maternal cell contamination (mcc) testing 2014 ecuador_draft

Maternal Cell Contamination (MCC) Testing

Andrea Puppio- Todos los derechos reservados-




Lquido amnitico (luego sem 16)
Vellosidad Corinica (sem 12 a 16)


SANGRE O SALIVA U OTRA MUESTRA DE LA MADRE, SANGRE EN EDTA, TARJETAS FTA, WHATMAN
VELLOSIDAD O LQUIDO AMNITICO O CORDN UMBILICAL


Depende el estudio Si es solo para STR con 15-20 ml. de lquido amnitico en tubo estril BD es suficiente. Si requiere pruebas ms complejas consultar al laboratorio cantidad necesariaSi es solo para STR con 10-20 vellosidades limpias (disgregadas con aguja estril de posible sangre), y llevada a volumen de 15-20 ml de solucin fisiolgica estril es suficiente. Si requiere pruebas ms complejas consultar al laboratorio cantidad necesaria


Depende de cada paciente, y debe firmar un consentimiento informado donde se le informa a la paciente que hasta incluso esta practica puede ocasionarle la prdida del embarazoEn general el riesgo es menor que el de una cesreaEn caso de haber problemas puede suspenderse la practica o esperar una semana o dos mas, por ejemplo en el caso que existan hematomas


Se informa en el consentimiento informado sobre los riesgos y beneficios de la practicaSe le informa que la practica ser realizada por el equipo de obstetricia bajo total control ecogrfico 4DSe solicitan previamente ecografas anteriores, y se solicita mandatoriamente los siguientes estudios serolgicos de Hepatitis B y C, HIV, Toxoplasmosis, VDRL (sifilis), rubeola, y si es necesario otros estudios serolgicos que puedan afectar al embrin. Se solicita tambin grupo y factor de sangre (en ciertos casos se receta aplicacin de globulina)A los 7 das se le realiza una ecografa de control en la zona de la toma de muestra


ES MANDATORIA y no se realiza habitualmente en Amrica Latina


Forenses
No forenses
Violacin IncestoHallazgo de beb vivo o muerto con el cordn umbilical Etc.
Determinar la paternidad de un nio/a, donde hay que saber si hay clulas de la madre mezcladasDeterminar si existe o no contaminacin materna para un estudio con fin diagnostico (cariotipo, estudio molecular, etc.)


Check for Maternal Cell Contamination Presence of the 2nd maternal allele in the fetal sample at all loci seen as a mixture with peaks of varying heights

Compare multiple preps for Identity Testing (Compare 2 DNA preps, compare Amnio to CVS, etc) Zygosity Testing

Demonstrate fetus/Mother relationshipAllele sharing


Amniotic FluidAmniocyte CulturesChorionic VilliCultured chorionic villiPOC (Products of Conception, usually placenta)Externally extracted DNA from any of these sources+ Maternal blood specimen, blood spot, or buccal mucosa


PCR (long final extension fragments up to 450bp)Run products on ABI3500 8-cap or Beckman CEQ8000 for fragment separation and sizingReview data Confirmations for unexpected results Sometimes even contaminated data is usable data!Written genotype analysis submitted to Second Review


Combined DNA Indexing System set of 13 loci with highly variable Short Tandem Repeats, plus gender XY
AmpFlSTR ID Direct also contains:D2S1338D19S433


Forward and reverse primers positioned at known locations

Amplify entire sequence between, including the highly variable short tandem repeats (TETRA-nucleotide rpts, here: TGAA)

Software will calculate the number of repeats based on each amplicons length (here: 6)


This slide shows the 17 loci in the color of the fluorochrome attached to the primers. Each locus has many common alleles, ALL of which are depicted in this artificial mix. A person will have 1 or 2 alleles at each locus. AMEL (in red) is not highly polymorphic but is useful as a gender test (next slide).


AMELX (amp = 105 bp) vs AMELY (amp = 111 bp)

TGGGCTCTGTAAAGATAGTGTGTTGATTCTTTATCCCTGGGCTCTGTAAAGATAGTGGGTGGATTCTTCATCCC

AGAT------GTTTCTCAAGTGGTCCTGATTTTACAGAAATAAAGTGGTTTCTCAAGTGGTCCTGATTTTACAG

TTCCTACCACCAGCTTCCCAGTTTAAGCTCTGATTTCCTACCACCAGCTTCCCAGTTTAAGCTCTGAT
The copy of Amelogenin on X produces amplified DNA of 105 basepairs.The copy of Amelogenin on Y produces amplified DNA of 111 basepairs.


* Contaminated = 15-100% of cells are maternal
Maternal cells decrease in amnio cultures
Maternal cells increase in CVS cultures
Tissue collected after fetal demise or abortion often contains maternal tissue.

