Page 1 of 21

Supplementary Information for

Astrocytic water channel aquaporin-4 modulates brain plasticity in both mice and humans: a potential gliogenetic mechanism underlying language-associated learning

Junsung Woo*, Jieun E. Kim*, Jooyeon J. Im*, Jaekwang Lee, Hyeonseok S. Jeong, Seahyung Park, Soon-Young Jung, Heeyoung An, Sujung Yoon, Soo Mee Lim, Sunho Lee, Jiyoung Ma, Emily Yunha Shin, Young-Eun Han, Binna Kim, Eun Hee Lee, Linqing Feng, Heejung Chun, Bo-Eun Yoon, Ilhyang Kang, Stephen R. Dager, In Kyoon Lyoo† and C. Justin Lee†

* These authors contributed equally to this work.†To whom correspondence should be addressed:

C. Justin Lee, PhDCenter for Glia-Neuron Interaction, KIST39-1 Hawolgokdong, Seongbukgu, Seoul, Republic of KoreaTel: +82-2-958-6940, Fax: +82-2-958-7219, E-mail: cjl@kist.re.kr

In Kyoon Lyoo, MD, PhD, MMS Ewha Brain InstituteDepartment of Brain and Cognitive Sciences, Ewha W. University52 Ewhayeodae-gil, Seodaemun-gu, Seoul, Republic of KoreaTel: +82-2-3277-6550, Fax: +82-2-3277-6562, E-mail: inkylyoo@ewha.ac.kr

This file includes:Supplementary Materials and MethodsReferences for the Supplementary InformationSupplementary Tables 1 to 4Supplementary Figures 1 to 9

Page 2 of 21

SUPPLEMENTARY MATERIALS AND METHODS

IN VITRO ASSAY

Luciferase assay

1027bp human AQP4 promoter region was PCR amplified by using primers sense: 5'-

GGGCCATACATGCACGAGTGATG-3', antisense: 5'-GCCTTCCCCAGCCAGAGTGCAG-3’

from one of the volunteer DNA samples containing the C/C SNP variation at rs162008 and

cloned into pGEM-T vector. To make the Promoter (Aqp-4C) construct, 582bp region as

previously described 7 was PCR amplified from this cloned 1027bp promoter region by using

primers sense: 5'-TTTGCTAGCAGCACCCTAGAGCAGTCTTTTTTC-3', antisense: 5'-

GGGCTCGAGTTCCCCAGCCAGAGTGCAG-3' and subcloned into pGL3 basic vector

containing firefly luciferase. The Promoter (Aqp-4T) construct containing T variant at rs162008

was made from the Promoter (Aqp-4C) construct by using EZchange site-directed mutagenesis

kit (Enzynomics, Daejon, Republic of Korea) according to the manufacturer's protocol.

The 5'-UTR (Aqp-4C) construct under the control of CMV promoter was made as

follows: 155bp human AQP4 5'-UTR region was PCR amplified from the Promoter (Aqp-4C)

construct containing C variant at rs162008 by using primers sense: 5'-

TTTCTCGAGAAGTTCAAATATAACTTAGCGATTGC-3', antisense: 5'-

CTTTATGTTTTTGGCGTCTTCCATGCCTTCCCCAGCCAGAGTGCAG -3'. Firefly luciferase

was PCR amplified from pGL3 basic vector by using primers sense: 5'-

CTGCACTCTGGCTGGGGAAGGCATGGAAGACGCCAAAAACAT-3', antisense: 5'-

TTTAAGCTTTTACACGGCGATCTTTCCGCC-3'. 155bp 5'-UTR and firefly luciferase fragments

were fused by PCR amplifying using primers sense: 5'-

TTTCTCGAGAAGTTCAAATATAACTTAGCGATTGC-3', antisense: 5'-

TTTAAGCTTTTACACGGCGATCTTTCCGCC-3’ and cloned into pcDNA3.1(-) vector containing

CMV promoter. The 5'-UTR (Aqp-4T) construct containing T variant at rs162008 was made from

Page 3 of 21

the 5'-UTR (Aqp-4C) containing the C variant by using EZchange site-directed mutagenesis kit

(Enzynomics) according to the manufacturer protocol. The control vector for 5'-UTR construct

was made by deleting the 5'-UTR sequence from 5'-UTR (Aqp-4C) construct by using primers

sense: 5'-ATGGAAGACGCCAAAAACATAAAG-3', antisense: 5'-

CTCGAGTCTAGAGGGCCCGTTTAAAC-3' and EZchange site–directed mutagenesis kit.

Each 900ng of human AQP4 promoter constructs was co-transfected with 100ng of

renilla luciferase construct per well into 12-well plates of HEK293T cells using effectene

transfection reagent (Qiagen, Hilden, Germany). In the case of C/T, 450 ng of each construct

was used for transfection. After 36 hours, the luciferase assay was performed using a

dual/Luciferase reporter assay system (Promega, Madison, WI, USA) and, in accordance with

the manufacturer's protocol, using a Multifunctional Microplate Reader (Tecan, Durham, NC,

USA). Relative luciferase activity was calculated by dividing firefly luciferase activity by renilla

luciferase activity. For the 5'-UTR firefly luciferase construct, 100ng of the construct together

with 100 ng of renilla luciferase construct were co-transfected into HEK293T cells. At 12h post-

transfection, the luciferase assay was performed as described.1

IN VIVO HUMAN BRAIN IMAGING

Brain imaging parameters

Three-dimensional T1-weighted images from each participant were acquired, with the

acquisition repeated to insure optimal image quality, using the following parameters: repetition

time (TR)=7.4ms, echo time (TE)=3.4ms, flip angle (FA)=8°, field of view (FOV)=220 X 220mm,

matrix=256, voxel size=0.86 X 0.86 X 1.00mm, slices=180, no gap. T2-weighted images

(TR=3000ms, TE=90ms; FA=90°, FOV=220 X 201mm, matrix=240, voxel size=0.92 X 0.92 X

2.50mm, slices=60, no gap) and fluid-attenuated inversion recovery (FLAIR) images

Page 4 of 21

(TR=8000ms, TE=332ms, FA=90°, FOV=250 X 250mm, matrix=576, voxel size=0.44 X 0.44 X

0.6mm, slices=280, no gap) were obtained and evaluated by an experienced neuroradiologist

(S.M.L.) to rule-out incidental findings.

Sensitivity analyses for study 1 (n=650)

A series of sensitivity analyses were performed to confirm the robustness of the findings (Figure

S2a-e). To adjust for the potential confounding effects of participants' intracranial volume (ICV)

and affective/mood states on gray matter (GM) volume variation, ICV (b), the 17-item Hamilton

Depression Rating Scale (HDRS) total score (c), and the Korean Edition of Profile of Mood

States total score (K-POMS)(d) were added to the main model as an additional covariate. As

language function is differentially lateralized according to handedness, we repeated analyses

with additional adjustment for handedness score from the Edinburgh Handedness Inventory (e).

To correct for multiple comparisons, three different thresholds of 0.05, 0.025, and 0.01 were

applied for cluster definition (Figure S5).2

Sensitivity analyses for study 2 (n=45)

Covariates used for the cross-sectional MRI study were entered into the sensitivity analyses

(Figure S4a-f), including ICV (c), HDRS score (d), K-POMS score (e), and handedness score

(f), respectively. Additional sensitivity analyses were also conducted, as detailed (Figure S4g-l).

In brief, although all subjects were native-Korean speakers, varying levels of baseline English

proficiency may have confounded word learning-associated brain changes. For this reason, we

repeated analyses, factoring in the Graduate Record Exam (GRE®) verbal reasoning score at

baseline (g). To control for possible intra-scanner variation, the predictor variable of total study

time was replaced with pre-post scanning sessions (pre-study scan coded as 0 and post-study

scan coded as 1 and treated as a factor variable)(h). The control group participants were

Page 5 of 21

included in the linear mixed-effects model that evaluated for significant interaction between

group and pre-post scanning session on a voxel by voxel basis (i). Statistics were estimated

from 1,000 bootstrapped samples using the clustered (j) and standard bootstrapping methods

(k).3 We also repeated analyses after excluding APOE4 allele carriers (n=6)(l).

MECHANISMS UNDERLYING THE AQP4-MODULATED BRAIN VOLUMETRIC PLASTICITY

Slice preparation and electrophysiology

Transverse slices containing hippocampus were sliced with 300 µm thickness using D.S.K

LinearSlicer pro7 (Dosaka EM Co. Ltd, Japan). Slices were left to recover for at least 1h before

recording in oxygenated (95% O2 and 5% CO2) artificial cerebrospinal fluid (ACSF) containing

(in mM) 130 NaCl, 24 NaHCO3, 3.5 KCl, 1.25 NaH2PO4, 1 CaCl2, 3 MgCl2 and 10 glucose (pH

7.4) at room temperature. Preparation ACSF was replaced with normal solution (1.5 CaCl2, and

1.5 MgCl2 containing ACSF) when recording was performed.

Field potentials in the CA1 stratum radiatum evoked by Schaffer-collateral stimulation

were measured as described,4,5 and responses were quantified in terms of field potential

amplitude measurements. Recordings were performed using a Multiclamp 700B amplifier

(Molecular Devices). Data were acquired and analyzed with pClamp 10.2. Recording electrodes

(4-8MΩ) were filled with NaCl (1M).

Whole-cell synaptic recordings of long-term potentiation

Stimulating electrode was placed in Schaffer-collateral fiber to stimulate the CA3-CA1 pathway

at 0.1Hz and a whole cell patch clamp was made in CA1 pyramidal neurons to record evoked

EPSCs. LTP was induced by TBS (10 trains of 4 half-maximal stimuli at 100Hz within 200ms

interval) while clamping the cell at 0mV, after recording a stable 5-min baseline. Before making

a whole cell, at giga seal configuration, a test pulse (0.1Hz) was delivered for about 10 min to

Page 6 of 21

warm up the fiber in order to avoid run-up effects. At this stage, stimulation intensity was

adjusted to 150-200% of threshold (inducing an action potential). After making a whole cell

configuration, LTP protocols was delivered within 10min to avoid any 'wash out' effect by the

internal solution. Evoked EPSCs (eEPSCs) were collected every 10s with a holding potential of

-60 mV and recorded using glass pipette electrodes (6–8MΩ), filled with an intracellular solution

containing (in mM): 135 CeMeSO4, 8 NaCl, 10 HEPES, 0.25 EGTA, 1 Mg-ATP, 0.25 Na-GTP

(pH 7.2 was adjusted with NaOH, OSM was 290). All collected eEPSCs were normalized to the

average of the baseline.

Passive avoidance test

Mice (8-10 weeks old) were placed into the light compartment and allowed to explore for 60s.

The door was then raised and the mice were allowed to explore freely. The latency to enter the

dark compartment with all four paws was recorded. On day 2, the latency to enter the dark

compartment was similarly recorded. A "training" foot shock (0.5mA, 2s duration) was then

delivered 3s after the door was closed. Mice were removed to their home cage 30s after the foot

shock. On the same test day (2h after training), mice were returned to the light compartment.

After 5s, the door was lifted and latency to enter the dark compartment was recorded.

Immunohistochemistry and analysis

B6 adult mice were deeply anesthetized with 2% avertin (20μl/g) and perfused with 0.1M PBS at

room temperature followed by ice-cold 4% paraformaldehyde. Brains were post-fixed in 4%

paraformaldehyde at 4°C for 24h and in 30% sucrose at 4°C for 48h. Coronal cryosections of

brains (30μm in thickness) were then cut. Sections were blocked in 0.1M PBS containing 0.3%

Triton X-100 (Sigma) and a 4% donkey or goat serum mixture, the same species as the

secondary antibody, for 1h. Primary antibody was then applied at the appropriate dilution

Page 7 of 21

(chicken anti-GFP [Millipore; AB16901; 1:500], chicken anti-GFAP [Millipore; AB5541; 1:500],

rabbit anti-AQP4 [Millipore; AB3594; 1:200]) and incubated overnight at 4°C. After overnight

incubation, the sections were washed three times in PBS and then incubated in secondary

(Alexa 488 donkey anti-rabbit IgG, Jackson Immunoresearch; 1:200), Alexa 647 donkey anti-

chicken IgG (Jackson Immunoresearch; 1:200) for 2hrs and counterstained with 4',6'-diamidino-

2-phenylindole (DAPI). After three rinses in PBS, the sections were mounted onto glass slides.

