[methods in enzymology] chromatin and chromatin remodeling enzymes, part c volume 377 || measurement...

180 histone modifying enzymes [10]

[10] Measurement of Mammalian HistoneDeacetylase Activity

By Eric Verdin, Franck Dequiedt, Wolfgang Fischle,Roy Frye, Brett Marshall, and Brian North

All core histone proteins are reversibly and dynamically acetylated atmultiple sites in their amino-terminal tails. Hyperacetylated histones aregenerally found in transcriptionally active genes, and hypoacetylated his-tones in transcriptionally silent regions, such as heterochromatin. The levelof histone acetylation at a particular locus in chromatin reflects the compet-ing activities of histone acetyltransferases and histone deacetylases(HDACs). The identification and characterization of numerous transcrip-tional regulators possessing histone acetyltransferase or HDAC activitieshas validated the prediction that histone acetylation plays a critical rolein transcriptional regulatory mechanisms (for general review see Cheunget al.1).

So far, 18 distinct human HDACs have been identified. They aregrouped into three classes based on their primary homology to three Sac-charomyces cerevisiae HDACs. Class I HDACs (HDAC1, 2, 3, 8, and 11)are homologous to yRPD3, share a compact structure, and are predomi-nantly nuclear proteins expressed in most tissues and cell lines (seeTable I) (reviewed in Fischle et al.2). Class II HDACs are homologous toyHDA1 and are subdivided in two subclasses, IIa (HDAC4, 5, 7, and 9and its splice variant MITR) and IIb (HDAC6 and HDAC10), based on se-quence homology and domain organization (for recent review, see Verdinet al.3). While class I and class II HDACs and their S. cerevisiae orthologs,yRPD3 and yHDA1, all share some degree of homology in their catalyticdomain, class III HDACs are homologous to ySIR2 and show no homologyto class I and class II proteins (see Table I). The class III enzymes are char-acterized by their dependence on nicotinamide adenine dinucleotide(NADþ). This cofactor serves as an acetyl-group acceptor in the deacety-lation reaction generating acetylADP ribose.4 The identity of proteins ineach class and some of their salient properties are summarized in Table I.

1 W. L. Cheung, S. D. Briggs, and C. D. Allis, Curr. Opin. Cell Biol. 12, 326 (2000).2 W. Fischle, V. Kiermer, F. Dequiedt, and E. Verdin, Biochem. Cell. Biol. 79, 337 (2001).3 E. Verdin, F. Dequiedt, and H. G. Kasler, Trends Genet. 19, 286 (2003).4 M. T. Borra, F. J. O’Neill, M. D. Jackson, B. Marshall, E. Verdin, K. R. Foltz, and J. M.

Denu, J. Biol. Chem. 277, 12632 (2002).

Copyright 2004, Elsevier Inc.All rights reserved.

METHODS IN ENZYMOLOGY, VOL. 377 0076-6879/04 $35.00

TABLE I

Characteristics of Human Histone Deacetylases

Class I Class IIa Class IIb Class III

Protein HDAC1, 2, 3, 8, 11 HDAC4, 5, 7, 9 HDAC6, 10 SIRT1, 2, 3, 4, 5, 6, 7

Yeast ortholog Rpd3 Hdal Hdal Sir2

Subcellular distribution Predominantly

nuclear

Nucleo-cytoplasmic

shuttling

Nucleo-cytoplasmic

shuttling

Nuclear (SIRT1),

cytoplasmic (SIRT2),

mitochondrial (SIRT3)

Target(s) Histones

p53 (HDAC1),

NF�B (HDAC3)

Histones Histones tubulin Histones

tubulin (SIRT2),

p53 (SIRT1),

TAF(I)68 (Sir2a/SIRT1)

Tissue expression Ubiquitous Tissue-specific

(brain, muscle,

thymus)

Tissue-specific

(Testis, . . .)Unknown

Protein cofactor necessary

for enzymatic activity

SMRT/N-CoR

(HDAC3)

HDAC3 þSMRT/N-CoR

? ?

Expression system

Mammalian (stable and

transient)

þ þ þ þ

E. coli � (þ for HDAC8) � � þ (SIRT1, 2, 3)

In vitro T&T � (þ for HDAC3) � � þ (SIRT3)

Enzyme cofactor Zinc Zinc Zinc NADþInhibition by:

Trichostatin A, SAHA þ þ þ �Trapoxin, Naþ Butyrate þ þ � �Nicotinamide (Vitamin B3) � � � þTubacin � � þ �

[10]

histo

ne

de

ac

ety

la

se

ac

tiv

ity

18

1


The properties of these enzymes have been described in detail in severalrecent, extensive reviews.3,5,6

This review focuses on the experimental protocols that are used todetect the enzymatic activity associated with these proteins.

Purification of Enzymatically Active Class I and II HDACs

All class I and class II HDACs have proven relatively difficult to purify inan enzymatically active form. With a couple of exceptions, all proteins needto be immunoprecipitated after transient or stable transfection in mamma-lian cells. While activity can be detected after immunoprecipitation of en-dogenous proteins, transient or stable transfections of epitope-taggedproteins allow for the standardization of immunoprecipitation protocolsand for the purification of larger amounts of enzymatically active enzymes.Of note, the enzymatic activity of class I enzymes, HDAC1 and HDAC3,can be inhibited when the epitope tag is placed at the N-terminus of the pro-tein (W. Fischle and E. Verdin, unpublished observations). For this reason,fusion proteins incorporating a C-terminal epitope have been favored.

Mammalian Cell Culture Systems

Plasmids. Plasmid constructs for the expression of different humanHDACs are based on the pcDNA3.1 vector(s). In a wide range of mamma-lian cells, the human cytomegalovirus immediate-early promoter of thisvector provides high levels of expression. In addition, the vector will repli-cate episomally in cell lines latently infected with SV40 or expressing theSV40 large T antigen (e.g., 293T, COS7). A neomycin (G418) resistancegene cassette allows for the selection of stable transfected cells. High-levelstable and nonreplicative transient expression can therefore be carried outin most mammalian cells. To generate C-terminal epitope-tagged con-structs of different HDACs, we used polymerase chain reaction (Pfu poly-merase) amplification with a reverse primer containing the sequence for theFLAG peptide.7 First, the two primers used to amplify HDAC3 were: for-ward ¼ 50-CCGGATCCGAATTC ACCATGGCCAAGACCGTGGCC-30; backward ¼ 50-GCTCTAGATTA CTTGTCATCGTCGTCCTTGTAGTCTCCTCC GAATTCAATCTCCACATCGCTTTCC-30. (Restrictionsites are underlined; the sequence encoding the FLAG epitope is in italics,

5 J. M. Denu, Trends Biochem. Sci. 28, 41 (2003).6 P. Marks, R. A. Rifkind, V. M. Richon, R. Breslow, T. Miller, and W. K. Kelly, Nat. Rev.

Cancer 1, 194 (2001).7 W. Fischle, F. Dequiedt, M. Fillion, M. J. Hendzel, W. Voelter, and E. Verdin, J. Biol.

Chem. 276, 35826 (2001).

[10] histone deacetylase activity 183

and the stop codon is in bold.) The PCR product was digested with the re-striction enzymes BamHI and XbaI and inserted into the correspondingsites of the pcDNA3.1(þ) vector by standard protocols. The cDNA se-quence encoding HDAC3 was then replaced with PCR fragments encodingeach of the other HDACs by subcloning into newly generated EcoRI sitesengineered into the PCR primers. Other vectors with different promotersfor the expression in mammalian cells can be used. Besides the FLAG epi-tope, HA and Myc tags have also been used successfully with differenthuman HDACs (W. Fischle and E. Verdin, unpublished observations).

Transient Transfection. Constructs based on pcDNA3.1 are used totransiently express different human HDACs in a variety of mammalian celllines, including: 293, HeLa, Jurkat, NIH3T3, COS7, and CHO cells.Depending on the cell type, 5 � 106 to 1 � 107 cells (corresponding to a10 cm culture dish) are transfected according to standard procedures eitherby the CaPO4 coprecipitation method or by lipofection. Cells are main-tained in growth medium for 24–48 h before harvesting to allow for accu-mulation of HDAC proteins. For further experimental details, seemammalian cell culture system section.

Note. When the transfection efficiency ranges from 50–90%, 5 � 106 to1 � 107 cells are sufficient for expression and immunoprecipitation ofenough HDAC protein for up to four radioactive enzymatic HDAC assays.

Generation of Stably Transfected HDAC–FLAG Cell Lines. pcDNA3.1vectors encoding human HDACs fused to the FLAG-epitope are linear-ized by digestion with the restriction enzymes SspI (HDACs1–5 andHDAC7) or SacI (HDAC6) and purified by agarose gel electrophoresis.293 HEK cells of a low passage number (1 � 105 in a 6-well dish) are trans-fected with the linearized pcDNA3.1 HDAC-FLAG expression plasmidsby lipofection according to common procedures. After 48 h, the cells aresplit into 15-cm tissue culture dishes at 3 � 104, 1 � 105, and 3 � 105

cells/dish. For selection of stable expressing cell clones, cultures are incu-bated in standard culture medium containing 700 �g/ml G418 sulfate untilvisible colonies appear. This takes approximately 3 weeks, and the mediumshould be changed every 3–4 days. Nontransfected cells (1 � 106 cells/dishas a control) die over this selection period. Plates are rinsed with phos-phate-buffered saline (PBS), and single colonies are isolated by trypsini-zation using cloning cylinders. For further culturing of the stabletransfected cell clones, the G418 sulfate concentration is reduced to450 �g/ml. As soon as the clones reach more than 1 � 106 cells, they arefrozen in liquid nitrogen. Expression of HDAC-FLAG is analyzed by west-ern blotting of total cellular extracts (see later) with anti-FLAG antibodies,and small-scale immunoprecipitations are tested for HDAC activity inenzymatic assays (see later).8,9 Indirect immunofluorescence is used to


verify protein expression in the majority of cells. Single clones areexpanded for further use if they test positive for expression of exogenousproteins, have high expression levels of HDAC-FLAG, and high deacety-lase activity in immunoprecipitation-mediated HDAC activity assays.Detailed analysis of extracts from 293 HEK cells stably expressingHDAC1-FLAG by gradient centrifugation and gel filtration chromatog-raphy verified that the majority of the fusion protein is incorporated in highmolecular weight multiprotein complexes similar to the endogenousHDAC1 protein. In addition, coimmunoprecipitation verified the inter-action of HDAC1-FLAG with Sin3 and Mi2, components of differentendogenous HDAC1 complexes (not shown).

Several aliquots of the expanded clonal cell lines are frozen in liquid N2

(90% fetal calf serum, 10% dimethyl sulfoxide) at low passage numbers(10–15 passages after initial selection). Cells are routinely grown inmedium containing 450 �g/ml G418. However, omission of the antibioticfor 6 weeks (approximately 10 passages) did not result in a significant re-duction in the expression level of HDAC1-FLAG. In addition, large-scalespinner cultures have been grown for several weeks without addition ofG418 sulfate. However, the viability of the clonal HDAC-FLAG celllines is significantly lower than that of the parental cell line, and on anumber of occasions, expression of HDAC has been lost during continuousculture. Therefore, cultures must be monitored for expression of theHDAC fusion protein, particularly after new cultures are started fromfrozen stocks.

Notes. The same protocol is suitable for generation of stable transfectedclones derived from other cell lines. 293 HEK cells were chosen becausethey show high levels of HDAC expression in transient transfections andcan easily be adapted for growth in suspension cultures. After maintainingclones in culture for more than 40 passages, an average of 70–80% of cellsexpressed the fusion constructs, as judged by immunofluorescence stainingwith anti-FLAG antibodies. Therefore, a second round of clonal selectionby limited dilution might be necessary if a totally homogeneous cellpopulation with optimized expression characteristics is desired.

If large-scale cell cultures of stable transfected cell lines are needed, thecells are transferred to small spinner flasks (250 ml, approximately 60 rpm,no additional aeration, 37

�incubator) and grown in OptiMEM containing

2% fetal calf serum, 50 units/ml penicillin, 50 mg/ml streptomycin, 2 mMglutamine. After adaptation to suspension growth, cells are expanded to

8 S. Emiliani, W. Fischle, C. Van Lint, Y. Al-Abed, and E. Verdin, Proc. Natl. Acad. Sci. USA

95, 2795 (1998).9 W. Fischle, S. Emiliani, M. J. Hendzel, T. Nagase, N. Nomura, W. Voelter, and E. Verdin,

J. Biol. Chem. 274, 11713 (1999).


4 L in spinner flasks. Cells are harvested by centrifugation at a density of 1� 106 cells/ml and washed three times in ice-cold PBS buffer. Cell pelletscan either be processed directly or flash-frozen in liquid N2 and stored at�80

�for at least 6 months without significant loss of HDAC activity.

Immunoprecipitation of HDACs from Mammalian Cell Culture Systems

Buffers

1. Buffer A: 50 mM Tris–HCl, pH 7.5, 120 mM NaCl, 0.5 mM EDTA,0.5% NP-40, and 10% glycerol.

2. Buffer B: 50 mM Tris–HCl, pH 7.5, 1 M NaCl, 0.5 mM EDTA,0.5% NP-40, and 10% glycerol.

3. Buffer C: 10 mM Tris–HCl, pH 8.0, 10 mM NaCl, and 10% glycerol.4. Buffer D: 10 mM HEPES (NaOH), pH 7.9, 10 mM KCl, 1.5 mM

MgCl2, and 0.5 mM dithiothreitol (DTT).5. Buffer E: 20 mM HEPES (NaOH), pH 7.9, 450 mM NaCl, 1.5 mM

MgCl2, 1% NP-40, 0.5 mM DTT, 0.2 mM EDTA, and 25% glycerol.6. Buffer F: 50 mM Tris–HCl, pH 7.5, 120 mM NaCl, 0.5 mM EDTA,

0.1% NP-40, and 10% glycerol.

All buffers are filtered (0.4 �m) and stored at 4�. DTT and protease

inhibitors are added immediately before use as needed.Procedure. Fresh or frozen cell pellets are resuspended in buffer A con-

taining protease inhibitors at a ratio of 5 volumes of buffer to 1 volume ofwet cell mass. Lysis is allowed for 30 min at 4

�with rotation. Large volumes

of cell lysates (>5 ml) are transferred to a Dounce homogenizer andhomogenized on ice by 30 strokes with pestle B. Lysates are cleared bycentrifugation at 14,000g for 30 min at 4

�.

Alternatively, fresh cell pellets are resuspended at a ratio of 5 volumesof buffer D containing protease inhibitors to 1 volume of wet cell mass andincubated on ice for 10 min. Swollen cells are recovered by centrifugationat 1000g for 10 min at 4

�and resuspended in 2 volumes of buffer D contain-

ing protease inhibitors. Cell membranes are broken by homogenization in aDounce homogenizer (pestle B, 30 strokes, on ice). Nuclei are pelleted bycentrifugation at 2000g for 10 min at 4

�. After removal of the supernatant

representing the cytoplasmic extract, nuclei are resuspended in 1 volumebuffer E containing protease inhibitors. Nuclei are extracted by homog-enization in a Dounce homogenizer (pestle B, 4

�, 15 strokes every 5 min

for 40 min). Extracts are cleared by centrifugation at 25,000g for 30 minat 4

�and dialyzed three times against 20 volumes of buffer F containing

1 mM phenylmethylsulfonyl fluoride at 4�. Nuclear extracts are finally

cleared by centrifugation at 25,000g for 30 min at 4�. Extracts can be

flash-frozen in liquid N2 and stored at �80�

for at least 6 months withoutsignificant loss of HDAC activity.


Exogenous HDACs from mammalian cell lines transiently or stablyoverexpressing HDACs can be immunoprecipitated on a small- or large-scale depending on the need. For small-scale immunoprecipitation, wholecell lysates are incubated with M2 agarose beads at 10 ml/ml (4 mg M2antibody/ml) overnight with rocking at 4

�. HDAC-FLAG immunocom-

plexes are recovered and washed as described for the immunoprecipitationof endogenous HDACs. For large-scale immunoprecipitations, cell lysatesor nuclear extracts are incubated with M2 agarose beads (4 mg M2 anti-body/ml) using 5 �l/ml resin for 4 h with rocking at 4

�. Immunocomplexes

bound to the agarose beads are recovered by centrifugation at 3000g for10 min at 4

�. The supernatant is incubated with M2 agarose for a second

time (5 �l/ml, 4 h). M2 agarose beads from the two immunoprecipitationsare combined and packed into a small disposable column. The column iswashed with 100 volumes of buffer A, 100 volumes of buffer B, and 30volumes of buffer C. HDAC-FLAG containing complexes are eluted infive column volumes of buffer C containing 0.25 mg/ml FLAG peptide ata low flow rate. At this step, the partially purified material can be aliquotedand stored at �80

�for several months without loss of enzymatic activity.

Two to three freeze—thaw cycles do not seem to interfere with theenzymatic activity.

To immunoprecipitate endogenous HDACs, cell lysates or nuclear ex-tracts are incubated with antibodies (IgG fraction) specific for humanHDACs at 1 �g/ml for overnight at 4

�. Immunocomplexes are recovered

by adding 20 �l/ml Protein G-Sepharose beads with rocking at 4�

for 3 h.Agarose beads are recovered by centrifugation at 3000g for 5 min at 4

�

and washed three times with buffer A, three times with buffer B, and twotimes with buffer C (about 1 ml of buffer per 10 ml of beads, each wash for5–10 min with rocking at 4

�, careful aspiration of the supernatant using gel

loader tips). After the final wash, immune complexes are either directlyused for enzymatic HDAC activity assays or stored in the residual volumeof buffer C at �80

�(stable for several months).

A representative experiment with transfected HDAC1, 3, and 4 isshown below (see Fig. 1A), including an inhibition study of HDAC1 and3 by trichostatin A and trapoxin (see Fig. 1B).

Notes. Only nuclear class II HDACs 4, 5, and 7 were found to be enzy-matically active. Unlike the enzymatically inactive cytoplasmic fractions,these are incorporated into large multiprotein complexes.10 A significantfraction of nuclear HDAC activity seems to be stably associated with thenuclear matrix and must be solubilized with detergents.

10 W. Fischle, F. Dequiedt, M. J. Hendzel, M. G. Guenther, M. A. Lazar, W. Voelter, and

E. Verdin, Mol. Cell 9, 45 (2002).

Fig. 1. HDAC activity associated with HDAC1, 3, and 4. (A) Cell extracts prepared from

293 HEK cells transfected with plasmids encoding the different HDACs were immunopre-

cipitated with M2 antibody in the presence or absence of the FLAG peptide (100-fold molar

excess over antibody). Immunoprecipitated material was assayed in the presence or absence

of trichostatin A (TSA, 400 nM) on a 3H-acetylated histone H4 peptide (see later). The

deacetylase activity (measured as cpm released) from a representative experiment is shown.

(B) Cell lysates were prepared from cells transfected with the different HDACs, and HDAC

expression was analyzed by western blot with anti-FLAG antiserum. (C) Immunoprecipitated

HDAC1 (open circles) and 3 (black circles) were tested for inhibition by TSA and trapoxin

(TPX) over a range of concentrations. Results are expressed as percentage of the activity

obtained in the absence of inhibitors. Adapted with modifications from Refs. 8 and 9.



For further purification, the eluate can be loaded directly onto a gel fil-tration column (Superose 6 HR 10/30) equilibrated in buffer C. Elution ofHDAC-FLAG protein is monitored by Western blotting and enzymaticHDAC assays. For example, HDAC1-FLAG elutes in a broad peakcentered at about 1 MDa with some protein detected in lower molecularmass fractions. High molecular mass HDAC1-FLAG fractions are pooledand stored at �80

�.

In vitro Translated Protein

Recent experiments have provided evidence that, while HDAC3 isinactive when expressed alone, it can be activated enzymatically when in-cubated with its corepressor, SMRT or N-CoR, in vitro.10,11 These experi-ments are consistent with the hypothesis that other class I and class IIHDACs also depend on unique cofactors that regulate their enzymatic ac-tivity. Such a model might provide a plausible explanation for our failure topurify recombinant enzymatically active proteins when these proteins areoverexpressed alone. We provide below a protocol for the expression ofenzymatically active HDAC3 using proteins translated in vitro.

Recombinant FLAG-tagged N-CoR and Myc-tagged human HDAC3,HDAC4, HDAC5, and HDAC7, all cloned in pcDNA3.1 (see mammaliancell culture systems section), are translated independently in vitro using theTNT T7 Quick coupled transcription-translation kit (Promega), accordingto the manufacturer’s protocol using 200 �l of reticulocyte lysate. Increas-ing amounts (0, 2, 10, 50, or 200 �l) of each recombinant HDAC are mixedwith 100 �l of unprogrammed reticulocyte lysate (�N-CoR) or with 100 �lof reticulocyte lysate programmed for FLAG-N-CoR. Mixed proteins arediluted three times with immunoprecipitation buffer (20 mM HEPES, pH7.9, 300 mM KCl, 0.25 mM EDTA, 10% glycerol, 0.1% Tween 20) supple-mented with protease inhibitors (Boehringer Mannheim, complete cock-tail). Complexes are immunoprecipitated with anti-Myc-beads (SantaCruz Biotechnology) overnight at 4

�. Beads are washed three times with

immunoprecipitation buffer and twice in 20 mM Tris–HCl, pH 8.0,150 mM NaCl, and 10% glycerol. One half of the immunoprecipitated ma-terial is tested for HDAC activity with the histone H4 peptide acetylatedin vitro (see Fig. 2). HDAC3, but not the other HDACs, is activated uponbinding to N-CoR. The second half of the immunoprecipitated material isanalyzed for N-CoR by Western blotting with an anti-Flag antiserum (notshown). Western blots show that N-CoR coimmunoprecipitates readilywith HDAC3, 4, 5, and 7 (data not shown).

11 M. G. Guenther, O. Barak, and M. A. Lazar, Mol. Cell. Biol. 21, 6091 (2001).

Fig. 2. HDAC3, but not class II HDACs (HDAC4, 5, and 7) is activated by binding to

SMRT. Myc-tagged HDAC3, 4, 5, and 7 were translated in vitro. Increasing amounts of each

translation reaction (0, 2, 10, 50, or 200 �l of reticulocyte extract for each HDAC) were added

to unprogrammed reticulocyte lysates (�N-CoR) or to translation reactions containing N-

CoR (þ N-CoR). The resulting mixtures were immunoprecipitated with an anti-Myc epitope

antiserum and tested for HDAC activity. The immunoprecipitation step is required in

this procedure since unprogrammed reticulocyte lysates contain significant amounts of

endogenous HDAC activity. Adapted with modifications from Ref. 10.


Notes

1. Decreasing the immunoprecipitation incubation time to 2 h leads toa very significant reduction in the recovery of enzymatically activeHDAC3.

2. The same experiment can be performed by cotranslating eachHDAC individually together with N-CoR. The immunoprecipitatedHDAC3-N-CoR complex works equally well as an enzymaticallyactive HDAC as when the proteins are translated independently,but not better.

3. SMRT can be used in place of N-CoR with similar efficiency.

Purification of Enzymatically Active Class III HDACs

Class III enzymes have generally proven easier to manipulate thanclass I and class II HDACs. While not all class III HDACs are known tohave histone deacetylase activity (see later), proteins with high enzymaticactivity can be purified by immunoprecipitation after transient or stable


transfection in mammalian cells. Recombinant proteins can also beexpressed in E. coli in an enzymatically active form.

Mammalian Cell Culture Systems

Each of the class III human HDACs has been cloned in the pcDNA3.1vector using the same strategy as described under mammalian cell culturesystems section for class I and class II HDACs.

