master’s thesis in iology€¦ · diarrea virus (bvdv) and classical swine fever virus (csfv), to...
TRANSCRIPT
U N I V E R S I T Y O F C O P E N H A G E N
D E P A R T M E N T O F B I O L O G Y
Master’s Thesis in Biology
Mira Willkan
RNA Recombination of Hepatitis C Virus in Cell Culture
Supervisors: Jeppe Vinther, Jens Bukh and Troels Scheel
Submitted on: 1st of March 2017
2
RNA Recombination of Hepatitis C Virus in Cell Culture
Master’s Thesis in Biology Mira Willkan
Copenhagen Hepatitis C Program (CO-HEP)
Department of Infectious Diseases and Clinical Research Centre
Copenhagen University Hospital, Hvidovre
Department of Immunology and Microbiology
Faculty of Health and Medical Sciences
University of Copenhagen
Department of Biology
Faculty of Science
University of Copenhagen
Supervisors: Jeppe Vinther, Jens Bukh and Troels Scheel
Submitted: 1st of March 2017
3
Content
ABSTRACT .................................................................................................................................... 6
INTRODUCTION ............................................................................................................................ 7
Hepatitis C Virus (HCV) ............................................................................................................................................... 7
Phylogeny and Quasispecies .......................................................................................................................................... 7
Molecular Biology .......................................................................................................................................................... 8
Cell Culture Systems .................................................................................................................................................... 11
Therapy ........................................................................................................................................................................ 12
RNA Recombination ..................................................................................................................................................14
Copy-choice RNA Recombination ................................................................................................................................ 15
Breakage-rejoining RNA Recombination ...................................................................................................................... 15
Previously Described HCV Recombination ................................................................................................................... 16
Scarcity of HCV Recombination or Detection Difficulties?........................................................................................... 17
Implications of HCV Recombination ............................................................................................................................ 18
AIM OF THIS STUDY ................................................................................................................... 19
METHODS .................................................................................................................................... 20
Huh-7.5 cell culture ...................................................................................................................................................... 20
Virus Strains ................................................................................................................................................................. 20
In Vitro Transcription ................................................................................................................................................... 20
Transfection ................................................................................................................................................................. 20
Immunostaining ........................................................................................................................................................... 20
Infectivity Titers ........................................................................................................................................................... 20
Cloning of pJ6/JFH1-m15-J4NS5A ................................................................................................................................ 21
Characterization of J6CF and JFH1∆E1E2 Cell Culture Recombinants ......................................................................... 21
psiCHECK-2 Vector and Dual-glo Luciferase Assay System .......................................................................................... 22
Double Infection Flow Cytometry Analysis .................................................................................................................. 22
EGFP Deletion Assessment .......................................................................................................................................... 23
4
Cell Culture Treatment with Daclatasvir and/or Miravirsen ........................................................................................ 23
5’ Rapid Amplification of cDNA .................................................................................................................................... 23
TOPO TA Cloning .......................................................................................................................................................... 23
HSPC117 siRNA Knock-Down and Western Blot .......................................................................................................... 23
RESULTS ..................................................................................................................................... 26
Observation of HCV RNA Recombination in Cell Culture ............................................................................................26
Preparations for Setting up a Recombination Treatment Escape Assay .....................................................................30
Selection of Virus Strains ............................................................................................................................................. 31
Comparison of Double Transfection Versus Infection ................................................................................................. 33
Daclatasvir Treatment Pilots ........................................................................................................................................ 36
Miravirsen Influence on Available Intracellular miR-122 ............................................................................................. 37
Establishment of Therapeutic Treatment Doses of Miravirsen ................................................................................... 39
Daclatasvir-miravirsen Double Treatment of J6-18 and m15-J4NS5A Transfected Cultures .......................................42
Miravirsen-resistant Virus Strains ..............................................................................................................................45
siRNA knock-down of HSPC117 - Initiation of Mechanistic Studies of HCV RNA Recombination ................................48
DISCUSSION ............................................................................................................................... 49
Recombination of the Non-viable Genomes J6CF and JFH1∆E1E2 ..............................................................................49
Primarily Heterologous Recombinants Were Observed .............................................................................................. 49
Genomic Position of the Recombination Junction ....................................................................................................... 50
Special Features of Recombinants ............................................................................................................................... 51
Attempts to Observe Recombination Between Resistant Viral Strains in Cell Culture ...............................................51
Choice of Viral Strains .................................................................................................................................................. 51
No Recombinants Observed ........................................................................................................................................ 52
The m15-J4NS5A Strain was Attenuated ..................................................................................................................... 52
Alternative Inhibitors ................................................................................................................................................... 52
Optimizing the Number of Double-positive Cells in Culture .......................................................................................53
Treatment in Cell Culture ...........................................................................................................................................53
Daclatasvir .................................................................................................................................................................... 54
5
Miravirsen .................................................................................................................................................................... 54
Mechanistic Studies of HCV RNA Recombination.......................................................................................................55
Broader Implications of RNA Recombination .............................................................................................................55
Breakage-rejoining RNA Recombination of Cellular RNAs ........................................................................................... 55
CONCLUSION .............................................................................................................................. 57
ACKNOWLEDGEMENTS ............................................................................................................. 58
ABBREVIATIONS ........................................................................................................................ 59
REFERENCES ............................................................................................................................. 60
6
Abstract
Hepatitis C virus (HCV) is a blood-borne, liver tropic positive single stranded RNA virus. 70-80% of the 3-4
million yearly infections become chronic leading to increased risk of liver cirrhosis and liver cancer, and 2-
3% of the total world population are estimated to be chronically infected. There is no prophylactic vaccine
against HCV, but the virus can be treated with a combination of direct-acting antivirals (DAAs). However,
resistance mutations towards specific DAA are known to occur.
RNA recombination is a mechanism, by which two independent RNA molecules are combined to make up a
new molecule partially derived from each of the parental molecules. Recombinant forms have been
observed for a number of viruses, including HCV, constituting an evolutionary shortcut.
In this study, cell culture co-transfection with the non-viable J6CF and JFH1∆E1E2 genomes demonstrated
hepatitis C virus RNA recombination. In total, five different recombinant viruses were characterized and
four of these were heterologous recombinants, whereas one was homologous. Three recombinants with
low fitness co-infected a single culture for several weeks. Except for one of the highly attenuated
recombinants, the position of the recombination junction ensured a monophyletic NS3-NS5B region.
Next, RNA recombination was investigated as a potential escape mechanism from combination therapy
putatively combining variants with escape mutations to individual inhibitors. The recombinant virus strains
J6-18 and m15-J4NS5A were selected due to reciprocal resistance to the NS5A and miR-122 inhibitors,
daclatasvir and miravirsen, respectively. Cell culture treatment conditions were established and cells were
co-transfected with the two genomes and treated with combination therapy. However, no resistant
recombinants were observed, potentially due to non-viability of potential recombinants, thereby failing to
provide proof-of-concept for recombination as escape mechanism in the studied setup. Further work to
elucidate the putative role of recombination in combination therapy escape is warranted for the future.
During miravirsen treatment, break-through of viable virus was observed. The 5’ UTRs of these viruses were
sequenced, but no mutations were found, suggesting an alternative to miravirsen resistance, e.g. through a
general fitness increase caused by adaptive mutations further downstream.
Finally, initial steps of mechanistic studies were made by knock-down of the tRNA-ligase HSPC117 with a
hypothesized role in breakage-rejoining RNA recombination. In further studies, the role of HSPC117 and
other cellular factors with a putative involvement in breakage-rejoining RNA recombination could be
assayed upon establishment of quantitative recombination assays. Identification of cellular molecules with
implications for viral RNA recombination could enable studies of potential viral and cellular implications of
RNA recombination.
7
Introduction
The hepacivirus hepatitis C virus (HCV) was identified in 1989. It is an RNA virus with a positive single-
stranded 9.6kb genome. Its natural host is humans, but experimentally also chimpanzees can be infected. It
is hepatocyte tropic and has only been shown to robustly complete its life cycle in liver cells. Each year, 3-4
million people get infected worldwide and 70-80% of the infections become chronic leading to increased
risk of liver cirrhosis and liver cancer. 2-3% of the total world population are estimated to be chronically
infected (Hajarizadeh, Grebely, and Dore 2013), and each year around 700,000 people die from disease
caused by the virus.
HCV is mainly blood-borne and transmission occurs by injection with unsterilized needles in drug use or
medical settings, unscreened blood transfusion, organ transplantation and to some extend maternal-fetal
vertical transfer and by sexual activity (Yen, Keeffe, and Ahmed 2003). HCV prevalence varies significantly
on a global scale. There is an overall low prevalence in the Western world, and a high prevalence in Africa
and the Middle East. Scandinavia, including Denmark, marks the low end of the scale with HCV infection of
less than 0.5 percent of the population. Egypt marks the other end with 15-20% HCV infection. The high
infection rate in Egypt was caused by HCV contamination introduced during treatment against a trematode
parasite from 1920’s-1980’s, but may be maintained high by low standard hospital practices (Hajarizadeh,
Grebely, and Dore 2013; Yen, Keeffe, and Ahmed 2003).
There is no vaccine against HCV, but studies of the virus lifecycle have led to development of increasingly
efficient treatments with direct-acting antivirals (DAAs). However, resistance mutations towards specific
DAAs have been observed in patients (Wyled 2012; Pawlotsky 2016). This fact combined with reports of
natural HCV recombinant chimeras and recombination in cell culture studies (Kalinina et al. 2002; Galli and
Bukh 2014; Scheel et al. 2013), raise the question of whether recombination of different resistant HCV
strains can lead to multi-resistant recombinant strains. This was the fundamental question that this thesis
sought to answer. That it can happen is known from Human Immunodeficiency Virus (HIV), where
recombination has led to combination of resistance mutations, while simultaneously maintaining genetic
diversity in other regions (Nora et al. 2007).
In the following, I will 1) introduce the naturally occurring genomic HCV variation, 2) provide a short
introduction to the molecular details of the HCV particle, genome and proteins, along with a description of
the cell culture systems that have moved the HCV field and enabled molecular understanding of HCV, 3)
summarize overall treatment possibilities and the different HCV variation that it selects for, and 4)
introduce the field of RNA recombination of RNA virus genomes. The aim here is to provide a sufficient
background for the presented Master’s thesis experimental work.
Hepatitis C Virus (HCV)
Phylogeny and Quasispecies
HCV evolved within the family Flaviviridae characterized by a positive single-stranded RNA (+ssRNA)
genome encoding a single polyprotein. Here HCV forms the hepacivirus genus together with Non-primate
hepacivirus (NPHV), GB virus B, Rodent hepacivirus (RHV) and others (Scheel, Simmonds, and Kapoor 2015).
Hepaciviruses are related to the genus Pestiviruses, which includes life stock viruses such as Bovine Viral
8
Diarrea Virus (BVDV) and Classical Swine Fever virus (CSFV), to the Pegiviruses such as the human GBV-C,
and to Flaviviruses such as Zika virus, dengue virus and yellow fewer virus (Simmonds et al. 2017).
Based on nucleotide sequence, HCV can be divided into 7 genotypes, which can be subdivided into at least
67 subtypes. Genome sequence varies with 25-30% between the genotypes, and subtypes vary about 15%
(Bukh 2016). The genetic diversity is not evenly distributed throughout the genome; some regions such as
NS5A and the NS3 helicase are highly conserved whereas other regions, in particular the hyper-variable
regions HVR1 and HVR2 in E2, are highly variable (Pawlotsky 2003).
On a global scale, approximately 75% of all HCV infections are genotype 1 or genotype 3. In Europe these
two genotypes are also the most common. Genotype 2 is also found in Europe, as well as in North and
South America and Japan. Genotype 4 and 5 are primarily found in Africa, genotype 4 in particular in Africa
and the Middle East and genotype 5 in sub-Saharan Africa. Genotype 6 is primarily in South-East Asia.
Genotype 7 has only been found in a few patients originally from central Africa (Bukh 2016).
Subtypes are classified by the genotype they belong to and a letter, for example 1b or 4a. A subtype
consists of several strains (also called isolates), for example J6 and JFH1 are two different 2a strains.
In addition to the genetic diversity existing on the levels
of genotype, subtype and strain, an extra layer exists
within each single strain. Each single infection consists of
a large population of almost, but not entirely, identical
HCV genomes referred to as quasispecies. The
quasispecies is the result of a continuous high
replication combined with the high error rate of the
NS5B polymerase corresponding to introduction of
approximately one mutation per genome synthesis. The
quasispecies provides a pool of genetic diversity, which
is used by the virus to quickly overcome environmental
challenges such as immune system pressure and drug
treatment (Pawlotsky 2003; Davis 1999). For polio virus,
it has been shown that the diversity provided by the
quasispecies population structure is an advantage in
colonization of new tissues, and that a diverse virus
population – despite having an identical consensus
sequence – is more fit (Vignuzzi et al. 2006; Lauring,
Frydman, and Andino 2013).
Molecular Biology
The HCV particle size varies, but is around 50 nm, and a pre-dominant feature is the association with low-
density and very-low density lipoproteins especially Apolipoprotein E (Catanese et al. 2013). The virion
consists of a 9.6 kb positive single-stranded RNA (+ssRNA) genome embedded in a HCV core (C) protein
capsid. This core structure is surrounded by an envelope, derived from cellular membranes, containing
heterodimers of the two viral envelope proteins E1 and E2 (Lindenbach 2013). Particle assembly uses lipid
droplets as platforms and very-low-density lipoproteins are required for the process, thus assembly is
closely connected with lipid synthesis of host cells (Bartenschlager et al. 2011).
Figure 1: Unrooted phylogeny of hepatitis C virus showing the 7 genotypes and 67 subtypes. The 0.05 bar represent the length of 0.05 nucleotide substitutions per site. Modified from Bukh 2016.
9
Entry happens by receptor binding and receptor-mediated endocytosis in a clathrin-dependent manner, or
by direct cell to cell transmission. Important host proteins for HCV entry are SR-B1, the tetraspanin CD81,
and the tight junction proteins claudin 1 (CLDN1) and occluding (OCLN) (Bartenschlager, Lohmann, and
Penin 2013).
The positive strand RNA genome consists of three regions - a 5’ untranslated region (UTR), an
approximately 9 kb open reading frame (ORF) and a 3’UTR (see Figure 2). The 5’ UTR contains two seed
sites, S1 and S2, for the highly expressed, liver-specific miRNA, miR-122. The seed sites are separated by 14
conserved nucleotides (Jopling, Schutz, and Sarnow 2008). Binding of miR-122 in complex with the
Argonaute protein of the RNA induced silencing complex (RISC) to these seed sites is a 5’nuclease inhibiting
and thereby genome stabilizing capping mechanism (Li et al. 2013; Sedano and Sarnow 2014). miR-122
further facilitates the life cycle of HCV replication in capping-unrelated manners. Translation of the HCV
ORF is enhanced by initial miR-122 stimulation of interaction between HCV RNA and ribosomes (Henke et
al. 2008). Furthermore, miR-122 has a suggested role in a regulatory mechanism of the switch between
HCV translation and replication (Masaki et al. 2015).
Recent studies showed that HCV infection reduces binding of miR-122 to its cellular targets. Thereby
cellular mRNAs will be de-repressed during HCV infection, which can have impacts on the processes that
miR-122 is involved in; anti-tumorigenic and anti-inflammatory pathways, and cellular lipid metabolism,
iron homeostasis, and circadian rhythm (Luna et al. 2015). Sequestering of miR-122 has been proposed to
lead to oncogenic changes, because absence/decrease in mice liver leads to spontaneous development of
tumors (Hsu et al. 2012). The sequestering of miR-122 can be changed to miR-15 sequestering by swapping
the 5’ UTR seed sites into miR-15-seed sites, while maintaining viral viability (Luna et al. 2015).
Furthermore, the 5’ UTR contains stem loop I-IV. Whereas stem-loop I is necessary for replication, stem
loop II, III and IV are components of an internal ribosome entry site (IRES) driving translation of the ORF.
The 3’ UTR contains a short variable region, a very long poly-U/C tract of 80-100 nts and a 3’X-tail
containing conserved RNA structures important for replication and translation (Niepmann 2013).
Figure 2: The hepatitis C virus genome consisting of the 5’ UTR, ORF and 3’ UTR. The 5’UTR contains two miR-122 seed sites and an IRES structure consisting of stem loop II, III and IV. The ORF encodes a polyprotein that is co-and post-transcriptionally cleaved into ten viral proteins. P7 is encoded between E2 and NS2. NS4A is encoded between NS3 and NS4B. Modified from Niepmann 2013.
Upon cell entry, the viral genome highjacks the cellular translation machinery. The single long ORF of the
+ssRNA genome encodes for a polyprotein consisting of approximately 3000 amino acids. The polyprotein is
cleaved into ten proteins by cellular and viral proteases. Three of the proteins are the structural proteins
10
Core, Envelope protein 1 (E1) and Envelope protein 2 (E2). The remaining seven proteins are the
nonstructural (NS) p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B. Cleavage of the polyprotein is executed by
several proteases; host cell signal peptidases liberate Core, E1, E2 and p7. NS2 cleaves itself off from NS3,
and the NS3/4A protease cuts the remaining NS proteins (Moradpour and Penin 2013).
The structural role of mature core protein, consisting of 177 amino acid residues, is to polymerize and from
the viral capsid. The envelope proteins E1 and E2 form a heterodimer that will be positioned in the viral
envelope. p7 belongs to the family of viroporins and can polymerize into hexa- or heptamer cation
channels. p7 channels have been suggested to be required for HCV particle production by preventing
acidification of intracellular compartments that would otherwise disrupt assembly and maturation of
virions (Wozniak et al. 2010).
Nonstructural protein 2 (NS2) configures as a homodimer and is a cysteine protease, but also exhibits protease-independent activity in the virus assembly process (Bartenschlager, Lohmann, and Penin 2013). The Core, E1, E2, p7 and NS2 proteins are not necessary for viral RNA replication (Lohmann et al. 1999). The 631 amino acid residue nonstructural protein 3 (NS3) and much smaller 54 amino acid residue nonstructural protein 4A (NS4A) form a complex with RNA-helicase and serine protease activity. The NS3-NS4A complex is essential for replication. Furthermore, it cleaves the cellular innate immunity factors MAVS and TRIF thereby protecting the virus by lowering host defenses (Horner and Gale 2013). NS4A membrane-tethers the complex with a transmembrane alfa-helix, and acts as a co-factor for the NS3 protease and helicase activity and interacts with other viral proteins (Bartenschlager, Lohmann, and Penin 2013). As a homo-oligomer, the integral membrane protein NS4B mediates the formation of change in structure in areas of the endoplasmatic reticulum (ER) forming a membranous web, which is a required for viral RNA replication. NS4B also has a crucial role in RNA replication and viral assembly. It can interact with other nonstructural proteins and potentially also viral RNA and it has NTPase activity (Moradpour and Penin 2013). The phosphoprotein NS5A is involved in RNA replication and virion assembly. Some experiments indicate that the degree of phosphorylation might provide a switch between replication (hyperphosphorylation) and assembly (hypophosphorylation) in the virus life cycle. NS5A can bind cellular factors and virus proteins. NS5A consists of domains D1, D2 and D3, which are linked by low complexity sequences LCS1 and LCS2. D1 contains a structure capable of dimerization and is required for RNA replication. D3 is required for assembly and D2 for RNA replication (Bartenschlager, Lohmann, and Penin 2013). D2 and D3 are intrinsically unfolded and might be the place of interaction with many other proteins, as is often the cases for intrinsically unfolded protein domains (Latysheva et al. 2015). NS5B is an RNA dependent RNA polymerase (RdRp) with an error rate of 10−4 mutations/base
corresponding to approximately 1 introduced mutation per genome copy. It is also membrane-anchored
through its C-terminal tail. NS3, NS4A, NS5A and NS5B are all required as part of the replicase to replicate
the viral RNA. NS4B is not engaging in this protein complex, but it is essential for formation of the
membraneous web in which replication takes place.