The intensity of GFAP immunoreactivity was measured using picture elements (pixels),

which give a measure of the optical density obtained from region of interest squares. Obvious

blood vessels and other artifacts were avoided. Five images were analyzed per stratum of the

hippocampi from 2 animals. Astrocytes within that region of interest used for estimating the

number of astrocytes were the same astrocytes analyzed, taking care to avoid those which were

superimposed upon other astrocytes or blood vessels. Images were acquired by a Nikon A1

confocal microscope and analyzed using ImageJ software. Measurements of the ramification

index and summation of intersect were analyzed by Sholl analysis.6,7

Statistical analysis for in vitro, in vivo/ex vivo animal studies

No statistical methods were used to pre-determine sample sizes but our sample sizes are

similar to or larger than those generally employed in the fields. Collation of data was not

randomized and was not done blindly, but experiments were repeated over a long study period

(>2 years). No animals were excluded from the study. Data are presented as mean ± s.e.m. and

were analyzed and graphed using Prism 7 (GraphPad, San Jose, CA, USA) and SigmaPlot

(Systat Software, San Jose, CA, USA). When two groups were being compared, the

significance of data was assessed by the two-tailed Student’s t-test. For comparison of multiple

groups, one-way or two-way ANOVA was utilized. When there is an interaction between groups,

Bonferroni test was applied for post analysis. In specific cases, one-way ANOVA with

Page 8 of 21

Bonferroni/Tukey test was used to classify the homogenous subsets. In general, data

distribution was assumed to be normal, but this was not formally tested.

Page 9 of 21

REFERENCES for the Supplementary Information

1. Umenishi F, Verkman AS. Isolation and functional analysis of alternative promoters in the

human aquaporin-4 water channel gene. Genomics 1998; 50: 373-377.

2. AFNI program. 3dClustSim.

https://afni.nimh.nih.gov/pub/dist/doc/program_help/3dClustSim.html, Accessed 4 Jan

2017.

3. Davison AC, Hinkley DV. Bootstrap Methods and Their Application. Cambridge

University Press: Cambridge, UK, 1997.

4. Andrew RD, Labron MW, Boehnke SE, Carnduff L, Kirov SA. Physiological evidence that

pyramidal neurons lack functional water channels. Cereb Cortex 2007; 17: 787-802.

5. MacVicar BA, Hochman D. Imaging of synaptically evoked intrinsic optical signals in

hippocampal slices. J Neurosci 1991; 11: 1458-1469.

6. Dall'Oglio A, Gehlen G, Achaval M, Rasia-Filho AA. Dendritic branching features of

Golgi-impregnated neurons from the "ventral" medial amygdala subnuclei of adult male

and female rats. Neurosci Lett 2008; 439: 287-292.

7. Sholl DA. Dendritic organization in the neurons of the visual and motor cortices of the

cat. J Anat 1953; 87: 387-406.

8. Choe AY, Hwang ST, Kim JH, Park KB, Chey J, Hong SH. Validity of the K-WAIS-IV

Short Forms. Kor J Clin Psychol 2014; 33: 413-428.

9. FreeSurfer Program. http://surfer.nmr.mgh.harvard.edu/. Accessed 6 Jan 2015.

Page 10 of 21

SUPPLEMENTARY TABLES & FIGURES

Table S1. Characteristics of participants included in neuroimaging-genetics data (n=650) used for in vivo human evaluation of the functionality of an AQP4 single nucleotide polymorphism rs162008

rs162008 CC (n=236) rs162008 CT/TT (n=414)

Age, years Mean (s.e.m.) 33.1 (0.8) 32.7 (0.6)

Sex Male/female, No. 152/84 264/150

Handedness * Right/both/left, No. 217/13/6 367/32/15

Intelligence quotient † Mean (s.e.m.) 113.3 (0.7) 114.3 (0.5)

Years of education Mean (s.e.m.) 15.1 (0.1) 15.2 (0.1)

Intracranial volume (cm3) § Mean (s.e.m.) 1299.5 (13.2) 1310.5 (9.7)

Semantic verbal fluency, total score ¶ Mean (s.e.m.) 39.4 (0.6) 40.1 (0.5)

Phonemic verbal fluency, total score ¶ Mean (s.e.m.) 44.0 (0.8) 45.3 (0.6)

* Handedness was determined using the Edinburgh Handedness Inventory.† Intelligence quotient was assessed using the Korean version of the abbreviated Wechsler Adult Intelligence Scale.8

§ Intracranial volume was estimated using FreeSurfer 5.3.0.9

¶ Semantic and phonemic verbal fluency performance level was measured using the total number of words produced for each subtest of the Controlled Oral Word Association Test. This test was not administered to 156 participants.

Page 11 of 21

Table S2. Characteristics of participants (n=45) included in the prospective study with intensive learning protocol

rs162008 CC (n=14) rs162008 CT/TT (n=31)

Age, years Mean (s.e.m.) 23.4 (0.6) 24.9 (0.6)

Sex Male/female, No. 8/6 18/13

Handedness* Right/both/left, No. 12/0/2 26/2/3

Intelligence quotient † Mean (s.e.m.) 121.1 (2.7) 121.8 (1.7)

Years of education Mean (s.e.m.) 15.3 (0.3) 15.8 (0.3)

Intracranial volume (cm3) § Mean (s.e.m.) 1119.6 (32.6) 1105.3 (23.0)

Total study time (min) ¶ Mean (s.e.m.) 5364.6 (345.5) 4843.7 (286.5)Total intrusion errors in the California Verbal Learning Test Mean (s.e.m.) 2.8 (0.4) 1.8 (0.4)

* Handedness was determined using the Edinburgh Handedness Inventory.† Intelligence quotient was assessed using the Korean version of the Wechsler Adult Intelligence Scale.§ Intracranial volume was estimated using FreeSurfer 5.3.0.9

¶ Total study time was calculated as the sum of time spent in lectures and self-reported study-alone time. We used the video-recording data to confirm the accuracy of total study time.

There were no differences between the C/C genotype and the C/T or T/T genotype groups, in age (t=1.54, p=0.13), sex (Fisher's exact p=1.00), handedness (Fisher's exact p=1.00), intelligence quotient (t=0.21, p=0.84), years of education (t=1.08, p=0.29), intracranial volume (t=-0.35, p=0.73), total study time (t=-1.07, p=0.29), and total intrusion errors in the California Verbal Learning Test (t=-1.55, p=0.13) as assessed by Student's t-test and Fisher's exact test for continuous and categorical variables, respectively. All participants were psychotropic medication-free.

Page 12 of 21

Table S3. Information of multiple comparison-corrected clusters of gray matter volume differences between individuals with the CC genotype (n=236) and those with the CT or TT genotypes (n=414).

Clusters* Volume Included brain regions† %

8,928mm3 Left

Central opercular cortex 40.0Postcentral gyrus 19.2Insular cortex 19.5Precentral gyrus 16.6Heschl's gyrus 2.3Superior temporal gyrus, anterior division 1.0Superior temporal gyrus, posterior division 0.7

13,112mm3 Right

Central opercular cortex 23.7Postcentral gyrus 22.3Precentral gyrus 14.0Supramarginal gyrus, anterior division 12.6Insular cortex 9.6Planum temporale 4.7Angular gyrus 4.7Supramarginal gyrus, posterior division 2.4Heschl's gyrus 2.4Parietal operculum cortex 2.2Planum polare 0.9Superior temporal gyrus, posterior division 0.5

9,552 mm3

Left Precuneus cortex 45.7

Right

Lateral occipital cortex, superior division 28.5Cuneal cortex 9.5Precuneus cortex 7.4Occipital pole 7.4

The detailed information on the two gray matter (GM) clusters, representing the brain regions of greater GM volume in individuals with the C/C genotype compared to those C/T or T/T genotypes, are presented after multiple comparison correction (using cluster-forming threshold of p<0.05 and cluster-wise threshold of p<0.05).

* Three-dimensional rendering of the clusters. All images are presented on a three-dimensional Montreal Neurologic Institute (MNI) Nonlinear Atlas Version 200931 (i.e., the left side of the images corresponding to the right side of the brain). † Brain regions were identified based on the Harvard-Oxford Cortical Structural Atlas. Regions of the atlas occupying more than 5 voxels are presented.

Page 13 of 21

Table S4. Information of multiple comparison-corrected clusters of gray matter volume changes after intensive learning between individuals with the CC genotype (n=14) and those with the CT or TT genotypes (n=31).

Clusters* Volume Included brain regions† %

Increased region, at false discovery rate-corrected q<0.05 and cluster extent threshold >100 voxels

1,160 mm3 Left

Inferior temporal gyrus, temporo-occipital part 80.7

Temporal occipital fusiform cortex 13.8

Inferior temporal gyrus, posterior division 5.5

1,168 mm3 Left

Inferior temporal gyrus, posterior division 43.2

Inferior temporal gyrus, anterior division 32.2

Temporal fusiform cortex, posterior division 14.4

Temporal pole 6.8

Decreased region, at false discovery rate-corrected q<0.05 and cluster extent threshold >100 voxels

808 mm3 Right

Planum polare 68.3

Insular cortex 18.8

Superior temporal gyrus, anterior division 9.9

The detailed information on the three gray matter (GM) clusters, representing the brain regions of significantly different GM volume changes in individuals with the CC genotype compared to those CT or TT genotypes, are presented after false discovery rate correction.* Three-dimensional rendering of the clusters. All images are presented on a three-dimensional Montreal Neurologic Institute (MNI) Nonlinear Atlas Version 200931 (i.e., the left side of the images corresponding to the right side of the brain). † Brain regions were identified based on the Harvard-Oxford Cortical Structural Atlas. Regions of the atlas occupying more than 5 voxels are presented.

Page 14 of 21

Figure S1. Summary of overall study design and results. SNP, single nucleotide polymorphism. AQP4, aquaporin-4. KD, knock down. GM, gray matter. LPITC, left posterior inferior temporal cortex. TBS, theta-burst stimulation. LTP, long-term potentiation.

Page 15 of 21

Figure S2. Knockdown efficiency of aquaporin-4 (AQP4) shRNA. (a) Images for HEK293T cells expressing GFP-tagged AQP4 and control shRNA (Ctrl) or AQP4 shRNA candidate (#1, #2) having mCherry as a reporter gene. (b) RT-PCR data in these HEK293T cells. (c) Images for cultured astrocytes expressing control shRNA or AQP4 shRNA. (d) RT-PCR data in these astrocytes. (e) Immunostaining for AQP4 in control and AQP4 shRNA expressing hippocampal sections. Inset: magnified images showing single astrocyte. (f and g)

Page 16 of 21

Quantification of AQP4 intensity in GFAP and shRNA positive pixels from low magnification (x20 objective, f) and high magnification (x60 objective, g) images. *** p < 0.001, Student’s t-test.

a Main analysis results

Z=

b Results from additional adjustment with intracranial volume

c

Results from additional adjustment with depressive symptom levels objectively assessed using the Hamilton Depression Rating Scale-17

dResults from additional adjustment with self-reported depressive symptom levels using the Profile of Mood States

eResults from additional adjustment with handedness score from the Edinburgh Handedness Inventory

Figure S3. Sensitivity analysis results showing the robustness of the correlative effect of the AQP4 genetic variation on gray matter (GM) volume. Volume differences are projected onto the cortical surface. Positive Z values indicate greater GM volume in CC group compared to CT/TT group.

Page 17 of 21

a Image orientation g

Results from additional adjustment with the Graduate Record Exam (GRE®) verbal reasoning section score at baseline

b Main analysis results h

Results when the total study time was replaced with the dichotomous variable for which baseline data were coded 0 and follow-up ones were coded 1

cResults from additional adjustment with intracranial volume

i

Results from repeated analysis including the data from the age- and sex-matched control participants*

d

Results from additional adjustment with depressive symptom levels objectively assessed using the Hamilton Depression Rating Scale-17

jResults when the significance level was determined through clustered bootstrapping

e

Results from additional adjustment with self-reported depressive symptom levels using the Profile of Mood States

kResults when the significance level was determined through standard bootstrapping

f

Results from additional adjustment with handedness score from the Edinburgh Handedness Inventory

lResults after excluding participants with the APOE4 allele

Figure S4. Sensitivity analysis results showing the robustness of the correlative effect of the AQP4 genetic variation on gray matter volume.

Volume differences are projected onto the cortical surface.* Control participants were those who had not undergone the intensive learning sessions but who were scanned twice with a comparable interval in the model (mean interval for control group, 52.5±1.6 days; mean interval for Learners group, 54.9±1.3). This analysis was performed to account for potential intra-scanner variations over time.

Page 18 of 21

Figure S5. (a) Sensitivity analysis results from in vivo human cross-sectional neuroimaging-genetics data (n=650) showing that AQP4 rs162008 C/C homozygotes have greater gray matter (GM) volumes in bilateral regions including the central operculum and the region encompassing the precuneus, than T carriers. In these sensitivity analyses, multiple comparison correction was performed with three different p values of 0.05 (beige), 0.025 (coral pink), and 0.01 (brown) for cluster definition, using 3dClustSim.2 Voxels with adjoining faces or edges were considered as a cluster. P value of 0.05 was used as cluster-wise threshold. With cluster-forming threshold of p<0.05, all three clusters survived Monte Carlo simulation-based correction threshold, while with cluster-forming threshold of p<0.025, only bilateral regions including central opercular cortices did. Only the right central opercular region survived with cluster-forming threshold of p<0.01. There were no regions identified as having greater volumes in individuals with CT/TT genotypes than those with CC genotype. (b-d) GM volumes in these regions were associated with greater semantic verbal fluency [(b) cluster defined at voxel level p value<0.05; β=0.15, p=0.001, (c) cluster defined at voxel level p value<0.025; β=0.14, p=0.002, (d) cluster defined at voxel level p value<0.01; β=0.13, p=0.004]. Regression (solid line) and s.e.m. lines (dotted lines) are shown. Tick marks above the graph denote data points.

Page 19 of 21

Figure S6. Transient volume change is mostly mediated by excitatory synaptic transmission. (a) Schematic diagram. Simultaneous recording of IOS (light transmittance at 755nm) and field EPSP (fEPSP) in stratum radiatum region of the mouse hippocampal slice after stimulating the Schaffer Collateral pathway. Black triangle: stimulation of 20Hz, 1s. (b-d) Representative traces of IOS normalized to peak in the presence of TTX (0.5 μM), Cd2+ (100 μM), and APV (50 μM) plus CNQX (20 μM). Inset: fEPSP trace. Gray-dotted line: baseline. Black triangle: stimulation. (e-g) Summary bar graphs of IOS, fEPSP, and fiber volley normalized to control response. Asterisks indicate significant differences determined by unpaired two-tailed t-tests (***p< 0.001). Data in d-f represent means ± s.e.m. (h and i) Representative traces of IOS normalized to peak in the presence of bicuculline (20 μM) plus CGP55845 (5 μM) and strychnine (1 μM) adding after treatment of APV plus CNQX. (j) Table showing the list of inhibitors and their effects on the amplitude of the IOS. Data value for IOS represent means±s.e.m. (%) after normalization to value in the presence of APV plus CNQX. These results indicate that the remaining component after APV+CNQX is not due to GABAA, GABAB, P2 receptor, EAAT, or glycine receptor. (k) Representative traces of IOS on 4% agarose gel to mimic the brain slice in the presence of glutamate (10 mM) and K+ (5 mM). (l) Summary bar graphs of IOS normalized to peak value of control response from brain slice suggest that the remaining component after APV+CNQX could be due to released glutamate and/or K+ release.

Page 20 of 21

Figure S7. Single astrocyte volume change upon synaptic stimulation. (a) Representative images of astrocytes. (b) Time course of averaged volume change induced by electrical stimulation (triangle, 20 Hz, 1s) in astrocytes. (c) Summary bar graph of volume change (%). Error bars represent s.e.m. (*** p<0.001, Student's t-test).

Figure S8. Dynamic range of transient volume change dependent on AQP4 (a) Experimental design (top). Representative traces of dynamic range of transient IOS from control and AQP4 shRNA after enriched environment (bottom). Intrinsic optical signal (IOS) response was normalized to maximal response. (b) Measurement of IOS amplitude in each condition versus time (* p<0.05, ** p<0.01, *** p<0.001, Student's t-test).

Page 21 of 21

Figure S9. Effect of AQP4 knockdown on the cell viability. (a) TUNEL assay from control and AQP4 shRNA expressing hippocampal sections. In positive control condition, DNase I (300u/ml) was added in control shRNA expressing section. (b and c) Quantification of TUNEL intensity in shRNA positive cells and cells in CA1 pyramidal layer. (d) DAPI positive cell number in each conditions (n=5 in each conditions, Two-way ANOVA test, N.S. indicates non-significant change).