To purify active enzyme, HEK 293T cells are transiently transfectedwith the expression vector by the calcium phosphate DNA precipitationmethod. The DNA precipitate is left on the cells for 8–16 h followed by amedium change. Cells are washed twice in PBS by centrifugation and resus-pended in fresh PBS. After the last centrifugation, the cell pellet is lysed infive packed cell pellet volumes of lysis buffer (buffer A see earlier) in thepresence of protease inhibitor cocktail (Complete; Roche Molecular Bio-chemicals, Indianapolis, IN), for more than 30 min at 4

�with agitation.

After lysis, cellular debris are cleared by centrifugation at 14,000g for10 min at 4

�, and the supernatant is transferred to a new precooled tube.

The resulting lysates are subjected to immunoprecipitation with ananti-FLAG peptide antiserum. We favor an anti-FLAG antibody alreadyconjugated to agarose beads (anti-FLAG M2 agarose affinity gel; Sigma).Protein concentration is measured in cell lysates with a detergent-compat-ible protein assay kit (DC protein assay kit, Biorad). Anti-FLAG M2 affin-ity gel should be added at 10 �l/ml of lysate and incubated for at least 2 h at4�

with constant agitation. After incubation, immune complexes arepelleted with the agarose beads by centrifugation at 6000g for 5 min at4�. The supernatant should be carefully removed from beads so as to not

disturb the pellet. The immune complexes are washed three times in bufferA for 15 min each at 4

�with agitation. After each wash, the beads are

pelleted and the supernatant is replaced with buffer A. The immune com-plexes are then washed twice for 15 min each in the buffer used for the en-zymatic assay. The beads containing the immunoprecipitated material arenow ready to use in the assay.

Using this protocol, significant histone deacetylase activity is detectedwith SIRT1, 2, 3, and 5 (see Fig. 3) while SIRT2 only shows tubulin deace-tylation activity (see Fig. 3). These experiments suggest that the other SIRTproteins, SIRT4, 6, and 7, might target other substrates for deacetylation orthat other cofactors, proteins or small molecules, are needed for theirenzymatic activity.

Notes. HEK 293T cells do not attach tightly to the plastic of the culturedish and tend to come off during the washes. We therefore favor removingthe cells from the plate by pipetting and transfer into a conical tube.

Fig. 3. Measurement of histone and tubulin deacetylase activity associated with human

SIRT proteins. HEK 293T cells were transfected with expression vectors for each of the

human SIRT proteins. One half of the immunoprecipitated material was subjected to HDAC

activity assay with a [3H] acetylated histone H4 peptide. The other half of the

immunoprecipitated protein corresponding to each SIRT-FLAG protein was incubated with

total cellular lysate. The reaction products were separated by SDS-PAGE and visualized by

western blotting with antisera specific for acetylated tubulin, tubulin, and FLAG. Adapted

with modifications from North et al.12


This lysis buffer does not give complete nuclear lysis in all cell types andshould be supplemented with sonication if nuclear proteins are to be effi-ciently released into the lysate. Determination if nuclear lysis has occurredcan be monitored by Trypan blue to visualize both cell lysis and thepresence of intact nuclei.

12 B. J. North, B. L. Marshall, M. T. Borra, J. M. Denu, and E. Verdin, Mol. Cell 11, 437 (2003).


Expression in Escherichia coli

In contrast to class I and class II enzymes, class III HDACs can be read-ily purified as enzymatically active protein after overexpression in E. coli.

Plasmid. Full-length human SIRT2 cDNA was cloned into pHEX, amodified version of pGEX-2T (Pharmacia) in which the GST-encoding se-quence was replaced with a hexahistidine-encoding sequence (6xHis). Theresulting protein is an N-tagged 6xHis-SIRT2 fusion protein (see Frye13 fordetails). This vector is transformed in DH5aF0IQ bacteria (Gibco) forexpression.

Buffers

1. Buffer G: 50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 10 mM imidazole.2. Buffer H: 50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 20 mM imidazole.3. Buffer I: 50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 250 mM

imidazole.4. Buffer J: 50 mM Tris–HCl, pH 8.0, 0.2 mM DTT, 10% glycerol,

50 mM NaCl.5. Buffer K: 50 mM Tris–HCl, pH 8.0, 0.2 mM DTT, 10% glycerol.6. Buffer L: 50 mM Tris–HCl, pH 8.0, 265 mM NaCl, 0.2 mM DTT,

10% glycerol.

Procedure

1. One liter of transformed bacterial culture is grown in LB-Amp to anoptical density of 0.6 (A600), induced with 0.1 mM IPTG at 37

�for

2 h, and pelleted.2. The pellet is resuspended in buffer G (2 ml/g wet weight) and

incubated on ice for 30 min in the presence of 1 mg/ml lysozyme.This mixture is sonicated on ice (four 10–15 s bursts at 40–60%power) and centrifuged at 4

�at 14,000g for 30 min.

3. Supernatant (cleared lysate) is bound to Ni-NTA resin (1 ml of 50%Ni-NTA slurry for 4 ml of cleared lysate, batch method, Qiagen) ona rotary mixer at 4

�for 60 min.

4. The batch mixture is passed through a commercial column(Polyprep, BioRad), and the flow-through is saved. The resin bedis washed twice with 4 ml of buffer H.

5. Bound proteins are eluted four times with 0.5 ml of elution buffer(buffer I). SDS-PAGE analysis revealed that the second elutingfraction contains a majority of recombinant protein along withcontaminating proteins.

13 R. A. Frye, Biochem. Biophys. Res. Commun. 260, 273 (1999).


6. Ion-exchange chromatography is used to further purify the recom-binant protein. The peak eluted fraction is shifted to ion exchangebuffer (buffer J) with a HiPrep26/10 desalting column (Pharmacia,2.0 ml/min flow rate, 1.0 ml fractions).

7. The peak fractions (as determined by UV monitoring or SDS-PAGE) are pooled (5–7, 1 ml fractions) and loaded on a SepharoseQ column and washed with buffer A.

8. Recombinant SIRT2 is eluted with a linear gradient of 50–1000 mMNaCl in buffer K. Under these conditions, SIRT2 elutes at �265 mMNaCl.

9. Peak fractions are pooled and concentrated using centrifuge concen-trating spin columns (Centricon, MWCO 30 KD). Recombinantprotein is aliquoted and stored at �20

�in buffer.

Notes

1. This protocol yields a recombinant SIRT2 protein with highenzymatic activity and >90% purity as determined by SDS-PAGE.

2. Using a linear gradient of imidazole (20–500 mM) for elution ofSIRT2 bound to the Ni-NTA resin has yielded a significantly purerrecombinant preparation (J. Denu, personal communication).

3. The above protocol has also been used in our laboratory to purify anN-terminally truncated form of SIRT3 with high enzymatic activity(B. Marshall, B. Schwer, and E. Verdin, unpublished observations).

4. Recombinant purified SIRT1 enzyme can be obtained using asimilar protocol and is commercially available (BIOMOL, PlymouthMeeting, PA).

5. Examples of enzymatic reactions performed with SIRT2 proteinsexpressed in E. coli are shown later (see Fig. 4). The activity of theprotein purified from E. coli is compared to that of the proteinexpressed in mammalian cells and its inhibition by nicotinamide andpH dependency are illustrated.

Enzymatic Substrates

A large variety of substrates and assay systems have been used to detectthe deacetylase activity of classes I, II, and III enzymes. A recent methoduses purified histone acetyltransferase to acetylate isolated nucleosomesin vitro with high specific activity.14 This method offers the very significantadvantage of a physiologically relevant substrate (chromatin) and shouldprove useful for examining the activity of HDACs on their natural sub-strates. A variety of novel nonradioactive assays, based on fluorescent

14 P. A. Wade, P. L. Jones, D. Vermaak, and A. P. Wolffe, Methods Enzymol. 304, 715 (1999).

Fig. 4. Measurement of HDAC activity associated with SIRT2 expressed in E. coli and in

mammalian cells. (A) The enzymatic activity of recombinant 6 � His-SIRT2 on a [3H]

acetylated histone H4 peptide was measured in the presence of increasing concentrations of

NAD (0, 0.001, 0.01, 0.1, 1.0, and 10 mM). Released acetate was extracted and measured by

scintillation counting. (B) The enzymatic activity of immunoprecipitated protein from mock–

or SIRT2-FLAG–transfected 293T cells on a [3H] acetylated histone H4 peptide was

measured in the presence of increasing concentrations of NAD (1 mM for mock and 0, 0.001,

0.01, 0.1, 1.0, and 10 mM for SIRT2-FLAG). Ten percent of immunoprecipitated input into

the enzymatic reaction was analyzed by SDS-PAGE and by Western blotting with an

antiserum specific for the FLAG peptide. (C) The activity of 6 � His-SIRT2 on a [3H]

acetylated histone H4 peptide was measured in a range of pH (6–9) in the presence of 1 mM

NAD. (D) Immunoprecipitations and reactions similar to those described in (B) of SIRT2-

FLAG 1 mM NAD were tested in the presence of increasing concentrations of

nicotinamide (0, 0.1, 0.3, 0.6, 1.2, 2.5, 5, 10, and 20 mM).


oligopeptides15,16 or on an acetylated lysine derivative17,18 have been de-veloped recently. Since an extensive description of these substrates isbeyond the scope of this review, we describe a sensitive assay using a peptidecorresponding to the N-terminal extremity of histone H4 acetylated in vitro.

15 K. Hoffmann, R. M. Soll, A. G. Beck-Sickinger, and M. Jung, Bioconjug. Chem. 12, 51 (2001).16 D. Wegener, F. Wirsching, D. Riester, and A. Schwienhorst, Chem. Biol. 10, 61 (2003).17 B. Heltweg and M. Jung, Anal. Biochem. 302, 175 (2002).18 B. Heltweg and M. Jung, Arch. Pharm. (Weinheim) 335, 296 (2002).


Peracetylation of Histone Peptides using [3H] Acetate

Synthetic peptides corresponding to the amino-terminal tails of eitherhistone H3 (amino acids 1–24: ARTKQTARKSTGGKAPRKQLATKA)or histone H4 (amino acids 1–24: SGRGKGGKGLGKGGAKRHRKVLRD) can be chemically acetylated in vitro using the protocol below. Theadvantages of this technique are the large amount of substrate obtainedand its high specific activity. However, the peracetylation reaction leadsto the modification of nonlysine residues in the peptide and requires themanipulation of volatile radioactive material and an HPLC purificationstep (modified from Taunton et al.).19

Procedure

1. Lyophilize 200 �g of peptide (stored at 2 mg/ml in water).2. Resuspend peptide in 250 ml of [3H] acetic acid (NEN NET003H,

10 Ci/mmol, 50 mCi/ml in ethanol) in a 5-ml scintillation vial using asmall magnetic bar.

3. Add 5 ml of BOP (Aldrich #22,608-4, 0.24 M, 0.12 mmol) andtriethylamine (0.2 M, 2 mmol) in acetonitrile (this solution shouldbe freshly prepared) and stored overnight at room temperature.

4. Dry under vacuum (Speedvac, no heat, do not over dry).5. Dissolve residue in 500 ml 10% MetOH/H2O, 0.1% trifluoroacetic

acid.6. Separate peracetylated peptide from free acetate by HPLC on a

reverse-flow column (RPC18 column, flow rate 1 ml/min, gradientfrom 0 to 40% acetonitrile, 0.1% trifluoroacetic acid in 40 min,Vydac #218TP54). Several acetylated forms of the peptide aredetected, with the largest peak corresponding to pentaacetylated H4peptide.

7. Peak fractions from different HPLC runs are combined andcounted. We generally obtain from 2 � 108 to 4 � 108 cpm ofacetylated peptide per reaction. The purified peptide is furthercharacterized by analytical SDS-PAGE (20% Tris/Tricine).

8. Test radiolabeled peptide in HDAC assay. We typically engagefrom 2 � 105 to 10 � 105 counts/min cpm per enzymatic reaction. Abackground of �200 cpm or lower is expected.

9. The peptide is stored in small aliquots at �70�. A progressive

increase in background counts is observed over time duringextended storage (>3 months).

19 J. Taunton, C. A. Hassig, and S. L. Schreiber, Science 272, 408 (1996).


Enzymatic Assays

Class I and Class II HDACs

Complexes immobilized on beads from immunoprecipitations are incu-bated in 100 �l of HDAC buffer (10 mM Tris–HCl, pH 8.0, 10 mM NaCl,and 10% glycerol) containing 100,000 cpm of 3H-histone H4 peptide sub-strate for 2 h at 37

�with agitation. Reactions are stopped by adding 25 �l

of 100 mM HCl and 160 mM acetic acid. Released acetate is extracted in500 �l of ethyl acetate by vortexing for 15 s. After centrifugation at14,000g for 5 min, 400 �l of the ethyl acetate fraction is mixed with 5 mlof scintillation fluid and counted.

Class III HDACs

Immunoprecipitated material and recombinant SIRT2 are resuspendedin 100 �l of SIRT2 deacetylase buffer containing NAD (Sigma) and100,000 cpm of 3H-histone H4 peptide substrate. Nicotinamide (resus-pended in water, Sigma) is added to reactions at the indicated concentration.Reactions containing inhibitors are preincubated with all componentsof the reaction in the absence of NAD for 10 min at room temperature.The enzymatic reactions are started by adding NAD. Reactions are incu-bated for 2 h at room temperature with agitation and stopped by adding25 �l of 100 mM HCl and 160 mM acetic acid. Released acetate isextracted in 500 �l of ethyl acetate by vortexing for 15 s. After centrifuga-tion at 14,000g for 5 min, 400 �l of the ethyl acetate fraction is mixed with5 ml of scintillation fluid and counted.

Notes. The product of the enzymatic reaction catalyzed by class IIIHDAC is not acetate but acetylADPribose.20 It is therefore not entirelyclear why the acetate release assay described earlier functions with theseenzymes. It is possible that free acetate is released from acetylADPriboseunder these acidic experimental conditions.

Acknowledgments

We thank Sarah Sande for help with the preparation of this manuscript, John Carroll and

Jack Hull for graphics, Stephen Ordway and Gary Howard for editorial assistance. W.F. is a

Robert Black fellow of the Damon Runyon Cancer Research Foundation. We apologize to

colleagues whose work could not be cited due to space constraints. Our research is supported

by the NIH and the J. David Gladstone Institutes.

20 K. G. Tanner, J. Landry, R. Sternglanz, and J. M. Denu, Proc. Natl. Acad. Sci. USA 97,

14178 (2000).

[methods in enzymology] chromatin and chromatin remodeling enzymes, part c volume 377 || measurement...

Documents