Upon entry and translation, the viral nonstructural proteins in concert enable transcription of the +ssRNA genome into –ssRNA RNA. The negative single stranded RNA serves as template for de novo synthesis of +ssRNA. Positive and negative HCV RNA is found in a ratio of 10:1, indicating that a mechanism ensures that primarily +ssRNA is synthesized (Lohmann 2013).
11
The initial phases of the intracellular viral life-cycle concern protein and RNA synthesis. At some point and by yet-to-be-determined mechanisms, this replicative mode is shifted towards packaging, where +ssRNA is embedded in Core-derived capsid structures, wrapped in lipid envelope and released from the cell and into the blood stream, from where it can infect other liver cells of the same host, or if transmission occurs, cells of another human being.
Cell Culture Systems
Molecular understanding of HCV has been gained by increasingly sophisticated methods for mimicking the
virus life cycle in cell culture systems. Genetic systems mimicking some and later all parts of the viral life
cycle were developed, and increasingly permissive cell lines were obtained through selection (Bukh 2016).
Patient isolates do not readily grow in cell cultures. In 1999, Lohmann et al. engineered a genetic construct
based on a full HCV genome, where Core-NS2 was replaced with a neomycin resistance marker and an
encephalomyocarditis virus IRES. This was followed by the HCV NS3-NS5B genes and the 3’ UTR. The
constructs were termed HCV replicons, because they are self-replicative in the human hepatoma cell line
Huh-7 (Lohmann et al. 1999). Several patient isolate-based HCV replicons were made, and as a general
pattern, adaptive mutations were required for efficient replication in culture. Thereby studies of the
replication driven by HCV proteins became possible, including functional studies of internal parts of the
viral life-cycle and studies of antiviral compounds, however without production of infectious HCV in cell
culture.
Similarly, the entry process was mimicked by production of HCV pseudo particles (HCVpp). HCVpp are
particles produced in 293T human embryo kidney cells co-transfected with an HCV E1 and E2 expression
vector, a retro- or lentiviral capsid expression vector, and a retro- or lentiviral genome encoding a
fluorescent or luminescent reporter. Co-expression causes capsid formation surrounding the reporter
genome, and at release the capsid will be enveloped in cell membrane containing E1 and E2 proteins in
complex. Thereby studies of the role of E1 and E2 in attachment were enabled, including studies of entry
inhibitors and neutralizing antibodies (Bartosch, Dubuisson, and Cosset 2003; Scheel and Rice 2013).
HCV replicons and HCVpp provide models of parts of the HCV life-cycle, but there are limitations. HCV
replicons mutated to optimize replication, but these mutations were later found to attenuate infection in
vivo (Bukh et al. 2002), suggesting differences between infectious HCV and replicon replication. The HCVpp
envelope contained the viral membrane proteins, but assembly in non-hepatocytes could cause differences
in host factor envelope components and the retro-viral capsid might further have changed the morphology
of the particle (Scheel and Rice 2013).
HCV cell culture (HCVcc) studies of the entire life cycle became possible with replication and infectious
particle production of a full-length genome, the genotype 2a patient isolate Japanese Fulminant Hepatitis C
virus 1 (JFH1) (Wakita et al. 2005). Growth in culture was further optimized with recombinant virus J6/JFH1,
which is a JFH1 genome where Core-NS2 has been replaced with Core-NS2 from another genotype 2a-
strain, J6 (Lindenbach et al. 2005). Regions of J6/JFH1, including Core-NS2, NS3-4A and NS5A have been
swapped experimentally to enable studies of genes or regions from different genotypes and subtypes to
enable culture studies of the encoded proteins and their role in different processes or response to
neutralizing antibodies (Gottwein et al. 2009) and antivirals (Gottwein, Scheel, et al. 2011). Subsequently
also robust full-length culture systems of non-2 genotypes have allowed in vitro studies of other genotypes
12
(Ramirez et al. 2016; Li et al. 2012). In this Master’s thesis modified versions of JFH1 and J6/JFH1 were
used.
The human hepatoma cell line Huh-7 was found permissive for HCV replication (Lohmann et al 1999). An adapted version, the Huh-7.5 cell line, was selected with neomycin treatment of HCV replicon transfected Huh-7 cells followed by replicon clearing with interferon treatment. The infected and cleared cell population showed increased permissiveness to HCV replication compared to standard Huh-7 cells (Blight, McKeating, and Rice 2002). The permissiveness was later found to be caused by a disruptive mutation of antiviral innate immune signaling. The Huh-7.5 cell line was used for most of the work in this thesis. Huh-7.5-MAVS cells are modified Huh-7.5 cells that express a fusion construct between MAVS and RFP (red
fluorescent protein) which, like MAVS normally does, localizes anchored to the mitochondrial membrane
(Jones et al. 2010). HCV infection causes cleavage of the MAVS protein by NS3/4A. The HCV-mediated
cleavage liberates RFP tagged with a nuclear localization signal (NLS), which again mediates a nuclear
relocation thereby causing complete relocation of the fluorophore into the nucleus. By microscopy of living
cells in culture or of unstained fixated cells, the percentage of cells with nuclear fluorescence can be
determined and used as a measure of infection.
Therapy
About 20% of HCV infections are spontaneously cleared. Factors significant for resolving an acute infection
includes virus genotype, host polymorphisms of HLA, ethnicity, gender, age and obesity (Scheel and Rice
2013). For the remaining 80% of infections which become chronic, treatment is necessary. No preventive
vaccine exists, partly due to high genetic HCV diversity, inefficient host immune responses and high HCV
persistence (Liang 2013).
The previous standard-of-care HCV therapy consisted of pegylated interferon alpha (peg-INF-a) and
ribavirin for ≤48 weeks. Viral resistance mutations towards peg-INF-a and ribavirin are not observed. This
treatment regimen caused sustained virologic response (SVR) in approximately 50% of the patients
completing therapy, however treatment had to be stopped in many patients due to severe side effects,
including flu-like symptoms, neuropsychiatric disease, autoimmune disease and hemolytic anemia. Peg-INF-
a induces a general antiviral cell state. The ribavirin mechanism of action is unclear, but hypothesized to be
efficient through increased mutagenesis during viral replication, stimulation of interferon-stimulated genes,
GTP depletion through inhibition of inosine monophosphate dehydrogenase, direct polymerase inhibition,
or induction of T helper cells (Scheel and Rice 2013).
Development of direct acting antivirals (DAAs) targeting viral proteins directly was enabled by studies in cell
culture systems and from solving of protein structures. Currently, there are three major targets for the
DAAs used in clinic: The NS3/NS4A serine protease, NS5A and the RdRp NS5B (Gotte and Feld 2016).
The first DAAs were used in combination with peg-IFN-a and ribavirin – this treatment regime had
increased viral elimination but also increased side-effects. Since 2014 combination treatment with different
DAAs without peg-INF-a, which causes most of the side-effects, has been possible. The most recent
versions of this treatment type shows SVR of ≥90% and causes significantly less severe side effects
(Bartenschlager, Lohmann, and Penin 2013).
The first generation NS3/NS4A serine protease inhibitors (PIs) telaprevir and boceprevir were the first
approved DAAs. They were introduced in 2011 and used in combination with peg-INF-a and ribavirin and
increased SVR to around 70%, but treatment side effects were also increased. Telaprevir and boceprevir
13
had narrow genotype specificity and low resistance barriers and were therefore only approved for
treatment of genotype 1. The same was the case for the subsequent PIs simeprevir and asunaprevir, that
however had lower side-effects. The second generation macrocyclic inhibitors PIs, such as grazoprevir, are
less sensitive to genotype variation and resistance mutations (Bartenschlager, Lohmann, and Penin 2013).
For NS3, resistance with medium fitness is associated with mutations in particular at amino acid positions
155, 156 or 168 (Wyled 2012).
Besides cleaving the viral polyprotein, the NS3/4A serine protease disrupts the cell innate immune system
by cleavage of signaling cellular molecules. Hindrance of this effect requires 100 fold higher concentrations
than for disruption of the viral life cycle, so despite that NS3/4A protease inhibitors in theory could gain
effect here, it might not occur with the doses used for treatment (Bartenschlager, Lohmann, and Penin
2013).
NS5B polymerase inhibitors can be divided into non-nucleotide and nucleotide inhibitors (NNIs and NIs).
NNIs were identified in high-throughput screenings and optimized, and can be classified based on where
they interact with NS5B (Thumb site I, thumb site II and palm site). Their antiviral effect is assumed to be
caused by inhibition of NS5B conformational change from initiation to elongation mode. Due to the low
conservation of the targeted protein regions, NNIs are typically genotype-specific and have a low barrier to
resistance. NIs are nucleotide analogs with ribose modifications. They are pan-genotypic, typically with a
high resistance barrier, although resistance associated variants (RAVs) have been observed. A main issue in
development has been cytotoxicity. These inhibitors are typically delivered as prodrugs and activated by
cell metabolism. The efficient drug sofosbuvir is a uridine analog with flouro-methyl attached to the 2’
carbon of the ribose ring (Bartenschlager, Lohmann, and Penin 2013). The mutation S282T in NS5B can lead
to sofosbuvir escape mutants with low fitness (Wyled 2012).
The most potent developed DAAs are inhibitors of the NS5A phosphoprotein, despite its lack of enzymatic
activity, but in contrary to other DAAs, NS5A inhibitor resistance associated variants (RAVs) have high
fitness and persist. Daclatasvir was the first NS5A inhibitor in the clinic. It is a symmetric molecule and as
predicted from location of resistance mutations, it binds NS5A domain I. Daclatasvir has been suggested as
a competitor in RNA binding and it further blocks assembly of the membranous web (Gotte and Feld 2016).
Another suggested mode of action is through inhibition of homo-dimerization since daclatasvir resistance
mutations are located in or just upstream the dimerization domain D1 in NS5A (Bartenschlager, Lohmann,
and Penin 2013). Upon the success of daclatasvir, other NS5A inhibitors such as ledipasvir,ombitasvir,
elabasvir, and velpatasvir have been developed and are now used in the clinic. Resistance mutations are
known; for example mutation of amino acid position 28, 30, 31 or 93 in NS5A can lead to escape mutants
with high fitness (see Figure 3) (Wyled 2012; Scheel et al. 2011).
Figure 3: The HCV NS5A protein domain I with mutations associated with daclatasvir resistance. Wildtype amino acid residues are depicted above the protein sequence and mutations below. Mutations depicted in bold are clearly associated with a resistance phenotype. b: amino acids are only wildtype in genotype 1a; c: amino acids are only wildtype in genotype 1b. Source: Wyled, 2012.
A number of cellular factors have been identified as necessary for completion of the viral life cycle, so viral
proteins are not the only possible treatment targets. Inhibitors aiming at cellular targets are termed host
14
targeting agents (HTAs). Cyclophilin A (CypA) is a cis-trans-isomerase that has been identified as a central
requirement for viral replication through binding to NS5A, resulting in conformational change. Further,
CypA inhibitors mutations occur in NS5A (Scheel and Rice 2013). CypA inhibitors have been tested in the
clinic, but due to side-effect issues studies were put on hold.
Miravirsen is another example of an HTA. It is a β-D-oxy locked nucleic acid (LNA) modified
phosphorothioate oligotide complementary to miR-122. By retention of miR-122, miravirsen makes miR-
122 unavailable for binding its seed sites in the HCV 5’UTR, and without miR-122 binding HCV replication is
inhibited (see above) (Ottosen et al. 2015). The therapeutic potential of miravirsen has been shown in
chimpanzees and in several clinical studies (Lanford et al. 2010; Janssen et al. 2013; van der Ree et al.
2017). Disadvantages include the need for injection and potential down-stream effects of inhibiting cellular
functions of miR-122. However, the long-lasting effect may, perhaps in combination with other antivirals,
enable one-shot cures for HCV.
Treatment success of individual drugs, but also combinations, is closely related to genotype. For example a
combination of the NI sofosbuvir and ribavirin causes 97% SVR for genotype 2 patients, but just above 56%
of genotype 3 patients achieve SVR. Today most therapies consist of a combination of several inhibitors to
diminish virus escape. Such combinations provide >90% cure rates in clinic (Scheel and Rice 2013).
RNA Recombination Viral RNA recombination is the construction of an RNA molecule with mixed ancestry from distinct parental
viral RNA strands or from viral and cellular RNA. It was first described in 1962 for polio virus (Hirst 1962).
Although frequencies vary, RNA recombination has been described for several RNA virus families including
the animal virus families Picornaviridae, Coronaviridae, Flaviviridae, Retroviridae and Togoviridae, and the
plant virus families Tombusviridae and Bromoviridae (Simon-Loriere and Holmes 2011).
Within Flaviviridae, natural recombinant forms have been found in several members such as GBV-C,
dengue virus and the widespread cattle virus Bovine viral diarrhea virus (BVDV) (Galli and Bukh 2014).
Interestingly, for BVDV RNA recombination is a very important functional mechanism that can cause change
from a non-lethal non-cytopathic phenotype to a lethal, cytopathic virus by integration of cellular RNA in
the NS2-NS3 region (Peterhans et al. 2010). Different types of HCV recombinants have also been
characterized and will be described in more detail below.
Despite similarities with sexual reproduction of cellular organisms, RNA recombination does not seem to be
a major driving force behind advantageous genetic mixtures or removal of disadvantageous mutations
(Simon-Loriere and Holmes 2011). Yet RNA recombination driven changes of host specificity and increased
virulence as well as evasion from host immunity and antiviral therapy have been described (Simon-Loriere
and Holmes 2011). RNA recombination has also caused emergence of new viruses: Western equine
encephalitis virus is a recombinant of the two Togoviridae alphaviruses Sindbis virus and Eastern equine
encephalitis virus (Hahn et al. 1988). RNA recombination can also have implications for vaccine safety. It
caused the combination of circulating wildtype enteroviruses and attenuated vaccine-derived polio, which
caused a polio outbreak in Latin America in the early 2000’s (Kew et al. 2002). This type of polio outbreak
also occurred elsewhere in the world, and recombination between polio virus and a co-circulating
enterovirus has subsequently been demonstrated in vitro (Jegouic et al. 2009). For polio virus, RNA
recombination furthermore has been shown to be a mechanism improving environmental adaptation in
15
addition to advantages achieved through mutagenesis and quasispecies (Xiao et al. 2016). Thus, RNA
recombination has several roles in evolutionary processes of RNA viruses.
RNA recombination can be classified in different ways based on the recombination junction, or on the
mechanism by which it occurs. The recombination junction can be homologous i.e. not contain insertions or
deletions, or heterologous i.e. contain insertions or deletions, and mechanisms assumed to drive
recombination are copy-choice and breakage-rejoining (Galli and Bukh 2014).
Copy-choice RNA Recombination is replication-associated. It occurs by disassociation between the
template RNA strand and the RNA polymerase with its nascent RNA strand, followed by association with
another template strand and continued RNA synthesis (see Figure 4). An unfinished RNA strand in complex
with the polymerase will be transferred to associate with another template, usually where there is a high
degree of complementarity. Thereby this recombination mechanism is likely to create homologous
recombinants, but copy choice recombination can also occur by re-association at a different location and
thereby create insertions or deletions. Due to favoring of similar sequences, copy-choice recombination is
prone to occur between two independent, but similar, viral RNA molecules (Simon-Loriere and Holmes
2011).
The frequency of copy choice recombination
will depend on the association-dissociation
kinetics of the RNA polymerase and therefore
vary between viruses and virus families
(Simon-Loriere and Holmes 2011).
Breakage-rejoining RNA Recombination
is not associated with replication, but
assumed to occur by breakage of two RNA
molecules that are subsequently ligated into
a single RNA strand (see Figure 5). Breakage
is assumed to be caused by mechanical
forces, endonucleases or cryptic ribozymatic
processing. Rejoining is assumed to be the
result of self-ligation or ligase-activity, but it
remains unknown what cellular factors may
be required for the ligation process.
Substrate RNA for breakage-rejoining
recombination can be viral, derived from the same or different strains, or viral-cellular. The resulting
recombinants are most often heterologous (Galli and Bukh 2014). Except for if driven by cryptic ribozyme
activity, breakage will occur randomly, which contributes to favoring of heterologous recombinants. The
current understanding of breakage-rejoining RNA recombination does not suggest favoring of similar
substrates (Gallei et al. 2004; Scheel et al. 2013; Austermann-Busch and Becher 2012). Thus breakage-
rejoining will presumably use cellular as well as viral RNAs as substrate, but due to a subsequent need for
self-replication primarily the viral-viral RNA recombinants are likely to be observed.
Figure 4: Copy-choice RNA recombination - A polyphyletic RNA genome is created during replication, when RdRp dissociates from the template strand and associates with a different template strand, most of in the genomic position. Source: Galli and Bukh, 2014.
16
Furthermore, many viral-viral breakage-
rejoining recombinants will contain fatal
deletions and would therefore never be
observed. Other recombinants will be viable
but not recognized as recombinants due to
partial sequencing or high similarity of the
parent RNA strands.
For the emergence of viral RNA
recombinants from different viruses or
strains to occur, several prerequisites must
be fulfilled. Different strains must occur in
the same individual, and within this
individual, single cells must be co-infected.
Furthermore distinct genomes must exhibit
sub-cellular co-localization and the
recombinant RNA must be viable and
relatively fit compared to the parental
viruses (Galli and Bukh 2014).
Previously Described HCV Recombination
All described natural HCV recombinants are homologous, and can be classified into intergenotypic,
intersubtypic, and intraisolate recombinants (Gonzalez-Candelas, Lopez-Labrador, and Bracho 2011). The
first clear evidence of natural HCV recombination was intergenotypic (Kalinina et al. 2002). This first
described recombinant, RF1_2k/1b, was a genotype 2k / 1b chimera, and has later been shown to be
widely distributed. Presently ≥8 intergenotypic and ≥9 intersubtypic recombinants have been described
(Galli and Bukh 2014).
The described intergenotypic recombinants all had recombination junctions in the NS2-NS3 region. This
tendency was not observed for the intersubtypic recombinants, where junctions were observed in other
regions of the genome (Galli and Bukh 2014). Two fully sequenced intersubtypic 1a/1c recombinants
contain multiple recombination junctions (Cristina and Colina 2006; Ross et al. 2008).
In a study of intra-isolate recombinants i.e. recombinants within the same quasispecies, the E1-E2 and the
NS5A regions were analyzed for recombination (Sentandreu et al. 2008). In analyses of E1-E2 and NS5A,
recombination was found in 17 out of 110 patients. In another patient group, where only NS5A was
analyzed, intra-isolate recombination was found in 9 out of 78 patients. More recombination might have
occurred in the remaining unsequenced genome. Recombination hotspots were suggested to be caused by
secondary RNA structure. Interestingly these regions were different than the observed intergenotypic
recombinants, but because the NS2/NS3 region was not sequenced in these studies further recombination
could also have occurred there.
In addition to the naturally occurring events, HCV RNA recombination has been observed experimentally in
chimpanzees and cell culture. Recombinants were identified in two out of three chimpanzees co-infected
with genotype 1a and 1b strains with junctions in the E1-E2 region (Gao et al. 2007). Recombination here
could have caused advantages toward the immune system by changing epitope topology. In this study only
the E1-E2 region was analyzed, so additional recombination could have occurred in other genomic regions.
Figure 5: Breakage-rejoining RNA recombination – A recombinant RNA is the result of rejoining of two broken RNA genomes. Source: Galli and Bukh 2014.
17
In cell culture, Reiter et al used 1b HCV replicons with deleterious mutations to show recombination,
recombinants were seen. Furthermore they found a linear relationship between HCV recombinant
frequency and distance between disruptive mutations in the two replicons present in the same cell. From
this, they calculated a recombination frequency of 4 × 10−8 for HCV in culture (Reiter et al. 2011).
In a different study, two different genotype 2a strains also with different disruptive mutations or deletions
were shown to recombine to produce viable genomes producing infectious particles (Scheel et al. 2013).
Recombination in this study mostly led to heterologous recombinants, and also occurred in the absence of
a functional polymerase from either parental genome, thereby proving recombination without replication
for HCV. This was previously demonstrated also for BVDV (Gallei et al. 2004). A lower frequency of
recombination between different genotypes compared to within a genotype was seen. Interestingly, in one
case a heterologous recombinant was observed to subsequently further recombine to delete most of the
duplicated sequence. This led to increased fitness, as demonstrated by higher infectivity titers (Scheel et al.
2013). Thus, characterized homologous recombinants can presumably either arise from initial homologous
recombination events, or as subsequent results of “repair” of heterologous recombinants to optimize
fitness.
Recombination with cellular RNA has also been observed experimentally. Modified genomes lacking stem-
loop I of the 5’ UTR regained viability by insertion of viral or cellular RNA fragments all predicted to fold into
stem-loop structures thereby replacing the natural stem-loop I. Interestingly one of these recombinants
lost miR-122 seed site I and its requirement for miR-122 (Li et al. 2011).
Furthermore, deletions have been observed upon insertion of markers in laboratory strains (Gottwein,
Jensen, et al. 2011). Deletions of RNA genomes could occur by polymerase slippage or breakage-rejoining,
and can therefore be relevant to consider when understanding recombination.
In conclusion, both copy-choice and breakage-rejoining recombination appear to occur for HCV, but their
relative importance in evolution remains to be determined.
Scarcity of HCV Recombination or Detection Difficulties?
Despite playing a clinical role, HCV recombinants are less frequently observed compared e.g. to HIV.
Phylogenetic analysis based on all full-length HCV genomes available in 2003, did not show ancient
recombination events. Genotype 4 was a possible exception – it could be an ancient recombinant of
genotype 1 and 6 (Magiorkinis et al. 2007). Recombination frequency and relevance could be changeable
over evolutionary time, as a result of changes in risk behavior such as invention of intravenous needles,
increased host mobility, and potentially treatment imposed selection pressure. Furthermore lack of living
descendants does not prove that recombinants did not previously exist.
There are several possible explanations for the scarcity of observed HCV recombination. These explanations
can be divided into two classes: 1) actual biological obstacles to the process, and 2) obstacles in detection
procedures.
Inhibitors of recombination are biological hindrances such as lack of co-infection either at the host or
cellular level, as well as reduced recombinant fitness compared to parental viruses. Natural recombinant
viruses might arise but might be outcompeted due to weak fitness compared to the present parental
wildtype genomes. Putative low level of polymerase template swap and/or breakage-rejoining of viral
genomes could further explain the low described occurrence of HCV recombinants.
18
Superinfection exclusion has been shown for HCV (Tscherne et al. 2007; Schaller et al. 2007), and might
provide a biological obstacle to co-infection. However, it is potentially less significant for co-infection
compared to subsequent secondary infections. In patients, infection with two or more HCV strains was
found for as many as 25.3% of a cohort of incarcerated intravenous drug users (Pham et al. 2010). Whether
hosts with multiple HCV strains exhibit cellular co-infection remains to be determined.
Failure to detect recombinants can be caused by routine genotyping based on one or two short genomic
regions. Mistakes can also be caused by difficulties in differentiating between accumulation of identical
mutations versus collection of mutations by recombination during the process of building phylogenies
especially for highly similar isolates (Gonzalez-Candelas, Lopez-Labrador, and Bracho 2011). Furthermore
intra-subtypic or intra-isolate recombination is hard to observe due to minor sequence differences and the
lack of knowledge of putative parental strains.
In conclusion, it is remains possible that the low level of described occurrence of HCV recombinants is an
underestimation.
Implications of HCV Recombination for Therapy
Recombinants might cause issues in the clinic if not correctly identified and accordingly treated.
Furthermore it might be a mechanism for accumulation of resistance towards antivirals. Treatment drug
combination is often chosen based on partial genotyping. Recombination will not be revealed from
standard genotyping, and recombinant virus genomes are therefore possibly treated with inefficient drugs
only suitable for another genotype. An example of this was recently reported, where a 1b/2k HCV
recombinant virus was typed as genotype 2 and treated accordingly without viral clearance. After more
thorough re-genotyping, genotype 1 treatment was successfully employed (Todt et al. 2017). Thus, further
studies of RNA recombination in relation to HCV therapy are warranted.
19
Aim of This Study
RNA recombination of HCV has been observed in patients and in cell culture, and high genetic diversity of
HCV means that a large potential for diversifying recombination exists. Treatment with DAAs is overall
efficient, but has been shown to cause selection of resistance mutations, potentially leading to
accumulation of resistance towards specific DAAs. This could potentially lead to recombination of different
resistance mutants into a single double-resistant recombinant.
The aim of this study was to investigate, as a proof-of-principle, whether double-resistant HCV
recombinants can arise from single resistant HCV types in cell culture – with potential downstream
implications for clinical therapy.
I aimed to set up a double treatment experiment of double-infected and/or transfected cells to determine
whether any recombinants would occur.
To prepare for this, I aimed to
I. Observe HCV RNA recombination of the cell culture non-viable genomes J6CF and
JFH1ΔE1E2, and characterize potential recombinants by sequencing of the recombination
junction.
II. Select two different virus genomes with different DAA resistance that potentially could
recombine into a double-resistant recombinant
III. Determine a method for simultaneous delivery of different viral RNAs to obtain double-
positive cells.
IV. Determine drug concentrations capable of suppressing the selected viruses.
Lastly, I wanted to investigate whether the RNA ligase HSPC117 has a role in RNA recombination.
20
Methods Huh-7.5 cell culture Huh-7.5 or Huh-7.5-MAVS cells were cultured at 37oC and 5%CO2 in DMEM
supplemented with 10%FBS. Cells were split two or three times weekly by removal of media and a PBS
wash followed by 5 minutes incubation with Trypsin-EDTA (0.01%) at 37oC. Upon cell detachment, new
media was added and depending on the cell confluency, 50-90% of the cells were removed.
Virus Strains J6-18, J6/JFH1d40-EGFP and J6/JFH1d40-mCherry are all derivatives of J6/JFH1(Lindenbach
et al. 2005). J6-18 carries NS5A from the J6 isolate (Scheel et al. 2011) and the mutations T2667C, T6350C,
A6452G and T6545C. J6/JFH1d40-EGFP and J6/JFH1d40-mCherry both have a 40 amino acid deletion in
NS5A and in-frame NS5A-reporter fusion proteins (Gottwein, Jensen, et al. 2011). All were kindly provided
by Judith Gottwein.
In Vitro Transcription 10ug HCV-plasmid DNA was linearized with XbaI. Linearization was confirmed on a
1% agarose gel and RNA transcription was carried out with T7 RiboMAX Express Large Scale RNA Production
System (Promega). Susequently, DNA was digested with RQ1 DNAse 30- 45 minutes on ice and RNA was
purified with RNAeasy mini kit (Qiagen).
Transfection 4x105 Huh-7.5 cells/well were plated out in a 6-well format, and the following day
transfected with 0.625-1.25ug RNA by the following method, unless otherwise specified: For each
transfection, 5µL Lipofectamine2000 was mixed with 250µL Opti-MEM and incubated 5 min. The RNA was
dissolved in 250µL Opti-MEM, and the two solutions were mixed and incubated 20min at RT. These 500µL
were added to the cells growing in 2mL normal media. The cells were incubated ON at standard conditions
and were split the following day and thereafter two-three times weekly. At each splitting, chamber slides
were plated out to enable visualisation of infected cells with immunostaining. For transfections in 12-well
format, cell count, reagent volumes and RNA amounts were divided with 2, and for 48-well format the
amounts were divided with 8.
Immunostaining The percentage infected cells in a cell culture was estimated by plating out 200-500 uL
cells in solution in an 8-well cell chamber culture slide (NUNC). The following day cells were fixated with -
18oC acetone, washed twice with PBS and once with PBS/0.1% tween. The fixated cells were incubated for
1-3hours at RT or ON at 4 oC with PBS/0.2%skimmed milk powder+1%BSA+1:1000 primary antibody anti-
NS5A-9E10 or anti-core C7-50. Subsequently, slides were washed twice with PBS and once with PBS/0.1%
tween. PBS/0.1% tween +0.05% DNA dye Hoechst 33342 (Life technologies) and 1:500 secondary antibody
Alexa Fluor 488 goat anti-mouse IgG (H+L), (Life Technologies) was added and the slides were incubated for
5-60 minutes. Slides were washed twice with PBS and observed in a fluorescent microscope.
Infectivity Titers To measure infectivity titers using the focus-forming-units (FFU) assay, 6*103 Huh7.5
cells/well were plated in 100µL/well DMEM+10%FBS in a 96well poly-lysine coated Nunc 96 Well™ Optical
Bottom Plate. The following day media was removed and 100µL viral supernatant was applied in triplicates
and in 4 different dilutions. A stock virus was included as positive control, and media only was included as
negative control. 48 hours later cells were fixated with -18oC methanol, washed with PBS and PBS/0.1%
tween, blocked for 20 minutes at RT with 30µL 1%BSA/0.2%skim milk in sterile PBS, washed with PBS and
incubated ON at 4oC with 50µL PBS/0.1%tween with 1:1000 primary antibody anti-NS5A (9E10). The
following day, the plate was washed with PBS and PBS/0.1% tween and incubated at RT with 50µL
PBS/0.1%tween with secondary antibody HRP-goat--mouse 1:300 (GE Healthcare). After washing with PBS
and PBS/0.1% tween, the plates were stained for 30 minutes with 30µL DAB substrate kit (DAKO, K3468)
and washed twice with sterile H2O and scanned in CTL ELISPOT-counter with customized software
21
(Gottwein, Jensen, et al. 2011) or manually under fluorescence microscope. The dilution factor yielding
wells containing 5-100 FFU was used for manual counting.
Cloning of pJ6/JFH1-m15-J4NS5AR867H, C1185S The existing plasmids pJ6/JFH1-J4NS5A with the 2 cell
culture adaptive substitutions R867H and C1185S (H77 reference numbering) (Scheel et al. 2011)and
pJ6/JFH1-clone2-m15 (Luna et al. 2015) were double digested with XbaI and Acc651. pJ6/JFH1(J4-NS5A)
was 12372 bp and had cutting sites XbaI(9621bp) and Acc65I(1271bp), which yielded a fragments of 3965
(discarded) and 8407 (used). pJ6/JFH1-clone2-m15 was 12315 bp and had cutting sites XbaI(9678) and
Acc65I(1271), which yielded a fragments of 8407 (discarded) and 3908 (used). The digests were run on a
1% agarose gel and the 8.7kb pJ6/JFH1-J4NS5A fragment and the 3.9kb pJ6-JFH1-clone2-m15 fragment
were excised. DNA was extracted with Wizard®SV Gel and PCR Clean-Up Kit (Promega) according to
standard protocol.
The vector backbone fraction from pJ6-JFH1-clone2-m15, was de-phosphorylated with Antarctic
Phosphatase and the two fragments were ligated in the backbone to insert ratio 1:3 with Rapid DNA
Ligation Kit (Roche). A ligation without the insert fragment was included as a control. Ligated product was
heat shocked into chemically competent One Shot®TOP10 Competent Cells (Invitrogen). The transformed
bacteria were grown on LB-Amp plates at 37 oC ON. Six of the resulting colonies were picked and grown ON
at 37oC, 200rpm in 5mL liquid LB-amp media in a shaking incubator. Plasmid DNA was extracted with
QIAprep Spin Miniprep Kit (Qiagen). An EcoRI restriction analysis confirmed the expected bands from the
cloning. Two constructs yielding a correct restriction pattern were transformed into One Shot®TOP10
Competent Cells (Invitrogen) and grown ON on LB-Amp plates at 37 oC. One resulting colony per plate was
picked and grown in a shaking incubator ON (37oC, 200rpm) in 200 mL liquid LB-amp media. Plasmid DNA
was extracted with HiSpeed Plasmid Purification kit (Qiagen) and sent for Sanger sequencing at Macrogen
with primers covering the entire HCV-part of the plasmid. The resulting sequences were aligned with a
reference of pJ6/JFH1-m15-J4NS5A with the software Sequencher (Gene Codes). The resulting J6/JFH1
based plasmid carried the miR-15 seed sites in the 5’ UTR instead of miR-122 and the two cell culture
adaptive mutations compensating for the replacement by the J4 NS5A (G2952A and T3905A at the specific
nucleotide level).
Characterization of J6CF and JFH1∆E1E2 Cell Culture Recombinants Virus d, e, and f acquired from
double transfections were passed on to naïve cells by applying 1 mL sterile filtered supernatant from
recombination transfection cultures. The 1st passage cultures were followed by immunostaining until
infection of >80% of cells was attained and supernatants were harvested at each time point. Viral RNA was
extracted with High Pure Viral Nucleic Acid Kit (Roche) according to standard protocol from cell culture
supernatant. The extracted RNA was used as template for reverse transcription with Superscript III Reverse
Transcriptase (Thermo-Fisher) and reverse primer 4796R_JFH1.
The Advantage 2 Polymerase Mix (Clontech) was used for nested PCR covering the expected recombinant
junction for d, e and f. Two time points were included for each recombinant and a short and a long PCR was
made for each time point. First primer sets were JF1593 combined with 4118R_JFH1 (long) or JR3294
(short), and second primer sets were JF1848 combined with JR4041(long) or 2763R_J6(short). The PCR
products were run on a 2% agarose TAE gel, purified with Wizard®SV Gel and PCR Clean-Up Kit (Promega)
and sent for direct Sanger sequencing at Macrogen.
Due to lack of PCR products covering the recombination junction for recombinant f, an alternative strategy
was applied. Trizol extracted RNA (Life Technologies, according to protocol) was unfolded at 70oC for 5 min
in mixture with cDNA primer J6‐JFH1-9472-RT, RNasin Plus RNase inhibitor (Promega) and dNTPs followed
22
by an incubation 1 min on ice. The unfolded RNA was incubated with Maxima minus H Reverse
Transcriptase in RT buffer (ThermoScientific) for 2 hours at 50 oC followed by 5 min at 85oC, incubation on
ice and centrifugation. Upon cDNA synthesis, the RNA was degraded with RNase H for 20min at 37 oC.
Next, a full-length PCR was set up with Q5®Hot start High Fidelity DNA Polymerase (NEB). The polymerase,
Q5 reaction buffer, High GC Enhancer, forward primer JFH1-303-F, reverse primer JFH1-9467-R, dNTPs and
sterile water was added to 2µL cDNA from the Maxima minus H Reverse Transcriptase reaction and a PCR
was run (see appendix for details). The PCR product was analyzed on a 1% agarose TAE gel, and a band of 9-
10 kb was excised and purified with Zymoclean™ Gel DNA Recovery Kit according to manufactor’s protocol.
To identify the region of recombination, the purified DNA was used as a template for nested PCRs using
Accuprime pfr SuperMix PCR with forward primer JF1848 and reverse primer 2763R_J6, JR4041,
4118R_JFH1 or 4796R_JFH1. For PCR program, see appendix. For a description of further analysis, see the
methods section TOPO TA cloning.
psiCHECK-2 Vector and Dual-glo Luciferase Assay System For measurement of miRNA activities,
modified psiCHECK-2 vectors obtained from Luna et al. were used (Luna et al. 2015). The psiCHECK-2
vectors encode modified versions of the luciferases Firefly and Renilla modified by insertion of a miR-122
seed (CTCGAGTCTAGCCACATGACACTCCATATGCGGCCGC) or a seed position 3 and 4 mutated miR-122 seed
(CTCGAGTCTAGCCACATGACACagCATATGCGGCCGC) between XhoI and NotI vector restriction sites, which
are in the 3’ UTR of the Renilla luciferase gene (see Figure 6).Restriction sites are underlined, the seeds are
blue and auxilliary pairing is red in the seed sequences given above.
On Day 1, 3x104 Huh7.5 cells in 300ul media were plated per
well in 48-well format and incubated at standard conditions
ON. On Day 2, 0nM, 0.64nM, 2.56nM, 10.24nM or 40.96nM of
miravirsen were transfected into the Huh-7.5 cells with
lipofectame RNAiMAX according to manufacturer protocol, or
added directly to the media (10.24nM and 40.96nM only). On
Day 3, psiCHECK reporter vectors psiCHECK-2-miR122 or
psiCHECK-2-miR122mutated were Lipofectamine2000 transfected
into the cells. On day 4, the cells were washed with PBS and
lysed. 20uL og the lysates were transferred to 96w plates and
analysed. fixated with acetone. Renilla and Firefly luciferase
activities were measured on a FLUOstar Optima reader (BMG).
Luciferase background signal was calculated from cells not
transfected with psiCHECK-2 reporter vector and miravirsen.
Each set of conditions was made in two replicates.
Double Infection Flow Cytometry Analysis J6/JFH1d40-EGFP and J6/JFH1d40-mCherry virus stocks
were concentrated with an Amicon Ultra-15 Centrifugal Filter Unit with Ultracel-100 (100kDa cut-off)
membrane (Merck Millipore). 60 mL J6/JFH1d40-mCherry supernatant was concentrated to approximately
600uL corresponding to a ~100x-concentration. 11 mL J6/JFH1d40-EGFP supernatant was concentrated to
approximately 250uL corresponding to a ~45x-concentration. The infectivity titers of the virus stocks were
assayed with the FFU assay before and after concentration.
Figure 6: The psiCHECK-2 miR-122 vector. hRluc indicates the Renilla luciferase gene, hluc+ the Firefly luciferase gene. Modified from Promega Technical Bulletin siCHECK vectors.
23
For double infections, 5*104 Huh7.5 cells/well were plated in 48w format. 1 day after plating, the cells were
infected with J6/JFH1d40-EGFP and J6/JFH1d40-mCherry virus at MOI as indicated. Uninfected wells were
included as controls. The cell populations were harvested and fluorescence was measured on a BD
LSRFortessa flow cytometer. Harvest was done by trypsinizing, centrifugation and media removal, followed
by pellet resuspension in fixation buffer (PBS/1% FBS/4% formaldehyde) and 10min incubation on ice. After
the fixation, the cells were spun again and supernatant was removed. Next, the cells were washed twice
with PBS/1% FBS and were resuspended in PBS/1% FBS and kept at 4oC until they were measured. All
centrifugations were at 4oC, 1800 rpm for 5 min.
EGFP Deletion Assessment Upon unexpectedly low fluorescence detection, J6/JFH1d40-EGFP RNA was extracted with trizol from cell culture supernatant. J6/JFH1 supernatant and sterile H2O were included as controls. cDNA was synthesized with SuperscriptIII (Thermofisher) with reverse primer JR7585. A PCR was set up with Accumprime pfx SuperMix (Thermofisher) using primers JF6862 and 7234R_JFH. The J6/JFH1d40-EGFP plasmid was included as a positive control. The PCR-products were analyzed on a 1%agarose TAE gel.
Cell Culture Treatment with Daclatasvir and/or Miravirsen Daclatasvir was diluted to desired
concentrations in growth media and directly applied to the cells. Miravirsen was diluted in growth media,
delivered with transfection agent RNAiMAX, or included in viral RNA transfections with lipofectamine 2000.
Treatment was done 2-3 times weekly. Miravirsen (Exiqon) is a 15-nucleotide LNA and DNA oligomer with
the sequence (+CC*+AT*T*+C+TC*A*+CA*+CT*+C+C). + indicates LNA, * indicates DNA, LNA cytidines are
methylated, and the backbone consists of thiophosphates. In one case, a mock LNA(Exicon) of same length
and with same modifications, but a scrambled sequence (+TC*+AT*A*+C+TA*T*+AT*+GA*+C+A) was
included.
5’ Rapid Amplification of cDNA RNA was extracted from culture supernatant with trizol according to
manufacturer protocol (Invitrogen). cDNA was made with SS III according to manufacturer protocol with
reverse primer SP1 1a2a4a5a6a7aR443. The 5’RACE kit (Invitogen) was used according to standard
protocol, including a thorough cDNA-wash (SNAP purification), TdT-tailing and a nested PCR. For A-tailing,
dATP was used instead of the standard protocol dCTP. The first PCR of the C-tailed construct was made with
forward primer AAP and reverse primer SP2 2aR397. The A-tailed construct first PCR differed from standard
protocol in that AAP was replaced with forward primer AUAP-T20NV (TS-O-00178). The second PCR was
performed according to standard protocol for A- and C-tail, with SP3 2a2b3a5aR352 as reverse primer and
AUAP as forward primer. The products of 1st and 2nd PCR were run on a 2% agarose gel. The resulting bands
were purified and sent for sequencing with primer 21R_HCV (which binds at nucleotide 297-320).
TOPO TA Cloning For TOPO-TA cloning, deoxy-adenosine was added to blunt DNA ends with a Taq polymerase. A TOPO TA cloning (Invitrogen Life technologies) was done according to standard protocol, heat-shocked into competent Top-10 cells and grown on ampicillin plate with X-Gal ON. White colonies were picked and grown ON in 5 mL LB. The DNA was purified with QIAprep Spin Miniprep Kit (Qiagen) and sent for Sanger sequencing AT Macrogen.
HSPC117 siRNA Knock-Down and Western Blot HSPC117 mRNA was targeted with a commercial pool
of 4 siRNAs designed to specifically bind HSPC117 mRNA, ON-TARGETplus Human C22orf28 (51493) siRNA –
SMARTpool (Dharmacon). AllStars Negative Control siRNA-1027281 (Qiagen) was used as a negative
control. The siRNA pools were transfected into naïve Huh7.5 cells plated on the previous day in a 24-well
plate well with 3*104 Huh7.5 cells/well. Before transfection, the media volume in each well was adjusted to
exactly 450ul. To prepare transfection, 30ul RNAiMAX diluted in 1mL Opti-MEM was mixed 1:1 with the
24
siRNA pool diluted to 2 or 20nM in Opti-MEM. After 5 minutes incubation at RT, 50uL of the transfection
mixture was applied to each well. 48 hours later, the cells were trypsinized, washed in PBS, spun down and
frozen at -80oC.
The cell pellets were thawed on ice and lysed with 100µL cold RIPA buffer with cOmplete, Mini Protease
Inhibitor Cocktail Tablets, EDTA free (Roche). Upon addition, the samples were kept on ice for 10 min and
vortexed frequently. 3 μl of RQ1 DNAse (Promega, M6101) was applied to each tube, which then incubated
at 37° for 5 min at 1000 rpm. Afterwards, the samples were centrifuged at 14,000 x g, 4C for 15 min and
the supernatant was transferred to a new Eppendorf tube. The protein concentration of each sample was
determined with the BCA kit (Pierce) according to the company protocol.
For each sample, 5ug protein was diluted in NuPAGE sample buffer (4x), reducing agent (10x) and RIPA-
buffer to a final volume of 22ul. The samples were heated to 70C for 10' and loaded on a 10% PAGE gel.
5uL Precision Plus Protein Western C Standard (BioRad) was used as a ladder. The gel ran for 1 hour at
150V, 100mA. Next, the protein was transferred from the gel to a PVDF membrane by wet electro transfer
(Invitrogen mini). The transfer ran for 1h30m at 30V in NuPage transfer buffer with 10% methanol. During
the transfer the chamber was placed on ice to avoid overheating.
Immunoblotting was performed to visualize HSPC117 and beta-actin on the membrane: After a 20 minutes
block in PBS/Tween 3%BSA at RT, the membrane was incubated ON at 4C with agitation in PBS /Tween 3%
BSA with Anti-C22orf28 antibody (Abcam ab118290) 0.2µg/ml + anti beta-actin(1:5000). Next day, the
membrane was rinsed twice in PBS, and washed 3 times in PBS/Tween for 5min with agitation.
Subsequently the membrane incubated for 30 minutes with agitation in PBS/Tween with 3% BSA, the
secondary horseradish peroxidase (HRP) conjugated antibody Donkey anti-Goat-HRP (JIR 712-035-147)
1:50000 and secondary antibody against the ladder (1:10,000). The membrane was rinsed twice in PBS,
and washed 3 times in PBS/Tween for 5min with agitation and developed with West Femto (Pierce)
according to protocol. The membrane was visualized with a Universal Hood III (Biorad). To envision beta-
actin, the membrane was again rinsed twice in PBS, and washed 3 times in PBS/tween for 5min with
agitation, and incubated for 30 minutes with goat anti-mouse Ig-HRP coupled (1:10,000) in PBS/Tween. The
actin band was developed with Clarity Western ECL substrate (Biorad) according to the standard protocol.
25
Methods Appendix 1, Primers:
Primers for recombinant analysis
Primer name Binds HCV Sequence Function
4796R_JFH1 5’CCTACCAAGCTACGGTGTGCGC RT-primer for extracted virus d, e, f RNA
JF1593 5’GCAGCTGGCACATCAACC 1st
forward primer for short and long PCR
JF1848 5’CTGTGTGTGGCCCAGTGTAC 2nd
forward primer for short and long PCR
4118R_JFH1 5’GATATAGAAGAGGTAGGCCTCGGGCG 1st
reverse primer for long PCR
JR3294 5’CATCTTCAGTCCGATGGAGAA 1st
reverse primer for short PCR
JR4041 5’CAGGTCGGGTACTTGCATGC 2nd
reverse primer for long PCR
2763R_J6 5’CCGTACTTCGTCAGGGCTCACGCT 2nd
reverse primer for short PCR
J6‐JFH1-9472-RT 5’AGCTATGGAGTGTACCTAGTGT RT-primer for extracted virus f RNA
JFH1-303-F CTT 5’GCGAGTGCCCCGGGAGG Forward primer for full-length PCR of virus f
JFH1-9467-R 5’TGGAGTGTACCTAGTGTGTGCCGCTC Reverse primer for full-length PCR of virus f
Primers for 5’ RACE analysis
Primer name Binds HCV Sequence Function
SP11a2a4a5a6a7aR443 5’CCCCTGCGCGGCAACAAGTA Reverse transcription of 5’end for RACE
SP2 2aR397 5’CCGCCCGGAAACTTAACGTCTTGT 1st
PCR reaction for RACE, reverse
AUAP-T20NV (TS-O-00178) 5’GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTT
TTTTVN
1st
PCR reaction for RACE, forward A-tail
AAP (included in 5’RACE kit) 1st
PCR reaction for RACE, forward C-tail
SP3 2a2b3a5aR352 5’GTGTTTCTTTTGGTTTTTCTTTGAGGTTTAGGA 2nd
PCR reaction for RACE, reverse
AUAP (included in 5’RACE kit) 2nd
PCR reaction for RACE, forward
21R_HCV (nt 297-320) 5’TCCCGGGGCACTCGCAAGCGCCCT Sequencing of 5’RACE PCR products
Methods Appendix 2, PCR programs:
5’RACE - 1st
and 2nd
PCR reaction: 2’ 95oC, 40x (30’’ 95
oC, 40’’56
oC, 1’ 68
oC), 5’ 68
oC.
Recombinant d, e, f characterization nested Advantage 2 PCR: 1st program: 3’ 95oC, 31x (35’’ 95
oC, 30’’65
oC, 4’
68oC), 7’ 68
oC. 2
nd program: 3’ 95
oC, 35x (35’’ 95
oC, 30’’65
oC, 4’ 68
oC), 3’ 68
oC.
Full-length PCR of virus f: 30’’ 98oC, 35x (10’’ 98
oC, 10’’65
oC, 8’ 72
oC), 8’ 72
oC, ∞4
oC.
Nested PCR of Full-length PCR of virus f: 2’ 95oC, 25x (20’’ 95
oC, 10’’55
oC, 4’ 70
oC), 5’ 70
oC, ∞4
oC.
26
Results
Observation of HCV RNA Recombination in Cell Culture
To observe virus RNA recombination in cell culture, a setup where only recombination events would lead to
viable viruses was used. The HCV genomes J6CF (also known as J6) and JFH1∆E1E2 (see Figure 7) cannot
produce virus particles in culture, but they have the potential to complement each other by recombination.
J6CF is a genotype 2a wildtype HCV that cannot replicate in culture. JFH1∆E1E2 is JFH1 with a deletion of
the envelope proteins E1 and E2. Because of this deletion, JFH1∆E1E2 cannot make virus particles, but the
genome can still replicate in cell culture.
Figure 7: The HCV genotype 2a genomes JFH1∆E1E2 and J6CF. JFH1∆E1E2 is a modified JFH1 genome with a partial deletion of the envelope protein. These genomes were used due to their inherent lack of ability to produce viral particles in cell culture, combined with that recombination of the two can lead to fully functional viruses. Figure from Scheel et al 2013.
A potential recombinant virus with structural genes from J6CF and non-structural genes from JFH1 would
be similar to the reference laboratory strain HCV J6/JFH1, therefore we know that the proteins function
together. J6CF and JFH1∆E1E2 have previously been used together to observe RNA recombination in a
study by Scheel, Galli et al. (2013). A similar setup was used here, expecting to discover novel recombinants
of the same type.
In vitro transcribed (IVT) RNAs of J6CF and JFH1∆E1E2 were co-transfected into naïve Huh-7.5-MAVS cells in
three replicate wells. Transfections of J6/JFH1, J6CF and JFH1∆E1E2 IVT RNA individually were included as
controls. As expected, the J6CF control did not give any signal in immunostainings at any time point.
JFH1∆E1E2 positive immunostaining of 25% of the cells decreased to 0% over 6 days. A similar infection
decrease was observed for the three replicates of J6CF+JFH1∆E1E2 termed d, e, and f: all were 10%
infected 1 day post transfection (dpt) and 6dpt the infection percentage had decreased to 1%, 5% and
0.1%, respectively. From 6 dpt to 8 dpt an increase in virus positive cells was observed. Infection had
further increased 10dpt to 80% in culture d and to 90% in culture e. Culture d and e remained ≥90%
infected at all later measurements. The infection of culture f developed differently: at 10 dpt the infection
had dropped to 1%. Thereafter the infection percentage increased again, but more slowly than what was
seen for culture d and e. When culture f reached 50% infection on 19dpt, culture d and e had been infected
≥80% for nine days (Figure 8).
27
Figure 8: Virus infection over time in wells transfected with J6CF and JFH1∆E1E2 IVT RNA. Cell culture d, e and f were co-transfected with J6CF and JFH1∆E1E2. J6CF and JFH1∆E1E2 individually were included as negative controls, and J6/JFH1 is included as positive control. Percentage infected cells was estimated with immunostaining targeting NS5A.The decrease of J6/JFH1 was observed upon substantial cell death.
Table 1: Peak infectivity titers from supernatant of the transfection culture for recombinant d, e and f ± standard deviation. J6/JFH1 was a representative sample from another experiment. NQ: Below level for quantification. Titers were produced by immunostaining and manual scoring of focus forming units of cell in a 96w infected with a diluted series of supernatant from cell culture.
Log(FFU/mL) Dpt
Virus d 4.0 ± 0.12 15
Virus e 3.7 ± 0.19 15
Virus f NQ 19, 23, 26
J6/JFH1 3.6 ± 0.01 Control
Huh-7.5-MAVS cells were selected for ease of culture infection estimation. However, the relatively weak
signal from red nuclei compared to the many red cytoplasms made estimation of fluorescence relocation
difficult. Therefore the Huh7.5-MAVS cells were immunostained with a NS5A-antibody and processed as
standard Huh7.5 cells.
Supernatants were harvested at each cell split. Infectivity titers were determined for virus d and e from 15
and 19 dpt, and for virus f at 19, 23 and 26 dpt. Virus d and e produced titers similar to the control J6/JFH1,
whereas the titers of virus f were below the lower level of quantification, mirroring its slow infection.
To separate replicating recombinant genomes from input, supernatants from culture d, e and f were
passaged onto naïve Huh-7.5 cells. In 10 days virus d and e both established 100% cell culture infection.
Virus f was significantly slower- it started spreading around day 10 and took approximately 20 days to
establish a full cell culture infection (Figure 9). The passage was done by applying supernatant from the
transfection experiment in the dilution 1:1, not taking viral titers into account. The much lower FFU of
0 5 10 15 200
25
50
75
100
Days post transfection
Perc
enta
ge Infe
cte
d C
ells J6/JFH1
J6CF
JFH1E1E
d: J6 + JFH1E1E2
e: J6 + JFH1E1E2
f: J6 + JFH1E1E2
28
recombinant f as compared to recombinant d and e means that this inoculum contained much fewer FFUs
than the passages of recombinant d and e, respectively.
Figure 9: Percentage infected cells over time for first passage of virus d, e and f. Supernatants from cell cultures co-transfected with J6CF and JFH1∆E1E1 were passaged to naïve cell cultures, and infection was estimated by immunostaining with a NS5A antibody.
Table 2: Peak Infectivity titers of 1
st passage virus d, e and f ±
standard deviation. NQ: Below level for quantification. Titers were produced by HRP-coupled immunostaining and CTL- scoring of focus forming units of cell in a 96w infected with a diluted series of supernatant from cell culture.
Log(FFU/mL) Dpt
Virus d 4.3 ± 0.04 8
Virus e 4.1 ± 0.02 8
Virus f NQ 21, 23, 26
Infectivity titers of the first passage were determined for virus d and e supernatants from 6 and 8 dpi.
Supernatants from 21, 23 and 26 dpi were used for virus f. Peak titers were 4.3 log(FFU/mL) for virus d, 4.1
log(FFU/mL) for virus e, and below the lower level of quantification for virus f.
A reverse transcription was made on RNA extracted from supernatants from 5 and 14 dpi for virus d and e,
and from 21 and 26 dpi for virus f. From the resulting cDNA two nested PCRs in the region nt1848 to nt4041
or nt2763 were made and used for sequencing. Based on data from a previous study, this region was
expected to contain the recombination junction (Scheel et al. 2013).
The resulting PCR bands were purified and sequenced. The resulting reads gave a clear sequence showing
recombination junctions for recombinant d and e (Figure 10).
The junction of virus d was from J6CF nucleotide 2805 (NS2-encoding region), to nucleotide 2233 (end of E2
-not part of the deletion) of JFH1∆E1E2. This corresponds to an in-frame insertion of 573 nucleotides.
Recombination for virus e occurred between nucleotide 2844 of J6CF, also in the NS2-region, and
nucleotide 831 of JFH1∆E1E2, in the core-encoding region. This corresponds to an in-frame insertion of
1053 nucleotides.
0 10 20 300
25
50
75
100
Days post infection
Perc
enta
ge Infe
cte
d C
ells
Virus d
Virus e
Virus f
29
Figure 10: The recombinant genomes of virus d and e. Recombinant d (top) has a junction at nt2805(NS2)-nt2233(E2), and recombinant e (below) has a junction at nt2844(NS2)-nt831(core). Blue depicts J6CF-sequence, and purple depicts JFH1∆E1E2-sequence. Only the recombination junction was sequenced, so additional recombination or mutation might exist in other genomic regions.
A similar strategy for recombinant f was inconclusive. Based on previous findings, we deemed it unlikely
that the infectious virus was an adapted full-length J6 genome rather than a recombinant (Gottwein et al.
2010).
Therefore, cDNA covering the complete ORF was made from RNA extracted with trizol. From this cDNA a
complete ORF PCR product was made. This PCR product was then used as template for four different PCR
reactions with a forward primer placed in the E1E2 region, which is deleted in JFH1∆E1E2, and 4 different
reverse primers placed in the interval nt3103 to nt5136. For the first reverse primer, the length of the
resulting PCR product was as expected for wildtype J6. The next three reverse primers gave bands 1-1.5kb
longer than expected from a wildtype 2a genome. This indicated that recombinant f contains nucleotide
3103 of J6 but not nucleotide 4041 (Figure 11).
The direct sequencing read of at the band in lane 2 (Figure 11) based on JF1848 and JR4041 primers were
unclear, potentially due to that virus f contains binding sites for the same sequencing primer in J6CF and
.
Figure 11: Characterization of virus f. The products of nested PCR based on a full-length ORF PCR of virus purified from culture f supernatant were analyzed on a 1% agarose gel. Forward and reverse primer binding sites for the nested PCR and expected band length are shown below each lane. The expected band length assumes only J6CF sequence.
30
JFH1 sequence. Therefore the fragment was TOPO TA cloned and 5 clones were sequenced. Clone 2, 4 and
5 gave clear reads, and surprisingly contained three different recombination junctions (Figure 12). This
further explained why sequencing of the purified PCR band before TOPO TA cloning did no provide clear
sequences.
Clone 2 had J6CF sequence until nt 4005 (beginning of NS3) followed by JFH1 sequence starting at nt 2779
(5bp into NS2), which corresponds to an in-frame insertion of 1227 nucleotides. Clone 4 sequence had J6CF
sequence until nt 3683 (beginning of NS3), two inserted thymidines and then JFH1 sequence from nt 2818
(early NS2), corresponding to an out of frame insertion of 868 nucleotides. Clone 5 was a homologous
recombinant, which had recombined somewhere in the region nt 3932-3959 (about 500bp into NS3),
where J6CF and JFH1 are identical.
The finding of three recombination events in a single cell culture revealed that more recombinants might
co-occur in a single culture, and we might typically only observe the fittest recombinant. In the case of only
attenuated recombinants, these can co-exist for an extended period. Also, long insertions might be
removed by further recombination, as seen in a previous study (Scheel et al. 2013). This is potentially what
we observed for clone 5, which might have emerged as a recombinant of clone 2 not long before the
sampling and would have taken over eventually. Also clone 4 could be a further reduced version of clone 2.
Figure 12: The genomes of the recombinants clone 2 (top), clone 4 (middle) and clone 5 (bottom) from culture f. Based on sequencing of TOPO TA clones containing the recombinant junction. Only the recombination junction was sequenced, so additional recombination or mutation might exist in other genomic regions. Light blue represents J6CF and purple represents JFH1∆E1E2. The exact junctions are described in the text.
In conclusion, four new heterologous recombinants and one new homologous recombinant of J6CF and
JFH1∆E1E2 were characterized here. Two of the heterologous and the homologous recombinants were
extracted from the same cell culture. These results suggested that more recombinants are likely to occur in
the same culture and over time one recombinant is selected for.
Preparations for Setting up a Recombination Treatment Escape Assay Upon confirmation of emergence of functional virus recombinants from two attenuated virus genomes in
cell culture, the aim here was to test if resistance towards different HCV DAAs could be collected in a single
genome by recombination.
Below follows a description of the process of resistant virus strain and drug selection, assessment of virus
co-transfection and co-infection, tests of drug delivery and concentrations, and final setups of
recombination treatment experiments.
31
Selection of Virus Strains
Two virus strains reciprocally resistant and sensitive to two differently targeting DAAs were selected to
enable recombinant selection by treatment of co-transfected or -infected cells with two DAAs (see Figure
13).
Figure 13: Conceptualization of the recombination selection strategy.
Recombination probability (disregarding recombinant survival) increases with genetic distance (Reiter et al.
2011), so drugs used for the experiment were chosen to hit targets related to genomic areas separated by a
maximal number of nucleotides. Also, drugs were chosen based on the fact that resistance would not occur
with only one point mutation. With that in mind, the NS5A inhibitor daclatasvir and the miR-122 HTA,
miravirsen, were chosen. The target of Daclatasvir, NS5A, is encoded by nt 6258-7601 (gt 1, NCBI Reference
Sequence: NC_004102.1) and daclatasvir resistance mutations are observed in domain I of that region
(Wyled 2012) . The genomic target of miravirsen is in the other end of the genome at the 5’ UTR miR-122
binding sites.
Due to the combination of high daclatasvir resistance and requirement of a number of mutations to escape
miravirsen, J6-18 was selected for drug escape recombination studies. J6-18 is a J6/JFH1-based
recombinant virus with a NS5A swap from JFH1 sequence to J6 sequence, the cell culture adaptive
mutation T2667C in p7, and the three resistance mutations T6350C (F28L), A6452G (N62D) and T6545C
(Y93H). The EC50 of this virus to Daclatasvir is 9165nM (Judith Gottwein, unpublished), for J6/JFH1 it is
0.10 nM and it is 14.0 nM for J6/JFH1-J6NS5A (Scheel et al. 2011), so the J6-18 daclatasvir EC50 value is
more than 50,000 fold higher than for J6/JFH1.
HCV escape of a sufficient miravirsen treatment requires multiple mutations e.g. by changing miRNA
tropism to a different miRNA (Luna et al. 2015). We hypothesized that J6-18 was incapable of escaping
miravirsen with point mutations. Ottosen et al. (2015) saw miravirsen escape or breakthrough after 72 days
of treatment, but they could not confirm an observed mutation as resistance-mediating.
For the recombinant virus m15-J6/JFH1 the 5’UTR miR-122 seed sites are swapped with miR-15 seed sites.
This eliminated the requirement of miRNA-122, and instead miR-15 is necessary. The eliminated
requirement of miRNA-122 causes miravirsen resistance. Here, m15-J6/JFH1 was combined with J6/JFH1-
J4NS5A (genotype 1b) with the cell culture adaptive mutations R867H and C1185S (Scheel et al. 2011).
J6/JFH1-J4NS5A with these mutations has a daclatasvir EC50 value of 0.009 nM (Scheel et al. 2011), thereby
32
being 106 times lower than J6-18. The recombinant genome m15-J6JFH1-J4NS5A with adaptive mutations
was named m15-J4NS5A in this text.
Figure 14: Schematic representation of J6-18 (above) and m15-J4NS5A (below). Both genomes are based on J6/JFH1. In J6-18, NS5A has been swapped with J6-sequence with mutations T2667C, T6350C, A6452G and T6545C. In m15-J4NS5A, NS5A has been swapped with J4 sequence (genotype 1b) and the two miRNA-122 seed sites in the 5’UTR have been replaced with miRNA-15 sites. Furthermore the m15-J4NS5A has the mutations R867H and C1185S (not depicted).
To characterize the new recombinant genome m15-J4NS5A, spread of infection in cell culture upon
transfection with a fixed amount of IVT RNA was compared to the strains that it origins from; J6/JFH1-
J4NS5A with adaptive mutations and m15-J6/JFH1. J6/JFH1 was included as a reference. Due to its role in
the study, J6-18 and the strain that it was developed from, J6/JFH1-J6NS5A, were also included in the virus
fitness characterization.
Figure 15: Viral fitness characterization of J6/JFH1, J6/JFH1-J6NS5A, J6-18, m15-J4NS5A, J6/JFH1-J4NS5A and m15-J6/JFH1. Huh-7.5 cell cultures were transfected with J6/JFH1, J6/JFH1-J6NS5A, J6-18, m15-J4NS5A, J6/JFH1-J4NS5A and m15-J6/JFH1 IVT RNA and percentage infected cells were followed over time by immunostaining with Core-antibodies.
Based on measurement of transfected RNA an identical number of genomes were present intracellularly in
the cultures upon transfection, but it did not cause the same kinetics of infection. The J6/JFH1-transfected
culture was 60% infected 1dpt. At that time, J6JFH1-J6NS5A, J6-18, and J6JFH1-J4NS5A cultures were 30%
infected, m15-J6JFH1 was 5% infected and m15-J4NS5A was only 1% infected. This shows that the
swapped NS5A initially affects the number of virus-positive cells in a similar way for J6JFH1-J6NS5A, J6-18
and J6JFH1-J4NS5A. At later time points, J4NS5A caused less infection than J6NS5A. Also a clear
disadvantage was related to miRNA-15 binding sites instead of miRNA-122 sites (Figure 15).
Over time the J6/JFH1 and J6/JFH1-J6NS5A cultures progressed almost as efficiently as J6-18, and J6JFH1-
J4NS5A was slightly more attenuated. J6/JFH1-J4NS5A and m15-J6JFH1 infection spread occurred slowly
compared to J6/JFH1 infection spread from the same amount of IVT RNA, indicating that the J4NS5A and
m15 modifications delay virus infection and spread in cell culture. m15-J4NS5A had delayed kinetics
compared to both the viruses it was created from.
0 4 8 120
50
100
days post transfection
Perc
enta
ge Infe
cte
d C
ells J6JFH1
J6JFH1-J6NS5A
J6-18
m15-J4NS5A
J6JFH1-J4NS5A
m15-J6JFH1
33
In conclusion all constructs planned for use in treatment recombination experiments were viable, although
m15-J4NS5A was clearly attenuated.
Comparison of Double Transfection Versus Infection
Cellular coinfection of two different virus strains is a prerequisite for RNA recombination, so different
methods for achieving virus-double-positive cells were tested. For this, EGFP-expressing J6/JFH1d40-EGFP
and mCherry-expressing J6/JFH1d40-mCherry were used. Thereby fluorescence microscopy of infected cells
could provide semi-quantitative estimates of presence or absence of the two differently fluorescing viruses.
J6/JFH1d40-EGFP has a 40 nucleotide deletion of J6/JFH1 7016-7135 and an EGFP 716nt insertion between
nt 7522 and nt 7523. J6/JFH1d40-mCherry has the same deletion and mCherry inserted instead of EGFP.
(Gottwein et al 2011).
IVT RNA transfection of J6/JFH1d40-EGFP, J6/JFH1d40-mCherry or both RNAs simultaneously was
performed on cells in Opti-MEM or in DMEM+10%FBS. Opti-MEM transfection required an extra step of
changing media 4-6 hours after transfection.
Figure 16: Infection over time in cell culture transfected with J6/JFH1d40-EGFG, J6/JFH1d40-mCherry or both. Dashed lines indicate that transfection occurred in Opti-MEM, and unbroken lines indicate that it happened in DMEM. Percentage infected cells was estimated by fluorescence microscopy using the inherent fluorescence of the viruses.
Transfection of cells in the two different media yielded similar results. The Opti-MEM transfection had
higher infection rates at late time points (Figure 16). This experiment could be repeated to determine
whether this was random variation or an actual difference. Because of the small potential difference and
less hands-on work, subsequent virus transfections were made in DMEM+10%FBS.
Individually, J6/JFH1d40-EGFP and J6/JFH1d40-mCherry transfection led to similar spread of infection; 80 %
infection was reached within 4 days. For double-transfections, the infection pattern of J6/JFH1d40-mCherry
was similar to that of single-transfected J6/JFH1d40-mCherry, whereas J6/JFH1d40-EGFP appeared to be
outcompeted by J6/JFH1d40-mCherry (Figure 16). This reduction of J6/JFH1d40-EGFP signal was most likely
due to the previously described principles of superinfection exclusion (Schaller et al. 2007; Tscherne et al.
2007). Superinfection exclusion decreases the possibility of recombination between genomes of two
different strains. The percentage of double-positive cells was not easily estimated from fluorescence
microscopy, and therefore exact scores of double-positive cells were not included.
0 2 4 6 8 100
25
50
75
100
Days post transfection
Perc
enta
ge infe
cte
d c
ells J6/JFH1d40-EGFP
J6/JFH1d40-mCherry
J6/JFH1d40-EGFP double transfection
J6/JFH1d40-mCherry double transfection
J6/JFH1d40-EGFP
J6/JFH1d40-mCherry
J6/JFH1d40-EGFP double transfection
J6/JFH1d40-mCherry double transfection
34
Next, I tested if virus double-positive cells could be more efficiently achieved with high multiplicity of
infection (MOI). Flow cytometry was employed, because it presumably could enable accurate estimation of
double-positive cells.
Supernatant from the J6/JFH1d40-mCherry and J6/JFH1d40-EGFP transfections above was passaged on to
naïve Huh-7.5 cells and collected over time. Subsequently, infectivity titers were determined from samples
of the collected supernatant. The peak infectivity titers of J6/JFH1d40-mCherry and J6/JFH1d40-EGFP were
measured to be 3.9 log(FFU/mL) and 4.6 log(FFU/mL), respectively. These titers were not sufficient to
enable infection with high MOI. Thus the J6/JFH1d40-EGFP and J6/JFH1d40-mCherry viruses were grown in
a large volume by passage of the supernatant used for infectivity titers, and the supernatants were
collected and concentrated. The volume of J6/JFH1d40-mCherry supernatant was reduced with a factor
100 and log(FFU/mL) went from 3.9 to 6.2. J6/JFH1d40-EGFP was concentrated 45 times resulting in change
of infectivity titer from 4.6 log(FFU/mL) to 6.8 log(FFU/mL).
For the recombination studies, a high initial infection was desired. Upon infection, the initial percentage
infected cells can be derived from the Poisson distribution as a function of applied virus particles per cell.
The percentage of cells infected by at least 1 particle can be calculated as1 − 𝑒−𝑀𝑂𝐼, e being Euler’s
number. Based on this, MOI=4 causes a 98.2% infection, which was deemed suitable and used for a flow
cytometry based experiment.
To establish the flow cytometry analysis, naïve Huh-7.5 cells were first infected with a MOI=0.1 (expected
to infect 9.5% of the cells based on Poisson calculations). The cells were analyzed 1 and 2 days post
infection. On day 1, no fluorescence above background level was measurable. On day 2, measurable
fluorescence was observed, so gates were set with cells from this time point.
The cells were gated on forward and side scatter to accept the majority of single cells with typical
morphology. Larger counts, which could represent cell clumps, were discarded. Gated events were plotted
based on fluorescence registered by a FITC-A filter and PE-Texas Red-A filter. Like FITC-A, EGFP is excited at
488nm and emission curves are similar. mCherry has an excitation maximum at 587nm and emission
maximum at 610 nm, but due to lack of a laser with the right wave-length, the PE-Texas Red-A fluorescence
(with emission maximum at 613nm) was used with excitation at 488nm.
Within this FITC-A ,PE-Texas Red-A plot three gates, P2,P3 and P4 were defined as P1 sub-populations
(Figure 17). P2 contained the fluorescence patterns of uninfected cells, P3 contained increased mCherry
fluorescence and P4 increased EGFP fluorescence. A gate with combined EGFP and mCherry fluorescence
was not set, because too few cells fell where it would have been defined.
35
Figure 17: Huh-7.5 cell gates P1 (left) was subdivided into P2, P3 and P4. Shown measurements are for double infection with MOI=0.1 of J6/JFH1d40-mCherry and J6/JFH1d40-EGFP. P1 was set to include standard size and granularity, and the subpopulations were based fluorescence. P2 was set based on an uninfected a cell population and represented cellular background fluorescence. P3 contained a population of increased mCherry-fluorescence, and P4 contained increased EGFP-fluorescence.
For MOI=0.1, 4.1 % of the J6/JFH1d40-mCherry infected cells fell within P3 and 0.0% fell within P4. For the
J6/JFH1d40-EGFP infected cells, 5.7% of the cells fell within the EGFP-gate and 0.3% fell within the gate
defined for mCherry. Cells infected with both J6/JFH1d40-mCherry and J6/JFH1d40-EGFP had 3.5% of the
cells in the mCherry-gate and 3.9% cells in the EGFP-gate. No double-positive cells could be identified. The
uninfected control cells had 0.1% mCherry cells and 0% EGFP-cells. The distribution of the MOI=0.1 cells is
also shown in Table 3. As expected from the low MOI, no double-positive cells were observed in this
experiment. However, it established conditions for which GFP and mCherry positive cells could be
quantified.
MOI=0.1 Total events P1 Percentage of P1 in gate
P2 P3 P4
Control 1941 99.3 0.1 0.0
mCherry 5911 95.2 4.1 0.0
EGFP 1874 84.7 0.3 5.7
mCherry+EGFP 3388 91.6 3.5 3.9
Table 3: Distribution of MOI=0.1 infected-cells within the described gates. P1 contains Huh-7.5 cell of standard size and granularity. P2, P3 and P4 are subpopulations of P1 with differences in fluorescence. Further gate descriptions can be found in the text.
Upon optimization of conditions for flow cytometry, Huh-7.5 cells infected with MOI=4 were harvested on
day 2 and measured with flow cytometry. For the MOI=4 cells, the P1 was 19.7% on average compared to
41.1% on average for the the MOI=0.1 setup. This could potentially be caused by a too narrow definition of
P1, or a MOI=4 cell population of low quality due to cell aggregation and/or partly cell death. Based on the
MOI, the percentages of fluorescent cells were lower than expected (Table 4).
36
MOI=4 Total events P1 Percentage of P1 in gate
P2 P3 P4
Control 7797 99.6 0.1 0.0
mCherry 655 56.5 3.4 0.0
EGFP 4032 79.5 0.0 10.5
mCherry+EGFP 1321 83.1 3.8 3.2
Table 4 : Distribution of MOI=4 cells within P2, P3 and P4. P1 contains Huh-7.5 cell of standard size and granularity. P2, P3 and P4 are subpopulations of P1 with differences in fluorescence. Further gate descriptions can be found in the text.
Whereas infection with MOI=4 is a 40 fold increase in virus particles compared to the MOI=0.1 infection,
and was expected to increase infection to almost 100%, the EGFP-fluorescence only increased with about a
factor 2. The percentage of J6JFH1d40-mCherry infected cells was similar for the MOI=0.1 and MOI=4.
This low percentage of fluorescent cells of the MOI=4-infected cells could be caused by lack of infection or
by loss of fluorescence. A previous study described loss of green fluorescence from sequential passage of
J6/JFH1d40-EGFP due to partial deletions of the EGFP-insertion (Gottwein, Jensen, et al. 2011).
To examine if the unexpected low fluorescence was caused by a partial deletion of the inserted EGFP, RNA
was extracted from the J6/JFH1d40-EGFP concentrated supernatant. Subsequently, the extracted RNA was
used as a template for reverse transcription, and a PCR of the EGFP-insertion region was based on the
resulting cDNA. The PCR product was run on an agarose gel and showed no obvious deletions, so the gel
band was purified and sequenced. The obtained sequence aligned perfect to the J6JFH1d40-EGFP genome,
so the attenuated fluorescence was not caused by deletions or disruptive mutations in the EGFP-gene.
In conclusion, it was more challenging to obtain the right conditions for co-infection at high MOI, compared
to co-transfection. Therefore, and in the interest of time for my studies, the following treatment-escape-
recombination study was based on transfections.
Daclatasvir Treatment Pilots
A treatment pilot was set up to determine daclatasvir concentrations capable of suppressing mi15-J4NS5A
for the estimated duration of a recombination experiment. Cells transfected with m15-J4NS5A were
treated with daclatasvir concentrations in the range 10 nM to 3000nM 3 times weekly starting 1 dpt.
Untreated cells were included as a control.
In the recombination study of J6CF and JFH1∆E1E2, infection emerged in the double transfected wells
within 8-10 days and turned out to be caused by recombination events in all cases. To take biological
variation into account, the treatment pilot was set to run for 18 days.
An initial infection of about 5% was observed for all cultures 2 dpt. Infection increased to 7.5% (3000nM),
10% (100nM, 300nM and 1000nM), 15% (10nM) and 20% (0nM) 4 dpt. Thereafter the infection decreased
again for all treated wells, and was cleared to below detection level 9dpt (Figure 18).
37
Figure 18: Percentage infected cells in m15-J4NS5A transfected cultures treated with 0 nM to 3000 nM daclatasvir. 10nM to 3000nM daclatasvir all suppressed infection to below detection level within 9 days and kept virus undetectable until experiment termination on 18dpt. Percentage infected cells were estimated by immunostaining with NS5A-antibodies.
Cell fractions from each culture were left untreated from 15dpt, to see if potentially remaining virus could
let to a detectable infection within two days. In the cultures previously treated with10nM and 300nM
infected cells were detected. See Table 5.
In recombination experiments, virus suppression would potentially be required for longer than 18 days.
Therefore due to risk of treatment escape at concentrations where the virus was present shortly after
treatment removal, treatment with 1000nM daclatasvir was selected for later double treatment of double-
transfected cell cultures.
Daclatasvir concentration
0nM 10nM 100nM 300nM 1000nM 3000nM
Infected cells 2% 1% 0% 1% 0% 0%
Table 5: Percentage infected cells in m15-J4NS5A transfected cultures on 20 days post transfection. Daclatasvir treatment was terminated 18 days post transfection. Percentage infected cells were estimated by immunostaining with NS5A-antibodies.
To confirm J6-18 resistance towards daclatasvir, Huh-7.5 cells transfected with J6-18 were treated with
1000nM daclatasvir from 1 day post transfection. 100 percent infection occurred within 5 days, which was
similar to an untreated control.
Miravirsen Influence on Available Intracellular miR-122
We hypothesized that a miravirsen concentration capable of depleting miR-122 to a level below availability
for cellular miRNA functions would also cause miR-122 levels insufficient for HCV. To determine a sufficient
concentration and a delivery method for miravirsen, a psiCHECK-2 vector reporter system based on miRNA
-induced downregulation of luciferase activity was used. PsiCHECK-2 vectors encoding the luciferase genes
Firefly and Renilla with a miR-122 seed or a mutated miR-122 seed in the 3’ UTR.
The miRNA-binding sites were co-transcribed with the Renilla luciferase, thus binding of miRNA to the
mRNA led to a decrease in transcription. Therefore the decrease in Renilla activity was a measurement of
RNAi. Unregulated Firefly activity was used to normalize Renilla activity.
0 5 10 15 200
50
100
Days Post Transfection
Perc
enta
ge Infe
cte
d C
ells 0nM
10nM
100nM
300nM
1000nM
3000nM
38
0nM, 0.64nM, 2.56nM, 10.24nM or 40.96nM miravirsen were either lipofectamine transfected or added to
the growth media of cells, followed by transfection with psiCHECK2-miR122 or psiCHECK2-miR122mutated on
the next day. Changes of available miRNA-122 concentrations were measured by a luciferase activity assay
of transfected cells. The Renilla:Firefly ratio (RLUC/FLUC) without miRNA binding was obtained from 0nM
miravirsen cells transfected with the psiCHECK2-miR-122mutated vector.
In absence of miravirsen the mean RLUC/FLUC was 40% lower for the psiCHECK-2-miR122 than for the
psiCHECK-2-miR122mutated indicating down-regulation of RLUC for psiCHECK-2-miR122. The expected
reversal of this down-regulation was seen in the presence of miravirsen of psiCHECK2-miR122-transfected
cells (Figure 19). The effect was seen in cells treated with 0.64nM and there was a tendency of dose
dependency with saturation occurring around 10nM (Figure 19).
Higher Renilla:Firefly activity ratios of all miravirsen-treated, psiCHECK-2-miR122 transfected cells
compared to the untreated mi122mut (Figure 19), could potentially be caused by a reduced but remaining
capacity of miRNA122-binding to the mutated mi122 site, or binding of a different miRNA to the mutated
site. Luciferase measurements of miravirsen treated and psiCHECK-2-miR122mutated transfected cells could
have been a control for the former. However, based on previous results with no such difference (Luna et al.
2015), it is also possible that it simply is a result of biological variation.
Miravirsen treatment without lipofectamine RNAiMAX transfection gave the highest RLUC/FLUC (Figure
19). This could potentially be due to random sampling effects, that delivery without RNAiMAX is more
efficient than delivery with RNAiMAX, or be caused cell differences induced by transfection on two
consecutive days.
Figure 19: RLUC/FLUC of Huh-7.5 cells transfected with the psiCHECK-2-miR122 or -miR122mut vector and treated with different concentrations of miravirsen. The data was normalized with RLUC/FLUC of PsiCHECK2-miR122mutated with 0nM miravirsen (red bar). All other cultures were transfected with the psiCHECK-2-miR122. Grey bares represent miravirsen delivery with lipofectamine RNAiMAX, green bars represent that miravirsen was diluted in the media.
In conclusion, these data showed that 10nM miravirsen delivered by direct addition to the cell growth
media would be sufficient to suppress miR-122 RNAi. Based on this we assumed that this would also be
sufficient for HCV suppression.
39
Establishment of Therapeutic Treatment Doses of Miravirsen
The EC50 value for un-transfected miravirsen treatment of HCV in cell culture was previously established
(Ottosen et al. 2015), however with doses that would infer unmanageable expenses for long-term
experiments. I therefore went on to establish alternate treatment schemes. Initial conditions for the first
miravirsen treatment pilot were based on the psiCHECK-2 dual-luciferase results. Thus, Huh-7.5 cells were
transfected with J6-18 and from 1 day post transfection (dpt) treated with 0nM, 0.64nM, 2.5nM or 10nM
miravirsen diluted in the growth media DMEM+10%FBS. J6-18 infection was not kept down, and ≥20% of
the cells were infected on 1dpt at all concentrations. To validate that miravirsen could not suppress J6-18
under these conditions, the setup was repeated and showed 100% infection when it was measured 3 dpt
(data not shown).
Due to lack of suppression under the initially chosen conditions, miravirsen concentrations were increased
to 0nM, 10nM and 50nM for J6-18-transfected cells, and 0nM and 50nM for m15-J4NS5A-transfected cells
in pilot b. Despite a delay in infection for the treated J6-18 cultures (Figure 20), J6-18 infection was not
suppressed with 10nM and 50nM miravirsen. As expected, the miravirsen-induced delay of infection of J6-
18 was not observed for m15-J4NS5A. The m15-J4NS5A-transfected cultures treated with 0nM and 50nM
established ≥80% infection 7dpt following a similar infection pattern (Figure 20). Thus, despite of effects on
miRNA activity in the psiCHECK-2 luciferase assay, addition of up to 50nM miravirsen to the media was not
sufficient to prevent J6-18 culture infection.
Figure 20: Miravirsen Treatment Pilot b –treatment by addition of miravirsen to the growth media. Percentage infected cells in cultures transfected with J6-18 or m15-J4NS5A and treated with 0 nM, 10 nM or 50 nM different miravirsen by addition directly to the growth media. The percentage of infected cells was estimated by immunostainings with a Core-antibody.
To test if miravirsen delivery by transfection would improve treatment efficacy, J6-18 transfected cells were
transfected with 0nM, 50nM and 100nM miravirsen using lipofectamine RNAiMAX three times a week,
upon each cell split, in pilot c. To obtain efficient miR-122 inhibition already at the time of viral RNA
delivery, the Huh-7.5 cells were pre-treated with miravirsen 1 day before virus transfection, and miravirsen
further was included in the viral RNA transfection with lipofectamine 2000. As a control, Huh-7.5 cells
initially co-transfected with viral RNA and miravirsen were treated subsequently by addition of 50nM
miravirsen to the growth media without transfection reagent. Surprisingly, all three treatments suppressed
J6-18, even when transfection reagent was not used at treatments post viral RNA delivery (Figure 21).
0 5 100
20
40
60
80
100
dpt
Perc
enta
ge Infe
cte
d C
ells J6-18 0nM
J6-18 10nM
J6-18 50nM
m15-J4NS5A 0nM
m15-J4NS5A 50nM
40
However, continuous transfections were unhealthy for the cells. 4 dpt the cultures continuously treated by
miravirsen-transfection showed significant cell death. 8dpt the cultures were closed due to massive cell
death. In contrast to what was seen for the 50nM treated culture in pilot b, the culture treated with 50nM
miravirsen without lipofectamine RNAiMAX was capable of suppressing infection for 28 days, suggesting
that inclusion of miravirsen with the viral RNA transfection greatly improved delivery and/or miR-122
inhibition. However, data points past day 13 for 50nM miravirsen without lipofectamine RNAiMAX could be
affected by low cell numbers.
Figure 21: Miravirsen Treatment Pilot c. Percentage infected cells for J6-18 RNA transfected cultures treated by transfection of 0 nM, 50 nM or 100 nM miravirsen, or by addition of 50 nM miravirsen to the growth media. Treatment included pre-treatment and inclusion of miravirsen in the transfection of viral RNA. Substantial cell death was seen in the RNAiMAX-transfected cultures 1-4dpt The percentage of infected cells was estimated by immunostainings with a Core-antibody.
The difference between the 50nM-treated cells in pilot b and pilot c was likely caused by the miravirsen
pre-treatment and/or miravirsen-inclusion in the virus transfection. To confirm whether this was the case,
the miravirsen pre-treatment and virus-miravirsen co-transfection was investigated further in pilot d.
Here, conditions were divided in two arms either with or without miravirsen present during the viral RNA
transfection with lipofectamine 2000. Each of these arms then included one condition where pre-treatment
and treatment with 50nM miravirsen was delivered without transfection, and 0nM, 50nM and 100nM
miravirsen delivered by lipofectamine RNAiMAX transfection. To reduce the cytotoxicity of continued
transfection, transfection mixture was replaced by DMEM+10%FBS without miravirsen after 4-6 hours.
0 10 20 300
20
40
60
80
100
dpt
Perc
enta
ge Infe
cte
d C
ells 0nM+RNAiMAX
50nM+RNAiMAX
100nM+RNAiMAX
50nM no RNAiMAX
41
Figure 22: Miravirsen treatment pilot d – comparison of cultures with and without miravirsen included in the transfection of viral RNA. Percentage infected cells for J6-18 RNA transfected cultures treated by transfection of 50 nM or 100 nM miravirsen, or by addition of 50 nM miravirsen to the growth media. Miravirsen transfection mixture was removed 4-6 hours post treatment. All cultures were pretreated with miravirsen, and in cultures shown with unbroken lines, miravirsen was included in the transfection of viral RNA. The dashed lines depict cultures where the viral RNA transfection did not include miravirsen. The percentage of infected cells was estimated by immunostainings with a Core-antibody
In the culture treated with 50nM delivered without transfection and without miravirsen present in the viral
RNA transfection mixture, the J6-18 virus was detectable from 5 days post transfection and had reached
80% infection 9 days post transfection. This was similar to what was observed in the previous treatment
pilot. Since this culture further had been pre-treated with miravirsen, this indicated importance of
especially miravirsen-inclusion with the virus transfection. 50nM without treatment by transfection and
with miravirsen included in the virus transfection suppressed J6-18, but the culture was closed already 5dpt
due to a handling mistake. Therefore this did not establish whether 50nM miravirsen delivered without
transfection reagent in a setting where it however was co-transfected with the viral RNA was sufficient for
J6-18 suppression.
The 50nM and 100nM treated cultures suppressed J6-18 regardless of whether miravirsen was included in
the virus transfection or not, indicating that miravirsen treatment via transfection is significantly more
efficient than without transfection. With removal of the treatment transfection mixture 4-6 hours post
transfection, treatment was not cytotoxic. Yet, estimated from visual inspection of the cell cultures and
splitting rates at later time points, treatment by transfection hampered the cell growth rate.
Therefore, to avoid the effects of continuous transfections on the cell populations, yet another pilot was
performed to establish whether suppressive effect of miravirsen could be achieved by direct addition to the
media. Thus, the miravirsen concentration was increased further. In pilot e, J6-18 transfected Huh-7.5 cells
were treated with 0nM, 100nM or 500nM miravirsen without transfection-delivery, or with 0nM, 50nM or
100nM transfection-delivered miravirsen with media change 4 to 6 hours post each transfection. The latter
was included to replicate findings of pilot d.
0 10 20 300
50
100
days post transfection
Perc
enta
ge Infe
cte
d C
ells 0nM
50nM
100nM
50nM no RNAiMax
0nM
50nM
100nM
50nM no RNAiMax
42
Figure 23: Miravirsen Treatment Pilot e –pretreatment and inclusion in transfection on viral RNA. Percentage infected cells in cultures transfected with J6-18 IVT RNA and treated by transfection of 0 nM, 50 nM or 100 nM miravirsen, or by addition of 0 nM, 100 nM, or 500 nM miravirsen to the growth media. All wells cultures were pretreated with miravirsen, and miravirsen was included in the transfection of viral RNA. The miravirsen treatment transfection mixture was removed 4-6 hours after transfection. The dashed line symbolizes treatment by lipofectamine RNAiMAX infection, the unbroken line treatment by addition directly to growth media. The percentage of infected cells was estimated by immunostainings with a Core-antibody.
The transfection-based treatments with 50nM and 100nM miravirsen kept J6-18 suppressed for the entire
20 days duration of the treatment. 100nM miravirsen without transfection-delivery did not suppress J6-18,
whereas 500 nM did (see Figure 23). To have a minimize cytotoxicity, treatment with 500nM miravirsen
delivered without transfection was chosen for further studies. The growth of m15-J4NS5A was not tested in
the presence of 500nM, but previously m15-J6/JFH1 has been shown to grow in miR-122 deleted cells (Luna
et al. 2015).
Daclatasvir-miravirsen Double Treatment of J6-18 and m15-J4NS5A Transfected
Cultures To investigate whether HCV RNA recombinants could be selected for from combination treated cultures,
cells pre-treated with 500 nM miravirsen (no transfection reagent) were co-transfected with m15-J4NS5A,
J6-18 and miravirsen, and subsequently from 1dpt treated by addition of 1000nM daclatasvir and 500nM
miravirsen directly to the media 2-3 times per week. As controls, co-transfected cells were untreated or
treated with miravirsen or daclatasvir individually, and cells transfected with m15-J4NS5A or J6-18
individually were treated with daclatasvir, miravirsen or daclatasvir+ miravirsen.
4 days post transfection, the cells transfected with J6-18 and J6-18+m15-J4NS5A and untreated or
daclatasvir treated were 100% infected. The miravirsen-treated cultures transfected with m15-J4NS5A and
J6-18+m15J4NS5A were delayed with at least 80% infected 13-18 days post infection. Miravirsen and
miravirsen+ daclatasvir treatment suppressed J6-18. Similarly, daclatasvir and miravirsen+ daclatasvir
treatment suppressed m15-J4NS5A. After 39 days, no emergence of infection had occurred in the double-
transfected and double-treated cells (Figure 24).
0 5 10 15 20
0
50
100
days post transfection
Perc
enta
ge Infe
cte
d C
ells 0 nM
100nM
500nM
0nM RNAiMAX
50nM RNAiMAX
100nM RNAiMAX
43
a.
b.
Figure 24: Development of percentage infected cells over time of J6-18 and/or m15-J4NS5A IVT RNA transfected cultures treated with miravirsen and/or daclatasvir. Graph a. and b. show six cultures each from the same experiment. a. shows cultures co-transfected with J6-18 and m15-J4NS5A IVT RNA and treated with daclatasvir, miravirsen or both, as indicated in the legend. b. shows control cultures transfected with J6-18 or m15-J4NS5A IVT RNA and treated with daclatasvir, miravirsen or both, as indicated in the legend. Miravirsen treatment consisted of pre-treatment, inclusion in the viral transfection and direct addition to the media every 2-4 days, all with 500 nM. Daclatasvir treatment occurred from 1 day post transfection (dpt) by addition of 1000 nM daclatasvir to the media at each cell split. The percentage of infected cells was estimated by immunostainings with Core-antibody.
To test for presence of virus below detection level in the treated cultures, from 25dpt treatment was
terminated on subpopulations of the cells transfected with J6-18+m15J4NS5A and J6-18 and treated with
miravirsen or miravirsen+ daclatasvir. Except for in the already 100% infected double-transfected and
miravirsen treated well, no virus was present at detection level with immunostaining and microscopy 14
days post treatment termination. Thus, all controls behaved as expected, but no putative recombinants
emerged.
One reason that we did not see escape by recombination could have been due to the slow propagation of
m15-J4NS5A, and thereby too little RNA present for recombination to efficiently take place. To overcome
this, Huh-7.5 cells were transfected with m15-J4NS5A and kept until infection reached 100%. These cells
were plated in 12w format and pre-treated (or not, corresponding to the subsequent treatment) with
500nM miravirsen. On the following day, J6-18 IVT RNA was transfected into the cells with or without
0 10 20 30 400
50
100
dpt
Perc
enta
ge Infe
cte
d C
ells
daclatasvir
miravirsen
a. daclatasvir +miravirsen
b. daclatasvir + miravirsen
c. daclatasvir + miravirsen
untreated
0 10 20 30 400
50
100
dpt
Perc
enta
ge Infe
cte
d C
ells
J6-18, daclatasvir
J6-18, miravirsen
J6-18, daclatasvir + miravirsen
m15-J4NS5A, daclatasvir
m15-J4NS5A, miravirsen
m15-J4NS5A, daclatacvir + miravirsen
44
miravirsen using lipofectamine 2000. From the subsequent day, cultures were treated either with 1000nM
daclatasvir, 500nM miravirsen or 1000nM daclatasvir+ 500nM miravirsen two times weekly. As controls,
the m15-J4NS5A positive cells without J6-18 transfection were treated with both drugs, and naïve Huh-7.5
cells, pre-treated with 500 nM miravirsen (or not), were transfected with J6-18 IVT RNA with or without
miravirsen and subsequently treated with daclatasvir, daclatasvir+ miravirsen, or daclatasvir+ a scrambled
LNA. The scrambled LNA was also used in pre-treatment of the corresponding control and included in the
transfection of the J6-18 IVT RNA. This scrambled LNA setup was included to test whether inclusion of LNA
in the transfection particles itself had effects on the following viral propagation.
The infection of the m15-J4NS5A positive cells rapidly declined, and was <1% within the 19 days of the
treatment with miravirsen and daclatasvir. The percentage of positive cells in the culture with initially 100%
m15-J4NS5A positive cells and following transfected with J6-18 and treated with daclatasvir and miravirsen
decreased to <1%. The similar culture treated with only daclatasvir or miravirsen were 100% infected at
almost all time points, with the exception of a decrease to ~40% as the initial response of the culture
treated only with miravirsen (Figure 25).
The naïve Huh-7.5 cells transfected with J6-18 developed as expected, although inclusion of scrambled LNA
caused infection to develop slower. This, as well as the decrease to ~40% of the miravirsen treated m15-
J4NS5A culture, indicated that LNA inclusion in viral RNA transfection slowed infection in a sequence-
independent manner (Figure 25).Thus, again the controls behaved as expected, but no putative
recombinants emerged during the course of the experiment.
45
a.
b.
Figure 25: Percentage infected cells in cultures initially 100% infected with m15-J4NS5A and/or transfected with J6-18. The graphs a. and b. show cultures from the same experiment. Graph a. shows 100% m15-J4NS5A infected cultures transfected with J6-18 IVT RNA and treated with daclatasvir, miravirsen or both as indicated in the legend. Graph b. indicates a 100% m15-J4NS5A infected culture treated with daclatasvir and miravirsen, and three initially uninfected cultures transfected with J6-18 IVT RNA and treated with daclatasvir, daclatasvir and miravirsen or daclatasvir and a scrambled LNA. For both graphs dpt indicates days post transfection with J6-18. Miravirsen and scrambled LNA treatment consisted of pre-treatment, inclusion in the viral transfection and direct addition to the media every 3-4 days, all with 500 nM. From 1 day post transfection, 1000 nM daclatasvir was applied to the media at each cell split. The percentage of infected cells was estimated by immunostainings with a Core-antibody.
In conclusion, for the two virus recombinants J6-18 and m15J4NS5A under the chosen treatment
conditions, recombination did not provide a mechanism for treatment escape. Escape mutants were not
observed, which validated the parameters chosen to avoid escape by point mutation.
Miravirsen-resistant Virus Strains Some miravirsen-treated J6-18 cultures became infected almost immediately in the miravirsen treatment
pilots, indicating insufficient treatment conditions. Other cultures were uninfected for 1-2 weeks until viral
breakthrough was seen (Figure 26). The viruses from two wells with viral breakthrough were examined
further to understand whether it had been caused by resistance mutations.
The acquired resistance could be caused by mutations in the 5’ end of the viral RNA making the virus less
dependent on miR-122. A study has suggested a correlation between miravirsen resistance and a single
0 5 10 150
50
100
dpt
Perc
enta
ge Infe
cte
d C
ells
daclatasvir
miravirsen
a. daclatasvir +miravirsen
b. daclatasvir + miravirsen
c. daclatasvir and miravirsen
0 5 10 150
50
100
dpt
Perc
enta
ge Infe
cte
d C
ells
J6-18, daclatasvir
J6-18, daclatasvir + miravirsen
J6-18 daclatasvir + mock LNAm15-J4NS5A, daclatasvir + miravirsen
46
base mutation of the fourth base of the genome, but could not confirm it with reverse genetic experiments
(Ottosen et al. 2015). Another study saw escape in patients probably linked to mutations in the early 5’ UTR
(van der Ree et al. 2017). The sequence of the very 5’ end of the genome could clarify this, but could not be
obtained with a normal PCR, because a forward primer impossibly could anneal upstream of the bases we
wanted sequence.
Figure 26: Miravirsen-treated J6-18-transfected cells. The curves show compiled data from 3 different miravirsen treatment pilots. ‘50nM (lipofectamine treatment)’ is an example of an initially insufficient treatment and ‘500nM’ shows a sufficient treatment. ‘50nM’ and ‘100nM’ shows treatment breakthrough and were further analyzed. The x-axis unit dpt is days post transfection. In the ‘100nM’ and ‘500nM’ cultures, cells were miravirsen-pretreated and viral RNA was transfected together with miravirsen. In the ’50 nM’ and ‘50nM (lipofectamine treatment)’ cultures were not pretreated and the virus transfection did not include miravirsen. In the ‘50nM (lipofectamine treatment)’ culture miravirsen was delivered in complex with lipofectamine RNAi/Max every 2-3 days. In the remaining cultures, miravirsen was delivered without transfection reagent. The percentage of infected cells was estimated by immunostainings with Core-antibody.
To enable sequencing of the extreme 5’ end, 5’ Rapid amplification of cDNA ends (5’RACE) was performed
on extracted viral RNA from one time point of the 100nM escaped virus and three time points of the 50nM
escaped virus. The principle of 5’RACE is 3’ cDNA A- or C- homopolymeric tailing using the terminal
deoxynucleotidyl transferase (TdT) on cDNA thoroughly purified for dNTPs and primer to avoid tailing of the
primer or incorporation of undesired dNTPs, followed by a nested PCR with forward primers placed in these
tails. When checked on an agarose gel, C-tailing did not yield PCR products, but A-tailing gave clear bands
for the 100nM escaped virus and two of the time points of the 50nM escaped virus (Figure 27).
0 5 10 15 200
50
100
dpt
Perc
enta
ge Infe
cte
d C
ells 100nM
50nM
500nM
50nM (lipofectamine treatment)
47
Figure 27: A- and C- homopolymeric tailing of three 50nM “escape” culture sample. The 5’ RACE nested PCR products were analyzed on a 2% agarose gel. The expected band length was 352nt plus tail. The row Sample indicate sampling name. The blank sample contains sterile water used for RNA purification and all subsequent RT, tailing, purification, tailing and PCR procedures. A- or C- homopolymeric tailing of the 100nM escaped virus had a band in the A-tailing and no band in the C-tailing (not shown).
These A-tailing based gel bands were excised and A-overhangs were added, so they could be ligated into a
TOPO TA vector. These vectors were cloned by transformation into bacteria, purified and sequenced with
vector-specific primers.
Figure 28: Sequences of 5’RACE products based on miravirsen-breakthrough J6-18 viruses inserted in TOPO TA clones. There is 100% alignment between the reference sequence (top), 50nM escaped virus reads (sequence 2 from above), and 100nM escaped virus (sequence 3, 4 and 5 from above). The sequences were aligned in Sequencer 5.1.
The TOPO TA vector sequences showed no mutations in the 5’ end of the genome (nt 1-300) (Figure 28) so
the miravirsen tolerance appeared to be caused by other factors than mutations in the 5’ end. It could
potentially be caused by mutations in other parts of the genome enhancing general virus fitness.
Alternatively it could be caused by an increased ability to metabolize miravirsen of the Huh-7.5 cells in the
specific cultures where virus emerged.
Thus, the 50nM culture, which came up early, might have been an example of break-through rather than
drug resistance. The infection in the 100nM-treated well grew from a few percent to full infection within
two day and then started decreasing. This pattern was unusual compared to typical HCV infection in vitro,
and could potentially have been caused by experimental errors.
48
siRNA knock-down of HSPC117 - Initiation of Mechanistic Studies of HCV RNA
Recombination The 55.2kDa human RtcB ortholog HSPC117 has been identified as the essential catalytic unit in ligation of
2’,3’-cyclic phosphate and 5’-OH RNA ends during tRNA maturation (Popow et al. 2011). Most RNA ligases
ligates other ends for example 5’ phosphate and 3’hydroxyl termini (Popow, Schleiffer, and Martinez
2012).
It was previously shown that exactly the 2’,3’-cyclic phosphate and 5’-OH RNA ends required for efficient
ligation during recombination of the HCV-related BVDV (Austermann-Busch and Becher 2012). We
therefore speculated that HSPC117 might be involved in re-ligation of two RNA fragments during HCV RNA
recombination.
To test the potential role of the tRNA ligase in viral RNA recombination, we initially wanted to make an
efficient siRNA knock down of HSCP117 that then could be used for a quantitative recombination assay.
Naïve Huh7.5 cells were transfected with 2 or 20 nM of a siRNA SMARTpool, which is a commercial pool of
4 different siRNAs targeting the open reading frame of HSPC117 (also called C22orf28), or mock siRNA
designed not to target anything. Untreated cells were included as a control. The cells were harvested and
lysed two days after the transfection. The cell lysate was run on a western blot. A primary antibody against
HSPC117 was used, and a weaker band of protein was seen in the cells knocked down with the HSPC117-
targeting siRNA (Figure 29).
Figure 29: siRNA knock-down of HSPC117. The concentration indicates i) HSPC117-targeting siRNA pool (ON-TARGETplus Human C22orf28 siRNA SMART pool) for lanes with a + in the siRNA target HSPC117 row, or ii) non-targeting pool in the lane with a plus in the siRNA no target row. Expected band length was 55.2 kDa. β-actin was used as loading control and confirmed equal loading ( not shown).
Further plans for assessment of HSPC117 in RNA recombination and ideas for mechanistic studies, are
included in the discussion below.
49
Discussion RNA recombination has been described for numerous RNA viruses, including HCV in both patients and cell
culture systems (Galli and Bukh 2014). As a mechanism enabling co-inheritage of sequence from distinct
parental genomes, RNA recombination has a potential for driving evolutionary processes.
Recombination of the Non-viable Genomes J6CF and JFH1∆E1E2 In this study, cell culture HCV RNA recombination was seen in all cultures co-transfected with the J6CF and
JFH1∆E1E2 genomes, both incapable of virion production in cell culture. In total, five recombinant viruses
were characterized; one each from culture d and e, and three different clones from culture f. Virus d and e
grew well in cell culture and produced infectivity titers comparable with J6/JFH1, but viral growth in the
culture containing the f viruses was highly attenuated and infectivity titers were below the limit for
quantification (Figure 8 and Table 1). Occurrence in three out of three wells revealed that HCV
recombination readily occurs in cell culture and that viable recombinants emerge under the right selection
criteria.
In cell culture f, where three distinct virus f recombinants were characterized, additional recombinants
might have been revealed by sequencing of further TOPO TA clones. The co-occurrence of distinct viruses
reveals that several recombination events occurred within the same culture. Presumably, several
recombination events also occurred in culture d and e, but weaker recombinants were outcompeted by the
more fit virus d and e. The HCV recombination frequency has previously been assayed by co- transfecting
Huh7.5 cells and plating low number of cells out in numerous wells. In a total of seventy-two wells with
seven thousand cells each, recombination was observed in four wells (Scheel et al. 2013). This frequency
corresponds to 3.2 recombinants in the format used for culture d, e and f, which matches well with culture
f observations.
Similarly to the potentially unobserved recombination events in culture d and e, in vivo recombination
might be underestimated, because recombinants rarely are revealed due to decreased fitness or lack of
identification due to high parental strand similarity or partial sequencing. Treatment with antivirals lowers
the fitness of parental virus genomes, so if some recombinants are more resistant towards treatment,
increased usage of antivirals could mean an increase in observed recombinants.
Primarily Heterologous Recombinants Were Observed
Heterologous and homologous recombinants most likely primarily emerge by breakage-rejoining and copy-
choice recombination, respectively. Known patient recombinant isolates are all homologous, but as seen
here and in other studies (Scheel et al. 2013), cell culture recombinants are most often heterologous. In this
study, four out of five characterized recombinants were heterologous. Therefore recombination observed
here primarily appears to be breakage-rejoining, but the homologous recombinant could have emerged by
copy-choice recombination.
This difference between cell culture and patient recombinants might be caused by different constrains and
selective pressures imposed in cell culture and in patients before, during, or after recombination. Wildtype
virus present in vivo might out-compete potential heterologous recombinants, but this constrain does not
exist in the attenuated cell culture systems used for recombination studies here. Alternatively, molecular
differences between Huh-7.5 cell culture and in vivo hepatocytes might cause breakage-rejoining to be
more likely in cell culture and copy-choice recombination in vivo. Transfection procedures might also
enhance recombination and/or increases the possibility for breakage-rejoining. This and other cell culture
50
HCV recombination studies (Scheel et al. 2013; Reiter et al. 2011) are based on transfection of viral RNA
rather than infection. RNA handling during transfection could result in a higher fraction of genome
breakage. Thereby unnaturally high availability of broken RNA substrate for recombination might be
present.
Alternatively, in vivo recombinants might quickly have lost initial insertions by further recombination.
Removal of insertions could occur by recombination between two different molecules or by polymerase
slippage within a single molecule (the latter strictly speaking does not classify as recombination). If it occurs
by recombination, it is more easily described with copy-choice recombination than with breakage-rejoining.
Breakage-rejoining would require the seemingly extremely rare event of two independent, relatively
simultaneous breakage events occurring between two specific sites out of almost ten thousand nucleotides
of RNA genomes in close proximity followed by ligation of those exact molecules.
In recombinant characterization, only the recombination junctions were sequenced. Full sequencing might
reveal adaptive mutations that allow interaction between proteins of different origin. However, this was
beyond the scope of the current study.
Genomic Position of the Recombination Junction
Recombination junctions have been described different places in the genome including in NS2 and E1-E2. In
known recombinants, the junction is not randomly distributed. The region around NS2, for example, is a
recombination hotspot. Characterized inter-genotypic recombination events in patients all map to this
region, and the same is the case for most culture recombinants (Galli and Bukh 2014; Scheel et al. 2013).
The recombination junction of the constructed high fitness recombinant strain J6/JFH1 also maps here.
Recombination hotspots could be caused by recombinant viability, and/or secondary structure more prone
for breakage. With cloned recombinant viruses, viability of viruses with recombination junctions outside of
the NS2/NS3 junction could be tested. If such constructs are less viable, the recombination that often
occurs in the NS2/NS3 region is more likely to be driven by viral viability rather than secondary structure
favoring RNA recombination. Alternatively the 3-dimensional RNA structure has previously been suggested
to drive recombination in the NS2 region (Kalinina, Norder, and Magnius 2004).
The NS3-NS5A region is necessary and sufficient for replication as exemplified by HCV replicons.
Monophyletic origin of this region might be selected for, because the replicative proteins have co-evolved
to function in concert within a subtype or even strain. Differently originated NS proteins might not be
evolutionarily fine-tuned for interaction for example at binding sites. Possibly a pressure for monophyletic
Core-p7±NS2 could also exist e.g. for assembly/packaging purposes. For heterologous recombinants, the
junction most often ensures mono-origin of NS3-NS5B and of Core-p7 ±NS2.
In this study, the two fit recombinant viruses d and e, encoded NS2 from JFH1, indicating that for a J6 and
JFH1 recombinant, NS2 was not required to be monophyletic with Core-p7. Two of five recombinants
observed had J6 junction in NS2, and three in beginning of NS3 (See Figure 10 and Figure 12). Furthermore,
four encoded the full NS3 to NS5B from JFH1, the remaining recombinant encoded all but the first segment
of NS3 (See Figure 10 and Figure 12). The recombination junction of the homologous recombinant virus
from culture f was found approximately 500 nucleotides into NS3. This virus could either have emerged
early and be attenuated due to the position of the junction, or alternatively be a newly emerged
recombinant, that upon additional passaging would outcompete the other strains.
51
Despite of Core-NS2 from J6 and NS3-NS5B from JFH1, virus clone 2 from culture f did not cause robust
infection. This clone differed from robust clones in that it also contained a NS3(J6)-NS2(JFH1) region
encoding a fusion protein containing a small N-terminal fraction of NS3 from J6 followed by most of NS2
from JFH1. This fusion protein might disrupt NS2 processes due to the NS3-derived ‘domain’. Alternatively,
the additional genome sequence of 1227 nucleotides could cause the reduced fitness, but in other studies
functional recombinants with insertions of more than 2.5 kb have been identified (Scheel et al. 2013).
Clone 4 from culture f contained Core-NS2 from J6 and NS3-NS5B from JFH1 also appeared highly
attenuated. However, in the light of its insertion being out of frame, it was more surprising that it still
persisted. Potentially this could have been caused by complementation from the other recombinant viruses
or translational frameshift. Yet another explanation could be recombination artifacts during RT-PCR
amplification. This possibility rises a more general question about the validity of the recombinant
characterizations. It could be the case for clone 4, but does not seem to be a general as the other
recombinants in this and other studies were in frame (Scheel et al. 2013). Furthermore viability of selected
recombinants determined by recombination junction PCR-amplification, has been confirmed by cloning and
subsequent in vitro transcription and transfection (Scheel et al. 2013).
Special Features of Recombinants
Viable heterologous recombinants encode an extended polyprotein, thus in infected cells additional fusion
proteins or additional protein copies will be present. Further studies of e.g. how the two different copies of
the p7 viroporin encoded in virus d and e function, could potentially aid a broader understanding of HCV.
Systematic studies of slightly modified d or e viruses with cloned disruptive mutations in J6-p7 or JFH1-p7
(Steinmann et al. 2007), respectively, would provide an answer to, whether both p7 proteins are equally
capable of supporting the virus. Emergence of adaptive mutations or potential differences between usage
of the different p7 proteins could elucidate potential further needs for p7 molecular interactions.
Furthermore comparison of viral fitness between viruses encoding two functional p7 proteins versus one
functional and one disrupted p7 protein might reveal potential advantages or disadvantages for two p7
genes, besides the disadvantage of a longer genome, which both viruses would have. Potentially the ratio
between expressed HCV proteins is significant for successful replication and assembly.
Attempts to Observe Recombination Between Resistant Viral Strains in Cell
Culture After validation of recombination, the aim was to establish cell culture proof-of-concept for RNA
recombination-mediated combination of different resistance mutations under selective pressure from
treatment.
Choice of Viral Strains
For this, two cloned recombinant viral strains, m15-J4NS5A and J6-18, were chosen based on reciprocal
resistance and sensitivity towards the host targeting agent miravirsen and the NS5A-inhibitor daclatasvir,
respectively. Furthermore, requirements for several mutations to convert the drug sensitivity to resistance
and a large EC50 difference between sensitive and resistance of the strains to avoid drug escape within one
of the strains, were fulfilled by combination of these two strains; J4-NS5A and J6-18 have more than 50,000
fold difference in daclatasvir EC50, and by 2-3 mutations being required for J4-NS5A to become resistant
(Scheel et al. 2011)(Gottwein, unpublished). Similarly wildtype HCV requires prolonged treatment or
complex 5’ mutation to escape the need for miR-122 (Ottosen et al. 2015; Li et al. 2011). Also, genetic
distance between two regions correlates positively with HCV recombination (Reiter et al. 2011) as
52
miravirsen resistance and daclatasvir resistance are separated by more than 6 kb. Furthermore, if HCV
recombination is more like to occur in the NS2 region due to the local RNA structure (Kalinina, Norder, and
Magnius 2004), this would also ensure combination of the two encoded resistances.
No Recombinants Observed
Here daclatasvir and miravirsen treatment of cultures co-transfected with m15-J4NS5A and J6-18, or
transfected with J6-18 upon full m15-J4NS5A infection, did not lead to proof of recombination-caused
treatment escape (Figure 24 and Figure 25). Treatment was continued for forty and nineteen days,
respectively, and drug termination revealed that the used doses had caused complete loss of virus 25 days
post transfection.
Non-replicating RNA is decreasing over time, thus prolonged treatment might not increase the chance of
viable recombinants significantly. Recombination of J6 and JFH1∆E1E2 was observed within a week (Figure
8), and a positive correlation between recombination in cell culture and RNA concentration has been
described in other studies (Reiter et al. 2011; Scheel et al. 2013). Instead there might be an issue of
recombinant viability.
The m15-J4NS5A Strain was Attenuated
m15-J4NS5A was cloned for this study, and in a characterization of viral propagation upon IVT RNA
transfection, m15-J4NS5A was compared with five other recombinant HCV genomes including the two
genomes that it was cloned from, m15-J6/JFH1 and J6/JFH1-J4NS5A. Both the genomes were attenuated
compared to J6/JFH1, and m15-J4NS5A was further attenuated (Figure 15). Especially replacement of the
miR-122 seed sites with miR-15 seed sites attenuated viral propagation. miR-15 and miR-122, however, are
expressed at similar levels in hepatocytes (Luna et al. 2015). miR-122 has several functions in the HCV life
cycle by binding the 5’ UTR, and it remains unclear whether miR-15 replace all functions or whether the
changed sequence introduce other issues e.g. for RNA structures.
m15-J4NS5A might have provided insufficient recombination substrate due to its low replication. In
addition, potential recombinants might have had even further decreased fitness due to insertions or the
new combination of nucleotides. For HCV, single mutations can impact viability significantly, for example
single adaptive mutation can have a huge impact on fitness (Jensen et al. 2015). Viability could be tested by
cloning and growth characterization of a m15-J6-18 recombinant.
Alternative Inhibitors
J6-18 could be combined with a less attenuated strain carrying resistance towards another viral or cellular
factor. Resistance against clinically relevant inhibitors targeting the NS3/4A protease or NS5B polymerase
could be tested. These inhibitors were not chosen originally, partly because heterologous recombination
has not typically been observed between NS5A and 4A or 5B. However, recombination in that region might
not have been observed due to lack of selection for it. Furthermore, NS5B resistance mutations cause low
fitness and nucleotide inhibitor EC50 between sensitive and resistant only varies approximately 10-fold
(Ramirez et al. 2016), and resistance is only described in genotype 3, where it can arise with a single S282T
mutation, making it less obvious for combination with e.g. J6-18. Thus NS5B inhibitor resistance is not
optimal for such studies.
Instead, an NS3/4A resistant strain in combination with a strain incapable of achieving resistance by a single
mutation could be used. The genotype 3a protease is inherently resistant to simeprevir and resistance can
be increased further e.g. with mutation I170T, whereas genotype 2a and 4a proteases are sensitive and do
53
not acquire resistance to the level of genotype 3a by a single mutation. However, inter-genotypic
recombinants might be constrained by viability, thus initial cloning of double-resistant strains with the
planned combinations of resistance mutations could reveal recombinant viability or lack of same, and
thereby assist strain selection.
Optimizing the Number of Double-positive Cells in Culture A prerequisite for RNA recombination of different virus strains is cellular co-infection, thus superinfection
exclusion could be a recombination barrier (Tscherne et al. 2007; Schaller et al. 2007). Infection and
transfection could cause different initial levels of superinfection exclusion. Therefore fluorescence-based
assessment of virus-positive cells were made after transfection of viral IVT RNA or infection with viral
particles with two J6/JFH1 constructs with genomic insertions of EGFP or mCherry in the NS5A gene.
Transfection efficiency was estimated with fluorescence microscopy of fixated and immunostained cells.
The mCherry virus spread similarly with and without co-transfection, but a clear decrease was seen in
propagation of the EGFP virus when it was co-transfected, thereby indicating a clear super-infection
exclusion effect. A direct estimation of double-positive cells was not achieved, but the estimated rates of
mCherry virus and EGFP virus infection in co-transfected cultures, showed out-competed EGFP virus instead
of a high rate of double infection.
Double infection might be more readily measured with flow cytometry, because individual cells can be
scored for fluorescence at the two relevant wavelengths. Flow cytometry upon infection with MOI=0.1
yielded positive infection rates of 3.5% to 5.7%, slightly below the 9.5% expected from a Poisson
calculation. When MOI was raised to 4 with the intention to infect the vast majority of cells, this was not
observed. Probably a main issue with the infection with this MOI was that it required 45- and 100- fold
virus stock concentration, and that also serum elements were concentrated. This resulted in a highly
viscous sample that was applied to the cells. This might have disrupted normal cell metabolism and/or
contact between viral particles and cells during the infections, and might explain the lower cell quality for
the cells infected with MOI=4 . This was seen by a lower rate of cells falling within the gate for normal cell
size and granularity, compared to MOI=0.1. A potential solution to this problem could be production of
virus stocks in cells grown in serum-free or serum-reduced media, so that concentrated supernatant would
not be viscous (Mathiesen et al. 2014).
A more direct comparison between transfection and infection of the percentage of virus-positive cells
would require flow cytometry of cell cultures from both setups. Yet due to issues of achieving a sufficient
concentration of infectious virus particles, transfection was thought to be preferable for further studies. A
more thorough investigation could have found potential advantages of infection compared to transfection.
Nonetheless, previous studies demonstrated that recombination could occur from transfected non-
replicating genomes (Scheel et al. 2013), thus transfection of drug-resistant genomes under applied drug
treatment was assumed to provide a sufficient basis for recombination.
Treatment in Cell Culture To select for recombination events under treatment, we assumed that drug concentrations should be
sufficient for suppression of detectable virus infection. We could not know, if recombination would occur
early, or if it would happen between genomes present below detection level. Therefore we extended
culture treatment for several weeks.
54
Daclatasvir
Complete suppression of m15-NS4A with daclatasvir was observed with a 10-fold lower daclatasvir
concentration than used in the final setup. Using the high concentration was based on observation of virus
positive cells immediately after treatment termination in wells treated with lower concentrations. We
hypothesized that this meant higher risk for escape or breakthrough caused by other things than
recombination. Yet lower daclatasvir concentrations might have kept a higher background level of virus
below detection, which might have been an advantage in providing necessary substrate for recombination.
Miravirsen
Miravirsen suppression of J6-18 required a composite treatment strategy with pre-treatment and inclusion
of miravirsen in transfection of viral RNA. Numerous treatment pilot experiments were made to determine
sufficient suppression conditions. The initially tested concentrations were 10 to 50 fold too low. These
initial concentrations were chosen based on the psiCHECK-2 luciferase assay. Miravirsen concentrations
below 1 nM significantly de-repressed luciferase activity by inhibition of miR-122 RNA interference, and a
concentration of around 10 nM was sufficient to achieve optimal effects (Figure 19). However, a difference
between concentrations sufficient for de-repression of RNAi and for suppression of J6-18 infection was
seen. This was perhaps not surprising: the amounts of luciferase mRNA versus viral RNA are likely different
and the two experiments occur on different time scales. Furthermore, degradation of luciferase mRNA
transiently sequesters miR-122 and leads to degradation of the target, whereas J6-18 presumably requires
continuous association and leads to accumulation of viral RNA.
No advantage of using a transfection agent for miravirsen in the psiCHECK-2 was observed, but transfection
was more efficient for HCV treatment. However, treatment by repeated miravirsen transfections posed a
high toxicity on cells, and was therefore not an optimal strategy. Instead increased doses, pre-treatment
and inclusion of miravirsen in the transfection of viral IVT RNA was found efficient.
The antiviral effect of miravirsen was assumed to solely be sequence-based, but inclusion of a scrambled
LNA, with chemical modifications similar with miravirsen, delayed viral propagation. The scrambled LNA
was only tested once, so further tests are necessary to validate the observed effect. Potentially, the high
levels of exogenous nucleic acid during treatment with scrambled LNA hyper-activate innate immunity.
Alternatively, inclusion of a large LNA amount in transfection of viral IVT RNA could have implications on
the quality of transfection vesicles and cause an overall decrease in transfection efficacy. A decrease in
transfection efficacy would imply that inclusion of miravirsen in transfection of viral RNA corresponds to
decreased addition of viral RNA. The scrambled LNA was only tested against J6-18, thus observation of
potential effects on m15-J4NS5A would be interesting. Expectedly the scrambled LNA affects the two
viruses similarly.
During miravirsen treatment, infection developed at late time points in two cell cultures transfected with
IVT RNA J6-18. Miravirsen-resistant viruses isolated from patients have previously been described to
contain mutations in the miR-122 auxiliary binding sites at the very 5’ end of the genome (van der Ree et al.
2017). However, introduction of such mutations in reverse genetic studies did not lead to resistant isolates
(Ottosen et al. 2015). In this study, 5’ end sequencing of the supernatant-extracted viruses did not reveal
mutations. Thus virus growth in these cultures might be characterized as break-through i.e. caused by
mutations enhancing the general fitness rather than changing miR-122 binding sites. Miravirsen
breakthrough has also been described in patients and is therefore clinically relevant (van der Ree et al.
55
2017). Full genome sequencing would reveal putative fitness enhancing mutations in other regions of the
genome.
Alternatively to break-through, the observed viruses could have been caused by changes in cellular
metabolism. Cellular mutations accumulate in immortalized cell lines, and potentially continuous growth
during miravirsen treatment selects for cells with enhanced miravirsen metabolism. In that case, the
miravirsen EC50 of the breakthrough viruses and wildtype J6-18 would be found highly similar if tested.
Mechanistic Studies of HCV RNA Recombination An interesting question is how RNA recombination occurs in the cells. As mentioned in the introduction,
RNA recombination is described to occur by copy-choice or breakage-rejoining mechanisms. The
mechanism producing the cell culture HCV recombinants was probably breakage-rejoining since most
recombinants were heterologous and recombination has been shown to occur for two viral genomes with
defect polymerases (Gallei et al. 2004; Scheel et al. 2013). In contrary to the viral polymerase-dependent
copy-choice recombination, breakage-rejoining recombination presumably requires cellular factors, at least
for the re-joining.
For the HCV-related virus BVDV, recombination implicates ligation of 3’-phosphate and 5’-hydroxy RNA
ends (Austermann-Busch and Becher 2012) and HSPC117 is a tRNA ligase with the relatively rare capacity to
catalyze this reaction (Popow et al. 2011). Therefore we hypothesized that HSPC117 could be involved in
HCV recombination and initiated studies to determine its putative involvement. This was done by
establishment of HSPC117 siRNA knock-down conditions. In future studies, knock-down conditions of
HSPC117 could be optimized and a quantitative assay of HCV RNA recombination should be established. A
quantitative assay of HCV RNA recombination could build on frequency measurements of recombination of
two unviable strains by binary infected/uninfected scoring in 96w format. This could set a standard
recombination frequency of x out of 96 wells, and a potential change in frequency upon knock-down or
over-expression of host factors, such as HSPC117, could be measured. Other cellular factors may also need
to be screened, for example factors involved in mRNA splicing or processing of other types of cellular RNAs.
Broader Implications of RNA Recombination RNA recombination can be a more or less important driving factor in viral evolution, and the role it plays is
by no mean fixed over time. Prerequisites will change over time: increase or decrease of co-circulating
RNAs, overall variety, and changed selective pressures can also change the significance of RNA
recombination. Potentially, antivirals could be changing this pressure.
Breakage-rejoining RNA Recombination of Cellular RNAs
RNA viruses recombine in polymerase-dependent and –independent ways. Copy choice RNA recombination
depends on the association between the polymerase and the template, and is therefore cell-independent
or at least primarily polymerase dependent. Therefore this kind of recombination can only occur in virus-
infected cellular systems.
In contrary, there are no obvious constraints for occurrence of breakage- rejoining RNA recombination
between cellular RNA molecules. In the current understanding of the process, viral RNA is not favored over
cellular RNA, but viable viral recombinants are observed due to amplification by self-replication. If this is a
correct interpretation, breakage-rejoining will also lead to a large amount of recombinant cellular RNA
molecules. It is interesting to speculate whether all these recombinant cellular RNA molecules are side-
56
products of another important cellular process and whether they have a function of their own. This could
e.g. be in evolution.
Further insights to this could be gained through a detailed functional molecular description of breakage-
rejoining for RNA viruses and subsequent tests of the cellular implications of knock-downs and
upregulations of key molecules. For example, comparative statistics between deep sequenced samples of
cellular RNAs could be made on reads mapping partially to two different RNAs.
A potential way that RNA recombination could have implications would be if recombinant RNA (cellular-
cellular or cellular-viral) got reverse transcribed and incorporated into the cellular genome. The reverse
transcription would only be possible in the presence of reverse transcriptase i.e. it could only occur in the
presence of a retrovirus or alternatively through the action of an endogenous retro-element.
Interestingly, RNA virus sequences have been found integrated into host genomes (Katzourakis and Gifford
2010) presumably by such a mechanism. Existence of gene flow from virus has been proved with the
finding of non-retroviral endogenous viral elements in animal genomes, thus potentially also novel
recombined cellular RNA or viral-cellular RNA can be preserved over evolutionary time.
57
Conclusion In order to examine the putative role of RNA recombination in treatment escape, initially recombination in
absence of treatment was studied in cell cultures co-transfected with the attenuated viruses J6CF and
JFH1deltaE1E2. One homologous and four heterologous RNA recombinants were observed and
characterized.
Preparations were then made to determine conditions under which RNA recombination potentially could
cause treatment escape. For this the two recombinant virus genomes J6-18 and m15-J4NS5A were selected
due to resistance to daclatasvir and miravirsen, respectively. For simultaneous delivery of viral J6-18 and
m15-J4NS5A RNA, transfection was chosen due to issues with achieving sufficiently high viral titers for
infections. Furthermore miravirsen and daclatasvir concentrations and delivery methods sufficient for
suppression of J6-18 and m15-J4NS5A, respectively, were determined.
Co-transfection of the chosen IVT viral genomes under these specific treatment conditions did not lead to
observation of recombinants. Also in a slightly different approach, where the same treatment was applied
to cell cultures transfected with J6-18 RNA after they had become 100% m15-J4NS5A-positive, no
recombinants were observed. The lack of recombinants might have been caused by lack of recombination
or lack of J6-18 and m15-J4NS5A recombinant viability.
Thus, in conclusion this study did not lead to proof-of-concept that RNA recombination can serve as a way
to escape combination HCV therapy. However, future studies could further optimize conditions to
potentially allow this to happen from miravirsen and daclatasvir, or alternatively combining e.g. NS5A with
NS3/4A protease inhibitors. For further work, initial cloning and fitness characterization of double resistant
recombinants could be used to confirm viability. Upon selection of resistances confirmed to be viable in
combination, treatment with as low doses as possible might have allowed for necessary below-detection
recombination, in contrary to what was done with daclatasvir here. By these measures, it might be possible
to observe RNA recombination as treatment escape in cell culture.
During optimizations of miravirsen concentration and delivery, two resistant J6-18 virus sub-strains were
observed. The 5’ ends of two of these were sequenced, but no mutations could explain the resistance. The
J6-18 growth in miravirsen might be break-through caused by fitness-enhancing mutations elsewhere in the
genome or changes in cell metabolism.
Finally, to initiate studies of the mechanism behind breakage-rejoining recombination, siRNA knock-down
of the RNA ligase HSPC117 was tested and knock-down was achieved although at less than 100%. With
further optimization, this could serve to understand the mechanisms behind breakage-rejoining RNA
recombination.
58
Acknowledgements This master thesis in Biology corresponds to 60ETCS and was conducted at the Copenhagen Hepatitis C
program (CO-HEP), Department of Infectious Diseases and Clinical Research Centre at Copenhagen
University Hospital, Hvidovre from 1st of September 2015 to 1st of March 2017. I was enrolled at
department of Biology with Jeppe Vinther as internal supervisor. Troels Scheel and Jens Bukh from CO-HEP
were secondary supervisors.
I would especially like to thank Troels Scheel for the many hours spent teaching and guiding me, and Lotte
S. Mikkelsen for all her help in with laboratory procedures. I would also like to thank Jens Bukh and Jeppe
Vinther for their roles as supervisors. Furthermore, I would like to thank Andrea Galli, Ulrik Fahnø, Judith
Gottwein, Anne Finne Pihl, Long Pham-Van and all other members for CO-HEP for instructions and help.
Finally, I would like to thank my family, friends and boyfriend for their continued help and support.
Especially I would like to thank Sarah Ommanney, Thomas Berlok and Kasper Mygind.
59
Abbreviations 5’ RACE 5’ rapid amplification of cDNA ends
bp base pair
DAA Direct-acting antiviral
DMEM Dulbrecco’s Modified Eagle Media
dpi days post infection
dpt days post transfection
EC50 Half maximal efficient concentration
EGFP Enhanced green fluorescent protein
FFU Focus forming unit
gt genotype
HCV Hepatitis C virus
HCVcc Hepatitis C virus cell culture system
HCVpp Hepatitis C virus pseudoparticle
HTA Host targeting agent
IRES Internal ribosome entry site
IVT In vitro transcription
JFH1 Japanese Fulminant Hepatitis C 1
LNA Locked nucleic acid
miR- micro RNA-
MOI Multiplicity of infection
NS-protein Non-structural protein
nt nucleotide
ON Over night
ORF Open reading frame
RT reverse transcription
ssRNA single-stranded RNA
SVR Sustained Virologic Response
UTR Untranslated region
60
References Austermann-Busch, S., and P. Becher. 2012. 'RNA structural elements determine frequency and sites of
nonhomologous recombination in an animal plus-strand RNA virus', J Virol, 86: 7393-402. Bartenschlager, R., V. Lohmann, and F. Penin. 2013. 'The molecular and structural basis of advanced
antiviral therapy for hepatitis C virus infection', Nat Rev Microbiol, 11: 482-96. Bartenschlager, R., F. Penin, V. Lohmann, and P. Andre. 2011. 'Assembly of infectious hepatitis C virus
particles', Trends Microbiol, 19: 95-103. Bartosch, Birke, Jean Dubuisson, and François-Loïc Cosset. 2003. 'Infectious Hepatitis C Virus Pseudo-
particles Containing Functional E1–E2 Envelope Protein Complexes', The Journal of Experimental Medicine, 197: 633-42.
Blight, K. J., J. A. McKeating, and C. M. Rice. 2002. 'Highly Permissive Cell Lines for Subgenomic and Genomic Hepatitis C Virus RNA Replication', Journal of Virology, 76: 13001-14.
Bukh, J. 2016. 'The history of hepatitis C virus (HCV): Basic research reveals unique features in phylogeny, evolution and the viral life cycle with new perspectives for epidemic control', J Hepatol, 65: S2-S21.
Bukh, J., T. Pietschmann, V. Lohmann, N. Krieger, K. Faulk, R. E. Engle, S. Govindarajan, M. Shapiro, M. St Claire, and R. Bartenschlager. 2002. 'Mutations that permit efficient replication of hepatitis C virus RNA in Huh-7 cells prevent productive replication in chimpanzees', Proc Natl Acad Sci U S A, 99: 14416-21.
Catanese, M. T., K. Uryu, M. Kopp, T. J. Edwards, L. Andrus, W. J. Rice, M. Silvestry, R. J. Kuhn, and C. M. Rice. 2013. 'Ultrastructural analysis of hepatitis C virus particles', Proc Natl Acad Sci U S A, 110: 9505-10.
Cristina, J., and R. Colina. 2006. 'Evidence of structural genomic region recombination in Hepatitis C virus', Virol J, 3: 53.
Davis, Gary L. 1999. 'Hepatitis C virus genotypes and quasispecies', The American Journal of Medicine, 107: 21-26.
Gallei, A., A. Pankraz, H. J. Thiel, and P. Becher. 2004. 'RNA recombination in vivo in the absence of viral replication', J Virol, 78: 6271-81.
Galli, A., and J. Bukh. 2014. 'Comparative analysis of the molecular mechanisms of recombination in hepatitis C virus', Trends Microbiol, 22: 354-64.
Gao, F., O. V. Nainan, Y. Khudyakov, J. Li, Y. Hong, A. C. Gonzales, J. Spelbring, and H. S. Margolis. 2007. 'Recombinant hepatitis C virus in experimentally infected chimpanzees', J Gen Virol, 88: 143-7.
Gonzalez-Candelas, F., F. X. Lopez-Labrador, and M. A. Bracho. 2011. 'Recombination in hepatitis C virus', Viruses, 3: 2006-24.
Gotte, M., and J. J. Feld. 2016. 'Direct-acting antiviral agents for hepatitis C: structural and mechanistic insights', Nat Rev Gastroenterol Hepatol, 13: 338-51.
Gottwein, J. M., T. B. Jensen, C. K. Mathiesen, P. Meuleman, S. B. Serre, J. B. Lademann, L. Ghanem, T. K. Scheel, G. Leroux-Roels, and J. Bukh. 2011. 'Development and application of hepatitis C reporter viruses with genotype 1 to 7 core-nonstructural protein 2 (NS2) expressing fluorescent proteins or luciferase in modified JFH1 NS5A', J Virol, 85: 8913-28.
Gottwein, J. M., T. K. Scheel, B. Callendret, Y. P. Li, H. B. Eccleston, R. E. Engle, S. Govindarajan, W. Satterfield, R. H. Purcell, C. M. Walker, and J. Bukh. 2010. 'Novel infectious cDNA clones of hepatitis C virus genotype 3a (strain S52) and 4a (strain ED43): genetic analyses and in vivo pathogenesis studies', J Virol, 84: 5277-93.
Gottwein, J. M., T. K. Scheel, T. B. Jensen, L. Ghanem, and J. Bukh. 2011. 'Differential efficacy of protease inhibitors against HCV genotypes 2a, 3a, 5a, and 6a NS3/4A protease recombinant viruses', Gastroenterology, 141: 1067-79.
Gottwein, J. M., T. K. Scheel, T. B. Jensen, J. B. Lademann, J. C. Prentoe, M. L. Knudsen, A. M. Hoegh, and J. Bukh. 2009. 'Development and characterization of hepatitis C virus genotype 1-7 cell culture systems: role of CD81 and scavenger receptor class B type I and effect of antiviral drugs', Hepatology, 49: 364-77.
61
Hahn, C. S., S. Lustig, E. G. Strauss, and J. H. Strauss. 1988. ' Western equine encephalitis virus is a recombinant virus', Proc. Natl. Acad. Sci. USA, Vol. 85, : pp. 5997-6001,.
Hajarizadeh, Behzad, Jason Grebely, and Gregory J. Dore. 2013. 'Epidemiology and natural history of HCV infection', Nat Rev Gastroenterol Hepatol, 10: 553-62.
Henke, Jura Inga, Dagmar Goergen, Junfeng Zheng, Yutong Song, Christian G. Schüttler, Carmen Fehr, Christiane Jünemann, and Michael Niepmann. 2008. 'microRNA-122 stimulates translation of hepatitis C virus RNA', The EMBO Journal, 27: 3300-10.
Hirst, George K. 1962. "Genetic recombination with Newcastle disease virus, polioviruses, and influenza." In Cold Spring Harbor Symposia on Quantitative Biology, 303-09. Cold Spring Harbor Laboratory Press.
Horner, S. M., and M. Gale, Jr. 2013. 'Regulation of hepatic innate immunity by hepatitis C virus', Nat Med, 19: 879-88.
Hsu, S. H., B. Wang, J. Kota, J. Yu, S. Costinean, H. Kutay, L. Yu, S. Bai, K. La Perle, R. R. Chivukula, H. Mao, M. Wei, K. R. Clark, J. R. Mendell, M. A. Caligiuri, S. T. Jacob, J. T. Mendell, and K. Ghoshal. 2012. 'Essential metabolic, anti-inflammatory, and anti-tumorigenic functions of miR-122 in liver', J Clin Invest, 122: 2871-83.
Janssen, H. L., H. W. Reesink, E. J. Lawitz, S. Zeuzem, M. Rodriguez-Torres, K. Patel, A. J. van der Meer, A. K. Patick, A. Chen, Y. Zhou, R. Persson, B. D. King, S. Kauppinen, A. A. Levin, and M. R. Hodges. 2013. 'Treatment of HCV infection by targeting microRNA', N Engl J Med, 368: 1685-94.
Jegouic, S., M. L. Joffret, C. Blanchard, F. B. Riquet, C. Perret, I. Pelletier, F. Colbere-Garapin, M. Rakoto-Andrianarivelo, and F. Delpeyroux. 2009. 'Recombination between polioviruses and co-circulating Coxsackie A viruses: role in the emergence of pathogenic vaccine-derived polioviruses', PLoS Pathog, 5: e1000412.
Jensen, S. B., S. B. Serre, D. G. Humes, S. Ramirez, Y. P. Li, J. Bukh, and J. M. Gottwein. 2015. 'Substitutions at NS3 Residue 155, 156, or 168 of Hepatitis C Virus Genotypes 2 to 6 Induce Complex Patterns of Protease Inhibitor Resistance', Antimicrob Agents Chemother, 59: 7426-36.
Jones, C. T., M. T. Catanese, L. M. Law, S. R. Khetani, A. J. Syder, A. Ploss, T. S. Oh, J. W. Schoggins, M. R. MacDonald, S. N. