risk of false positive associations between repeats and breakpoints must be high. Mattarucchi and colleagues attempted to overcome this problem by applying r-scan statistics (Mattarucchi et al. 2008). This method uses the distance between markers in a DNA fragment to generate a score that reflects the strength of association between the markers. They found a significant association between repeat elements and breakpoints in 60% of patients. In contrast, we found that breakpoints occurred in repeat elements no more often than would be predicted by chance. It remains possible that genomic repeats might be involved in the formation of a higher order DNA structure that influences the location of a breakpoint outside of the repeat element itself, in the surrounding DNA. We also could not exclude the possibility that specific repeat elements are of significance, as the number of any individual type of repeat was small. Local sequence homology between repeat elements does not appear to be a significant risk factor for BCR-ABL translocation events: translocations in which both breakpoints were in repeat regions were uncommon. This finding is consistent with a mammalian cell line model of Alu-mediated recombination after double strand breaks, which showed that the frequency of inter-Alu recombination events was unaltered by homology between Alu elements (Elliott et al. 2005). Translocations in cells of B lymphoid lineage have been studied extensively because of their role in immunoglobulin gene rearrangement and isotype class switching, which require the induction and repair of DNA strand breaks: activation-induced cytidine deaminase (AID) induces instability at cytosine residues, and the recombination-activating gene (RAG) complex induces double strand breaks (Tsai et al. 2008). CpG dinucleotides were reported to be over-represented in translocations associated with B lymphoid neoplasms, but not in a series of 35 CML patients (Tsai et al. 2008). A FISH-based study found that breakpoints were more likely in GC-rich regions of the genome (Fisher et al. 2005), but this was not confirmed in a more recent study using the sequence of the region surrounding the breakpoints (Mattarucchi et al. 2008). Neither of these studies examined the relationship of breakpoints to the CpG dinucleotide. In keeping with the original observation of Tsai and colleagues we found no association between CpG repeats and BCR-ABL breakpoints in CML patients. Similarly, we found no association between immunoglobulin recombination heptamers and breakpoint location. The activity of AID and RAG is restricted to the B cell lineage, and is unlikely to be relevant in the common myeloid-lymphoid progenitor of CML, but might be relevant in Ph-positive precursor B cell acute lymphoblastic leukaemia. Other DNA topological elements that have been implicated in oncogenic translocations include topoisomerase cleavage sites, scaffold attachment regions, and χ-like octamers. There
64
is a topoisomerase consensus and DNase I hypersensitivity site in BCR intron 13, but the majority of BCR breakpoints in chronic phase CML patients are in intron 14. BCR-ABL-positive leukaemia is not seen as a secondary neoplasm after topoisomerase inhibitor therapy. We found two ABL1 breakpoint clusters associated with χ-like octamers, but we were unable to demonstrate a significant association between this recombination motif and BCR-ABL breakpoints. It is possible that a more sophisticated bioinformatic analysis would reveal associations between subsets of breakpoints and specific motifs. We have approached a group with expertise in bioinformatics to perform a formal statistical analysis of breakpoint clustering and association with known or novel motifs. We have been unable to find any DNA element that is involved in the genesis of the Ph rearrangement, and it is possible that the precise nucleotide position of each BCR-ABL DNA breakpoint in CML is more or less random.
4.7.3 Deletions, duplications, microhomology, and DNA repair In 1993 a study using restriction enzyme digestion and Southern blotting found that the same BCR sequence was present in both BCR-ABL and ABL-BCR in 3/46 CML patients (7%). This was confirmed by sequencing of one of the cases with a duplication of 258 bp. (Litz et al. 1993). With the higher resolution of sequencing we have shown that duplications of at least 2 bp were present in BCR in a higher proportion of patients than previously reported (12/36; 33%) with the majority of duplications >20 bp in length. We have shown that duplications occur at a similar frequency in the ABL1 gene: duplications of at least 2 bp were found in 17/36 patients. It is hypothesized that genomic duplications at a translocation junction arise from staggered DNA breaks (Zhang et al. 1995; Gillert et al. 1999). In this model two single stranded breaks occur some distance apart and the intervening area is replicated at both DNA ends using the complementary strand as the template. Small duplications have also been reported in other leukaemia-associated translocations (Gillert et al. 1999; van der Reijden et al. 1999; Wiemels and Greaves 1999; Reiter et al. 2003). Staggered breaks at a distance of several bp may be caused by topoisomerases (Buhler et al. 2001) or restriction endonucleases, but the cause of more widely separated breaks is not known. Random DNA damage (e.g. due to reactive oxygen species or ionizing radiation) could potentially cause widely staggered breaks due to multiple simultaneous lesions. Data from in vitro models of DNA repair suggest that NHEJ may be the major mechanism of DNA repair in human cells (McVey and Lee 2008). The rapid repair of free DNA ends is critical to prevent genomic instability, and the classical NHEJ pathway (DNA protein kinase dependent) repairs most strand breaks within approximately 10-20 minutes of irradiation (Iliakis et al. 2004). Although NHEJ is error-prone the limited spatial territories of chromosomes should ensure that in most cases the repair is intrachromosomal (Soutoglou et al. 2007). Typically, the NHEJ pathway results in deletions of only several nucleotides, and occurs at sites of up to 5 bp of microhomology, as we observed in the translocation sequences of around one-third of our CML patients. Significant microhomology was present in 32% of fusions, and small DNA insertions (also a feature of NHEJ) were present in an additional 7%. Different definitions of microhomology have been used by different authors. We have used a very narrow definition of homology considering only the very ends of the ligated DNA, and excluding homology in the flanking sequence. We found that a single base of homology at the breakpoint was seen no more often than would be predicted by chance, and incorporated this into our definition of significant microhomology. Taking this into account the frequency of microhomology in this study was comparable with previous reports in smaller numbers of CML patients (Chissoe et al. 1995; Mattarucchi et al. 2008), and in other translocations associated with acute leukaemia (Wiemels and Greaves 1999; Reiter et al. 2003).
65
There is evidence from in vitro models of DNA repair that DNA repair pathways may sense and adapt to the specific type of damaged DNA sequence (Elliott et al. 2005). We found that the occurrence of breakpoints at sites of genomic repeat elements increased the rate of significant microhomology, consistent with an effect of the local sequence on the mechanism of DNA repair. An alternative explanation for the increased rate of microhomology might be that sequence homology is shared between repeats, increasing the likelihood of matched sequence at the breakpoint. This seems less likely, as few patients had repeat elements of the same family in both BCR and ABL1. In an experimental model of DNA strand breaks and repair it was found that translocations were more likely to have significant deletions (>20 bp) than intrachromosomal repairs (Weinstock et al. 2006). One-third of the 36 patients in whom we sequenced both BCR-ABL and ABL-BCR had deletions in excess of 20 bp. In 46% of our series of 26 newly diagnosed CML patients the predicted ABL-BCR gene was not detected: presumably, most of these cases carry deletions of the reciprocal fusion gene. Therefore we estimated that around 80% of translocations had deletions, varying in size from 20-30 bp up to megabases (in patients with cytogenetic der(9) deletions). There is significant heterogeneity in the precision of DNA repair at the time of forming BCR-ABL. Genetic instability is associated with the progression of CML to advanced phase (Melo and Barnes 2007). If there were an underlying defect in DNA repair preceding the BCR-ABL translocation this might help to explain the adverse prognosis seen in IFN-treated CML patients with large der(9) deletions. There is epidemiological evidence of an inherited predisposition to myeloid lineage malignancies (Landgren et al. 2008), but there have been no studies to investigate a potential aetiological role of specific DNA repair genes in CML.
4.7.4 The ABL-BCR gene In a subset of patients we screened for ABL-BCR in genomic DNA, and in one case we were able to find BCR-ABL only by using the identified reciprocal breakpoints to design a new ABL1 reverse primer for the appropriate region. ABL-BCR mRNA can be identified in around 60% of patients, and is a helpful indicator of the site of the ABL-BCR fusion. In a minority of patients who did not express ABL-BCR mRNA we were, perhaps unexpectedly, able to detect the ABL-BCR gene. One such patient had an ABL1 breakpoint upstream of exon Ib. In other patients a ‘normal’ ABL-BCR gene was sequenced, but the mRNA was apparently not expressed. Therefore, the absence of ABL-BCR mRNA does not equate with der(9) deletion either at a cytogenetic (de la Fuente et al. 2001) or molecular level. The group of patients in whom we screened for the ABL-BCR gene was a subset of the 100 patients for whom we had BCR-ABL breakpoint sequences, and some of these patients were selected for having a good response to therapy. In an unselected group of 26 patients with BCR-ABL breakpoints we could detect the ABL-BCR gene in 54%. Like ABL-BCR mRNA expression, these data show that deletions (or perhaps inversions) of der(9) are significantly more frequent than deletions of der(9) detected by FISH. There is presumably a spectrum of deletion size ranging from hundreds of bases (detected by sequencing) up to millions of bases (detected by FISH) Approximately 30% of CML patients do not express ABL-BCR mRNA, and do not have deletions of der(9) detectable by FISH. In this group it would be helpful to have an alternative test, such as multiplex ligation-dependent probe amplification, to confirm the presence of a gene deletion. The mechanism underlying the adverse prognosis of the der (9) deletion in -treated patients is unclear, and der(9) deletions detected by FISH lack prognostic significance in imatinib-treated CML patients (Huntly et al. 2003; Quintas-Cardama et al. 2005). We have sequenced the ABL-BCR gene in newly-diagnosed patients commencing imatinib treatment, but we do not yet have follow-up data to indicate whether smaller deletions of the reciprocal fusion gene (identified by sequencing) have any prognostic relevance.
66
4.7.5 Implications for the detection of MRD The BCR-ABL breakpoints in BCR were tightly clustered, and some patients shared BCR breakpoints. A consequence of breakpoint clustering is that the probability of two patients sharing a breakpoint sequence is increased, and the specificity of the patient-specific breakpoint sequence is reduced. However, breaks in ABL1 were much more widely dispersed, and no two patients had the same ABL1 breakpoint. Each of the 100 BCR-ABL breakpoints that we studied had a unique sequence. If the BCR-ABL fusion sequence is to be used as a long-term marker for MRD monitoring it is essential that the breakpoint sequence should be highly conserved. We showed that the intronic fusion sequences of BCR-ABL were conserved even in BCR-ABL cell lines with a high rate of genomic instability. Most intronic mutations would be expected to be functionally silent, so there should be no positive selection of clones with mutations in the breakpoint region. Exonic breakpoints might alter function, but we have not yet seen an exonic breakpoint in ABL1, and the BCR breaks in exon 14 resulted in splicing out of the damaged exon with the expression of ‘normal’ e13a2 BCR-ABL. Direct sequencing can detect mutant sub-clones at a ratio of approximately 10-20%. Whilst we cannot exclude the presence in the cell lines of an additional clone with a mutation or deletion spanning the binding regions for one or both breakpoint primers the quantitative PCR results for K562 BCR-ABL indicate that the same breakpoint sequence was present in the majority of the BCR-ABL genes in the majority of cells. The risk of under-estimating the proportion of BCR-ABL cells in clinical samples due to a mutation of the BCR-ABL sequence must be very small. Whether the quantification of BCR-ABL DNA could detect genomic amplification in patient samples is an unanswered question. The emergence of Ph duplication in a sub-clone of leukaemic cells would probably result in a change in MRD estimation within the limits of error of real-time PCR, and therefore undetectable by this method. Outside the setting of MRD, a potential use of the BCR-ABL breakpoint sequence is to identify CML cell lines, and to detect contamination of cell cultures. The use of incorrectly identified cell lines could invalidate the results of published research (Chatterjee 2007), and there have been moves to recommend or require definitive identification of cell lines (United States National Institutes of Health NOT-OD-08-017, 2007). This typically requires the analysis of multiple polymorphic loci, as in paternity testing, but for CML cell lines it would be faster and simpler to use the published BCR-ABL breakpoint sequence. If a patient has both BCR-ABL and ABL-BCR it should, in principle, be possible to use either gene for the monitoring of the CML clone. ABL-BCR mRNA is not a suitable target for MRD monitoring. The expression level of ABL-BCR is under the control of the ABL1 promoter, and ABL1 mRNA is known to be relatively less abundant than BCR (Beillard et al. 2003). Genomic BCR-ABL and ABL-BCR are present in identical numbers of cells in most cases (excepting der(9) deletions and BCR-ABL amplification). Nevertheless, BCR-ABL is a preferable target for disease monitoring because it is pathogenetically related to the clonal disorder. In rare cases der(9) deletion has been reported as a clonal evolution event (Rudduck-Sivaswaren et al. 2005; Xinh et al. 2006), and it is possible that ABL-BCR might be lost during the follow-up of a patient, leading to under-estimation of the burden of residual disease. On the other hand there are some patients in whom highly conserved repeat regions preclude the design of specific primers to the BCR-ABL breakpoint region, or in whom a low GC content in the breakpoint region results in a melting temperature below that required for the binding of a real-time PCR probe. In selected patients the ABL-BCR fusion gene might be a preferable target for MRD studies.
67
4.8 Publication of findings and contributions of co-authors The study examining the conservation of the BCR-ABL fusion sequence in the genetically unstable environment of the K562 cell line was published as a letter in Cancer Genetics & Cytogenetics (2007 Impact Factor 1.6). David Ross conceived the project, planned and conducted the PCR experiments, analysed the data and wrote the manuscript. Mario Nicola performed the cytogenetic analysis of the cell lines. Joannah Score designed the original set of long range PCR BCR-ABL screening primers. Timothy Hughes and Susan Branford oversaw the project and were involved in writing the manuscript.
68
69
5 Development of a quantitative PCR method for the detection of BCR-ABL DNA
5.1 Rationale The primary aim of this study was to develop a more sensitive method for the detection of MRD in CML. An efficient way to achieve a lower limit of detection of BCR-ABL would be to perform replicate PCR tests (Ross et al. 2009). Replicate RT-PCR is problematic because of the risk of false positive results due to cross-contamination of samples. Rare BCR-ABL transcripts are sometimes present in normal cells (Biernaux et al. 1995; Bose et al. 1998), and this phenomenon may impose a threshold on the detection limit that can be achieved using highly sensitive RT-PCR in CML patients. Therefore, we decided to use the patient-specific sequence of the BCR-ABL gene for the detection and quantification of MRD.
5.1.1 Established methods for the quantification of CML cells RQ-PCR for BCR-ABL mRNA has become a routine method for the measurement of disease burden in CML patients. BCR-ABL levels measured by RQ-PCR correlate well with conventional cytogenetic monitoring, and provide powerful prognostic information (Ross and Hughes 2008). Despite this, the relationship between the two measurements is not simple: a MCR represents <35% of the average proportion of leukaemic cells at diagnosis, whereas the equivalent value in RQ-PCR is <10%. Both karyotyping and RQ-PCR are, in a sense, functional assays (reflecting proliferative capacity and mRNA expression levels, respectively), and therefore provide an indirect measurement of the proportion of leukaemic cells in a sample. Karyotyping measures the proportion of Ph-positive cells in a mixed population of metaphase cells. Cells that cannot be induced to undergo mitosis are not counted, so karyotyping reflects a population that is less mature (myelocytes and earlier) and has higher proliferative activity. Karyotyping typically measures only 20 cells, and therefore the confidence interval of the result is wide. CCR is often referred to as a ‘gold standard,’ as if the absence of leukaemic cells were absolute, but this is an over-simplification. Sampling error can be estimated using the probability mass function (Colton 1974): if no Ph-positive cells are detected in 20 metaphases there is a 95% probability that the true proportion of Ph-positive metaphases in the sample is <14% (Figure 5.1). The BCR-ABL level by RQ-PCR is a ratio of the number of BCR-ABL transcripts to the number of control gene transcripts. The BCR-ABL ratio will depend on the proportion of leukaemic cells, and on the relative expression of BCR-ABL and the control gene in each cell. In addition to the biological variation in BCR-ABL levels, there is significant variability in the RQ-PCR assay itself, with up to 5-fold variation commonly reported as within the limits of error of the test (Baccarani et al. 2006). Despite these limitations, RQ-PCR should be more accurate than karyotyping because it samples the mRNA content of thousands of cells, thereby reducing the sampling error, and lowering the detection limit. FISH analysis of CML patient samples typically examines up to 300 interphase cells, so the precision and detection limit of the test are intermediate between karyotyping and RQ-PCR. In 98 samples a comparison of karyotyping and interphase FISH showed that a CCR was approximately equivalent to ≤8% Ph-positive cells (Cuneo et al. 1998), consistent with the statistical estimate given above. Near to the level of CCR karyotyping consistently under-estimated the proportion of Ph-positive cells. Interphase FISH for BCR-ABL differs from both
karyotyping and RQ-PCR in that it directly counts Ph-positive cells. In 7 newly-diagnosed chronic phase CML patients with >95% Ph-positive metaphases the proportion of BCR-ABL-positive interphase cells in the bone marrow ranged from 62 to 90%, with a similar proportion in the peripheral blood (Tefferi et al. 1995; Haferlach et al. 1997), indicating that karyotyping may over-estimate the proportion of Ph-positive cells at diagnosis.
Figure 5.1 Prediction of sampling error using the Poisson distributionThe formula for calculating the probability mass function is shown, together with a plot of the probability of observing at least one positive result (y axis) according to the number of replicate tests performed (x axis). If, on average, 1 sample in 10 contains 1 copy of BCR-ABL(λ=0.1) thirty replicates are needed to give a 95% probability that if the test is negative the sample is negative.
Probability mass functionThe probability of observing precisely k random occurrences when the probability of observing one occurrence in the specified interval is λ is given by the formula:
where e is the base of the natural logarithm.
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
0 5 10 15 20 25 30 35 40
Number of samples
Prob
abili
ty o
f obs
ervi
ng a
t lea
st o
ne e
vent
=1.0
=0.1
FISH can also be used to investigate the clonality of small numbers of selected cells. Flow-sorting of different cell types for FISH demonstrated that the average proportion of clonal leukaemic cells was highest in immature granulocytes (90-98%), and lowest in lymphocytes (37%) (Haferlach et al. 1997). Quantitative DNA PCR using real-time fluorescence should combine the advantage of FISH (direct quantification of leukaemic cells) with the sensitivity of real-time PCR.
70
71
5.1.2 BCR-ABL mRNA expression levels A theoretical advantage of mRNA versus DNA for the monitoring of MRD is that a single leukaemic cell may contain multiple copies of the oncogene transcript, whereas there is (in most cases) only one copy of the BCR-ABL fusion gene. Of particular relevance to MRD studies, it was reported that CML progenitors may be transcriptionally silent (Bedi et al. 1993; Keating et al. 1994), and this might result in the under-estimation of MRD by RT-PCR. More recent work has shown increased levels of BCR-ABL transcripts in primitive or quiescent leukaemic cells that survive after kinase inhibitor therapy (Holyoake et al. 1999; Jiang et al. 2007) Inadequate controls for the sensitivity of the RT-PCR methods used in the earlier studies may explain the discrepancy between these studies (Diamond et al. 1995; Zhang et al. 1996).
5.1.3 BCR-ABL DNA PCR monitoring There is only one published study of genomic DNA PCR for the monitoring of CML (Zhang et al. 1996). This study compared qualitative nested PCR for BCR-ABL DNA with competitive RT-PCR for BCR-ABL mRNA. Ten patients were each tested on several occasions after receiving an allograft. In 24 samples, where DNA and RNA were collected on the same day, 19 samples gave concordant results with both methods; 3 were DNA-positive RNA-negative; 2 were RNA-positive DNA negative. For MRD analysis up to 2 μg genomic DNA was used: based on an estimate of 7 pg DNA per cell using spectrophotometry (Ausubel et al. 1988) this would equate to a detection limit of 5.5 log. The results indicated that DNA PCR was at least as sensitive as RT-PCR, but the DNA method was not quantitative. In the years since that study was published RQ-PCR has replaced competitive RT-PCR, and current RT-PCR methods might be more sensitive.
5.1.4 DNA Q-PCR for the monitoring of MRD in other types of leukaemia DNA PCR using the immunoglobulin gene rearrangement in neoplasms of B cell lineage has been studied extensively for the quantification of MRD. The immunoglobulin gene rearrangement is a unique marker of clonality. In childhood precursor B cell acute lymphoblastic leukaemia (ALL) real-time DNA PCR typically achieves a reliable lower detection limit of 10-4 using triplicate analyses with 500 ng DNA in each real-time PCR (van der Velden et al. 2007; van der Velden et al. 2007). The level of MRD determined by DNA PCR has been shown to influence prognosis in several clinical studies of paediatric ALL (Cave et al. 1998; Marshall et al. 2003), and more recent work has extended these findings to standard risk ALL in adults (Bruggemann et al. 2006).
5.2 Real-time Q-PCR for BCR-ABL DNA
5.2.1 Design of primers and probes for real-time Q-PCR The known sequence of the patient-specific BCR-ABL breakpoint was used to design a pair of PCR primers flanking the breakpoint with a target amplicon length of <350 bp. The forward primer was in BCR and the reverse primer was in ABL1. This DNA breakpoint fragment was amplified, and direct sequencing was used to confirm the identification of the breakpoint-flanking region. Subsequently, nested primers and a TaqMan® probe for real-time PCR were designed. The target length of the real-time PCR amplicon was <120 bp. As far as possible, the forward primer was in BCR and the reverse primer was in ABL1, with the probe spanning the breakpoint to maximize specificity (see example in Figure 5.2). This was not always possible due to the frequency of repeat regions, local variations in melting temperature (GC content) and amplicon length constraints. In such cases either the real-time forward or reverse primer was situated over the breakpoint. The Basic Local Alignment Search Tool software
(BLAST, available at www.ncbi.nlm.nih.gov) was used to give an indication of the degree of specificity of the primer target sequences (Altschul et al. 1990). If there were multiple matches for a candidate primer then the primers were, wherever possible, re-designed to increase specificity. In rare cases it was not possible to meet all of these design requirements. Even if one or both primers were situated in a repeat region, specificity should still be conferred by the primer pair and probe, and in nested PCR by the selective amplification of the target region in the first round PCR.
Figure 5.2 Design of primers and probe for real-time PCRPatient JT is shown as an example. The first 200 bp of sequence are in BCR and the second 200 bp are in ABL1. The forward primer is in BCR, the probe spans the breakpoint with 5 bp in BCR and 22 bp in ABL1. The reverse primer is in ABL1.
BCR
ABL1
5.2.2 Details of patient-specific amplicons Patient-specific primers and probes were used in 33 CML patients and two BCR-ABL cell lines, K562 and MOLM-1. The real-time PCR amplicon length ranged from 63 to 130 bp (median 85 bp). The longer first round amplicon ranged from 177 to 392 bp in length (median 253 bp). The TaqMan® probe spanned the breakpoint in 24/35 patients: the remaining 11 probes were wholly in BCR (n=8) or wholly in ABL1 (n=3). If the probe did not span the breakpoint the probe was preferentially located in BCR due to the lower frequency of genomic repeat elements in the BCR breakpoint region.
5.2.3 Real-time DNA PCR method Real-time DNA PCR was performed using the patient-specific primers and TaqMan® probe following the manufacturer’s recommended concentrations of reagents using an ABI 7500 thermal cycler. The reaction volume was 25 μL containing 2.5 μL gDNA. Baseline fluorescence was determined from cycle 3 to 15. As a negative control real-time PCR was performed using normal DNA pooled from at least 5 individuals. If any non-specific amplification was observed in normal DNA the highest level (lowest Ct) at which this occurred was used to set the negative threshold. Any sample with a Ct >40 was considered negative, as in our standard BCR-ABL RQ-PCR assay. The BCR-ABL DNA level in each sample was determined using a patient-specific standard curve. The standard curve was constructed using dilutions of gDNA from the sample used to
72
detect the breakpoint, usually collected at the time of diagnosis. The patient’s diagnostic DNA was serially diluted 10-fold in a standard diluent solution consisting of buffered salmon DNA. In initial experiments the highest BCR-ABL standard for each patient was adjusted to contain 50 ng/μL DNA so that results could be compared between patients.
5.2.3.1 Initial results
73
Real-time PCR was performed using DNA from the K562 cell line, and from 3 CML patients who had achieved a CMR defined by RQ-PCR (Figure 5.3). Real-time PCR was performed in triplicate. The slope of the standard curve gives an indication of the efficiency of PCR. With optimal efficiency each cycle reflects a two-fold difference in copy number, so the Ct for each
successive log-dilution should be log2(10), i.e. 3.322 cycles apart. The efficiency of real-time PCR varied from patient to patient, and the limit of detection varied by 2 log-dilutions (10-2 to
15
20
25
30
35
40
0 1 2 3 4 5 6
BC
R-A
BL
Ct
JT y=-3.77x + 50.6
R2=0.99
Log pg DNA
Figure 5.3 BCR-ABL DNA standard curves of three CML patients. The highest standard for each patient contained 125 pg presentation DNA, and 10-fold serial dilutions in standard diluent were assayed using patient-specific real-time PCR.
15
20
25
30
35
40
0 1 2 3 4 5 6
BCR
-AB
L C
t
MRE y=-3.97x + 47.3
R2=0.99
15
20
25
30
35
40
0 1 2 3 4 5 6
BCR
-AB
L C
t
GRS y=-3.44x + 43.2
R2=0.99
74
10-4). K562 was detected at a dilution of 10-5. The 10-4 dilution contained approximately 12.5 pg DNA: in patient samples this should be equivalent to the DNA content of 2 cells, and in K562 (which is hyperdiploid) around half a cell. K562 contains multiple copies of the BCR-ABL gene, as discussed in Chapter 4, so the detection limit was expected to be lower than in patient cells. DNA was extracted from samples stored at different time points from 2 of the 3 CML patients (GRS and MRE). DNA Q-PCR results were compared with the results of RQ-PCR. BCR-ABL DNA was detected in 1 of the 2 patients when in CMR, but in GRS the detection limit was estimated to be equivalent to a BCR-ABL mRNA level of around 0.3% (Table 5.1). The third patient, with a detection limit of 10-2 in the standard curve, was not tested due to the apparently lower sensitivity of the assay.
Table 5.1 BCR-ABL DNA in CML patient samples
Patient Date BCR-ABL mRNA
level by RQ-PCR
Real-time DNA Ct
GRS 25/11/98 Not done* 26.39
6/12/99 3.4% 36.06
28/10/02 0.02% Undetectable
29/5/03 0 Undetectable
MRE 30/9/97 Not done* 24.0
14/11/00 2.8% 30.1
12/8/02 0.02% 39.01
8/4/03 0 39.92
* RQ-PCR was not available before 1999.
5.2.3.2 Preliminary conclusions (a) For most patients the real-time PCR standards gave linear results. Two patients had a lower limit of detection close to one copy, but the detection limit was higher for the third patient (JT), despite using an identical amount of DNA in each patient’s standards. One possible explanation for this difference is variable PCR efficiency, but the slope of the standard curve for patient JT indicated PCR efficiency intermediate between the other two patients, and not substantially lower. A second possible explanation is that the DNA in this sample was partially degraded, and the amount of amplifiable DNA was reduced. These observations led to the development of a real-time PCR method for the quantification of intact, amplifiable DNA in all patient samples. This should make it possible to determine whether or not an assay has achieved its maximum possible limit of detection (i.e. one intact copy).
5.2.4 Restrictions on primer design related to the breakpoint sequence
5.2.4.1 Low melting temperature Under ideal conditions the forward and reverse primers for real-time PCR had a melting temperature of 60 C, and the probe had a melting temperature 10 C higher. The BCR breakpoint of patient JES was at nt 123881-2, and the ABL1 breakpoint was at nt 27578-9. The first 100 bp of ABL1 sequence following the breakpoint contained 42 adenine bases and
36 thymidine bases. With a GC content of 22% the melting temperature of oligonucleotides in this region was far below the requirement for efficient real-time PCR (Figure 5.4a). Consequently, it was necessary to design the forward primer and probe in BCR and the reverse primer predominantly in BCR with only 4 bp at the 3’ end of the reverse primer in ABL1 (Figure 5.4b). In this situation the risk of amplifying normal BCR in genomic DNA
must be very high. The Ct determined in pooled normal DNA using the patient-specific BCR-ABL primers and probe was 22, indicating that there was non-specific amplification.
Figure 5.4 Melting temperature restricts primer design for Q-PCRPatient JES. The GC content (green) and melting temperature (pink) of the first 100 bp of ABL1 3’ of the breakpoint are shown (Fig 5.4a). The GC content was too low for efficient binding of the real-time oligonucleotides. It was necessary to design the probe in BCR (Fig 5.4b).
BC
RA
BL1
a. Patient JES: melting temperature of ABL1 sequence adjacent to the BCR-ABL breakpoint
b. Patient JES: design of real-time PCR oligonucleotides
75
76
5.2.4.2 Genomic repeat element at the breakpoint In order to maximize specificity it is preferable to avoid locating primers or the probe in a genomic repeat element. The BCR breakpoint of patient JJ was at nt 125427-9 in an L1 repeat. The ABL1 breakpoint was not in a repeat region. Due to melting temperature requirements it was not possible to design a probe to span the breakpoint, so it was necessary to locate the probe wholly in BCR or wholly in ABL1. ABL1 was chosen because it was not a repeat sequence. The forward primer spanned the breakpoint with 18 bp in BCR and 7 bp at the 3’ end in ABL1. No non-specific amplification was detected in pooled normal DNA. In fact, there was no non-specific amplification in any of the other 8 patients whose probes were located wholly in BCR or ABL1, indicating that the design strategy employed usually ensures a high degree of specificity. The precise BCR-ABL breakpoint of patient AM could not be determined due to the presence of a polyT repeat at the ABL1 breakpoint, around nt 49064-85 (See section 4.2.2.2). The ABL1 sequence immediately following the breakpoint contained two contiguous repeat elements: SVA and AluY. The AluY repeat ends at nt 49485, so in order to place the first round reverse primer outside the repeat element it would have been necessary to have an amplicon length of >450 bp. This patient’s ABL-BCR reciprocal translocation product was sequenced, and it was possible to design nested ABL-BCR primers with a breakpoint-spanning probe.
5.2.4.3 Preliminary conclusions (b) In one patient non-specific amplification occurred in real-time DNA PCR, and prevented the quantification of BCR-ABL in patient samples. In such cases we predicted that selective amplification of BCR-ABL in nested DNA PCR would overcome the problem of non-specificity. An additional advantage of nested DNA PCR might be to ensure that rare copies of BCR-ABL are amplified prior to real-time PCR, so that sampling error at very low copy numbers is reduced.
5.3 Preliminary experiments with nested DNA PCR
5.3.1 Time-release PCR method Genomic DNA 500 ng was pre-amplified in a first round PCR using the sequencing primers described above. A time-release PCR method was used, as recommended by the manufacturer of the PCR reagents for the amplification of low copy number targets. The DNA polymerase is heat-activated. In our standard PCR method the enzyme is activated at the start of the PCR by a 10 minute incubation at 70 C. In the time-release PCR this incubation step is omitted so that the enzyme progressively reaches full activity with successive PCR cycles. This thermal cycling protocol reduces DNA polymerase activity early in the PCR when target copy number is low, and the risk of non-specific amplification is high. Polymerase activity should then be maximal after several low-efficiency cycles have increased the number of BCR-ABL templates available. In addition, the number of cycles of PCR was increased from the standard 40 cycles to 60 cycles. In the nested second step real-time PCR was performed using 2.5 μL of PCR product from the first round, and the appropriate patient-specific real-time PCR probe. Cryopreserved cells collected at different time points during imatinib treatment were selected to represent different levels of residual disease in three chronic phase CML patients. Nested DNA PCR was performed and the results were compared with the historical RQ-PCR results. The results are shown in Table 5.2. For the purposes of comparison the results of non-nested PCR from Table 5.1 are also shown.
77
Table 5.2 BCR-ABL DNA in CML patient samples
Patient Date BCR-ABL mRNA
level by RQ-PCR
Nested DNA Ct Real-time DNA Ct
GRS 25/11/98 Not done <2 26.39
6/12/99 3.4% 2.27 36.06
28/10/02 0.02% 2.30 Undetectable
29/5/03 0 2.36 Undetectable
17/11/03 0 2.74 Not done
11/9/06 0 2.57 Not done
23/1/7 0 2.3 Not done
JT 3/9/01 0.07 5.21 Not done
14/12/04 0 Undetectable Not done
5/12/05 0 Undetectable Not done
5/7/06 0 Undetectable Not done
19/3/07 0 Undetectable Not done
MRE 30/9/97 Not done 3.0 24.0
14/11/00 2.8% 7.4 30.1
12/8/02 0.02% 9.1 39.01
8/4/03 0 5.28 39.92
9/6/04 0 16.44 Not done
25/7/06 0 Undetectable Not done
1/3/07 0 Undetectable Not done
27/6/07 0 Undetectable Not done
Single step real-time DNA PCR was performed on samples in chronological order until the limit of detection of BCR-ABL DNA was reached. Subsequent samples were tested only using nested DNA PCR. All of the samples with detectable BCR-ABL DNA had Ct values of <10 due to the amplification in the first round PCR. In real-time PCR the baseline fluorescence is usually determined from cycle 3 to cycle 15, as virtually all non-nested samples give a Ct higher than 15. For nested samples with a very low Ct it was necessary to modify the baseline fluorescence determination of the thermal cycler to avoid false negative results Baseline fluorescence was determined from cycle 1 to cycle 2, and necessitated an increase in the fluorescence threshold at which the Ct was determined in order to avoid false positive results due to under-estimation of the baseline fluorescence.
5.3.2 Non-specific amplification Four different patient-specific nested DNA PCR assays were performed using gDNA from 5 different BCR-ABL-positive samples. There was no cross-specificity for BCR-ABL from
78
different CML patients. Nested DNA PCR was performed using pooled gDNA from 5 normal individuals (tested for disorders other than CML). There was no non-specific amplification.
5.3.3 Sensitivity In 2/3 patients BCR-ABL was detectable by nested DNA PCR when it was not detectable by real-time DNA PCR on the same sample or by RQ-PCR performed at the time when the sample was collected (Table 5.2). In the third patient RQ-PCR and nested DNA PCR gave concordant qualitative results. BCR-ABL DNA was not detected by real-time DNA PCR in a sample with a BCR-ABL mRNA level of 0.02% by RQ-PCR.
5.3.4 Preliminary conclusions Patient-specific DNA PCR was highly specific. Nested DNA PCR appeared to be more sensitive than real-time DNA PCR and RQ-PCR, but was non-quantitative. It is likely that the large number of PCR cycles in the time-release method resulted in saturation of the real-time PCR. There is a linear relationship between the number of templates in the starting sample and the number of templates in the PCR product only across a limited number of amplification cycles. The optimum number of amplification cycles for nested DNA PCR was investigated further (Section 5.5.1). The pre-amplification step in the nested DNA PCR assay contained 500 ng DNA in up to 10 μL in a total reaction volume of 50 μL to test a fixed amount of nucleic acid template. This is similar to the first step of RQ-PCR, the reverse transcription of mRNA, which uses a fixed 2 μg amount of RNA. As each diploid cell contains the same amount of DNA (around 7 pg) (Ausubel et al. 1988), a fixed amount of DNA should represent the genomic content of a fixed number of cells. In contrast, the non-nested real-time DNA PCR assay contained a variable amount of DNA (in a fixed volume of 2.5 μL), which complicates the estimation of assay sensitivity, or detection limit. The DNA concentration of individual samples was highly variable (see Section 5.4), and it would not be possible to standardize the DNA input of real-time DNA PCR without reducing the input amount (and assay sensitivity) to a level achievable in the majority of samples. Hence, for the substantial number of samples with a DNA concentration of <200 ng/μL, nested DNA PCR offered the practical advantage of testing a larger total amount of DNA in a single assay.
5.4 Genomic DNA control gene for Q-PCR The mRNA control genes most commonly used for BCR-ABL RQ-PCR are ABL1 and BCR. The use of one of the translocation partners complicates quantification because the number of copies of the control gene may differ between normal and leukaemic cells (e.g. due to BCR-ABL amplification or der(9) deletion), and this will result in a non-linear relationship between cell number and copy number. We selected the β-glucuronidase (GUSB) locus on chromosome 7q as our control gene, as it is not known to be involved in the BCR-ABL translocation. In the vast majority of CML patients each cell will therefore contain two copies of GUSB per copy of BCR-ABL. If there were degradation of DNA, or if there were an inhibitor of PCR in the gDNA preparation then GUSB and BCR-ABL should be affected to a similar extent. Real-time PCR quantification of GUSB was developed as a control for the amount of intact, amplifiable DNA in each individual sample.
5.4.1 Design of quantitative primers and probe for GUSB A region of GUSB was chosen spanning the end of exon 2 and the beginning of intron 2, so that GUSB mRNA would not be amplified. Forward and reverse primers and a TaqMan® probe were designed to give an amplicon of 76 bp. The specificity of the amplicon was
confirmed by BLAST searches for the primers and the probe, and the absence of amplification in the standard diluent solution containing salmon DNA.
5.4.2 Establishment of a GUSB standard Peripheral blood from a normal donor was collected in EDTA. The cell count was determined before and after red cell lysis so that the total number of cells used for DNA extraction was known. Two million cells were used and the mean DNA yield from 4 replicates was 11.4 μg. Assuming 100% extraction efficiency the estimated amount of DNA per cell was 5.7 pg, which is comparable with a published estimate of 7 pg per diploid eukaryotic cell (Ausubel et al. 1988). A series of 10-fold dilutions of normal DNA was repeatedly assayed for GUSB and served as the standard material for assignment of DNA quantity in patient samples (Figure 5.5).
y = -3.2991x + 40.061R2 = 0.9975
15
20
25
30
35
40
0 1 2 3 4 5 6
Log pg DNA
GU
SBC
t
Figure 5.5 GUSB control gene standard curveDNA was extracted from 2 x106 blood cells collected in EDTA, and the concentration of DNA (pg/µL) was assigned by spectrophotometry. Serial dilutions of the DNA in standard diluent were used to construct a standard curve for Q-PCR.
5.4.3 DNA quantification by spectrophotometry and real-time PCR Most DNA samples were extracted by one of two methods: column extraction for fresh cells, and back extraction from samples received frozen in Trizol®. Fresh cells were collected in two different anticoagulants: EDTA and lithium heparin. Heparin is reported to be a significant inhibitor of PCR (Beutler et al. 1990; Pardoe and Michalak 1995), so EDTA samples were preferred. The DNA concentration was determined by spectrophotometry, and the results were compared with the amplifiable DNA concentration determined by GUSB Q-PCR. The results were compared separately for cells collected in EDTA, cells collected in lithium heparin, and DNA extracted from Trizol® (Figure 5.6). In DNA extracted from cells in EDTA the DNA concentrations determined by spectrophotometry and by GUSB Q-PCR showed a reasonable correlation (R2=0.49). The slope of the curve was 0.63. If the average DNA extraction efficiency were identical by both methods the slope of the correlation curve would be 1.0. Hence, these results indicated that the amount of intact, amplifiable DNA from cells in EDTA anticoagulant was around two-thirds of the amount measured by spectrophotometry. The amplifiable yield of DNA
79
(determined from the slope of the curve) extracted from cells in heparin was significantly lower at 0.21. Residual heparin contamination in these DNA samples may have inhibited the real-time PCR (Pardoe and Michalak 1995). In DNA extracted from Trizol® there was no correlation between the amount of amplifiable DNA and the spectrophotometry result (R2<0.01), suggesting that the extracted DNA was often contaminated with protein or RNA. If the proportion of BCR-ABL in a sample were determined using the spectrophotometric amount of DNA this would introduce a significant error. In most cases the detection limit of the DNA assay would be over-estimated.
Ampl
ifiab
le D
NA c
once
ntra
tion
by G
USB
Q-P
CR
(ng/
uL)
Cells in EDTA
Cells in heparin
Cells in Trizol®
Figure 5.6 Correlation between DNA concentrations determined by spectrophotometry and by GUSB Q-PCR after extraction of DNA from different types of samplesThe best correlation between spectrophotometry and the amplifiable amount of GUSB was seen in samples extracted from EDTA (R2=0.49). There was no correlation between the two methods of DNA quantification in samples extracted from Trizol®.
y = 0.6267x + 30.749R2 = 0.4875
0
100
200
300
400
500
0 100 200 300 400 500
y = 0.2197x + 46.902R2 = 0.1691
0
100
200
300
400
500
0 100 200 300 400 500
y = -0.0566x + 433.78R2 = 0.0087
0
300
600
900
1200
1500
0 500 1000 1500 2000 2500 3000 3500 4000
Spectrophotometry (ng/uL)
80
5.5 Development of a nested DNA Q-PCR method Patient-specific standards were prepared. Ten-fold serial dilutions of each patient’s presentation DNA were prepared in standard diluent (buffered salmon DNA), and 2.5 µL of standard was amplified in real-time DNA PCR using the appropriate patient-specific primers and probe. The amount of DNA in the dilution series was no longer standardized between patients because the quantification of GUSB obviated this requirement. Pooled gDNA from five normal individuals was used as a BCR-ABL-negative control for non-specific amplification. The standard diluent solution was tested as a ‘no template’ control. Nested DNA Q-PCR was performed with a first round amplification of 2.5 µL of standard material followed by real-time PCR using 2.5 µL of PCR product. For comparison this was performed together with the non-nested real-time DNA PCR, as described above. For each method a standard curve was constructed using Excel software. The threshold cycle (Ct) number was plotted on a linear scale against the amount of gDNA used with the DNA concentration on a logarithmic scale.
5.5.1 Number of first round amplification cycles The kinetics of efficient PCR amplification are such that only samples containing very few templates are in the exponential phase of amplification beyond 35 cycles; samples with more abundant starting templates may exhaust the reaction and PCR efficiency will be reduced in later cycles. Consequently we reduced the number of PCR cycles in the first round PCR in order to ensure that BCR-ABL amplification in patient samples would be in the exponential phase when the PCR ended. The number of first round amplification cycles tested was 10, 20 and 30. The time-release thermal cycling was not used, in case this had contributed to non-linearity of Q-PCR. Nested DNA Q-PCR was performed to generate standard curves for 3 different patients. Linear standard curves were obtained for all three patients with all three PCR conditions (10, 20 or 30 cycles of first round PCR). Allowing for sampling error the detection limit was similar at 10, 20 and 30 cycles (Figure 5.7), so larger numbers of cycles were not tested. The first round PCR was 30 cycles for all subsequent experiments.
BCR-
ABL
Ct
Log dilution K562 DNA
0
5
10
15
20
25
30
35
40
-5 -4 -3 -2 -1 0
rt: y=-3.23x + 18.84 R2= 0.997
10 cycles: y=-3.35x + 21.1 R2= 0.99
20 cycles: y=-3.07x + 13.73 R2= 0.988
30 cycles: y=-3.17x + 5.62 R2= 0.976
10
20
30
rt
Figure 5.7a Number of cycles of PCR before nested Q-PCR (K562)Serial dilutions of DNA were used in real-time Q-PCR without nesting (rt) or with 10, 20, or 30 cycles of PCR prior to the nested Q-PCR. The efficiency of PCR and lower detection limit were similar in all four experiments.
81
Figure 5.7b Number of cycles of PCR before nested Q-PCR (patients)Nested DNA Q-PCR with 10, 20, or 30 cycles of pre-amplification in two different CML patients. The efficiency of PCR and the lower detection limit were similar in both patients at 10, 20 and 30 cycles.
0
5
10
15
20
25
30
35
40
0 1 2 3 4 5
0
5
10
15
20
25
30
35
40
0 1 2 3 4 5
BC
R-A
BL
Ct
10 cycles: y=-2.71x + 39.29 R2= 0.997
20 cycles: y=-3.10x + 31.53 R2= 1.0
30 cycles: y=-3.24x + 23.08 R2= 0.974
Log pg amount of DNA (by Q-PCR)
10 cycles: y=-2.87x + 37.61 R2= 0.921
20 cycles: y=-2.82x + 29.65 R2= 0.983
30 cycles: y=-2.99x + 20.83 R2= 0.996
BC
R-A
BL
Ct
5.5.2 Non-linearity of standards with high levels of BCR-ABL Just as a high number of amplification cycles caused non-linearity, we also observed that the values at the high end of the standard curve were sometimes non-linear in patients whose standards contained a larger amount of BCR-ABL DNA (data not shown). It was necessary that each standard curve should include at least 3 data points, and the standards with a larger amount of DNA typically had 5 data points, so the omission of the highest point was acceptable. Furthermore, as the method was developed for quantification of low levels of MRD non-linearity due to high levels in patient samples was not a concern.
82
83
5.5.3 Calculation of nested DNA Q-PCR results Nested DNA Q-PCR was initially performed in quadruplicate, using 500 ng gDNA in each reaction. The number of replicates was chosen based on the Poisson distribution, which indicates that if there is one copy of BCR-ABL in 500 ng amplifiable DNA, it is necessary to perform 4 replicates in order to have >98% certainty that the true level of MRD in the sample is less than 1 copy in 500 ng (i.e. <10-4.94). The number of negative control samples (each containing 500 ng pooled normal DNA) was equal to the number of test replicates included in each assay. Every assay included a standard curve. Like the test samples, the lower dilutions of the standard curve, when performed in replicate, gave discrepant results with some positive and some negative, consistent with sampling error. Consequently, the lowest consistently positive standard in a series of 10-fold dilutions was likely to contain around 10 copies of BCR-ABL (4 to 30 copies). Therefore, a true positive result (resulting from a single copy of BCR-ABL in the sample) should give a Ct value within approximately 6 cycles (2 log at optimal PCR efficiency) of the lowest consistently positive standard.
5.5.3.1 Extrapolated Ct values in nested DNA Q-PCR It was not always possible to ensure that the values obtained in patient samples could be interpolated from the standard curve. Extrapolating from the standard curve, the amount of DNA equivalent to a single cell (one copy of BCR-ABL) present in the pre-amplification step should result in a Ct of <25 cycles in every nested DNA Q-PCR assay. A true positive might nevertheless have a higher Ct for two reasons: 1) amplification of a single copy is a stochastic event, and efficient amplification of a single copy might not occur from the very first cycle of PCR; and 2) the true minimum amount of DNA that contains a single, intact BCR-ABL template is a small fraction of a single chromosome, much less than 1 pg. Replicate results from a single patient are shown in Table 5.3: the calculated amount of DNA varied widely, even though each signal must have arisen from a single copy of BCR-ABL. BCR-ABL Ct results that gave extrapolated values of less than 1 amplifiable genome (5.7 pg) were treated as equivalent to one cell, as any lower result would be illogical. Table 5.3 Replicate Ct values equivalent to one copy of BCR-ABL: Any calculated amount of BCR-ABL DNA up to 5.7 pg (the DNA content of one cell) was assigned a value of 5.7 pg, as it is not possible to detect less than one cell (one copy of the BCR-ABL gene). There was significant variation in the Ct corresponding to one copy. Threshold cycle number (Ct) values obtained in four samples (A-D) from one patient (JEM) are shown to illustrate this variability. Nested Q-PCR was performed in 5 independent runs over a period of approximately 4 months. Each calculated amount was extrapolated from the patient-specific standard curve. Each value was equivalent to one CML cell, or one copy of BCR-ABL in 500 ng DNA. There was no non-specific amplification in this patient’s assay. Run number Sample Ct Calculated amount of BCR-ABL DNA (pg)
1 A 22.22 1.14 2 A 20.88 2.70 2 A 22.07 1.26 3 B 18.36 4.25 3 B 19.37 2.04 4 C 18.89 8.31 5 C 17.01 6.78 5 C 16.94 7.14 5 C 18.07 3.04 5 D 27.87 0.002 5 D 18.12 2.94 5 D 18.04 3.11
84
5.5.3.2 Calculation of results For each replicate Ct the pg equivalent amount of BCR-ABL DNA was calculated. As described above, Ct values that gave a calculated amount of less than 5.7 pg BCR-ABL DNA were assigned a value of 5.7 pg. The total amount of BCR-ABL in all replicates was added, and the result was expressed as a fraction of the total amount of amplifiable DNA used. For example, a single low positive in four replicates would give a result of 5.7 pg BCR-ABL in 2 μg amplifiable DNA (i.e. 10-5.55 or 0.0003%).
5.5.4 Negative threshold for nested DNA Q-PCR In occasional patients non-specific amplification was observed in the real-time PCR step. The negative threshold was set at >3 cycles earlier than any positive in the pooled DNA negative control (approximately 10-fold greater than the highest level of non-specific amplification). In Section 5.2.6 we identified two patients whose primers and probes resulted in non-specific amplification. In nested DNA Q-PCR the level of non-specific amplification in pooled normal DNA was substantially reduced in both of these patients, and the difference between the lowest value of the standard curve and the highest level of non-specific amplification was at least 5 cycles. In contrast, one of the patients with a probe located wholly in BCR had non-specific amplification in nested DNA Q-PCR, but not in single step real-time DNA PCR. This problem was seen in 1 out of 14 patients for whom we tested nested DNA Q-PCR.
5.5.5 Estimation of assay detection limit based on amplifiable DNA The amount of amplifiable DNA in each sample was converted to a number of cells, using the amount of 5.7 pg amplifiable DNA per cell. When BCR-ABL was not detected the result was expressed as less than 1/(number of cells). If 500 ng amplifiable DNA was used this was equivalent to 87,719 cells and gave a lower detection limit of 10-4.94 (0.001%). If 10 μg DNA was used (20 replicates) the lower detection limit was 10-6.24 (0.00006%).
5.6 Alternative materials for the patient-specific standards
5.6.1 Amplified DNA versus genomic DNA in real-time PCR A quantitative method that relies on the availability of intact DNA from the time when the patient was first diagnosed has inherent disadvantages. Firstly, if the assay is developed retrospectively diagnostic material might not be available, or might be degraded. Secondly, the percentage of BCR-ABL-positive cells in the diagnostic sample will vary from patient to patient, so that the absolute copy number is not known. Thirdly, a sufficient amount of this gDNA standard material must be stored for repeated use over the course of the patient’s life, and may be subject to degradation. An alternative approach for the patient-specific BCR-ABL standard curve is to synthesize a standard material incorporating the breakpoint target sequence. We examined the use of a BCR-ABL PCR amplicon for the patient-specific standard curve. The BCR-ABL PCR amplicons of several patients were purified, and the DNA concentration was determined by spectrophotometry. The molecular weight of the amplicon was calculated based on the nucleotide composition (Kibbe 2007), and the molar copy number was calculated. Ten-fold serial dilutions of the amplified DNA (aDNA) in standard diluent were assayed by real-time DNA PCR for BCR-ABL (Figure 5.8).
Figure 5.8 Comparison of patient-specific standard curves using genomic DNA and amplified BCR-ABL DNAStandard curves were prepared using PCR amplicons (squares) or gDNA (triangles) in standard diluent solution. Both methods gave linear results, indicating that PCR amplicons could be substituted for gDNA in the standard curve.
BCR
-AB
LC
t
K562
gDNA: y=-3.316x + 40.00
GRS
aDNA: y=-3.533x + 40.87
gDNA: y=-3.571x + 43.68
aDNA: y=-3.148x + 39.73
BCR
-AB
LC
t
Log dilution (nominal values)
0
10
20
30
40
0 1 2 3 4 5 6 7 8
0
10
20
30
40
0 1 2 3 4 5 6 7 8
Since the aDNA and gDNA standard curves showed similar PCR efficiency a value could be assigned using the ΔΔCt method: for any given absolute copy number the ΔCt between the two methods will be constant, and it is therefore possible to assign a pg DNA equivalent value to the aDNA standards, or an absolute copy number to the genomic DNA standards. The proportion of leukaemic cells at diagnosis is variable (although averaging close to 90%), so a molar standard could be used to enable the reporting of BCR-ABL DNA levels as absolute cell numbers, instead of as a proportion of the amount in the diagnostic DNA sample.
5.6.2 Patient-specific DNA standards diluted in human DNA versus diluent solution
Non-specific amplification was observed in patient samples and in normal DNA, but not in the standard diluent solution of buffered salmon DNA. This might influence the efficiency of
85
PCR, and the lower limit of detection of BCR-ABL. We compared standard curves using BCR-ABL DNA diluted in human DNA instead of the standard diluent solution. Ten-fold serial dilutions of K562 DNA in pooled normal human DNA were assayed by real-time DNA PCR and nested DNA Q-PCR and the standard curves were compared (Figure 5.9). The normal DNA pool had an amplifiable DNA concentration of 200 ng/μL, and was extracted from the peripheral blood of 5 individuals. The standards diluted in human DNA all gave linear results in nested DNA Q-PCR, but the slope of the standard curve was affected by the type of diluent used. Single step real-time DNA PCR for K562 DNA was less efficient when K562 DNA was diluted in human DNA than when it was diluted in standard diluent. In nested DNA Q-PCR both standard curves were linear, but using human DNA as a diluent the slope of the standard curve was again reduced. Importantly, the reduced PCR efficiency did not affect the lower limit of detection, which was similar, irrespective of the diluent used. This experiment was repeated for patient MP using nested DNA Q-PCR, and the results were similar to those seen in K562: the detection limit was similar, and the slope of the standard curve was reduced from -2.90 to -2.23 (data not shown).
0
5
10
15
20
25
30
35
40
-1 0 1 2 3 4 5 6 7Log amount K562 DNA (pg)
BC
R-A
BL
Ct
rt DIL: y=-3.32x + 36.68 R2= 0.982
Nested DIL: y=-3.17x + 20.53 R2= 0.976
Nested DNA: y=-2.37x + 19.45 R2= 0.962
rt DNA: y=-2.62x + 37.81 R2= 0.983
Figure 5.9 Standard curves using BCR-ABL DNA diluted in human DNA versus DNA diluted in standard diluent solution. Serial dilutions were prepared using human DNA diluent(squares) or standard diluent (diamonds), real-time PCR was performed, and the standard curves were compared. Using human DNA the efficiency of PCR was reduced (lower slope), but there was no difference in the detection limit of the assay. rt = real-time non-nested PCR
5.7 DNA versus RNA for the monitoring of chronic phase CML Nested DNA Q-PCR was more sensitive than RQ-PCR in selected samples studied so far, but our aim was to develop a quantitative method for BCR-ABL DNA. This was important for several reasons: firstly, a useful method for MRD monitoring should be able to demonstrate in serial samples whether the level of disease is stable, rising or falling; secondly, the accurate quantification of MRD may have prognostic significance (as in the case of MMR, determined by RQ-PCR); and thirdly, the study of response kinetics by DNA and mRNA may improve our understanding of BCR-ABL mRNA expression and the role that it plays in response and relapse of CML. In most of the MRD samples BCR-ABL was detected at a low level or not at all, so it was not possible to determine the measurement error of the assay at varying levels of disease.
86
87
We commenced a project to measure BCR-ABL DNA levels in chronic phase CML patients at diagnosis, and during the first months of imatinib treatment. Because the level of BCR-ABL DNA was expected to be high in these samples the single step real-time DNA PCR method was used. DNA was extracted from peripheral blood or bone marrow samples of 13 chronic phase CML patients enrolled in the ALLG CML9 study. Briefly, patients in this trial commenced imatinib at a dose of 600 mg daily, with selective dose escalation for failure to reach specified treatment milestones (i.e. sub-optimal plasma imatinib level at day 22; BCR-ABL >10% by RQ-PCR at 3 months or >1% at 6 months). Results were compared with BCR-ABL RQ-PCR.
5.7.1 Calculation of quantitative results DNA was extracted from peripheral blood or bone marrow samples of 11 chronic phase CML patients. Some of the samples were extracted from fresh cells, and some from Trizol® preparations. The concentration of DNA in each sample varied, so the quantification process involved the following steps: 1) the amount of amplifiable DNA in the patient-specific standards was determined by GUSB Q-PCR; 2) the BCR-ABL Ct in the patient’s standards was determined by real-time PCR (non-nested) and a standard curve was constructed with the amplifiable DNA concentration on the x axis and the BCR-ABL Ct on the y axis: this enabled the BCR-ABL Ct result to be expressed as an equivalent amount of leukaemic DNA; 3) the amount of amplifiable GUSB DNA in the sample was determined as usual; 4) the BCR-ABL Ct was converted to an equivalent concentration of BCR-ABL DNA from the standard curve; and 5) the final result was BCR-ABL DNA/GUSB DNA, expressed as a percentage. All measurements were performed at least in duplicate. On some dates multiple samples (e.g. fresh cells and Trizol®; blood and marrow) were available, and were processed independently. The true BCR-ABL DNA level that corresponds to any given RQ-PCR value is presently unknown, so agreement between DNA replicates was used to exclude outlier values.
5.7.2 The level of BCR-ABL mRNA falls more rapidly than BCR-ABL DNA early in imatinib treatment
The results of BCR-ABL DNA and mRNA levels are summarized in Figure 5.10. The median DNA BCR-ABL level at diagnosis was 88%. There was little change in the BCR-ABL DNA level until the mRNA level fell to around 10%. All of these patients had achieved a complete haematological response in the first 4 weeks, and almost all (10/11) achieved an mRNA level of <10% within 3 months of commencing treatment. When the BCR-ABL RNA levels fell below 10% there was a good correlation between the two methods of measurement (R2=0.70).
5.7.3 Two patients with undetectable BCR-ABL using real-time DNA PCR In two CML patients BCR-ABL DNA was quantifiable at diagnosis, but was subsequently not detected in real-time DNA PCR in one or more follow-up samples after a period of treatment. Patient HK had no detectable BCR-ABL DNA after 9 months of treatment. BCR-ABL mRNA was also not detected (calculated sensitivity of RQ-PCR 4.93 log) and remained undetectable 3 months later, indicating that the patient had achieved a CMR. The amount of DNA used in real-time PCR was 580 ng, which should be equivalent to a detection limit of 5.0 log. In this case the DNA and mRNA results were concordant, both indicating a low level of MRD. Patient EG had no detectable BCR-ABL in real-time DNA PCR after 3 months of treatment. The BCR-ABL mRNA level at that time was 0.17%. The amount of DNA used in the real-time PCR was 50 ng, which should be equivalent to a detection limit of 0.02%. This suggests either that the DNA level was lower than the mRNA level in this patient, or that the efficiency of DNA Q-PCR was compromised. The 3 month sample was re-tested using nested DNA Q- PCR with 500 ng of gDNA, and BCR-ABL was detected. The amplified DNA was sequenced
and confirmed that there was no acquired mutation in the breakpoint region. Nested DNA Q-PCR for BCR-ABL was performed on serial samples up to 6 months after commencing treatment, and BCR-ABL was detectable at every time point (Figure 5.11). These results indicate that in selected patients there was an improvement in sensitivity using nested DNA Q-PCR for BCR-ABL.
Figure 5.10 Serial monitoring of BCR-ABL mRNA and DNA during imatinib treatmentComparison of results from RQ-PCR (mRNA) and real-time PCR (DNA). BCR-ABL DNA levels remain stable until the mRNA level falls to around 10%.
0.001
0.01
0.1
1
10
100
1000
0.001 0.01 0.1 1 10 100 1000
BCR-ABL mRNA level (%)
BCR
-ABL
DN
A le
vel (
%)
0.0001
0.001
0.01
0.1
1
10
100
1000
0 60 120 180
Days on imatinib treatment
Log
BCR
-ABL
leve
l (%
) mRNArt DNANested DNA
Figure 5.11 Serial monitoring of BCR-ABL mRNA and DNA during imatinib treatmentPatient EG. BCR-ABL DNA was not detectable by non-nested real-time PCR after 3 months of imatinib treatment. Nested DNA PCR was more sensitive than real-time PCR.
BC
R-A
BL
leve
l (%
)
88
89
5.8 Discussion
5.8.1 Detection limit of BCR-ABL DNA Using the GUSB control gene we were able to calculate the equivalent number of cells tested in each assay, and therefore we could accurately assign the lower detection limit of each sample. This is a more direct calculation of sensitivity than the EAC calculation of sensitivity for RT-PCR. The BCR-ABL and GUSB genes are present in a constant ratio of 1:2, whereas the ratio of BCR-ABL mRNA to its control gene mRNA is variable, depending on the control gene used. The integrity of extracted DNA should be similar for different genes, whereas the stability of mRNA species is variable (van der Velden et al. 2004). The EAC calculated sensitivity assumes that the expression ratio of BCR-ABL to its control gene is constant with treatment, but whether this is true is unknown. If less mature CML cells have a relative over-expression of BCR-ABL, as has been reported in some experiments (Jiang et al. 2007), then the EAC calculated sensitivity might under-estimate the actual lower limit of detection. In the small number of patient samples included in this chapter there was good agreement between the detection limits calculated by DNA and RNA methods. The agreement between methods was examined in a larger number of samples from the ALLG CML8 study, and is reported in Chapter 6. In nested DNA Q-PCR we found that the lower limit of detection was similar using 10, 20 or 30 cycles of PCR in the first round, and in some cases the nested DNA Q-PCR was no more sensitive than single-step real-time DNA PCR. For instance, in the GUSB standard curve the lower limit of detection of real-time PCR was around the maximum achievable detection limit, based on the amount of DNA in the assay. In patients with less efficient real-time DNA PCR the addition of the first round amplification step in nested DNA Q-PCR might have improved the sensitivity of the assay. In some patients nested DNA Q-PCR increased the separation between a low positive result and the background level of non-specific amplification, so in these few cases nested DNA Q-PCR was very useful. In the absence of non-specific amplification it might be possible for single-step real-time PCR to achieve a detection limit similar to nested PCR.
5.8.2 Accuracy and precision of quantification The precision of any method can be determined by replicate analyses to demonstrate the limits of agreement of a value. The precision of nested DNA Q-PCR can be gauged from the spread of Ct values in the replicate standard curves. The accuracy of a method requires a ‘gold standard’ against which the new method can be compared. For low levels of MRD in CML the only measurement available is RQ-PCR, but the level of BCR-ABL mRNA is not truly a standard for the level of DNA because the RQ-PCR result is determined by the mRNA expression level, as well as by cell number. In patients at diagnosis and early in treatment the best available comparator for BCR-ABL DNA Q-PCR is probably FISH. Within this study our main focus was on samples with low levels of MRD, below the detection limit of FISH. In the longer term it would be useful to compare the results of FISH and BCR-ABL DNA Q-PCR in selected samples, particularly if there are cases in which the BCR-ABL mRNA and DNA levels are discrepant. The slope of the patient-specific standard curve was different when the patient sample was diluted in human DNA instead of standard diluent, suggesting that the type of diluent affected the efficiency of PCR. This is evidently not a problem with primer design, as the same primers achieved efficient amplification in the standard diluent series. The most likely explanation for the discrepancy would be the presence of a PCR inhibitor in the pooled DNA used to prepare the dilution, yet there was no evidence of non-linearity in the serial dilutions. It is likely that the efficiency of PCR in the patient sample was more accurately reflected by
90
the standard curve using dilutions in human DNA. The DNA standards for quantification of GUSB were also prepared in standard diluent, and it is possible that this might have resulted in an equivalent bias that restores the accuracy of the calculation. Nevertheless, it is possible that a measurement bias was introduced by the use of patient-specific standards that were not diluted in human DNA. If a bias is linear it can be corrected mathematically using the formulae of the standard curves, in a modification of the ΔΔCt method. In the nested DNA Q-PCR assay it would be possible to change to a set of standards diluted in human DNA, but this would not be feasible for single step real-time DNA PCR because a high level of non-specific amplification in certain patients renders the standard curve non-linear. It is important to note that the problem of non-identical standard curves should be less important near the lower limit of detection. There was considerable variation in the Ct attributable to a single copy of BCR-ABL, and in this situation the error due to the difference in the slope of the standard curve would be a smaller contributor to measurement error. An advantage of using the standard diluent was that it enabled us to measure the GUSB control gene in each of the standards. If the standards were prepared in human DNA this would not be possible. It would be then be necessary to measure GUSB in the original sample prior to dilution, and to calculate the values in the dilution series. The standard for the GUSB control gene cannot be diluted in human DNA.
5.8.3 Comparison with other DNA Q-PCR methods There is only one published paper studying Q-PCR for BCR-ABL DNA (Zhang et al. 1996). More recently, our collaborators in the UK presented an abstract describing DNA Q-PCR after allografting (Sobrinho-Simoes et al. 2007). The two major differences between this study and these reports were the use of nested PCR, and the quantification of a DNA control gene. In our experiments with single step real-time DNA PCR the lower detection limit of the assay in most patients was similar to the two earlier reports. If the real-time PCR is efficient and specific there is probably no improvement in sensitivity by the use of nested PCR. In such cases the principal advantage of nested DNA Q-PCR was the potential to use a larger amount of DNA in the first round PCR in order to reduce sampling error, and thereby lower the detection limit of the assay. In a minority of patients non-specific amplification in real-time DNA PCR precluded quantification using the single-step method. In some of those cases it might have been possible to re-design the primers and probe to overcome the non-specificity. We did not attempt to re-design the oligonucleotides because of cost and time constraints, and because we were able to obtain results using nested DNA Q-PCR. Our experience in designing primers for over 30 patients suggested that sequence-specific constraints will mean that it is sometimes not possible to ensure efficient and specific amplification of BCR-ABL in single step real-time DNA PCR. Another potential advantage of the nested PCR assay was the standardization of the amount of DNA in the first round of the assay. It has been reported in RT-PCR that the starting amount of RNA affects the efficiency of the reaction (Stahlberg et al. 2004). In DNA PCR it is likely that the efficiency of the reaction would be compromised once the DNA concentration exceeded a certain threshold, but it is possible that the DNA input in nested PCR could be increased significantly. This would be of practical benefit, as it would greatly reduce the number of replicates required for a highly sensitive assay, and it should reduce the measurement error of a quantifiable result.
91
By performing Q-PCR for the GUSB control gene we showed that the yield of amplifiable DNA differed according to the extraction method. The best of our three methods was column extraction of DNA from fresh cells in EDTA. Even in this setting the amplifiable yield for a given amount of DNA by spectrophotometry was variable. The correlation statistic for the comparison of the two methods suggested that only half of the variability in the amplifiable amount was reflected in the spectrophotometry result. The amplifiable yield might be reduced by DNA damage or fragmentation, or by the presence of a functional inhibitor of PCR. The lower yield of amplifiable DNA from fresh cells collected in heparin suggested that PCR inhibitors were not entirely removed by the silica column extraction method. The quantification of a control gene by Q-PCR must increase the accuracy of the quantitative result, and of the calculated detection limit of the assay. A DNA-based MRD assay that uses the spectrophotometry value is probably over-estimating the sensitivity of each sample. There are several potential problems in our method of quantifying GUSB. The first is that it is not possible to prepare GUSB standards diluted in human DNA, yet dilution in a material other than human DNA might affect the efficiency of real-time PCR. This problem could not be avoided. Secondly, we had no reference material for intact, amplifiable DNA, so we had to create a standard and assign a DNA concentration determined by spectrophotometry. In fact, the Q-PCR detection limit of the GUSB standard in serial dilution experiments showed good agreement with the assigned value. Thirdly, our highest standard contained 100 ng/μL DNA, but a significant proportion of samples had higher concentrations, and it was therefore necessary to extrapolate these higher values off the standard curve. This was most problematic in Trizol® samples, and we avoided the use of Trizol® samples if fresh cells could be obtained. In future we should prepare a standard with a higher DNA concentration. Finally, the GUSB Q-PCR method quantifies a DNA fragment of 76 bp. The real-time PCR BCR-ABL amplicons were similar in length (median 85 bp), but the first round PCR products were significantly longer (median 253 bp). If DNA lesions are randomly distributed the probability of a lesion occurring in the target is proportional to the length of the target. Consequently, if there is any DNA damage the number of intact targets of 253 bp will be less than the number of intact targets of 76 bp. Therefore, the control gene amplicon should ideally be of the same length as the BCR-ABL amplicon. A real-time PCR product of 253 bp would not be amplified efficiently, but it would be possible to determine the significance of this theoretical problem by performing nested PCR for the GUSB control gene, with a first round product of the appropriate length. Guidelines for the performance of DNA PCR for MRD quantification in ALL were published while this work was in progress (van der Velden et al. 2007). We have independently reached similar conclusions with regard to some methodology: e.g. the setting of negative thresholds based on non-specific amplification, and the performance of replicates to ensure reliable results. Some other of the recommendations could be incorporated in our assay: e.g. the authors defined an acceptable range for the slope of the standard curve, and individual assays in which the slope fell outside this range were rejected. This should improve the precision of the assay. In nested DNA Q-PCR the acceptable range will need to be determined retrospectively after collating the standard curves of a number of replicate PCR runs. An important difference between our method and the ESG-MRD-ALL method is that they determined the blast cell percentage in the mononuclear cells that were used for DNA extraction to prepare the standard curve (van der Velden et al. 2007). This ensures that the baseline sample represents 100% leukaemic cells. In contrast in CML the leukaemic clone cannot be defined by morphology or flow cytometry. The most accurate way to assign a number of leukaemic cells in our diagnostic material would be FISH. Our current quantitative method reports results as a log-reduction from the proportion in the original sample. Because the proportion of leukaemic cells in most samples is close to 90% by interphase FISH this
92
should not unduly affect the accuracy of results, taking into account the measurement error of Q-PCR. Nevertheless, there are occasional patients with lower proportions of leukaemic cells at diagnosis, or the only DNA available might be from a sample collected after treatment. In response to this problem we tested the use of a BCR-ABL PCR amplicon (one could substitute a BCR-ABL plasmid) as a standard with a defined BCR-ABL copy number. We showed that quantitative results could be obtained, and in the longer term this would be a useful improvement to our method.
5.8.4 Kinetics of response to imatinib treatment Kinetic modelling of the response to imatinib of chronic phase CML using BCR-ABL RQ-PCR data shows a biphasic reduction in disease burden. There is a rapid reduction in the first 3 months, of around 2 log, and this is followed by a much slower reduction (Michor et al. 2005). Beyond 18 months the average rate of reduction in BCR-ABL mRNA was around 0.25 log per annum (Branford et al. 2007). We wanted to examine whether DNA PCR would provide similar information, or whether it would identify patients in whom DNA and mRNA kinetics were different. So far we have collected small numbers of observations only from the first few months of treatment. Prior to commencing imatinib treatment the median BCR-ABL DNA level was 88%. In the first month there was little change in the BCR-ABL DNA level, while the mRNA level fell approximately 1 log. If the proportion of leukaemic cells remains close to 100% for the first month of treatment the reduction in BCR-ABL mRNA must be due, at least in part, to a reduction in the BCR-ABL/BCR ratio in individual cells. Immature CML cells have relative over-expression of BCR-ABL (Jiang et al. 2007), and the achievement of CHR is associated with the clearance of immature myeloid cells from the peripheral blood. This suggests that the majority of peripheral blood cells at the time of achieving CHR remain leukaemic, despite the falling BCR-ABL mRNA level, and that a significant reduction in the proportion of leukaemic cells can only occur if there is recovery of normal, non-clonal haematopoiesis. This hypothesis could be tested by monitoring imatinib-treated patients who have problematic cytopenia, which is thought to be due to delayed recovery of normal haematopoiesis. In this setting our hypothesis would predict that the drop in BCR-ABL DNA level is greater when the white cell count recovers than when pancytopenia occurs. After the first month we found a closer agreement between BCR-ABL DNA and mRNA levels. After the achievement of CHR the leukaemic cell population is presumably more homogeneous and the reduction in BCR-ABL mRNA should more closely parallel the reduction in cell number. The measurement error of the real-time DNA PCR assay is not yet sufficiently well defined to interpret apparent differences between BCR-ABL DNA and mRNA at a low level. As data continue to accumulate we aim to examine the log-reduction in BCR-ABL DNA that corresponds to the prognostically important threshold of MMR.
5.9 Publication of findings and contributions of co-authors The BCR-ABL DNA PCR methods and results have been presented at various stages of development at the annual scientific meetings of the European Hematology Association (Ross et al. 2007), the Haematology Society of Australia & New Zealand (oral presentations October 2007 and October 2008), and the American Society of Hematology (Ross et al. 2008). The BCR-ABL DNA Q-PCR method was developed by David Ross. Timothy Hughes and Susan Branford supervised the research. Paul Bartley and Alexander Morley collaborated in the development of breakpoint detection methods. The remaining co-authors were collaborators in the ALLG CML8 clinical trial.
93
6 Clinical trial of imatinib withdrawal in CML patients with a stable complete molecular response
6.1 Rationale After several years of imatinib treatment an increasing proportion of chronic phase CML patients achieve a complete molecular response (CMR) (Branford et al. 2007). Whether it is possible for these patients safely to stop treatment is an important clinical and biological question. Prior experience in the treatment of CML has shown that the achievement of clinical, morphological and cytogenetic remission does not indicate eradication of the disease: for months or years after achieving CCR virtually all patients have measurable disease by RQ-PCR, and would relapse if imatinib were withdrawn (Cortes et al. 2004; Mauro et al. 2004). These patients must harbour residual leukaemic cells capable of re-establishing the disease. CMR defines a group of patients with a low level of MRD. The eradication of CML would require CMR, but CMR is not a guarantee of eradication of the leukaemia, because the significance of CMR is determined by the detection limit of the assay that is used. The work presented in the foregoing chapters was intended to improve the sensitivity of MRD detection with the aim of identifying patients who might be able to stop imatinib treatment and remain in CMR.
6.1.1 Hypotheses The depth of molecular response in chronic phase CML in CMR is variable, and some patients with a sustained, stable CMR on imatinib treatment have MRD. A higher level of MRD identifies patients at higher risk of relapse on imatinib withdrawal.
6.2 Design of the clinical trial Chronic phase CML patients who had achieved a sustained, stable CMR in response to imatinib monotherapy were enrolled in the ALLG CML8 study. Prior therapy other than imatinib was permitted, with the exception of allografting. Imatinib treatment was ceased and RQ-PCR monitoring was performed monthly in the first year, and 2-monthly in the second year. The primary objective of the study was to determine the probability of sustained CMR two years after imatinib cessation. The principal secondary objective of the study was to determine the safety of imatinib cessation, as indicated by the response of patients to re-treatment with imatinib. The accrual target was 50 patients. The study is ongoing, and the current interim analysis was undertaken for this thesis. A final analysis is expected in 2012.
6.2.1 Contribution of the author David Ross designed the study with the Principal Investigator, Timothy Hughes, and in consultation with other members of the ALLG. David Ross wrote the study protocol, was responsible for the study budget, was involved in the day-to-day management of the study, analysed the study data, and performed the correlative science studies, as described in this thesis.
94
6.2.2 Inclusion and exclusion criteria
6.2.2.1 Definition of stable CMR A complete molecular response was defined as undetectable BCR-ABL transcripts in an RQ-PCR assay with a calculated sensitivity of at least 4.5 log below the standardized baseline, and confirmed on subsequent testing (Branford et al. 2007). Patients were required to have at least two tests per annum for at least 2 years prior to enrolment. If BCR-ABL was detected in any test on either peripheral blood or bone marrow the patient was not eligible. These samples were tested in various laboratories around Australia, and not all samples could be expected to achieve a calculated sensitivity of at least 4.5 log. Consequently, a screening RQ-PCR assay was sent to the IMVS to determine eligibility, and was required to achieve a calculated sensitivity of at least 4.5 log. In addition, if stored RNA was available from earlier time points, selected samples were sent to the IMVS for re-analysis in an effort to standardize the sensitivity of CMR samples over the 2 year qualifying period.
6.2.2.2 Disease status and treatment In order to minimize any potential risk associated with the interruption of effective anti-leukaemic therapy, the intention of the study was to enrol only patients with chronic phase disease. An exception was made for patients with accelerated phase disease where the definition of AP was based solely on the emergence of clonal evolution without evidence of haematological acceleration. There is evidence to suggest that such patients have a prognosis comparable to that of CP patients (O'Dwyer et al. 2002; Cortes et al. 2003). Patients with prior haematological acceleration or blast crisis were excluded. Patients were enrolled in one of two cohorts. Patients in the ‘imatinib-only’ (IM-only) cohort were treated de novo with imatinib in early chronic phase. Any imatinib dose was acceptable, but patients who had significant intermission of imatinib treatment in the 3 months prior to enrolment were excluded. Prior cytoreductive therapy with leukapheresis, hydroxyurea or anagrelide was allowed. All of the patients in the second cohort, with prior therapy before commencement of imatinib, had received interferon-α (IFN-IM cohort). In addition, IFN-IM patients may have received cytotoxic treatment such as cytarabine, busulphan, or autografting with myeloablative conditioning. All patients were required to have measurable BCR-ABL by RQ-PCR or cytogenetics at the time of commencing imatinib, and the CMR should have been achieved solely in response to imatinib therapy. Allogeneic stem cell transplantation was excluded due to the potential confounding effects of an immunological graft-versus-leukaemia response. Patients treated with an ABL kinase inhibitor other than imatinib were excluded.
6.2.2.3 Other criteria Patients with serious co-morbidities, including active neoplasia, were excluded. The use of G-CSF (or other cytokines) was not permitted within one month prior to enrolment because of a theoretical risk of increasing proliferation or mobilization of CML precursor cells.
6.2.3 RQ-PCR monitoring of BCR-ABL mRNA All study samples for BCR-ABL RQ-PCR were sent to the IMVS. RQ-PCR was performed, as described in Section 2.3.4, with one significant modification from the routine method of the IMVS laboratory: random pentadecamer primers were used in place of random hexamers in order to increase the BCR-ABL transcript copy number and achieve approximately a 2-fold lower limit of detection (Ross et al. 2008).
6.2.4 Definition of relapse Based on the depth of response in CMR patients, and prior published experience with imatinib cessation it was anticipated that any relapse would first be detected at a molecular
95
level (Rousselot et al. 2007). Haematological and cytogenetic relapse were defined conventionally (O'Brien et al. 2003). Molecular relapse was defined solely on the basis of peripheral blood (PB) RQ-PCR monitoring as: 1) any single result above the level of a major molecular response (BCR-ABL >0.1%); or 2) any two consecutive results with detectable BCR-ABL mRNA. In cases where relapse was defined on the basis of two consecutive results, the relapse was deemed to have occurred on the first of the two dates. Bone marrow (BM) RQ-PCR for BCR-ABL was performed, but the results were not considered in determining molecular relapse for clinical purposes because BM RQ-PCR is not a routine part of the clinical management of chronic phase CML patients. BM RQ-PCR was performed only for the purpose of comparing its sensitivity with that of PB RQ-PCR.
6.2.5 Treatment of relapse On confirmation of relapse additional bone marrow and peripheral blood samples were collected, and imatinib treatment was recommenced. The imatinib dose was at the discretion of the treating clinician, with the assumption that the previous tolerated and effective dose would be used. RQ-PCR monitoring was performed monthly until CMR was achieved and sustained for at least 6 months, for up to a maximum of 12 months.
6.2.6 Study stopping rules At the time of writing the study protocol there were no published data on which to base estimates of the risk of relapse. In order to reduce the potential risk to patients taking part in the study, two sets of stopping rules were applied. The first rules applied in case the rate of relapse was unacceptably high. The second rules applied in case the response of patients to re-treatment with imatinib was unacceptably poor. These rules were applied independently to each of the treatment cohorts. Consideration was to be given to early closure or modification of the trial if 7 or more of the first 8 patients were to relapse in the first 6 months off imatinib. In order to assess this endpoint, accrual was suspended after the first 8 patients had been registered and it recommenced when at least 2 of the first 8 patients had not experienced a molecular relapse in their first 6 months off imatinib. At the time of this interim analysis both cohorts had passed this stopping rule. Consideration was to be given to early closure or modification of the trial if 1 or more of the first 6 patients who relapsed should fail to achieve a MMR within 6 months of restarting imatinib, or if two or more of the first 12 patients who relapsed should fail to achieve MMR within 6 months of restarting imatinib. At the time of this interim analysis 7 relapsed patients (from both cohorts) had completed 6 months of imatinib re-treatment and all of these patients were in MMR.
6.3 Interim results of the clinical trial
6.3.1 Patient characteristics Twenty-two patients were included in this interim analysis. The first patient was enrolled in July 2006, and the 22nd patient was enrolled in November 2008. The patients were diagnosed with CML between 1994 and 2004. Eight patients received imatinib treatment only (IM-only cohort), and 14 patients had received other treatment before commencing imatinib, including IFN (IFN-IM cohort). The characteristics of the 22 patients are summarized in Table 6.1. The mean age of the patients was 58 years. The mean duration of imatinib treatment was 62 months, and the mean duration of CMR prior to imatinib cessation was 43 months. In the IM-only cohort the mean time to achieve MMR after first starting imatinib was 5 months,
96
whereas in the IRIS study fewer than 50% of patients achieved MMR in the first 12 months of imatinib treatment (Hughes et al. 2003). In the IFN-IM cohort the mean duration of IFN treatment prior to commencing imatinib was 42 months (range 4 to 99 months). There were no statistically significant differences between the two treatment cohorts, but with small numbers in each group the statistical tests of difference were under-powered. Seven of 8 patients in the IM-only cohort were female, in comparison with 6 of 14 in the IFN-IM cohort (p=0.07). There has been no prior report to suggest a higher rate of CMR and female patients on imatinib treatment, and this (non-significant) difference will presumably diminish as greater numbers of patients are accrued. Table 6.1 Baseline characteristics of the 22 patients enrolled in the CML8 study
IFN-IM cohort
(n=14)
IM-only cohort
(n=8)
p-value
Age (years) 58 (42-70) 58 (29-72) >0.5
Male sex 57% 13% 0.07
Duration of imatinib treatment (months) 63 (40-82) 62 (42-89) >0.5
Duration of CMR (months) 46 (26-78) 38 (24-82) 0.34
Duration of imatinib prior to CMR (months) 17 (3-46) 26 (12-53) 0.19
The values given are mean (range)
6.3.2 Sensitivity and specificity of RQ-PCR monitoring The EAC sensitivity formula was used to estimate the lower detection limit of BCR-ABL mRNA by RQ-PCR (Beillard et al. 2003). All patients were required to demonstrate CMR in an RQ-PCR assay with a sensitivity of at least 4.5 log at study entry, but the true depth of molecular response might be better reflected by the average sensitivity achieved over a longer period. The average detection limit for each patient was calculated using all available samples from the period of CMR (a minimum of 2 years). The median sensitivity was 4.60 log (range 3.61 to 5.13 log), and was similar in patients who did and did not relapse. Four patients had an average detection limit of <4.5 log (less sensitive), and 3 of the 4 relapsed, versus 7 of 18 in the patients with an average detection limit of ≥4.5 log (p=0.29). All patients who relapsed had two or more consecutive samples with detectable BCR-ABL, and these results were considered to be true positives, meeting the study definition of relapse. A sample with a detectable BCR-ABL value of <0.1% that was not confirmed on the following test might represent: 1) a false positive, 2) detection of MRD at the very limit of sensitivity of the test, or 3) a variable level of MRD. Only four such samples have been encountered in the study to date. Two of these patients subsequently relapsed (4 months and 5 months later, respectively) and are described in more detail in Section 6.3.3.1; the other two patients remained in CMR after follow-up of 2 months and 6 months, respectively.
6.3.3 Molecular relapse-free survival The median follow-up was 17 months (range 3-30 months). The Kaplan-Meier estimate of molecular relapse-free survival (MRFS) for all 22 patients, shown in Figure 6.1, was 47% (95% confidence interval 23% – 68%). Ten patients relapsed after a median interval of 4 months (range 2-16 months). Only two relapses occurred more than 6 months after imatinib cessation: both of these patients were in the IFN-IM cohort and relapsed at 15 months and 16 months, respectively.
Figure 6.1 Molecular relapse-free survival for all 22 patientsThe Kaplan-Meier estimate of molecular relapse-free survival is shown together with the 95% confidence intervals of the estimate (broken lines). With a median follow-up of 17 months the probability of remaining in a stable CMR after imatinib withdrawal was 47%.
Months on study181260 24
Prop
ortio
n in
sta
ble
CM
R
0.25
0.5
0.75
1.0
30
6.3.3.1 MRFS in the IFN-IM cohort The Kaplan-Meier estimate of MRFS for the 14 patients treated with IFN prior to imatinib was 53% (95% confidence interval 23% – 76%) with a median follow-up of 20 months (Figure 6.2). Excluding the one patient with <6 months of follow-up the characteristics of the patients who have (n=4) and have not (n=9) relapsed are compared in Table 6.2. There were again no statistically significant differences between the two groups. Table 6.2 Baseline characteristics of 13 IFN-IM patients according to relapse status
Stable CMR (n=7)
Relapse (n=6)
p-value
Age (years) 58 57 >0.5
Male sex 71% 33% 0.29
Duration of interferon treatment (months) 53 (9-99) 32 (4-89) 0.27
Duration of imatinib treatment (months) 59 (42-89) 67 (52-78) 0.33
Duration of CMR (months) 46 (29-82) 49 (40-59) >0.5
Median duration of imatinib treatment prior to achieving CMR (months)
6 (3-46) 12 (6-32) 0.14
The average values given are means (range), except where indicated
97
Figure 6.2 Molecular relapse-free survival according to patient cohortThe Kaplan-Meier estimate of molecular relapse-free survival (MRFS) is shown for the IM-only cohort (50%; median follow-up 9 months) and the IFN-IM cohort (53%; median follow-up 20 months). There was no significant difference in MRFS between the two cohorts (p=0.44).
IFN-IM
IM-only
Months on study181260 24
Prop
ortio
n in
sta
ble
CM
R
0.25
0.5
0.75
1.0
30
We examined whether the depth of response to prior IFN therapy might be predictive of relapse risk. The BCR-ABL mRNA level at the time of switching to imatinib treatment was available for 10 patients, and ranged from 0.01% to 26%. The mean BCR-ABL level did not differ between patients who relapsed (8.3%) and those in stable CMR (2.1%; p=0.37). One of 4 patients who relapsed was in a MMR at the time of first starting imatinib versus 3 of 6 patients who remain in stable CMR (p>0.5). We examined whether the duration of IFN treatment might be predictive of relapse risk. Three of 4 patients who had received less than 1 year of IFN treatment relapsed; in contrast, 3 of 9 patients who received at least 1 year of IFN treatment have relapsed (p=0.27), and 2 of the 3 relapses in the latter group occurred more than a year after stopping imatinib. The two patients who experienced a late molecular relapse were females aged 50 and 66 years, respectively. They had received IFN treatment for 50 months and 89 months, respectively. Both patients had a good response to IFN, with BCR-ABL mRNA levels <1% by RQ-PCR at the time of commencing imatinib, and both achieved a CMR within 12 months of changing to imatinib treatment.
6.3.3.2 MRFS in the IM-only cohort The Kaplan-Meier estimate of MRFS for the 8 patients treated only with imatinib was 50% (95% confidence interval 15% – 77%) with a median follow-up of 9 months (range 6-18 months), as shown in Figure 6.2. The estimated MRFS was not significantly different in the
98
IFN-IM and IM-only cohorts (log rank test p=0.44). All relapses in the IM-only cohort occurred within the first 6 months. In the IM-only cohort the number of patients was too small to permit a comparison of clinical characteristics that might be associated with stable CMR after imatinib withdrawal. BCR-ABL levels by RQ-PCR from the first year of treatment were available for 6 of the patients, and in all of these patients there was a steep reduction in BCR-ABL with a median time to MMR of 4 months (range 3-9 months).
6.3.4 Relapse and response to imatinib re-treatment At the time of writing 10 patients had relapsed. No patient had a cytogenetic or haematologic relapse. All relapses were defined by two consecutive results with the first below the level of MMR (<0.1%). The median BCR-ABL level at the onset of relapse was 0.006%, the highest BCR-ABL level reached was a median of 0.06%, and 2 patients lost MMR (Figure 6.3).
Figure 6.3a BCR-ABL mRNA levels during molecular relapseThe BCR-ABL levels for the 10 patients who relapsed are shown. Patients in the IFN-IM cohort are indicated by solid lines; IM-only patients by broken lines. In the first column, CMR*, the value shown is the calculated lower limit of detection of BCR-ABL in the RQ-PCR sample from the month preceding relapse. This can be viewed as the highest possible level of MRD present.The true value must be at or below this level. Each relapse was defined by two consecutive positive results one month apart.
CMR*
BC
R-A
BL
mR
NA
leve
l (%
)
Second positive
First positive
*
0.001
0.1
0.01
99
Months on imatinib re-treatment
0.001
5431
0.01
1
0.1
BC
R-A
BL
mR
NA
leve
l (%
)
2
* * *
*
**
**
*
Figure 6.3b BCR-ABL mRNA levels during imatinib re-treatmentImatinib was resumed after the second positive result confirmed relapse. The last result shown for each patient is thesample when CMR was regained. The detection limit of the sample indicating CMR is shown (*), and the true level of MRD must be at or below this level. All patients with more than 6 months of imatinib re-treatment have regained CMR. One patient had received imatinib re-treatment for less than one month, and is not shown.
The relapse gradient was estimated as the log-increase in BCR-ABL per day based on the change in BCR-ABL mRNA level from the first relapse sample to the second (or highest subsequent BCR-ABL level). The median relapse gradient in 10 patients was 0.02 log/d, or a doubling time of 15 days (range 6 to 20 days in the 8 patients with a positive gradient). This relapse gradient is comparable with the estimate derived from 3 patients in a previous report (Michor et al. 2005).
100
Two patients (PRM and WO) who relapsed in the IFN-IM cohort had no progressive increase in BCR-ABL between the first and subsequent positive results. Their BCR-ABL RQ-PCR results are shown in Figure 6.4, together with the results of a third patient (PM) who did show
a progressive increase in BCR-ABL. The calculated detection limits of the patients’ assays were compared with the BCR-ABL levels. The BCR-ABL levels in PRM and WO were within approximately 0.5 log of the estimated detection limit of the RQ-PCR assay. Interestingly, both patients had a single positive RQ-PCR result around 4 to 5 months before relapse was detected, and in both patients the earlier result indicated a level of MRD similar to that seen at relapse. These results raise the possibility that the ‘relapse’ was due to a stable or minimally increased level of MRD close to the limit of detection. This pattern of relapse was strikingly different from the kinetic models reported previously (Michor et al. 2005; Roeder et al. 2006).
Figure 6.4 BCR-ABL mRNA levels indicate two different patterns of molecular relapsePatient PM exemplifies a ‘typical’ relapse with a progressive increase in BCR-ABL (solid line). Patients WO and PRM had little or no progressive rise in BCR-ABL, and the level of MRD remained close to the calculated detection limit of RQ-PCR (broken line).
Months on study
0.001
Undet181260
0.1
1
0.01
0.001
Undet
0.1
1
0.01
0.001
Undet
0.1
1
0.01
BC
R-A
BL
mR
NA
leve
l (%
)
WO
PRM
PM
6.3.4.1 BCR-ABL kinase domain mutations Point mutations in the kinase domain of BCR-ABL are associated with acquired resistance to imatinib therapy (Gorre et al. 2001; Branford et al. 2002). The region encoding the kinase domain of BCR-ABL was amplified in cDNA from relapsed patients, and direct sequencing
101
was performed (Branford and Hughes 2006). No kinase domain mutations were identified in any of the relapsed patients.
6.3.4.2 Response to imatinib re-treatment All patients who relapsed resumed imatinib as planned. At last follow-up all patients were in a MMR, and 9 of 10 patients had regained a CMR. The only patient not in CMR had commenced imatinib re-treatment less than one month before. All patients regained CMR within 6 months of imatinib re-treatment (Figure 6.3b). A CMR regained after imatinib re-treatment was stable: the first patient to relapse was in continuous CMR for 21 months at last follow-up, and no patient on imatinib re-treatment had lost the second CMR.
6.4 Sensitive detection of BCR-ABL mRNA to predict relapse
6.4.1 Bone marrow versus peripheral blood RQ-PCR BM aspiration was performed every 3 months for up to 12 months in patients who remained in a stable CMR. The results of BM and PB RQ-PCR are shown in Figure 6.5 for the 10 patients who relapsed. Only 4 patients relapsed at a BM collection time point: in 3 patients the PB and BM results were concordant, whereas in the fourth patient BCR-ABL was detected in the PB, but not in the BM. Given that the timing of molecular relapse was clustered around 4 months in 8 of the 10 patients the BM sample collected 3 months after imatinib cessation was the only one evaluable for the majority of relapsing patients. With this pattern of relapse it would have been necessary to perform the BM aspirate much more frequently in the first 6 months to have had an opportunity to detect relapse at an earlier time point.
PB
1
4
3
5
2
6
7
8
9
RQ-PCR negative
RQ-PCR positive
RQ-PCR failed/not sent
Months since imatinib cessation0 123 6 9
BMPB
BM
BMPB
BMPB
BMPB
BMPB
BMPB
BMPB
BMPB
PBBM
10
15
Figure 6.5 Comparison of marrow and blood monitoring of BCR-ABL mRNA levelsRQ-PCR was performed on peripheral blood (PB) and bone marrow (BM) samples every 3 months in the first year off treatment. PB RQ-PCR was performed monthly. Allowing for the difference in test frequency the results were concordant in most cases. In one patient BCR-ABL mRNA was detected first in BM, and in one patient first in PB.
There were 2 patients in whom BCR-ABL mRNA was detected in a BM sample before the occurrence of relapse, as defined by PB RQ-PCR (1 month and 5 months earlier, respectively). In a third case there was a single positive BM RQ-PCR result in a patient who
102
103
has not relapsed (to date). Conversely, in a fourth patient BCR-ABL mRNA was detected in the PB 4 months before relapse, and yet BCR-ABL was not detected in the intervening BM. We concluded that, in patients monitored by PB RQ-PCR for BCR-ABL, there was probably no additional clinical benefit in performing BM RQ-PCR, and certainly not at intervals of 3 months or greater.
6.4.2 Nested real-time RT-PCR for BCR-ABL Nested real-time RT-PCR was performed on cDNA at selected time points using the method described in Section 3.5. The volume of cDNA remaining after the completion of RQ-PCR testing was small, and replicate nested real-time RT-PCR could not be performed. At the time when testing was performed 8 patients had relapsed, and the sample tested for each of these patients was the cDNA from one month prior to relapse: BCR-ABL mRNA was detectable in 3 out of 8 patients. At the same time a further 8 patients had completed 6 months of follow-up and had not relapsed: for these patients the sample tested was the cDNA from 6 months after imatinib cessation: BCR-ABL mRNA was not detected in any of the 8 samples. However, one of these 8 patients subsequently relapsed 16 months after imatinib withdrawal. The remaining 6 patients were not tested because they had less than 6 months of follow-up at the time of the analysis. These results suggest that nested real-time RT-PCR was more sensitive than RQ-PCR, and was specific for subsequent relapse. However, 5 patients who did relapse had no detectable BCR-ABL mRNA when tested just one month before relapse. The novel nested real-time RT-PCR method (described in Chapter 3) was estimated to be around 1 log more sensitive than RQ-PCR. Extrapolating from the median relapse gradient of 0.02 log/d the predicted average level of BCR-ABL one month before relapse would be 0.6 log below the level of CMR. Given the variability of relapse gradients, and the limitation of not having performed replicate nested RT-PCR assays, the detection of BCR-ABL in 3/8 patients was consistent with the estimated detection limit of the test.
6.5 Patient-specific BCR-ABL DNA Q-PCR DNA samples were collected from all patients at all RQ-PCR time points. The patient-specific BCR-ABL DNA breakpoint was identified in 13 study patients (59%), as described in Chapter 4. Quantitative DNA PCR, as described in Chapter 5, was performed at selected time points for 12 patients, excepting only the patient most recently enrolled. Failure to identify the breakpoints in the remainder was primarily due to difficulty in obtaining DNA from the time of diagnosis. No sample was received from 5 of the patients, and the DNA from the other 4 patients was partially degraded. All patients with stored leukaemic cells available for DNA extraction had the BCR-ABL breakpoint identified, and patient-specific primers and probes were designed for all of these patients.
6.5.1 BCR-ABL breakpoint characteristics of the study patients Four BCR breakpoints were in intron 13, and 9 were in intron 14. Ten ABL1 breaks were between exons Ib and Ia; 2 breakpoints were between exons Ia and 2; and one breakpoint was upstream of exon Ib, outside the ABL1 gene. The distribution of breakpoints in study patients was similar to the overall distribution of breakpoints in the 100 patients reported in Chapter 4. ABL-BCR was detected in genomic DNA in 2/13 patients (15%) versus 54% in the unselected patient group (14/26; p=0.05). Eight patients (one of whom had ABL-BCR with an ABL1 breakpoint upstream of exon Ib) had available archived cDNA with a high level of BCR-ABL: ABL-BCR mRNA was not detected in any of these samples, corroborating the absence of ABL-BCR DNA in these patients.
104
6.5.2 BCR-ABL DNA PCR identified MRD in patients in CMR Eleven out of 12 patients studied had detectable BCR-ABL DNA on at least one occasion when otherwise in a CMR, confirming the higher sensitivity of the DNA PCR method. The difference in the estimated lower limit of detection between DNA PCR and RQ-PCR was approximately 1 to 1.5 log.
6.5.3 The detection of BCR-ABL DNA prior to imatinib withdrawal did not predict subsequent relapse
Samples collected at study entry, prior to imatinib withdrawal, were tested in 11 patients (one sample was not available). Seven patients (64%) had detectable BCR-ABL DNA at study entry, after a minimum of 2 years of stable CMR defined by sensitive RQ-PCR monitoring. Four of these patients (57%) subsequently relapsed within the first 6 months after imatinib withdrawal. The 3 remaining patients were still in CMR after intervals of 5, 6, and 20 months, respectively. Four patients were BCR-ABL DNA-negative at study entry, but had BCR-ABL DNA detected during follow-up: 2 of these patients (50%) subsequently relapsed 2 months after the detection of BCR-ABL DNA, while the remaining 2 patients remained in a stable CMR after 18 months and 30 months, respectively. Consequently, the identification of BCR-ABL DNA prior to imatinib withdrawal was not predictive of relapse.
6.5.3.1 BCR-ABL DNA in IM-only patients Of the 11 patients tested prior to imatinib withdrawal 4 were in the IM-only cohort. BCR-ABL DNA was detected in all 4 patients, 2 of whom have relapsed. A fifth IM-only patient had no baseline sample available, but the sample collected one month after imatinib withdrawal was tested, and BCR-ABL was not detected. This patient subsequently relapsed.
6.5.3.2 BCR-ABL DNA in IFN-IM patients Of the 11 patients tested prior to imatinib withdrawal 7 were in the IFN-IM cohort. BCR-ABL DNA was detected in 3 patients, 2 of whom have relapsed. The duration of IFN treatment was >2 years for 2 of these patients, and 7 months for the third patient. Of the 4 patients with no detectable BCR-ABL DNA at baseline only one patient has relapsed. This patient had received only 4 months of IFN treatment, whereas the other 3 patients had all received more than 2 years of IFN prior to commencing imatinib. The conclusions that can be drawn from these data are limited by the very small numbers of patients in each sub-group. There was a suggestion that the level of MRD was lower in the IFN-IM cohort (3/7 positive vs 4/5 in the IM-only cohort), but there was no indication that the duration of IFN treatment influenced the level of MRD.
6.5.4 BCR-ABL DNA levels increased at or before relapse Six of the 10 patients who relapsed were available for analysis by BCR-ABL DNA Q-PCR (Figure 6.6). Three of these patients were in the IFN-IM cohort, and 3 in the IM-only cohort. In all 6 patients there was a significant increase in the level of MRD measured by BCR-ABL DNA at or before the detection of mRNA relapse. Relapse was associated with a reduction in the BCR-ABL Ct in nested DNA Q-PCR, and an increase in the proportion of PCR replicates that gave positive results (Table 6.3). As described in Section 6.3.4, patient WO in the IFN-IM cohort had no progressive rise in BCR-ABL mRNA at the time of relapse. Prior to imatinib withdrawal the estimated BCR-ABL DNA level was 5.4 log below baseline (5/12 replicates positive). At relapse 6 months later the BCR-ABL DNA level was higher at 4.9 log below baseline (7/8 replicates positive). The estimated relapse gradient from the DNA data was 0.003 log/d (Figure 6.7), which is considerably below the average of 0.02 log/d estimated in the 10 relapsed patients using BCR-ABL mRNA levels. The average relapse gradient calculated from BCR-ABL DNA levels in
four other patients was also 0.02 log/d (range 0.02-0.03 log/d). The very shallow relapse gradient in this patient was not seen in any of the IM-only patients, and again suggests that prior IFN therapy might alter the pattern of relapse.
RNA
1
4
3
5
2
6
BCR-ABL not detected
BCR-ABL detected
Sample not available
Months since imatinib cessation
0 2 4 6
DNARNA
DNA
DNARNA
DNARNA
DNARNA
DNARNA
Figure 6.6 Comparison of BCR-ABL mRNA and DNA detection in 6 patients who relapsedSix patients were monitored by DNA PCR and relapsed. BCR-ABL DNA was detected before BCR-ABL mRNA in all 6 patients.
Table 6.3 Example of BCR-ABL DNA PCR results from a patient who relapsed *
Days since imatinib
withdrawal
Number of DNA PCR replicates (positive/total)
Median Ct of positive
replicates
BCR-ABL DNA level
BCR-ABL mRNA level
0 3/20 23.51 5.82 >5.16
28 6/20 23.44 5.34 >5.06
84 4/4 18.78 4.25 4.90
Negative controls 0/26 -- Not detected --
* BCR-ABL levels are expressed as log-reduction from baseline. If BCR-ABL mRNA was not detected the result was shown as greater than the estimated detection limit of the sample (EAC calculated sensitivity). The negative control samples each contained 500 ng amplifiable DNA pooled from 5 normal individuals. In this particular patient-specific assay non-specific amplification occurred in normal DNA with a Ct of 31-35 cycles.
105
Figure 6.7 Patterns of relapse based on BCR-ABL mRNA and DNA in patient WORelapse gradients were estimated using data from BCR-ABL DNA (broken line) and BCR-ABLmRNA (solid line). Note that the initial positive mRNA result occurred with stable BCR-ABLDNA levels, and the second consecutive positive mRNA result was no higher than the first.
Months on study
BCR-
ABL
leve
l (%
)
0.0001
Undet9
imatinib resumed
-9 -3 0 63-6
DNAmRNA
0.001
imatinib ceased
6.5.4.1 BCR-ABL DNA levels decline during imatinib re-treatment The primary aim of the BCR-ABL DNA Q-PCR study was to improve the early detection of relapse, so samples from most of the 10 patients who relapsed were not tested during imatinib re-treatment. Three patients were tested on at least one occasion after regaining a CMR during imatinib re-treatment. In all 3 patients there was a reduction in the BCR-ABL DNA level, but BCR-ABL DNA remained detectable even in CMR (Figure 6.8).
AJR
FB
GRS
Figure 6.8 BCR-ABL DNA levels before and during imatinib re-treatmentOnly 3 patients were tested with BCR-ABL DNA Q-PCR after starting imatinib re-treatment (arrows). In all 3 patients BCR-ABL DNA levels fell, but remained detectable after CMR was restored.
30
BC
R-A
BL
leve
l (%
) 0.1
0.001
0.0001
1
Undet
0.00001
Months on study0 6 12 18 24
imatinib resumed
106
107
6.5.5 Comparison of DNA PCR and nested real-time RT-PCR for BCR-ABL Five of the 10 patients who relapsed were tested with both DNA Q-PCR and real-time nested RT-PCR. All 5 patients had BCR-ABL DNA detected before relapse, but only 2/5 had detectable BCR-ABL mRNA by nested RT-PCR. BCR-ABL DNA was detected 2 to 6 months before relapse. Nested RT-PCR was performed only at one month before relapse, so it was not possible to determine whether this method might also have detected relapse at an earlier time point.
6.6 Discussion The occurrence of molecular relapse in 45% of the study patients to date is clear evidence of the persistence of MRD in CML patients despite the demonstration of a stable CMR using a sensitive RQ-PCR method. The converse conclusion, that 55% of patients do not have MRD, cannot be drawn from these data. In fact, the development of a more sensitive DNA-based method for the detection of MRD enabled us to demonstrate that most patients (11 out of 12) had residual disease, including 5 patients who have not yet relapsed.
6.6.1 Minimal residual disease burden in stable CMR A plot of BCR-ABL RQ-PCR data from imatinib-treated CP CML patients reveals a biphasic response (Michor et al. 2005). The first phase of the imatinib response has a steep downward gradient, reflecting rapid clearance of mature CML progeny, and is associated with the achievement of haematological and cytogenetic response. The second phase has a shallow gradient, and is thought to reflect gradual depletion of the CML granulocyte-macrophage precursor (GMP) pool (Roeder et al. 2006). CML precursors are relatively resistant to imatinib (Graham et al. 2002; Jiang et al. 2007), and this slow depletion might reflect the induction of apoptosis in a manner that is dependent on cell cycle. Mathematical modelling of relapsing CML using RQ-PCR data and model assumptions from stem cell biology predicts a rapid increase in BCR-ABL when treatment is withdrawn (Michor et al. 2005; Roeder et al. 2006). In the model the rapid increase is due to the unchecked proliferation of progeny derived from a pool of CML GMP precursors. The time taken for MRD to rise to a level that results in molecular relapse will depend on the proliferative capacity of the GMPs and on the size of the GMP pool (as well as the sensitivity of the assay). Given the high proliferative capacity of cells derived from CP CML, it might be predicted that the size of the GMP pool at the time of imatinib cessation would be the primary determinant of the time to relapse. Beyond the second year of treatment the reduction in BCR-ABL mRNA is <0.5 log per annum in the majority of patients (Roeder et al. 2006; Branford et al. 2007). We found that most study patients had detectable BCR-ABL DNA at a level <2 log below the lower limit of detection of BCR-ABL mRNA. Given that patients had been in CMR on imatinib for a mean of 3-4 years prior to study entry, the BCR-ABL DNA levels observed were entirely consistent with the level of MRD predicted from mRNA data. Contrary to our hypothesis, we found no clear relationship between the level of MRD prior to imatinib withdrawal and the likelihood of subsequent molecular relapse. Some patients with detectable BCR-ABL DNA at study entry remained in a stable CMR, while other patients with no detectable BCR-ABL DNA relapsed within the first few months. These data parallel case reports from small numbers of patients in stable CCR after cessation of IFN (Bonifazi et al. 2001; Kantarjian et al. 2003). For instance, Verbeek reported a single patient with a stable MMR 9 years after IFN cessation (Verbeek et al. 2006). Our study is the first to report a stable level of MRD after cessation of therapy in a CML patient treated only with imatinib.
108
Broadly, two possible hypotheses might explain why a pool of viable leukaemic cells should not cause relapse. Firstly, there might be a critical number of leukaemic progenitors below which the population is no longer able to generate relapse (an ‘inoculum’), or the leukaemic progenitors that survive after imatinib treatment might be functionally defective. In transplantation models of leukaemia there may be a critical cell dose required to initiate leukaemia, but this probably reflects the rarity of true stem cells in a mixed population of leukaemic cells, rather than the need for a critical initiating mass of leukaemic progenitors. The estimated number of CML cells in a patient in CMR is up to around 106, which is similar to the number of leukaemic cells used in mouse transplantation experiments (Krause et al. 2006). A second, and more plausible, explanation is that the leukaemic clone is suppressed, most likely by immunological surveillance. This hypothesis is discussed in more detail below (Section 6.6.6).
6.6.2 Kinetics of response to imatinib treatment as a predictor of relapse when treatment was withdrawn
Quantifying the response to treatment in this study was complicated by the inclusion of a substantial number of patients treated with IFN before imatinib. In IM-only patients it was relatively simple to plot the initial rapid reduction in BCR-ABL to determine the response gradient, but there were too few patients to analyse whether this gradient was associated with the risk of relapse. Time to CMR and time to MMR were also examined, but from the limited data available there was no indication that the time to response was predictive of relapse risk. Much larger numbers of patients would be needed to enable an appropriately powered statistical analysis. Among IFN-IM patients the baseline pre-imatinib BCR-ABL level was highly variable, complicating the interpretation of imatinib response kinetics. Nevertheless, the time taken to achieve CMR on imatinib was not associated with relapse risk (Table 6.2).
6.6.3 Absence of the ABL-BCR gene and the response to imatinib treatment In our study there was an over-representation of patients in whom the ABL-BCR gene was undetectable using long range PCR. This over-representation reached borderline statistical significance (p=0.05), and might yet prove to be a chance finding. Deletions of der(9) have been shown to carry an adverse prognosis in patients treated with IFN (Cohen et al. 2001; Huntly et al. 2001; Kolomietz et al. 2001), but the expression of ABL-BCR mRNA in IFN-treated CML patients did not influence prognosis (Melo et al. 1996). No prognostic effect of der(9) deletions is seen in imatinib-treated patients (Huntly et al. 2003; Quintas-Cardama et al. 2005; Kim et al. 2008). We hypothesized that if the absence of ABL-BCR DNA had any prognostic effect it would be adverse, so the absence of ABL-BCR in most of the study patients tested was surprising, given that the group was selected for its excellent response to therapy. We inferred that small deletions on der(9) underlie the absence of genomic ABL-BCR using our breakpoint detection method. It is possible that the very large cytogenetic deletions of der(9) might occur by a fundamentally different mechanism, and might reflect a greater risk of genomic instability. Hence, smaller genomic deletions might not have the same biological and prognostic relevance as cytogenetic deletions. No ABL-BCR protein has ever been identified in CML cells (Melo et al. 1996), so it seems unlikely that ABL-BCR deletion would influence immunological responses to CML. In one study multiplex ligation probe-dependent amplification was used to identify ABL-BCR deletions in IFN-treated CML patients, and distinguished between deletions confined to ABL1, deletions confined to BCR, and deletions spanning the breakpoint. Unexpectedly, the study found that breakpoint-spanning deletions conferred a favourable prognosis (Kreil et al. 2007). If our initial observation is confirmed in
109
a larger number of ALLG CML8 study patients a more detailed investigation of the reciprocal translocation product may be warranted.
6.6.4 Optimizing the detection of MRD in CML patients In CP CML patients there is generally close concordance between BCR-ABL mRNA levels measured in blood and bone marrow samples. This observation is consistent with the near-normal maturation of CML cells, which would therefore be expected to circulate in the peripheral blood. When exposed to ABL kinase inhibitors in vitro CML stem cells may have a survival advantage over more mature CML cells (Graham et al. 2002; Jiang et al. 2007), and it is therefore plausible that there might be a higher proportion of leukaemic cells in the marrow than in the blood after prolonged imatinib treatment. However, we were unable to demonstrate any improvement in the detection of MRD in BM samples using RQ-PCR, although the comparison was limited by the lower frequency of BM sampling. There was no advantage to BM sampling for RQ-PCR analysis at a frequency that is likely to be acceptable to patients and clinicians. It may be of interest to re-examine this question using nested RT-PCR or DNA PCR, but this was not considered of sufficient priority within the constraints of the current body of work. In serial dilutions of BCR-ABL-positive cell lines we previously demonstrated an increase in the sensitivity of RT-PCR using a novel nested real-time PCR assay (Chapter 3). In patient samples collected during the ALLG CML8 study we confirmed that there was an improvement in the detection of BCR-ABL mRNA, with 3/8 samples having detectable BCR-ABL mRNA. The real-time nested RT-PCR assay was predictive of relapse, but in our limited study was less sensitive than the patient-specific BCR-ABL DNA assay. False positive results occurred in replicate HeLa cell line samples using real-time nested RT-PCR, so we elected not to perform large numbers of RT-PCR replicates. If false positive results are a consequence of rare BCR-ABL transcripts in HeLa cells, then it may be possible for nested RT-PCR to achieve a level of sensitivity comparable to patient-specific DNA PCR. This would require the identification and validation of an alternative negative control material. The patient samples undergo RNA extraction and cDNA synthesis in parallel with the negative control cells, so this analysis could not be performed retrospectively. Patient-specific BCR-ABL DNA PCR was performed using replicates to test up to 10 μg of amplifiable DNA per sample, and achieved a sensitivity of approximately 5 x 10-7. In nested RT-PCR, the presence of BCR-ABL transcripts in normal individuals imposes a lower limit of detection of MRD in CML patients. In contrast, we have not observed any false positive results in DNA PCR, even though the total number of negative controls tested for a single patient was up to 44 replicates (22 μg of amplifiable DNA). Hence, the detection limit of BCR-ABL DNA could be lowered simply by increasing the number of PCR replicates. Almost all patients had detectable BCR-ABL DNA even when in a stable CMR, confirming the utility of this method. The accuracy of our quantitative BCR-ABL DNA results from patients in a CMR could not be determined by comparison with any other method. Instead, we extrapolated relapse and response gradients using BCR-ABL mRNA levels to estimate the likely level of MRD in patient samples. The measured BCR-ABL DNA results showed good agreement with these predictions. In addition, the maximum level of MRD present could be estimated using the EAC calculated detection limit of RQ-PCR. Again, the BCR-ABL DNA levels in CMR samples were consistently at or below the EAC detection limits of those samples. The measurement error of RQ-PCR has been carefully studied so that the clinical significance of an increase in BCR-ABL mRNA level is known. For instance, in the IMVS laboratory a greater than 2-fold rise in BCR-ABL at or above the level of MMR is associated with the
110
emergence of mutations in the BCR-ABL kinase domain (Branford et al. 2004). The precision of the BCR-ABL DNA assay is not known. As a single assay consists of up to 20 replicates the amount of DNA required, and the time required to perform the analysis, rendered a formal assessment of assay precision impractical within this study. Furthermore, the measurement error of any assay near the limit of detection will be considerable unless large numbers of replicates are performed. Finally, each patient-specific assay will have slightly different performance characteristics, and therefore the analysis of reproducibility should ideally be performed for each patient. If patient-specific BCR-ABL DNA were to be used routinely it would be necessary to analyse the measurement error.
6.6.5 Effect of prior interferon-α on relapse risk The average time taken for a newly diagnosed patient treated with imatinib to reach CMR is in excess of 5 years (Branford et al. 2007), so the average duration of treatment before becoming eligible for this study would be in excess of 7 years. Imatinib became readily available in Australia in 2001, and the study began in 2006. Hence, the majority of eligible patients when the study commenced had received the previous best available medical therapy, IFN (with or without cytarabine). We found that the risk of relapse was similar in both treatment cohorts, IM-only and IFN-IM, but the pattern of relapse in the IFN-IM cohort was possibly different: 2 late relapses (>12 months after imatinib withdrawal) occurred in the IFN-IM cohort, whereas all relapses in the IM-only cohort occurred within 4 months. Furthermore, BCR-ABL DNA levels identified two IFN-IM patients with a stable level of measurable MRD who remained in stable CMR for at least 18 months after imatinib withdrawal, but no such patients have yet been identified in the IM-only cohort. Within the IFN-IM cohort there was some indication that the duration of prior IFN therapy might influence the risk of relapse after imatinib withdrawal: there was a higher rate of relapse among patients who had received IFN for less than one year. This was apparently not due to a lower level of MRD at the time of study entry, because the BCR-ABL DNA level was not predictive of relapse risk. A very similar cohort of patients, treated with imatinib after IFN, was reported by the French CML Intergroup (FILMC). Patients in the FILMC study had a minimum duration of CMR of 2 years, and were monitored monthly with RQ-PCR after imatinib cessation: only 1 of 10 patients was treated with IFN for <12 months, and that patient also relapsed. Three of 9 patients treated for >12 months remained in stable CMR (Rousselot et al. 2007). The FILMC data, while still representing only small numbers of patients, support our findings. Data from larger numbers of patients would be needed to demonstrate whether there is a significant difference in relapse risk according to the duration of IFN treatment. Data on the depth of response to IFN of patients entered in the ALLG CML8 study were incomplete, but 70% of patients in the IFN-IM cohort were in a CCR prior to commencing imatinib. This proportion was considerably higher than the 15% of all IFN-treated CP CML patients who achieve CCR (Bonifazi et al. 2001), so the IFN-IM cohort of patients was biased towards a favourable prognosis. Consequently, the over-representation of patients with >2 years of IFN treatment among patients with a stable CMR after imatinib cessation might reflect favourable disease characteristics unrelated to imatinib treatment. The mechanism of action of IFN in CML is complex, with effects including altered stromal interactions, and depletion of CML stem cells. If prior IFN treatment has a durable effect on the relapse risk after imatinib treatment (beyond selecting a group with favourable disease biology) the most likely mechanism for such an effect is immunological surveillance. Two patients in this study, both treated with IFN before imatinib, lend support to the immune surveillance hypothesis: both patients had detectable BCR-ABL DNA on multiple occasions, but remained in CMR for at least 18 months after imatinib withdrawal. Furthermore, the BCR-ABL DNA levels in these two patients were stable over time, whereas in most of the patients who relapsed there was an exponential increase in the level of BCR-ABL DNA on successive tests.
111
6.6.6 Immune surveillance of CML IFN increases the expression of known leukaemia-associated antigens, and is associated with the development of T cell responses against leukaemia-associated antigens (Burchert et al. 2003). For example, one study showed an association between clinical response to IFN therapy and the emergence of cytotoxic T lymphocytes (CTLs) specific for PR1, an epitope of proteinase 3, which is a protein component of myeloid granules in normal and leukaemic cells (Molldrem et al. 2000). There is conflicting evidence as to whether similar CTL responses occur during imatinib treatment (Burchert et al. 2003; Chen et al. 2008). In fact, rare CTLs against CML-associated antigens can be found in the blood of normal individuals (Rezvani et al. 2003). This is perhaps not surprising, given that many of the antigens associated with a CTL response in CML (and other myeloid malignancies) are widely expressed in normal cells (Barrett and Rezvani 2007). Leukaemia-specific autologous CTLs can be elicited by peptide vaccination using the amino acid sequence of the BCR-ABL junction (Pinilla-Ibarz et al. 2000; Rojas et al. 2007; Rezvani et al. 2008), and there is limited evidence that an immunological response to vaccination results in a clinically significant reduction in the level of MRD (Bocchia et al. 2005; Rojas et al. 2007). The best evidence for immunological suppression of the leukaemic clone in CML comes from patients with residual disease or relapse after allogeneic stem cell transplantation. In this setting donor lymphocyte infusion can restore a durable CMR, described by Goldman as an ‘operational cure’ (Goldman and Gordon 2006). In allograft patients several lines of evidence suggest that operational cure does not require complete eradication of the leukaemic clone: very late relapses may occur (Clift et al. 1993), and low levels of BCR-ABL mRNA may be detected intermittently without overt relapse (Miyamura et al. 1993; Kaeda et al. 2006). In a study by our UK collaborators patient-specific BCR-ABL DNA was detected in 1/24 samples from 9 patients in a stable remission post-allograft (Sobrinho-Simoes et al. 2007). While the follow-up of patients in our study is too short to say that an operational cure has been achieved with drug therapy alone, we have at least shown that early relapse is not inevitable. Another important finding of this study was that stable CMR is rapidly regained in response to imatinib re-treatment. This observation has a parallel in the use of imatinib, with or without donor lymphocyte infusion, to treat relapse of CML post-allograft: stable CMR is typically achieved very quickly (DeAngelo et al. 2004; Savani et al. 2005). This observation might be interpreted as indicating that, after allografting, the reduction of MRD by imatinib somehow helps to restore immunological control. Two studies have shown that CTL responses against leukaemia-associated antigens emerged or were augmented in response to a reduction in disease burden (Molldrem et al. 2000; Butt et al. 2005; Chen et al. 2008). This finding has parallels in a mouse model of the immune response to chronic infection with Trypanosoma (Bustamante et al. 2008), from which the authors concluded that a reduction in the antigenic burden (by chemotherapy) might be necessary to prevent functional impairment of the host immune response against a chronic pathogen. Additional indirect evidence of the role of the immune system in the control of CML comes from the association of certain HLA types with disease susceptibility (Posthuma et al. 1999; Posthuma et al. 2000; Oguz et al. 2003) or prognosis (Cortes et al. 1998). Such studies must be interpreted with caution due to the risk of identifying spurious associations, for instance due to linkage disequilibrium between the major histocompatibility complex and other genes that might influence leukaemia biology. Nevertheless it is biologically plausible that certain HLA antigens might effect more efficient presentation of leukaemia-associated antigens. HLA typing was not requested in the original study protocol, and was available for only 6 of our patients at the time of writing. Five of the 6 patients expressed HLA A2, and samples from these patients could in the future be tested with commercially available HLA tetramers to
112
identify CTL responses against leukaemia-associated antigens. An examination of HLA associations with prognosis was not possible in this small number of patients.
6.6.7 Clinical implications of the study findings, and future directions We have shown that around 40-50% of patients with a durable CMR on imatinib treatment may remain in CMR when treatment is withdrawn. There are now two patients off imatinib treatment for >2 years, and it is possible that these patients have an operational cure of CML. The atomic bomb explosions in Japan during World War II showed that the clinical latency period of CML is around 5 to 7 years (Ichimaru et al. 1991). Longer follow-up of study patients in stable CMR without imatinib treatment is needed to determine whether the leukaemic clone has been eradicated (Ross and Hughes 2008). If immunological control of CML turns out to be important in our patients, as in allograft patients, then a small risk of relapse may persist indefinitely. Given the significant risk of relapse, and the good tolerability of imatinib treatment one could not routinely recommend a trial of imatinib withdrawal in patients in stable CMR. However, we have shown that molecular relapse is highly sensitive to imatinib re-treatment, and all patients regained CMR within 6 months of resuming imatinib. Severe imatinib toxicity is uncommon after several years of treatment, but at least 50% of CML patients have mild ongoing imatinib toxicity (Druker et al. 2006) that may impair their quality of life. The data from this study provide information for selected patients to make an assessment of the risks and benefits of stopping or continuing imatinib. In addition, these data may help to reassure patients in CMR who need to interrupt therapy temporarily due to pregnancy or co-morbid conditions. Imatinib is no longer the only BCR-ABL kinase inhibitor in use for the treatment of chronic phase CML. Nilotinib and dasatinib are both available in Australia for patients who have failed imatinib treatment, and clinical trials of de novo treatment with these drugs have shown promising responses (Pavlovsky et al. 2009). In the future it is possible that the use of these more potent BCR-ABL inhibitors will increase the proportion of patients who achieve a stable CMR, and result in a more profound depletion of MRD. However, the results of our study in imatinib-treated patients cannot necessarily be translated to CML patients treated with alternative kinase inhibitors. If immunological surveillance is shown to be important in determining the stability of CMR in these patients, then the T cell immunosuppressive effects of dasatinib (Blake et al. 2008; Schade et al. 2008) and, to a lesser extent, nilotinib (Blake et al. 2008) might alter the risk of relapse when therapy is withdrawn. Contrary to our initial hypothesis, the absolute level of MRD was not predictive of relapse risk, and DNA PCR could not be used at baseline, prior to imatinib withdrawal, to identify patients with a higher or lower risk of relapse. However, the patient-specific BCR-ABL DNA assay enabled early detection of rising BCR-ABL levels, and impending relapse (defined by mRNA monitoring). Applied prospectively, BCR-ABL DNA Q-PCR could have reduced the time that each patient was off imatinib treatment, and should therefore minimize any potential risks to the patient associated with a trial of imatinib withdrawal. BCR-ABL DNA monitoring could also be very useful to assess the response of patients with MRD to novel treatment strategies, such as BCR-ABL peptide vaccination. The pattern of stable MRD (measured by BCR-ABL DNA), and of late relapse in 2 patients with prior IFN treatment suggested that immunological reactivity against the CML clone might have influenced the risk of relapse, at least in the IFN-IM cohort. Further study is needed to determine whether a test of patients’ immunological reactivity against leukaemia-associated antigens could help to predict the risk of relapse. We have stored mononuclear cells from all patients in this study and in the future we plan to perform an analysis of
113
immunological reactivity. The ALLG CML8 study continues to accrue patients, and existing patients remain in follow-up. More data are needed, particularly in the IM-only cohort, to improve our ability to predict relapse in individual patients.
6.7 Presentation of results and contribution of co-authors Parts of this chapter are drawn from a commentary published in Leukemia & Lymphoma (2007 Impact Factor 1.5) (Ross and Hughes 2008). The commentary was written by David Ross and critically reviewed by Timothy Hughes. Interim clinical results of the study were presented in abstract form at the Haematology Society of Australia & New Zealand annual scientific meeting in Perth, Western Australia, October 2008, and at the American Society of Hematology annual scientific meeting in San Francisco, USA, December 2008. The study was conducted under the auspices of the Australasian Leukaemia & Lymphoma Group. The protocol was designed by Timothy Hughes and David Ross, and written by David Ross. The ALLG trial co-ordinators, Rachel Koelmeyer and Dr Ruth Columbus, and statistician, Dr John Reynolds, critically reviewed the protocol, and performed the modelling used for the determination of sample size and stopping rules. Dr Andrew Grigg, Dr John Seymour, Dr Anthony Schwarer, and Dr Chris Arthur critically reviewed the protocol, and were investigators in the clinical trial. Dr Robin Filshie and Dr Anthony Mills were investigators. The laboratory of Susan Branford performed the BCR-ABL RQ-PCR monitoring. Lisa Schafranek performed the research RT-PCR assays and, with other staff of the IMVS Melissa White Laboratory, processed study samples. David Ross developed and performed the patient-specific BCR-ABL DNA assays.
114
115
7 Publications arising Ross, D. M. and T. P. Hughes (2008). "Current and emerging tests for the laboratory monitoring of chronic myeloid leukaemia and related disorders." Pathology 40(3): 231-46. Ross, D. M. and T. P. Hughes (2008). "How complete is "complete" molecular response in imatinib-treated chronic myeloid leukemia?" Leuk Lymphoma 49(7): 1230-1. Ross, D. M., D. B. Watkins, T. P. Hughes and S. Branford (2008). "Reverse transcription with random pentadecamer primers improves the detection limit of a quantitative PCR assay for BCR-ABL transcripts in chronic myeloid leukemia: implications for defining sensitivity in minimal residual disease." Clin Chem 54(9): 1568-71. Ross, D. M., L. Schafranek, T. P. Hughes, M. Nicola, S. Branford and J. Score (2009). "Genomic translocation breakpoint sequences are conserved in BCR-ABL1 cell lines despite the presence of amplification." Cancer Genet Cytogenet 189(2): 138-9. Ross, D. M., S. Branford, J. V. Melo and T. P. Hughes (2009). "Reply to 'What do we mean by sensitivity when we talk about detecting minimal residual disease?' by Steinbach and Debatin." Leukemia 23(4): 819-20; author reply 820.
116
117
8 Bibliography Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman (1990). "Basic local
alignment search tool." J Mol Biol 215(3): 403-10. Anastasi, J., J. Feng, M. M. Le Beau, R. A. Larson, J. D. Rowley and J. W. Vardiman (1995).
"The relationship between secondary chromosomal abnormalities and blast transformation in chronic myelogenous leukemia." Leukemia 9(4): 628-33.
Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman and K. Struhl, Eds. (1988). Current Protocols in Molecular Biology. New York, Wiley.
Baccarani, M., G. Rosti, A. de Vivo, F. Bonifazi, D. Russo, G. Martinelli, N. Testoni, M. Amabile, M. Fiacchini, E. Montefusco, G. Saglio and S. Tura (2002). "A randomized study of interferon-alpha versus interferon-alpha and low-dose arabinosyl cytosine in chronic myeloid leukemia." Blood 99(5): 1527-35.
Baccarani, M., G. Saglio, J. Goldman, A. Hochhaus, B. Simonsson, F. Appelbaum, J. Apperley, F. Cervantes, J. Cortes, M. Deininger, A. Gratwohl, F. Guilhot, M. Horowitz, T. Hughes, H. Kantarjian, R. Larson, D. Niederwieser, R. Silver and R. Hehlmann (2006). "Evolving concepts in the management of chronic myeloid leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet." Blood 108(6): 1809-20.
Barjesteh van Waalwijk van Doorn-Khosrovani, S., K. Vanhees, E. Ruijters and F. J. van Schooten (2008). "Etoposide-initiated MLL rearrangements: the pitfalls of inverse PCR." Eur J Haematol 81(6): 486-8.
Barrett, A. J. and K. Rezvani (2007). "Translational mini-review series on vaccines: Peptide vaccines for myeloid leukaemias." Clin Exp Immunol 148(2): 189-98.
Baxter, E. J., A. Hochhaus, P. Bolufer, A. Reiter, J. M. Fernandez, L. Senent, J. Cervera, F. Moscardo, M. A. Sanz and N. C. Cross (2002). "The t(4;22)(q12;q11) in atypical chronic myeloid leukaemia fuses BCR to PDGFRA." Hum Mol Genet 11(12): 1391-7.
Bedi, A., B. A. Zehnbauer, M. I. Collector, J. P. Barber, M. S. Zicha, S. J. Sharkis and R. J. Jones (1993). "BCR-ABL gene rearrangement and expression of primitive hematopoietic progenitors in chronic myeloid leukemia." Blood 81(11): 2898-902.
Beer, N. R., B. J. Hindson, E. K. Wheeler, S. B. Hall, K. A. Rose, I. M. Kennedy and B. W. Colston (2007). "On-chip, real-time, single-copy polymerase chain reaction in picoliter droplets." Anal Chem 79(22): 8471-5.
Beillard, E., N. Pallisgaard, V. H. van der Velden, W. Bi, R. Dee, E. van der Schoot, E. Delabesse, E. Macintyre, E. Gottardi, G. Saglio, F. Watzinger, T. Lion, J. J. van Dongen, P. Hokland and J. Gabert (2003). "Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using 'real-time' quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) - a Europe against cancer program." Leukemia 17(12): 2474-86.
Benelux CML Study Group (1998). "Randomized study on hydroxyurea alone versus hydroxyurea combined with low-dose interferon-alpha 2b for chronic myeloid leukemia. The Benelux CML Study Group." Blood 91(8): 2713-21.
Beutler, E., T. Gelbart and W. Kuhl (1990). "Interference of heparin with the polymerase chain reaction." Biotechniques 9(2): 166.
Biernaux, C., M. Loos, A. Sels, G. Huez and P. Stryckmans (1995). "Detection of major bcr-abl gene expression at a very low level in blood cells of some healthy individuals." Blood 86(8): 3118-22.
Blake, S., T. P. Hughes, G. Mayrhofer and A. B. Lyons (2008). "The Src/ABL kinase inhibitor dasatinib (BMS-354825) inhibits function of normal human T-lymphocytes in vitro." Clin Immunol 127(3): 330-9.
118
Blake, S. J., A. B. Lyons and T. P. Hughes (2008). "Nilotinib inhibits the Src-family kinase LCK and T-cell function in vitro." J Cell Mol Med.
Bland, J. M. and D. G. Altman (1986). "Statistical methods for assessing agreement between two methods of clinical measurement." Lancet 1(8476): 307-10.
Bocchia, M., S. Gentili, E. Abruzzese, A. Fanelli, F. Iuliano, A. Tabilio, M. Amabile, F. Forconi, A. Gozzetti, D. Raspadori, S. Amadori and F. Lauria (2005). "Effect of a p210 multipeptide vaccine associated with imatinib or interferon in patients with chronic myeloid leukaemia and persistent residual disease: a multicentre observational trial." Lancet 365(9460): 657-62.
Bonifazi, F., A. de Vivo, G. Rosti, F. Guilhot, J. Guilhot, E. Trabacchi, R. Hehlmann, A. Hochhaus, P. C. Shepherd, J. L. Steegmann, H. C. Kluin-Nelemans, J. Thaler, B. Simonsson, A. Louwagie, J. Reiffers, F. X. Mahon, E. Montefusco, G. Alimena, J. Hasford, S. Richards, G. Saglio, N. Testoni, G. Martinelli, S. Tura and M. Baccarani (2001). "Chronic myeloid leukemia and interferon-alpha: a study of complete cytogenetic responders." Blood 98(10): 3074-81.
Bose, S., M. Deininger, J. Gora-Tybor, J. M. Goldman and J. V. Melo (1998). "The presence of typical and atypical BCR-ABL fusion genes in leukocytes of normal individuals: biologic significance and implications for the assessment of minimal residual disease." Blood 92(9): 3362-7.
Bradeen, H. A., C. A. Eide, T. O'Hare, K. J. Johnson, S. G. Willis, F. Y. Lee, B. J. Druker and M. W. Deininger (2006). "Comparison of imatinib mesylate, dasatinib (BMS-354825), and nilotinib (AMN107) in an N-ethyl-N-nitrosourea (ENU)-based mutagenesis screen: high efficacy of drug combinations." Blood 108(7): 2332-8.
Branford, S., N. C. Cross, A. Hochhaus, J. Radich, G. Saglio, J. Kaeda, J. Goldman and T. Hughes (2006). "Rationale for the recommendations for harmonizing current methodology for detecting BCR-ABL transcripts in patients with chronic myeloid leukaemia." Leukemia 20(11): 1925-30.
Branford, S., L. Fletcher, N. C. Cross, M. C. Muller, A. Hochhaus, D. W. Kim, J. P. Radich, G. Saglio, F. Pane, S. Kamel-Reid, Y. L. Wang, R. D. Press, K. Lynch, Z. Rudzki, J. M. Goldman and T. Hughes (2008). "Desirable performance characteristics for BCR-ABL measurement on an international reporting scale to allow consistent interpretation of individual patient response and comparison of response rates between clinical trials." Blood 112(8): 3330-8.
Branford, S. and T. Hughes (2006). "Detection of BCR-ABL mutations and resistance to imatinib mesylate." Methods Mol Med 125: 93-106.
Branford, S., T. P. Hughes and Z. Rudzki (1999). "Monitoring chronic myeloid leukaemia therapy by real-time quantitative PCR in blood is a reliable alternative to bone marrow cytogenetics." Br J Haematol 107(3): 587-99.
Branford, S., T. P. Hughes and Z. Rudzki (2002). "Dual transcription of b2a2 and b3a2 BCR-ABL transcripts in chronic myeloid leukaemia is confined to patients with a linked polymorphism within the BCR gene." Br J Haematol 117(4): 875-7.
Branford, S., Z. Rudzki, I. Parkinson, A. Grigg, K. Taylor, J. F. Seymour, S. Durrant, P. Browett, A. P. Schwarer, C. Arthur, J. Catalano, M. F. Leahy, R. Filshie, K. Bradstock, R. Herrmann, D. Joske, K. Lynch and T. Hughes (2004). "Real-time quantitative PCR analysis can be used as a primary screen to identify patients with CML treated with imatinib who have BCR-ABL kinase domain mutations." Blood 104(9): 2926-2932.
Branford, S., Z. Rudzki, S. Walsh, A. Grigg, C. Arthur, K. Taylor, R. Herrmann, K. P. Lynch and T. P. Hughes (2002). "High frequency of point mutations clustered within the adenosine triphosphate-binding region of BCR/ABL in patients with chronic myeloid leukemia or Ph-positive acute lymphoblastic leukemia who develop imatinib (STI571) resistance." Blood 99(9): 3472-5.
119
Branford, S., J. F. Seymour, A. Grigg, C. Arthur, Z. Rudzki, K. Lynch and T. Hughes (2007). "BCR-ABL messenger RNA levels continue to decline in patients with chronic phase chronic myeloid leukemia treated with imatinib for more than 5 years and approximately half of all first-line treated patients have stable undetectable BCR-ABL using strict sensitivity criteria." Clin Cancer Res 13(23): 7080-5.
Bruggemann, M., T. Raff, T. Flohr, N. Gokbuget, M. Nakao, J. Droese, S. Luschen, C. Pott, M. Ritgen, U. Scheuring, H. A. Horst, E. Thiel, D. Hoelzer, C. R. Bartram and M. Kneba (2006). "Clinical significance of minimal residual disease quantification in adult patients with standard-risk acute lymphoblastic leukemia." Blood 107(3): 1116-23.
Buchdunger, E., J. Zimmermann, H. Mett, T. Meyer, M. Muller, B. J. Druker and N. B. Lydon (1996). "Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative." Cancer Res 56(1): 100-4.
Buhler, C., J. H. Lebbink, C. Bocs, R. Ladenstein and P. Forterre (2001). "DNA topoisomerase VI generates ATP-dependent double-strand breaks with two-nucleotide overhangs." J Biol Chem 276(40): 37215-22.
Burchert, A., S. Wolfl, M. Schmidt, C. Brendel, B. Denecke, D. Cai, L. Odyvanova, T. Lahaye, M. C. Muller, T. Berg, H. Gschaidmeier, B. Wittig, R. Hehlmann, A. Hochhaus and A. Neubauer (2003). "Interferon-alpha, but not the ABL-kinase inhibitor imatinib (STI571), induces expression of myeloblastin and a specific T-cell response in chronic myeloid leukemia." Blood 101(1): 259-64.
Bustamante, J. M., L. M. Bixby and R. L. Tarleton (2008). "Drug-induced cure drives conversion to a stable and protective CD8+ T central memory response in chronic Chagas disease." Nat Med 14(5): 542-50.
Butt, N. M., J. M. Rojas, L. Wang, S. E. Christmas, H. M. Abu-Eisha and R. E. Clark (2005). "Circulating bcr-abl-specific CD8+ T cells in chronic myeloid leukemia patients and healthy subjects." Haematologica 90(10): 1315-23.
Cambier, N., A. Renneville, T. Cazaentre, V. Soenen, C. Cossement, S. Giraudier, N. Grardel, J. L. Lai, C. Rose and C. Preudhomme (2008). "JAK2V617F-positive polycythemia vera and Philadelphia chromosome-positive chronic myeloid leukemia: one patient with two distinct myeloproliferative disorders." Leukemia 22(7): 1454-5.
Cave, H., J. van der Werff ten Bosch, S. Suciu, C. Guidal, C. Waterkeyn, J. Otten, M. Bakkus, K. Thielemans, B. Grandchamp and E. Vilmer (1998). "Clinical significance of minimal residual disease in childhood acute lymphoblastic leukemia. European Organization for Research and Treatment of Cancer--Childhood Leukemia Cooperative Group." N Engl J Med 339(9): 591-8.
Chatterjee, R. (2007). "Cell biology. Cases of mistaken identity." Science 315(5814): 928-31. Chen, C. I., H. T. Maecker and P. P. Lee (2008). "Development and dynamics of robust T-cell
responses to CML under imatinib treatment." Blood 111(11): 5342-9. Chen, X. Q., H. Bonnefoi, M. F. Pelte, J. Lyautey, C. Lederrey, S. Movarekhi, P. Schaeffer,
H. E. Mulcahy, P. Meyer, M. Stroun and P. Anker (2000). "Telomerase RNA as a detection marker in the serum of breast cancer patients." Clin Cancer Res 6(10): 3823-6.
Cheng, K. C. and G. R. Smith (1987). "Cutting of chi-like sequences by the RecBCD enzyme of Escherichia coli." J Mol Biol 194(4): 747-50.
Chissoe, S. L., A. Bodenteich, Y. F. Wang, Y. P. Wang, D. Burian, S. W. Clifton, J. Crabtree, A. Freeman, K. Iyer, L. Jian and et al. (1995). "Sequence and analysis of the human ABL gene, the BCR gene, and regions involved in the Philadelphia chromosomal translocation." Genomics 27(1): 67-82.
Clift, R. A., F. R. Appelbaum and E. D. Thomas (1993). "Treatment of chronic myeloid leukemia by marrow transplantation." Blood 82(7): 1954-6.
Cohen, N., G. Rozenfeld-Granot, I. Hardan, F. Brok-Simoni, N. Amariglio, G. Rechavi and L. Trakhtenbrot (2001). "Subgroup of patients with Philadelphia-positive chronic
120
myelogenous leukemia characterized by a deletion of 9q proximal to ABL gene: expression profiling, resistance to interferon therapy, and poor prognosis." Cancer Genet Cytogenet 128(2): 114-9.
Colton, T. (1974). Statistics in medicine. Boston, Little, Brown and Co. Cortes, J., L. Fayad, H. Kantarjian, S. O'Brien, M. S. Lee and M. Talpaz (1998). "Association
of HLA phenotype and response to interferon-alpha in patients with chronic myelogenous leukemia." Leukemia 12(4): 455-62.
Cortes, J., S. O'Brien and H. Kantarjian (2004). "Discontinuation of imatinib therapy after achieving a molecular response." Blood 104(7): 2204-5.
Cortes, J. E., M. Talpaz, F. Giles, S. O'Brien, M. B. Rios, J. Shan, G. Garcia-Manero, S. Faderl, D. A. Thomas, W. Wierda, A. Ferrajoli, S. Jeha and H. M. Kantarjian (2003). "Prognostic significance of cytogenetic clonal evolution in patients with chronic myelogenous leukemia on imatinib mesylate therapy." Blood 101(10): 3794-800.
Cross, N. C., T. P. Hughes, L. Feng, P. O'Shea, J. Bungey, D. I. Marks, A. Ferrant, P. Martiat and J. M. Goldman (1993). "Minimal residual disease after allogeneic bone marrow transplantation for chronic myeloid leukaemia in first chronic phase: correlations with acute graft-versus-host disease and relapse." Br J Haematol 84(1): 67-74.
Cross, N. C., T. P. Hughes, A. Hochhaus and J. M. Goldman (2007). "International standardisation of quantitative real-time RT-PCR for BCR-ABL." Leuk Res.
Cuneo, A., R. Bigoni, B. Emmanuel, E. Smit, G. M. Rigolin, M. G. Roberti, A. Bardi, N. Piva, G. Scapoli, G. Castoldi, H. Van Den Berghe and A. Hagemeijer (1998). "Fluorescence in situ hybridization for the detection and monitoring of the Ph-positive clone in chronic myelogenous leukemia: comparison with metaphase banding analysis." Leukemia 12(11): 1718-23.
Curtin, N. J., P. J. Campbell and A. R. Green (2005). "The Philadelphia translocation and pre-existing myeloproliferative disorders." Br J Haematol 128(5): 734-6.
de la Fuente, J., K. Merx, E. J. Steer, M. Muller, R. M. Szydlo, O. Maywald, U. Berger, R. Hehlmann, J. M. Goldman, N. C. Cross, J. V. Melo and A. Hochhaus (2001). "ABL-BCR expression does not correlate with deletions on the derivative chromosome 9 or survival in chronic myeloid leukemia." Blood 98(9): 2879-80.
DeAngelo, D. J., E. P. Hochberg, E. P. Alyea, J. Longtine, S. Lee, I. Galinsky, B. Parekkedon, J. Ritz, J. H. Antin, R. M. Stone and R. J. Soiffer (2004). "Extended follow-up of patients treated with imatinib mesylate (gleevec) for chronic myelogenous leukemia relapse after allogeneic transplantation: durable cytogenetic remission and conversion to complete donor chimerism without graft-versus-host disease." Clin Cancer Res 10(15): 5065-71.
Deininger, M. W., S. Bose, J. Gora-Tybor, X. H. Yan, J. M. Goldman and J. V. Melo (1998). "Selective induction of leukemia-associated fusion genes by high-dose ionizing radiation." Cancer Res 58(3): 421-5.
Demiroglu, A., E. J. Steer, C. Heath, K. Taylor, M. Bentley, S. L. Allen, P. Koduru, J. P. Brody, G. Hawson, R. Rodwell, M. L. Doody, F. Carnicero, A. Reiter, J. M. Goldman, J. V. Melo and N. C. Cross (2001). "The t(8;22) in chronic myeloid leukemia fuses BCR to FGFR1: transforming activity and specific inhibition of FGFR1 fusion proteins." Blood 98(13): 3778-83.
Dewald, G. W., W. A. Wyatt and R. T. Silver (1999). "Atypical BCR and ABL D-FISH patterns in chronic myeloid leukemia and their possible role in therapy." Leuk Lymphoma 34(5-6): 481-91.
Diamond, J., J. M. Goldman and J. V. Melo (1995). "BCR-ABL, ABL-BCR, BCR, and ABL genes are all expressed in individual granulocyte-macrophage colony-forming unit colonies derived from blood of patients with chronic myeloid leukemia." Blood 85(8): 2171-5.
121
Dierov, J., P. V. Sanchez, B. A. Burke, H. Padilla-Nash, M. E. Putt, T. Ried and M. Carroll (2009). "BCR/ABL induces chromosomal instability after genotoxic stress and alters the cell death threshold." Leukemia 23(2): 279-86.
Donia, D., M. Divizia and A. Pana (2005). "Use of armored RNA as a standard to construct a calibration curve for real-time RT-PCR." J Virol Methods 126(1-2): 157-63.
Druker, B. J., F. Guilhot, S. G. O'Brien, I. Gathmann, H. Kantarjian, N. Gattermann, M. W. Deininger, R. T. Silver, J. M. Goldman, R. M. Stone, F. Cervantes, A. Hochhaus, B. L. Powell, J. L. Gabrilove, P. Rousselot, J. Reiffers, J. J. Cornelissen, T. Hughes, H. Agis, T. Fischer, G. Verhoef, J. Shepherd, G. Saglio, A. Gratwohl, J. L. Nielsen, J. P. Radich, B. Simonsson, K. Taylor, M. Baccarani, C. So, L. Letvak and R. A. Larson (2006). "Five-year follow-up of patients receiving imatinib for chronic myeloid leukemia." N Engl J Med 355(23): 2408-17.
Druker, B. J., S. Tamura, E. Buchdunger, S. Ohno, G. M. Segal, S. Fanning, J. Zimmermann and N. B. Lydon (1996). "Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells." Nat Med 2(5): 561-6.
El-Hefnawy, T., S. Raja, L. Kelly, W. L. Bigbee, J. M. Kirkwood, J. D. Luketich and T. E. Godfrey (2004). "Characterization of amplifiable, circulating RNA in plasma and its potential as a tool for cancer diagnostics." Clin Chem 50(3): 564-73.
El-Zimaity, M. M., H. Kantarjian, M. Talpaz, S. O'Brien, F. Giles, G. Garcia-Manero, S. Verstovsek, D. Thomas, A. Ferrajoli, K. Hayes, B. Nebiyou Bekele, X. Zhou, M. B. Rios, A. B. Glassman and J. E. Cortes (2004). "Results of imatinib mesylate therapy in chronic myelogenous leukaemia with variant Philadelphia chromosome." Br J Haematol 125(2): 187-95.
Elliott, B., C. Richardson and M. Jasin (2005). "Chromosomal translocation mechanisms at intronic alu elements in mammalian cells." Mol Cell 17(6): 885-94.
Fisher, A. M., P. Strike, C. Scott and A. V. Moorman (2005). "Breakpoints of variant 9;22 translocations in chronic myeloid leukemia locate preferentially in the CG-richest regions of the genome." Genes Chromosomes Cancer 43(4): 383-9.
Gabert, J., E. Beillard, V. H. van der Velden, W. Bi, D. Grimwade, N. Pallisgaard, G. Barbany, G. Cazzaniga, J. M. Cayuela, H. Cave, F. Pane, J. L. Aerts, D. De Micheli, X. Thirion, V. Pradel, M. Gonzalez, S. Viehmann, M. Malec, G. Saglio and J. J. van Dongen (2003). "Standardization and quality control studies of 'real-time' quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - a Europe Against Cancer program." Leukemia 17(12): 2318-57.
Gillert, E., T. Leis, R. Repp, M. Reichel, A. Hosch, I. Breitenlohner, S. Angermuller, A. Borkhardt, J. Harbott, F. Lampert, F. Griesinger, J. Greil, G. H. Fey and R. Marschalek (1999). "A DNA damage repair mechanism is involved in the origin of chromosomal translocations t(4;11) in primary leukemic cells." Oncogene 18(33): 4663-71.
Goldman, J. and M. Gordon (2006). "Why do chronic myelogenous leukemia stem cells survive allogeneic stem cell transplantation or imatinib: does it really matter?" Leuk Lymphoma 47(1): 1-7.
Gorre, M. E., M. Mohammed, K. Ellwood, N. Hsu, R. Paquette, P. N. Rao and C. L. Sawyers (2001). "Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification." Science 293(5531): 876-80.
Graham, S. M., H. G. Jorgensen, E. Allan, C. Pearson, M. J. Alcorn, L. Richmond and T. L. Holyoake (2002). "Primitive, quiescent, Philadelphia-positive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vitro." Blood 99(1): 319-25.
Gratwohl, A., R. Brand, J. Apperley, C. Crawley, T. Ruutu, P. Corradini, E. Carreras, A. Devergie, C. Guglielmi, H. J. Kolb and D. Niederwieser (2006). "Allogeneic hematopoietic stem cell transplantation for chronic myeloid leukemia in Europe 2006:
122
transplant activity, long-term data and current results. An analysis by the Chronic Leukemia Working Party of the European Group for Blood and Marrow Transplantation (EBMT)." Haematologica 91(4): 513-21.
Griesinger, F., H. Hennig, F. Hillmer, M. Podleschny, R. Steffens, A. Pies, B. Wormann, D. Haase and S. K. Bohlander (2005). "A BCR-JAK2 fusion gene as the result of a t(9;22)(p24;q11.2) translocation in a patient with a clinically typical chronic myeloid leukemia." Genes Chromosomes Cancer 44(3): 329-33.
Groffen, J., J. R. Stephenson, N. Heisterkamp, A. de Klein, C. R. Bartram and G. Grosveld (1984). "Philadelphia chromosomal breakpoints are clustered within a limited region, bcr, on chromosome 22." Cell 36(1): 93-9.
Guilhot, F., C. Chastang, M. Michallet, A. Guerci, J. L. Harousseau, F. Maloisel, R. Bouabdallah, D. Guyotat, N. Cheron, F. Nicolini, J. F. Abgrall and J. Tanzer (1997). "Interferon alfa-2b combined with cytarabine versus interferon alone in chronic myelogenous leukemia. French Chronic Myeloid Leukemia Study Group." N Engl J Med 337(4): 223-9.
Guilhot, F., B. J. Druker, O. B. S.G. and R. A. Larson (2007). "Cytogenetic response and discontinuations from IRIS study with long term imatinib therapy (IM) in newly diagnosed Ph+ chronic myelogenous leukemia (Ph+CML)." Haematologica 92(S1): Abstract 357.
Guilhot, F., L. Roy, J. Guilhot and F. Millot (2004). "Interferon therapy in chronic myelogenous leukemia." Hematol Oncol Clin North Am 18(3): 585-603, viii.
Haferlach, T., M. Winkemann, C. Nickenig, M. Meeder, L. Ramm-Petersen, R. Schoch, M. Nickelsen, K. Weber-Matthiesen, B. Schlegelberger, C. Schoch, W. Gassmann and H. Loffler (1997). "Which compartments are involved in Philadelphia-chromosome positive chronic myeloid leukaemia? An answer at the single cell level by combining May-Grunwald-Giemsa staining and fluorescence in situ hybridization techniques." Br J Haematol 97(1): 99-106.
Halicka, H. D., E. Bedner and Z. Darzynkiewicz (2000). "Segregation of RNA and separate packaging of DNA and RNA in apoptotic bodies during apoptosis." Exp Cell Res 260(2): 248-56.
Hasford, J., M. Pfirrmann, R. Hehlmann, N. C. Allan, M. Baccarani, J. C. Kluin-Nelemans, G. Alimena, J. L. Steegmann and H. Ansari (1998). "A new prognostic score for survival of patients with chronic myeloid leukemia treated with interferon alfa. Writing Committee for the Collaborative CML Prognostic Factors Project Group." J Natl Cancer Inst 90(11): 850-8.
Hasselmann, D. O., G. Rappl, W. Tilgen and U. Reinhold (2001). "Extracellular tyrosinase mRNA within apoptotic bodies is protected from degradation in human serum." Clin Chem 47(8): 1488-9.
Hehlmann, R., U. Berger, M. Pfirrmann, H. Heimpel, A. Hochhaus, J. Hasford, H. J. Kolb, T. Lahaye, O. Maywald, A. Reiter, D. K. Hossfeld, C. Huber, H. Loffler, H. Pralle, W. Queisser, A. Tobler, C. Nerl, M. Solenthaler, M. E. Goebeler, M. Griesshammer, T. Fischer, S. Kremers, H. Eimermacher, M. Pfreundschuh, W. D. Hirschmann, K. Lechner, B. Wassmann, C. Falge, H. H. Kirchner and A. Gratwohl (2007). "Drug treatment is superior to allografting as first-line therapy in chronic myeloid leukemia." Blood 109(11): 4686-92.
Hehlmann, R., H. Heimpel, J. Hasford, H. J. Kolb, H. Pralle, D. K. Hossfeld, W. Queisser, H. Loffler, B. Heinze, A. Georgii and et al. (1993). "Randomized comparison of busulfan and hydroxyurea in chronic myelogenous leukemia: prolongation of survival by hydroxyurea. The German CML Study Group." Blood 82(2): 398-407.
Heisterkamp, N., K. Stam, J. Groffen, A. de Klein and G. Grosveld (1985). "Structural organization of the bcr gene and its role in the Ph' translocation." Nature 315(6022): 758-61.
123
Herens, C., F. Tassin, V. Lemaire, Y. Beguin, E. Collard, S. Lampertz, C. Croisiau, M. Lecomte, B. De Prijk, L. Longree and L. Koulischer (2000). "Deletion of the 5'-ABL region: a recurrent anomaly detected by fluorescence in situ hybridization in about 10% of Philadelphia-positive chronic myeloid leukaemia patients." Br J Haematol 110(1): 214-6.
Hietala, S. K. and B. M. Crossley (2006). "Armored RNA as virus surrogate in a real-time reverse transcriptase PCR assay proficiency panel." J Clin Microbiol 44(1): 67-70.
Holyoake, T., X. Jiang, C. Eaves and A. Eaves (1999). "Isolation of a highly quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia." Blood 94(6): 2056-64.
Hughes, T. and S. Branford (2006). "Molecular monitoring of BCR-ABL as a guide to clinical management in chronic myeloid leukaemia." Blood Rev 20(1): 29-41.
Hughes, T., M. Deininger, A. Hochhaus, S. Branford, J. Radich, J. Kaeda, M. Baccarani, J. Cortes, N. C. Cross, B. J. Druker, J. Gabert, D. Grimwade, R. Hehlmann, S. Kamel-Reid, J. H. Lipton, J. Longtine, G. Martinelli, G. Saglio, S. Soverini, W. Stock and J. M. Goldman (2006). "Monitoring CML patients responding to treatment with tyrosine kinase inhibitors: review and recommendations for harmonizing current methodology for detecting BCR-ABL transcripts and kinase domain mutations and for expressing results." Blood 108(1): 28-37.
Hughes, T. P., S. Branford, D. L. White, J. Reynolds, R. Koelmeyer, J. F. Seymour, K. Taylor, C. Arthur, A. Schwarer, J. Morton, J. Cooney, M. F. Leahy, P. Rowlings, J. Catalano, M. Hertzberg, R. Filshie, A. K. Mills, K. Fay, S. Durrant, H. Januszewicz, D. Joske, C. Underhill, S. Dunkley, K. Lynch and A. Grigg (2008). "Impact of early dose intensity on cytogenetic and molecular responses in chronic- phase CML patients receiving 600 mg/day of imatinib as initial therapy." Blood 112(10): 3965-73.
Hughes, T. P., J. Kaeda, S. Branford, Z. Rudzki, A. Hochhaus, M. L. Hensley, I. Gathmann, A. E. Bolton, I. C. van Hoomissen, J. M. Goldman and J. P. Radich (2003). "Frequency of major molecular responses to imatinib or interferon alfa plus cytarabine in newly diagnosed chronic myeloid leukemia." N Engl J Med 349(15): 1423-32.
Huntly, B. J., A. Bench and A. R. Green (2003). "Double jeopardy from a single translocation: deletions of the derivative chromosome 9 in chronic myeloid leukemia." Blood 102(4): 1160-8.
Huntly, B. J., F. Guilhot, A. G. Reid, G. Vassiliou, E. Hennig, C. Franke, J. Byrne, A. Brizard, D. Niederwieser, J. Freeman-Edward, G. Cuthbert, N. Bown, R. E. Clark, E. P. Nacheva, A. R. Green and M. W. Deininger (2003). "Imatinib improves but may not fully reverse the poor prognosis of patients with CML with derivative chromosome 9 deletions." Blood 102(6): 2205-12.
Huntly, B. J., A. G. Reid, A. J. Bench, L. J. Campbell, N. Telford, P. Shepherd, J. Szer, H. M. Prince, P. Turner, C. Grace, E. P. Nacheva and A. R. Green (2001). "Deletions of the derivative chromosome 9 occur at the time of the Philadelphia translocation and provide a powerful and independent prognostic indicator in chronic myeloid leukemia." Blood 98(6): 1732-8.
Hussein, K., O. Bock, K. Theophile, A. Seegers, H. Arps, O. Basten, K. H. Grips, J. Franz-Werner, G. Busche and H. Kreipe (2008). "Chronic myeloproliferative diseases with concurrent BCR-ABL junction and JAK2V617F mutation." Leukemia 22(5): 1059-62.
Ichimaru, M., M. Tomonaga, T. Amenomori and T. Matsuo (1991). "Atomic bomb and leukemia." J Radiat Res (Tokyo) 32 Suppl: 162-7.
Iliakis, G., H. Wang, A. R. Perrault, W. Boecker, B. Rosidi, F. Windhofer, W. Wu, J. Guan, G. Terzoudi and G. Pantelias (2004). "Mechanisms of DNA double strand break repair and chromosome aberration formation." Cytogenet Genome Res 104(1-4): 14-20.
Jaffe, E., N. Harris, H. Stein and J. Vardiman, Eds. (2001). World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of Haematopoeitic and Lymphoid Tissues. Lyon, IARC Press.
124
Jeffs, A. R., S. M. Benjes, T. L. Smith, S. J. Sowerby and C. M. Morris (1998). "The BCR gene recombines preferentially with Alu elements in complex BCR-ABL translocations of chronic myeloid leukaemia." Hum Mol Genet 7(5): 767-76.
Jiang, X., Y. Zhao, C. Smith, M. Gasparetto, A. Turhan, A. Eaves and C. Eaves (2007). "Chronic myeloid leukemia stem cells possess multiple unique features of resistance to BCR-ABL targeted therapies." Leukemia 21(5): 926-35.
Kaeda, J., D. O'Shea, R. M. Szydlo, E. Olavarria, F. Dazzi, D. Marin, S. Saunders, J. S. Khorashad, N. C. Cross, J. M. Goldman and J. F. Apperley (2006). "Serial measurement of BCR-ABL transcripts in the peripheral blood after allogeneic stem cell transplantation for chronic myeloid leukemia: an attempt to define patients who may not require further therapy." Blood 107(10): 4171-6.
Kamm, R. C. and A. G. Smith (1972). "Nucleic acid concentrations in normal human plasma." Clin Chem 18(6): 519-22.
Kantarjian, H., F. Giles, L. Wunderle, K. Bhalla, S. O'Brien, B. Wassmann, C. Tanaka, P. Manley, P. Rae, W. Mietlowski, K. Bochinski, A. Hochhaus, J. D. Griffin, D. Hoelzer, M. Albitar, M. Dugan, J. Cortes, L. Alland and O. G. Ottmann (2006). "Nilotinib in imatinib-resistant CML and Philadelphia chromosome-positive ALL." N Engl J Med 354(24): 2542-51.
Kantarjian, H., R. Pasquini, N. Hamerschlak, P. Rousselot, J. Holowiecki, S. Jootar, T. Robak, N. Khoroshko, T. Masszi, A. Skotnicki, A. Hellmann, A. Zaritsky, A. Golenkov, J. Radich, T. Hughes, A. Countouriotis and N. Shah (2007). "Dasatinib or high-dose imatinib for chronic-phase chronic myeloid leukemia after failure of first-line imatinib: a randomized phase 2 trial." Blood 109(12): 5143-50.
Kantarjian, H., C. Sawyers, A. Hochhaus, F. Guilhot, C. Schiffer, C. Gambacorti-Passerini, D. Niederwieser, D. Resta, R. Capdeville, U. Zoellner, M. Talpaz, B. Druker, J. Goldman, S. G. O'Brien, N. Russell, T. Fischer, O. Ottmann, P. Cony-Makhoul, T. Facon, R. Stone, C. Miller, M. Tallman, R. Brown, M. Schuster, T. Loughran, A. Gratwohl, F. Mandelli, G. Saglio, M. Lazzarino, D. Russo, M. Baccarani and E. Morra (2002). "Hematologic and cytogenetic responses to imatinib mesylate in chronic myelogenous leukemia." N Engl J Med 346(9): 645-52.
Kantarjian, H., M. Talpaz, S. O'Brien, G. Garcia-Manero, S. Verstovsek, F. Giles, M. B. Rios, J. Shan, L. Letvak, D. Thomas, S. Faderl, A. Ferrajoli and J. Cortes (2004). "High-dose imatinib mesylate therapy in newly diagnosed Philadelphia chromosome-positive chronic phase chronic myeloid leukemia." Blood 103(8): 2873-8.
Kantarjian, H. M., D. Dixon, M. J. Keating, M. Talpaz, R. S. Walters, K. B. McCredie and E. J. Freireich (1988). "Characteristics of accelerated disease in chronic myelogenous leukemia." Cancer 61(7): 1441-6.
Kantarjian, H. M., S. O'Brien, J. E. Cortes, J. Shan, F. J. Giles, M. B. Rios, S. H. Faderl, W. G. Wierda, A. Ferrajoli, S. Verstovsek, M. J. Keating, E. J. Freireich and M. Talpaz (2003). "Complete cytogenetic and molecular responses to interferon-alpha-based therapy for chronic myelogenous leukemia are associated with excellent long-term prognosis." Cancer 97(4): 1033-41.
Kantarjian, H. M., T. L. Smith, K. B. McCredie, M. J. Keating, R. S. Walters, M. Talpaz, J. P. Hester, G. Bligham, E. Gehan and E. J. Freireich (1985). "Chronic myelogenous leukemia: a multivariate analysis of the associations of patient characteristics and therapy with survival." Blood 66(6): 1326-35.
Keating, A., X. H. Wang and P. Laraya (1994). "Variable transcription of BCR-ABL by Ph+ cells arising from hematopoietic progenitors in chronic myeloid leukemia." Blood 83(7): 1744-9.
Kibbe, W. A. (2007). "OligoCalc: an online oligonucleotide properties calculator." Nucleic Acids Res 35(Web Server issue): W43-6.
Kim, D. H., G. Popradi, L. Sriharsha, S. Kamel-Reid, H. Chang, H. A. Messner and J. H. Lipton (2008). "No significance of derivative chromosome 9 deletion on the clearance
125
kinetics of BCR/ABL fusion transcripts, cytogenetic or molecular response, loss of response, or treatment failure to imatinib mesylate therapy for chronic myeloid leukemia." Cancer 113(4): 772-81.
Kim, D. H., W. Xu, C. Ma, X. Liu, K. Siminovitch, H. A. Messner and J. H. Lipton (2009). "Genetic variants in the candidate genes of the apoptosis pathway and susceptibility to chronic myeloid leukemia." Blood 113(11): 2517-25.
Kishi, K. (1985). "A new leukemia cell line with Philadelphia chromosome characterized as basophil precursors." Leuk Res 9(3): 381-90.
Kolomietz, E., J. Al-Maghrabi, S. Brennan, J. Karaskova, S. Minkin, J. Lipton and J. A. Squire (2001). "Primary chromosomal rearrangements of leukemia are frequently accompanied by extensive submicroscopic deletions and may lead to altered prognosis." Blood 97(11): 3581-8.
Kopreski, M. S., F. A. Benko, L. W. Kwak and C. D. Gocke (1999). "Detection of tumor messenger RNA in the serum of patients with malignant melanoma." Clin Cancer Res 5(8): 1961-5.
Koptyra, M., R. Falinski, M. O. Nowicki, T. Stoklosa, I. Majsterek, M. Nieborowska-Skorska, J. Blasiak and T. Skorski (2006). "BCR/ABL kinase induces self-mutagenesis via reactive oxygen species to encode imatinib resistance." Blood 108(1): 319-27.
Kozubek, S., E. Lukasova, A. Mareckova, M. Skalnikova, M. Kozubek, E. Bartova, V. Kroha, E. Krahulcova and J. Slotova (1999). "The topological organization of chromosomes 9 and 22 in cell nuclei has a determinative role in the induction of t(9,22) translocations and in the pathogenesis of t(9,22) leukemias." Chromosoma 108(7): 426-35.
Kramer, A., A. Reiter, J. Kruth, P. Erben, A. Hochhaus, M. Muller, N. C. Cross, A. V. Jones, A. D. Ho and M. Hensel (2007). "JAK2-V617F mutation in a patient with Philadelphia-chromosome-positive chronic myeloid leukaemia." Lancet Oncol 8(7): 658-60.
Krause, D. S., K. Lazarides, U. H. von Andrian and R. A. Van Etten (2006). "Requirement for CD44 in homing and engraftment of BCR-ABL-expressing leukemic stem cells." Nat Med 12(10): 1175-80.
Kreil, S., M. Pfirrmann, C. Haferlach, K. Waghorn, A. Chase, R. Hehlmann, A. Reiter, A. Hochhaus and N. C. Cross (2007). "Heterogeneous prognostic impact of derivative chromosome 9 deletions in chronic myelogenous leukemia." Blood.
Kubonishi, I. and I. Miyoshi (1983). "Establishment of a Ph1 chromosome-positive cell line from chronic myelogenous leukemia in blast crisis." Int J Cell Cloning 1(2): 105-17.
Landgren, O., L. R. Goldin, S. Y. Kristinsson, E. A. Helgadottir, J. Samuelsson and M. Bjorkholm (2008). "Increased risks of polycythemia vera, essential thrombocythemia, and myelofibrosis among 24,577 first-degree relatives of 11,039 patients with myeloproliferative neoplasms in Sweden." Blood 112(6): 2199-204.
Landstrom, A. P. and A. Tefferi (2006). "Fluorescent in situ hybridization in the diagnosis, prognosis, and treatment monitoring of chronic myeloid leukemia." Leuk Lymphoma 47(3): 397-402.
Lange, T., T. Bumm, M. Mueller, S. Otto, H. K. Al-Ali, L. Grommisch, S. Musiol, C. Franke, R. Krahl, D. Niederwieser and M. W. Deininger (2005). "Durability of molecular remission in chronic myeloid leukemia patients treated with imatinib vs allogeneic stem cell transplantation." Leukemia 19(7): 1262-5.
Lange, T., T. Bumm, S. Otto, H. K. Al-Ali, I. Kovacs, D. Krug, T. Kohler, R. Krahl, D. Niederwieser and M. W. Deininger (2004). "Quantitative reverse transcription polymerase chain reaction should not replace conventional cytogenetics for monitoring patients with chronic myeloid leukemia during early phase of imatinib therapy." Haematologica 89(1): 49-57.
Lekanne Deprez, R. H., A. C. Fijnvandraat, J. M. Ruijter and A. F. Moorman (2002). "Sensitivity and accuracy of quantitative real-time polymerase chain reaction using SYBR green I depends on cDNA synthesis conditions." Anal Biochem 307(1): 63-9.
126
Lesser, M. L., G. W. Dewald, C. P. Sison and R. T. Silver (2002). "Correlation of three methods of measuring cytogenetic response in chronic myelocytic leukemia." Cancer Genet Cytogenet 137(2): 79-84.
Liss, B. (2002). "Improved quantitative real-time RT-PCR for expression profiling of individual cells." Nucleic Acids Res 30(17): e89.
Litz, C. E., J. S. McClure, C. M. Copenhaver and R. D. Brunning (1993). "Duplication of small segments within the major breakpoint cluster region in chronic myelogenous leukemia." Blood 81(6): 1567-72.
Lo, K. W., Y. M. Lo, S. F. Leung, Y. S. Tsang, L. Y. Chan, P. J. Johnson, N. M. Hjelm, J. C. Lee and D. P. Huang (1999). "Analysis of cell-free Epstein-Barr virus associated RNA in the plasma of patients with nasopharyngeal carcinoma." Clin Chem 45(8 Pt 1): 1292-4.
Lo, Y. M. and R. W. Chiu (2004). "The biology and diagnostic applications of plasma RNA." Ann N Y Acad Sci 1022: 135-9.
Ma, W., H. Kantarjian, I. Jilani, M. E. Gorre, O. Ottmann, K. Bhalla, F. Giles and M. Albitar (2005). "Discrepancy in detecting Bcr-Abl kinase domain mutations between cells from bone marrow and cells from peripheral blood, and greater concordance between bone marrow cells and plasma free RNA." Blood 106(11): Abstract 4849.
Ma, W., R. Tseng, M. Gorre, I. Jilani, M. Keating, H. Kantarjian, J. Cortes, S. O'Brien, F. Giles and M. Albitar (2007). "Plasma RNA as an alternative to cells for monitoring molecular response in patients with chronic myeloid leukemia." Haematologica 92(2): 170-5.
Marshall, G. M., M. Haber, E. Kwan, L. Zhu, D. Ferrara, C. Xue, M. J. Brisco, P. J. Sykes, A. Morley, B. Webster, L. Dalla Pozza, K. Waters and M. D. Norris (2003). "Importance of minimal residual disease testing during the second year of therapy for children with acute lymphoblastic leukemia." J Clin Oncol 21(4): 704-9.
Matsuo, Y., T. Adachi, T. Tsubota, J. Imanishi and J. Minowada (1991). "Establishment and characterization of a novel megakaryoblastic cell line, MOLM-1, from a patient with chronic myelogenous leukemia." Hum Cell 4(3): 261-4.
Mattarucchi, E., V. Guerini, A. Rambaldi, L. Campiotti, A. Venco, F. Pasquali, F. Lo Curto and G. Porta (2008). "Microhomologies and interspersed repeat elements at genomic breakpoints in chronic myeloid leukemia." Genes Chromosomes Cancer 47(7): 625-32.
Mauro, M. J., B. J. Druker and R. T. Maziarz (2004). "Divergent clinical outcome in two CML patients who discontinued imatinib therapy after achieving a molecular remission." Leuk Res 28 Suppl 1: S71-3.
McVey, M. and S. E. Lee (2008). "MMEJ repair of double-strand breaks (director's cut): deleted sequences and alternative endings." Trends Genet 24(11): 529-38.
Melo, J. V. (1996). "The diversity of BCR-ABL fusion proteins and their relationship to leukemia phenotype." Blood 88(7): 2375-84.
Melo, J. V. and D. J. Barnes (2007). "Chronic myeloid leukaemia as a model of disease evolution in human cancer." Nat Rev Cancer 7(6): 441-53.
Melo, J. V., D. E. Gordon, N. C. Cross and J. M. Goldman (1993). "The ABL-BCR fusion gene is expressed in chronic myeloid leukemia." Blood 81(1): 158-65.
Melo, J. V., A. Hochhaus, X. H. Yan and J. M. Goldman (1996). "Lack of correlation between ABL-BCR expression and response to interferon-alpha in chronic myeloid leukaemia." Br J Haematol 92(3): 684-6.
Melo, J. V., H. Myint, D. A. Galton and J. M. Goldman (1994). "P190BCR-ABL chronic myeloid leukaemia: the missing link with chronic myelomonocytic leukaemia?" Leukemia 8(1): 208-11.
Melo, J. V., X. H. Yan, J. Diamond, F. Lin, N. C. Cross and J. M. Goldman (1996). "Reverse transcription/polymerase chain reaction (RT/PCR) amplification of very small
127
numbers of transcripts: the risk in misinterpreting negative results." Leukemia 10(7): 1217-21.
Merx, K., M. C. Muller, S. Kreil, T. Lahaye, P. Paschka, C. Schoch, A. Weisser, C. Kuhn, U. Berger, H. Gschaidmeier, R. Hehlmann and A. Hochhaus (2002). "Early reduction of BCR-ABL mRNA transcript levels predicts cytogenetic response in chronic phase CML patients treated with imatinib after failure of interferon alpha." Leukemia 16(9): 1579-83.
Michor, F., T. P. Hughes, Y. Iwasa, S. Branford, N. P. Shah, C. L. Sawyers and M. A. Nowak (2005). "Dynamics of chronic myeloid leukaemia." Nature 435(7046): 1267-70.
Miyamura, K., T. Tahara, M. Tanimoto, Y. Morishita, K. Kawashima, Y. Morishima, H. Saito, S. Tsuzuki, K. Takeyama, Y. Kodera and et al. (1993). "Long persistent bcr-abl positive transcript detected by polymerase chain reaction after marrow transplant for chronic myelogenous leukemia without clinical relapse: a study of 64 patients." Blood 81(4): 1089-93.
Molldrem, J. J., P. P. Lee, C. Wang, K. Felio, H. M. Kantarjian, R. E. Champlin and M. M. Davis (2000). "Evidence that specific T lymphocytes may participate in the elimination of chronic myelogenous leukemia." Nat Med 6(9): 1018-23.
Morley, A. A., P. A. Bartley, D. M. Ross, S. Latham, H. Martin-Harris, B. Budgen, V. Wilczek, S. Branford and T. P. Hughes (2008). "DNA-based monitoring of minimal residual disease (MRD) in chronic myeloid leukemia (CML)." Blood 112(11): 406a. Abstract 1111.
Morris, C. M., N. Heisterkamp, J. Groffen and P. H. Fitzgerald (1991). "Entire ABL gene is joined with 5'-BCR in some patients with Philadelphia-positive leukemia." Blood 78(4): 1078-84.
Mughal, T. I., A. Yong, R. M. Szydlo, F. Dazzi, E. Olavarria, F. van Rhee, J. Kaeda, N. C. Cross, C. Craddock, E. Kanfer, J. Apperley and J. M. Goldman (2001). "Molecular studies in patients with chronic myeloid leukaemia in remission 5 years after allogeneic stem cell transplant define the risk of subsequent relapse." Br J Haematol 115(3): 569-74.
Muller, M. C., N. Gattermann, T. Lahaye, M. W. Deininger, A. Berndt, S. Fruehauf, A. Neubauer, T. Fischer, D. K. Hossfeld, F. Schneller, S. W. Krause, C. Nerl, H. G. Sayer, O. G. Ottmann, C. Waller, W. Aulitzky, P. le Coutre, M. Freund, K. Merx, P. Paschka, H. Konig, S. Kreil, U. Berger, H. Gschaidmeier, R. Hehlmann and A. Hochhaus (2003). "Dynamics of BCR-ABL mRNA expression in first-line therapy of chronic myelogenous leukemia patients with imatinib or interferon alpha/ara-C." Leukemia 17(12): 2392-400.
Naumann, S., D. Reutzel, M. Speicher and H. J. Decker (2001). "Complete karyotype characterization of the K562 cell line by combined application of G-banding, multiplex-fluorescence in situ hybridization, fluorescence in situ hybridization, and comparative genomic hybridization." Leuk Res 25(4): 313-22.
Neumann, F., N. Teutsch, S. Kliszewski, S. Bork, U. Steidl, B. Brors, N. Schimkus, N. Roes, U. Germing, B. Hildebrandt, B. Royer-Pokora, R. Eils, N. Gattermann, R. Haas and R. Kronenwett (2005). "Gene expression profiling of Philadelphia chromosome (Ph)-negative CD34+ hematopoietic stem and progenitor cells of patients with Ph-positive CML in major molecular remission during therapy with imatinib." Leukemia 19(3): 458-60.
Neumann, H. A. and A. A. Fauser (1982). "Effect of interferon on pluripotent hemopoietic progenitors (CFU-GEMM) derived from human bone marrow." Exp Hematol 10(7): 587-90.
Neves, H., C. Ramos, M. G. da Silva, A. Parreira and L. Parreira (1999). "The nuclear topography of ABL, BCR, PML, and RARalpha genes: evidence for gene proximity in specific phases of the cell cycle and stages of hematopoietic differentiation." Blood 93(4): 1197-207.
128
Ng, E. K., N. B. Tsui, N. Y. Lam, R. W. Chiu, S. C. Yu, S. C. Wong, E. S. Lo, T. H. Rainer, P. J. Johnson and Y. M. Lo (2002). "Presence of filterable and nonfilterable mRNA in the plasma of cancer patients and healthy individuals." Clin Chem 48(8): 1212-7.
Nowell, P. and D. Hungerford (1960). "A minute chromosome in human chronic granulocytic leukemia." Science 132: 1497-1501.
Nowicki, M. O., R. Falinski, M. Koptyra, A. Slupianek, T. Stoklosa, E. Gloc, M. Nieborowska-Skorska, J. Blasiak and T. Skorski (2004). "BCR/ABL oncogenic kinase promotes unfaithful repair of the reactive oxygen species-dependent DNA double-strand breaks." Blood 104(12): 3746-53.
O'Brien, S. G., F. Guilhot, R. A. Larson, I. Gathmann, M. Baccarani, F. Cervantes, J. J. Cornelissen, T. Fischer, A. Hochhaus, T. Hughes, K. Lechner, J. L. Nielsen, P. Rousselot, J. Reiffers, G. Saglio, J. Shepherd, B. Simonsson, A. Gratwohl, J. M. Goldman, H. Kantarjian, K. Taylor, G. Verhoef, A. E. Bolton, R. Capdeville and B. J. Druker (2003). "Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia." N Engl J Med 348(11): 994-1004.
O'Dwyer, M. E., M. J. Mauro, G. Kurilik, M. Mori, S. Balleisen, S. Olson, E. Magenis, R. Capdeville and B. J. Druker (2002). "The impact of clonal evolution on response to imatinib mesylate (STI571) in accelerated phase CML." Blood 100(5): 1628-33.
Ogura, M., Y. Morishima, R. Ohno, Y. Kato, N. Hirabayashi, H. Nagura and H. Saito (1985). "Establishment of a novel human megakaryoblastic leukemia cell line, MEG-01, with positive Philadelphia chromosome." Blood 66(6): 1384-92.
Oguz, F. S., S. Kalayoglu, A. S. Diler, H. Tozkir, D. Sargin, M. Carin and M. T. Dorak (2003). "HLA system affects the age-at-onset in chronic myeloid leukemia." Am J Hematol 73(4): 256-62.
Pane, F., M. Intrieri, C. Quintarelli, B. Izzo, G. C. Muccioli and F. Salvatore (2002). "BCR/ABL genes and leukemic phenotype: from molecular mechanisms to clinical correlations." Oncogene 21(56): 8652-67.
Papadopoulos, P., S. A. Ridge, C. A. Boucher, C. Stocking and L. M. Wiedemann (1995). "The novel activation of ABL by fusion to an ets-related gene, TEL." Cancer Res 55(1): 34-8.
Pardoe, I. U. and T. I. Michalak (1995). "Detection of hepatitis B and woodchuck hepatitis viral DNA in plasma and mononuclear cells from heparinized blood by the polymerase chain reaction." J Virol Methods 51(2-3): 277-88.
Pavlovsky, C., H. Kantarjian and J. E. Cortes (2009). "First-line therapy for chronic myeloid leukemia: Past, present, and future." Am J Hematol 84(5): 287-293.
Pavlovsky, C., H. Kantarjian and J. E. Cortes (2009). "First-line therapy for chronic myeloid leukemia: Past, present, and future." Am J Hematol.
Pinilla-Ibarz, J., K. Cathcart, T. Korontsvit, S. Soignet, M. Bocchia, J. Caggiano, L. Lai, J. Jimenez, J. Kolitz and D. A. Scheinberg (2000). "Vaccination of patients with chronic myelogenous leukemia with bcr-abl oncogene breakpoint fusion peptides generates specific immune responses." Blood 95(5): 1781-7.
Posthuma, E. F., J. H. Falkenburg, J. F. Apperley, A. Gratwohl, B. Hertenstein, R. F. Schipper, M. Oudshoorn, J. H. Biezen, J. Hermans, R. Willemze, E. Roosnek and D. Niederwieser (2000). "HLA-DR4 is associated with a diminished risk of the development of chronic myeloid leukemia (CML). Chronic Leukemia Working Party of the European Blood and Marrow Transplant Registry." Leukemia 14(5): 859-62.
Posthuma, E. F., J. H. Falkenburg, J. F. Apperley, A. Gratwohl, E. Roosnek, B. Hertenstein, R. F. Schipper, G. M. Schreuder, J. D'Amaro, M. Oudshoorn, J. H. van Biezen, J. Hermans, R. Willemze and D. Niederwieser (1999). "HLA-B8 and HLA-A3 coexpressed with HLA-B8 are associated with a reduced risk of the development of chronic myeloid leukemia. The Chronic Leukemia Working Party of the EBMT." Blood 93(11): 3863-5.
129
Quintas-Cardama, A., H. Kantarjian, M. Talpaz, S. O'Brien, G. Garcia-Manero, S. Verstovsek, M. B. Rios, K. Hayes, A. Glassman, B. N. Bekele, X. Zhou and J. Cortes (2005). "Imatinib mesylate therapy may overcome the poor prognostic significance of deletions of derivative chromosome 9 in patients with chronic myelogenous leukemia." Blood 105(6): 2281-6.
Radich, J. P., G. Gehly, T. Gooley, E. Bryant, R. A. Clift, S. Collins, S. Edmands, J. Kirk, A. Lee, P. Kessler and et al. (1995). "Polymerase chain reaction detection of the BCR-ABL fusion transcript after allogeneic marrow transplantation for chronic myeloid leukemia: results and implications in 346 patients." Blood 85(9): 2632-8.
Ravandi, F., J. Cortes, M. Albitar, R. Arlinghaus, J. Qiang Guo, M. Talpaz and H. M. Kantarjian (1999). "Chronic myelogenous leukaemia with p185(BCR/ABL) expression: characteristics and clinical significance." Br J Haematol 107(3): 581-6.
Rawer, D., A. Borkhardt, M. Wilda, S. Kropf and J. Kreuder (2003). "Influence of stochastics on quantitative PCR in the detection of minimal residual disease." Leukemia 17(12): 2527-8; author reply 2528-31.
Rego, E. M. and P. P. Pandolfi (2002). "Reciprocal products of chromosomal translocations in human cancer pathogenesis: key players or innocent bystanders?" Trends Mol Med 8(8): 396-405.
Reiter, A., S. Saussele, D. Grimwade, J. L. Wiemels, M. R. Segal, M. Lafage-Pochitaloff, C. Walz, A. Weisser, A. Hochhaus, A. Willer, A. Reichert, T. Buchner, E. Lengfelder, R. Hehlmann and N. C. Cross (2003). "Genomic anatomy of the specific reciprocal translocation t(15;17) in acute promyelocytic leukemia." Genes Chromosomes Cancer 36(2): 175-88.
Ren, R. (2005). "Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous leukaemia." Nat Rev Cancer 5(3): 172-83.
Rezvani, K., M. Grube, J. M. Brenchley, G. Sconocchia, H. Fujiwara, D. A. Price, E. Gostick, K. Yamada, J. Melenhorst, R. Childs, N. Hensel, D. C. Douek and A. J. Barrett (2003). "Functional leukemia-associated antigen-specific memory CD8+ T cells exist in healthy individuals and in patients with chronic myelogenous leukemia before and after stem cell transplantation." Blood 102(8): 2892-900.
Rezvani, K., A. S. Yong, S. Mielke, B. N. Savani, L. Musse, J. Superata, B. Jafarpour, C. Boss and A. J. Barrett (2008). "Leukemia-associated antigen-specific T-cell responses following combined PR1 and WT1 peptide vaccination in patients with myeloid malignancies." Blood 111(1): 236-42.
Robbiani, D. F., A. Bothmer, E. Callen, B. Reina-San-Martin, Y. Dorsett, S. Difilippantonio, D. J. Bolland, H. T. Chen, A. E. Corcoran, A. Nussenzweig and M. C. Nussenzweig (2008). "AID is required for the chromosomal breaks in c-myc that lead to c-myc/IgH translocations." Cell 135(6): 1028-38.
Roeder, I., M. Horn, I. Glauche, A. Hochhaus, M. C. Mueller and M. Loeffler (2006). "Dynamic modeling of imatinib-treated chronic myeloid leukemia: functional insights and clinical implications." Nat Med 12(10): 1181-4.
Rojas, J. M., K. Knight, L. Wang and R. E. Clark (2007). "Clinical evaluation of BCR-ABL peptide immunisation in chronic myeloid leukaemia: results of the EPIC study." Leukemia 21(11): 2287-95.
Ross, D. M., P. A. Bartley, A. A. Morley, J. F. Seymour, S. Branford and T. P. Hughes (2007). "Detection of patient-specific BCR-ABL genomic DNA in CML patients with no detectable BCR-ABL by quantitative reverse transcriptase PCR." Haematologica 92(S1): Abstract 567.
Ross, D. M., S. Branford, J. V. Melo and T. P. Hughes (2009). "Reply to 'What do we mean by sensitivity when we talk about detecting minimal residual disease?' by Steinbach and Debatin." Leukemia 23(4): 819-20; author reply 820.
130
Ross, D. M., S. Branford, S. Moore and T. P. Hughes (2006). "Limited clinical value of regular bone marrow cytogenetic analysis in imatinib-treated chronic phase CML patients monitored by RQ-PCR for BCR-ABL." Leukemia 20(4): 664-70.
Ross, D. M., A. Grigg, A. Schwarer, C. Arthur, K. Loftus, A. K. Mills, R. Filshie, R. Columbus, J. Reynolds, J. F. Seymour, B. S. and T. P. Hughes (2008). "The majority of chronic myeloid leukaemia patients who cease imatinib after achieving a sustained complete molecular response (CMR) remain in CMR, and any relapses occur early." Blood 112(11): 402-3. Abstract 1102.
Ross, D. M. and T. P. Hughes (2008). "Current and emerging tests for the laboratory monitoring of chronic myeloid leukaemia and related disorders." Pathology 40(3): 231-46.
Ross, D. M. and T. P. Hughes (2008). "How complete is "complete" molecular response in imatinib-treated chronic myeloid leukemia?" Leuk Lymphoma 49(7): 1230-1.
Ross, D. M., L. Schafranek, T. P. Hughes, M. Nicola, S. Branford and J. Score (2009). "Genomic translocation breakpoint sequences are conserved in BCR-ABL1 cell lines despite the presence of amplification." Cancer Genet Cytogenet 189(2): 138-9.
Ross, D. M., D. B. Watkins, T. P. Hughes and S. Branford (2008). "Reverse transcription with random pentadecamer primers improves the detection limit of a quantitative PCR assay for BCR-ABL transcripts in chronic myeloid leukemia: implications for defining sensitivity in minimal residual disease." Clin Chem 54(9): 1568-71.
Rousselot, P., F. Huguet, D. Rea, L. Legros, J. M. Cayuela, O. Maarek, O. Blanchet, G. Marit, E. Gluckman, J. Reiffers, M. Gardembas and F. X. Mahon (2007). "Imatinib mesylate discontinuation in patients with chronic myelogenous leukemia in complete molecular remission for more than 2 years." Blood 109(1): 58-60.
Rowley, J. D. (1973). "Identification of a translocation with quinacrine fluorescence in a patient with acute leukemia." Ann Genet 16(2): 109-12.
Rozman, C., A. Urbano-Ispizua, F. Cervantes, M. Rozman, D. Colomer, P. Feliz, A. Pujades and J. L. Vives Corrons (1995). "Analysis of the clinical relevance of the breakpoint location within M-BCR and the type of chimeric mRNA in chronic myelogenous leukemia." Leukemia 9(6): 1104-7.
Rudduck-Sivaswaren, C., S. L. Tien, P. Lim, E. Lim, D. K. Lie, P. H. Tan and A. S. Lee (2005). "Evidence for deletion of 9q as a two-step process in chronic myeloid leukemia." Clin Genet 68(5): 461-5.
Saussele, S., A. Weisser, M. C. Muller, M. Emgi, P. La Rosee, P. Paschka, C. Kuhn, A. Willer, R. Hehlmann and A. Hochhaus (2000). "Frequent polymorphism in BCR exon b2 identified in BCR-ABL positive and negative individuals using fluorescent hybridization probes." Leukemia 14(11): 2006-10.
Savani, B. N., A. Montero, R. Kurlander, R. Childs, N. Hensel and A. J. Barrett (2005). "Imatinib synergizes with donor lymphocyte infusions to achieve rapid molecular remission of CML relapsing after allogeneic stem cell transplantation." Bone Marrow Transplant 36(11): 1009-15.
Schade, A. E., G. L. Schieven, R. Townsend, A. M. Jankowska, V. Susulic, R. Zhang, H. Szpurka and J. P. Maciejewski (2008). "Dasatinib, a small-molecule protein tyrosine kinase inhibitor, inhibits T-cell activation and proliferation." Blood 111(3): 1366-77.
Score, J., M. J. Calasanz, F. Pane, O. Ottmann, F. H. Grand and N. C. P. Cross (2007). "Analysis of t(9;22) breakpoints indicates that p210 and p190 BCR-ABL are formed by distinct mechanisms." Haematologica 92(s1): (abstract [2]).
Shepherd, P., R. Suffolk, J. Halsey and N. Allan (1995). "Analysis of molecular breakpoint and m-RNA transcripts in a prospective randomized trial of interferon in chronic myeloid leukaemia: no correlation with clinical features, cytogenetic response, duration of chronic phase, or survival." Br J Haematol 89(3): 546-54.
Silva, J. M., R. Rodriguez, J. M. Garcia, C. Munoz, J. Silva, G. Dominguez, M. Provencio, P. Espana and F. Bonilla (2002). "Detection of epithelial tumour RNA in the plasma of
131
colon cancer patients is associated with advanced stages and circulating tumour cells." Gut 50(4): 530-4.
Sinclair, P. B., E. P. Nacheva, M. Leversha, N. Telford, J. Chang, A. Reid, A. Bench, K. Champion, B. Huntly and A. R. Green (2000). "Large deletions at the t(9;22) breakpoint are common and may identify a poor-prognosis subgroup of patients with chronic myeloid leukemia." Blood 95(3): 738-43.
Sobrinho-Simoes, M. A., J. Score, N. C. Cross, J. Apperley and J. V. Melo (2007). "How cured are CML patients in complete molecular response (CMR) after stem cell transplantation or imatinib?" Blood 110(11): 306a Abstract 1009.
Sokal, J. E., E. B. Cox, M. Baccarani, S. Tura, G. A. Gomez, J. E. Robertson, C. Y. Tso, T. J. Braun, B. D. Clarkson, F. Cervantes and et al. (1984). "Prognostic discrimination in "good-risk" chronic granulocytic leukemia." Blood 63(4): 789-99.
Soutoglou, E., J. F. Dorn, K. Sengupta, M. Jasin, A. Nussenzweig, T. Ried, G. Danuser and T. Misteli (2007). "Positional stability of single double-strand breaks in mammalian cells." Nat Cell Biol 9(6): 675-82.
Stahlberg, A., J. Hakansson, X. Xian, H. Semb and M. Kubista (2004). "Properties of the reverse transcription reaction in mRNA quantification." Clin Chem 50(3): 509-15.
Stangegaard, M., I. H. Dufva and M. Dufva (2006). "Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA." Biotechniques 40(5): 649-57.
Tefferi, A., C. R. Schad, R. K. Pruthi, G. J. Ahmann, J. L. Spurbeck and G. W. Dewald (1995). "Fluorescent in situ hybridization studies of lymphocytes and neutrophils in chronic granulocytic leukemia." Cancer Genet Cytogenet 83(1): 61-4.
Tsai, A. G., H. Lu, S. C. Raghavan, M. Muschen, C. L. Hsieh and M. R. Lieber (2008). "Human chromosomal translocations at CpG sites and a theoretical basis for their lineage and stage specificity." Cell 135(6): 1130-42.
Tsui, N. B., E. K. Ng and Y. M. Lo (2002). "Stability of endogenous and added RNA in blood specimens, serum, and plasma." Clin Chem 48(10): 1647-53.
van der Reijden, B. A., H. G. Dauwerse, R. H. Giles, S. Jagmohan-Changur, C. Wijmenga, P. P. Liu, B. Smit, H. W. Wessels, G. C. Beverstock, M. Jotterand-Bellomo, D. Martinet, D. Muhlematter, M. Lafage-Pochitaloff, J. Gabert, J. Reiffers, C. Bilhou-Nabera, G. J. van Ommen, A. Hagemeijer and M. H. Breuning (1999). "Genomic acute myeloid leukemia-associated inv(16)(p13q22) breakpoints are tightly clustered." Oncogene 18(2): 543-50.
van der Velden, V. H., N. Boeckx, M. Gonzalez, M. Malec, G. Barbany, T. Lion, E. Gottardi, N. Pallisgaard, E. Beillard, W. C. Hop, P. G. Hoogeveen, J. Gabert and J. J. van Dongen (2004). "Differential stability of control gene and fusion gene transcripts over time may hamper accurate quantification of minimal residual disease--a study within the Europe Against Cancer Program." Leukemia 18(4): 884-6.
van der Velden, V. H., G. Cazzaniga, A. Schrauder, J. Hancock, P. Bader, E. R. Panzer-Grumayer, T. Flohr, R. Sutton, H. Cave, H. O. Madsen, J. M. Cayuela, J. Trka, C. Eckert, L. Foroni, U. Zur Stadt, K. Beldjord, T. Raff, C. E. van der Schoot and J. J. van Dongen (2007). "Analysis of minimal residual disease by Ig/TCR gene rearrangements: guidelines for interpretation of real-time quantitative PCR data." Leukemia 21(4): 604-11.
van der Velden, V. H., E. R. Panzer-Grumayer, G. Cazzaniga, T. Flohr, R. Sutton, A. Schrauder, G. Basso, M. Schrappe, J. M. Wijkhuijs, M. Konrad, C. R. Bartram, G. Masera, A. Biondi and J. J. van Dongen (2007). "Optimization of PCR-based minimal residual disease diagnostics for childhood acute lymphoblastic leukemia in a multi-center setting." Leukemia 21(4): 706-13.
Varga, A. and D. James (2006). "Real-time RT-PCR and SYBR Green I melting curve analysis for the identification of Plum pox virus strains C, EA, and W: effect of amplicon size, melt rate, and dye translocation." J Virol Methods 132(1-2): 146-53.
132
Verbeek, W., H. Konig, J. Boehm, D. Kohl, C. Lange, T. Heuer, C. Scheibenbogen, H. E. Reis, A. Hochhaus and U. Graeven (2006). "Continuous complete hematological and cytogenetic remission with molecular minimal residual disease 9 years after discontinuation of interferon-alpha in a patient with Philadelphia chromosome-positive chronic myeloid leukemia." Acta Haematol 115(1-2): 109-12.
Verstovsek, S., H. Lin, H. Kantarjian, G. Saglio, D. De Micheli, F. Pane, G. Garcia-Manero, M. Intrieri, B. Rotoli, F. Salvatore, J. Q. Guo, M. Talpaz, G. Specchia, G. Pizzolo, A. M. Liberati, J. Cortes, R. C. Quackenbush and R. B. Arlinghaus (2002). "Neutrophilic-chronic myeloid leukemia: low levels of p230 BCR/ABL mRNA and undetectable BCR/ABL protein may predict an indolent course." Cancer 94(9): 2416-25.
von Bubnoff, N., P. W. Manley, J. Mestan, J. Sanger, C. Peschel and J. Duyster (2006). "Bcr-Abl resistance screening predicts a limited spectrum of point mutations to be associated with clinical resistance to the Abl kinase inhibitor nilotinib (AMN107)." Blood 108(4): 1328-33.
Waller, C. F., G. Dennebaum, C. Feldmann and W. Lange (1999). "Long-template DNA polymerase chain reaction for the detection of the bcr/abl translocation in patients with chronic myelogenous leukemia." Clin Cancer Res 5(12): 4146-51.
Wang, L., K. Pearson, L. Pillitteri, J. E. Ferguson and R. E. Clark (2002). "Serial monitoring of BCR-ABL by peripheral blood real-time polymerase chain reaction predicts the marrow cytogenetic response to imatinib mesylate in chronic myeloid leukaemia." Br J Haematol 118(3): 771-7.
Weinstock, D. M., B. Elliott and M. Jasin (2006). "A model of oncogenic rearrangements: differences between chromosomal translocation mechanisms and simple double-strand break repair." Blood 107(2): 777-80.
Wiemels, J. L. and M. Greaves (1999). "Structure and possible mechanisms of TEL-AML1 gene fusions in childhood acute lymphoblastic leukemia." Cancer Res 59(16): 4075-82.
Witt, D. J. and M. Kemper (1999). "Techniques for the evaluation of nucleic acid amplification technology performance with specimens containing interfering substances: efficacy of boom methodology for extraction of HIV-1 RNA." J Virol Methods 79(1): 97-111.
Xiang, X., D. Qiu, R. D. Hegele and W. C. Tan (2001). "Comparison of different methods of total RNA extraction for viral detection in sputum." J Virol Methods 94(1-2): 129-35.
Xinh, P. T., H. A. Vu, H. Nghia, N. T. Binh, T. Van Be, T. Van Binh, K. Tokunaga and Y. Sato (2006). "Coexistence of Philadelphia chromosome positive cells with and without der(9) deletion in a patient with chronic myelogenous leukemia." Cancer Genet Cytogenet 164(2): 122-7.
Yoong, Y., T. J. VanDeWalker, R. O. Carlson, G. W. Dewald and A. Tefferi (2005). "Clinical correlates of submicroscopic deletions involving the ABL-BCR translocation region in chronic myeloid leukemia." Eur J Haematol 74(2): 124-7.
Zhang, J. G., J. M. Goldman and N. C. Cross (1995). "Characterization of genomic BCR-ABL breakpoints in chronic myeloid leukaemia by PCR." Br J Haematol 90(1): 138-46.
Zhang, J. G., F. Lin, A. Chase, J. M. Goldman and N. C. Cross (1996). "Comparison of genomic DNA and cDNA for detection of residual disease after treatment of chronic myeloid leukemia with allogeneic bone marrow transplantation." Blood 87(6): 2588-93.