Percent of SpecimensAmniotic FluidAmniotic Fluid CulturesCVSCVS CulturesProducts of Conception1.8%0.4%2.2%5.5%20.5%


When HET, peaks approx equal heights

Fetal sample shares 1 allele with Mom at every locus

Fetal sample must differ from Mom for at least 1 locus

No peak in fetal prep at Moms UN-inherited allele
Good Data without MCC D3S1358
Fetus
Mom


Fetus
Heterozygous peaks approx equal height especially important for Amel-X and Amel-Y
Good Data without MCC - AMEL
Mom


Peaks in the fetal prep for ALL Maternal alleles

Easiest to see when both Fetus and Mom are heterozygous Necessary for calculating level of MCC!
Data with MCC D7S820
Fetus
Mom


Fetus
Mom
Peaks in the fetal prep for ALL Maternal alleles

Easiest to see when both Fetus and Mom are heterozygous Necessary for calculating level of MCC!


Data with MCC Which peak is which?
Fetus
Mom
Which peak is the Mixed Peak? Inheritance from Mom PLUS MCC

Which peak is the MCC peak?Moms 2nd Allele

Which peak is Fetus Only?Dads Allele

Well calc the level of MCC later


Cannot quantify MCC when either sample is HOMOZYGOUS

Still visible though, but not informative. Ex: Fetus is HOM and Mom is HET

IMPOSSIBLE to see at loci where Fetus and Mom are both HOMOZYGOUS
Fetus
Mom


Marker must be informative:Fetus heterozygousMom heterozygousDifferent HET
Calculating % MCC D8S1179
MCCarea Fetusarea + MCCarea
x 100 = % MCC


Back to our previous example D16S539

MCC peak will be bigger than the Fetus Only peak when MCC level is 50% or more
Calculating MCC Level (%MCC)
6692 5633 + 6692
x 100
= 54% MCC
Fetus
Mixed
MCC


Uninformative Why???no Fetus Only (Paternal) peak
833 ? + 833
x 100
Calculating MCC Level (%)
= ? %MCC
Mixed
MCC


Trisomies detected (apparent*): 4, 8, 11, 13, 15, 16, 18, 21Some in Mosaic amounts
Serendipitous Findings non-MCC
Fetus
Mom
*Apparent since we target only one locus or gene, not entire chromosomes NOT reportable based solely on MCC results


Serendipitous Findings non-MCC (cont)
Mom
XYY Syndrome (known)
Fetus
Trisomy rescue???Uniparental heterodisomy Gain/Loss of a repeat length???Need Dad to solve... Either way no imprinting of Chr21
Fetus
Mom


We can visually assess for Maternal Cell Contamination by the presence of 2nd maternal alleles (informative)

We can demonstrate Identity between fetal preps

We can determine that it is highly probable that a fetal sample is related to the Maternal sample indicated

We can confirm certain findings from other platforms IF we have an STR on the same chromosome


Case 1: Hydrocephalus detected on sonogram. Sequencing of the X-linked gene L1CAM gene was NEGATIVE on amnio cultures. It was important to make sure the DNA was not the mothers.
Amelogenin
Mother has X

Fetus has X and Y in equal amounts. Fetus is male and has no contamination.
At this locus on Chr 18, Mother = 17, 18.Fetus = 13, 18.No contamination.
D18S51


Case 1: Two other loci shown. Final interpretation was Not Contaminated
D8S1179
D13S317
At this locus on Chr 13, Mother = 8, 10. Fetus = 10, 11. No contamination.
At this locus on Chr 8, Mother = 10, 13.Fetus = 10, 13. Not informative.


Case 2: Test for Noonan Syndrome due to increased nuchal translucency. CVS cultures were submitted.
D7S820
TH01
D8S1179
CSF1PO
All markers showed that the fetal sample was 100% overgrown with maternal cells. The gene sequence for the Noonan Syndrome genes could not be interpreted.


Baby with Junctional EB, died. DNA was saved. Test hotspots in Lamin 5 genes --> no mutationsSequence LAMB3 --> no mutationsSequenced LAMC2 --> no mutationsSequenced LAMA3 --> no mutationsPregnant!Sequenced COL17A1---> 2 different mutations foundCVS ---> Very small sample, uncultured, positive for maternal contamination.
Case 3: Prenatal Diagnosis for Junctional Epidermolyis Bullosa


Case 3: MCC results on the first CVS Sample. C = CVS, M= Mother, F = Father*
All markers show maternal DNA in the fetal specimen. There are 3 peaks, or, one peak is too high.
C
M
F
* Testing of fathers is not necessary and is not done now.


Case 3: Prenatal Diagnosis for Junctional Epidermolyis Bullosa
We did not test the cultures that were available from the first CVS procedure. They would be contaminated also. We requested they perform another CVS procedure and obtain a larger specimen.Repeat CVS --> Larger sample, uncultured, was free of maternal contamination. The COL17A1 result using the 2nd CVS specimen was:Maternal COL17A1 mutation PRESENTPaternal COL17A1 mutation ABSENTThis result is indistinguishable from the maternal genotype but we know that it is the fetuss genotype and he will be an unaffected carrier.


Utilizacin de Identifiler, Powerplex Mnimo de 15 loci + amelogenina




Preguntas [email protected] +5411-4778-1724Skype: andreapuppio


maternal cell contamination (mcc) testing 2014 ecuador_draft

Science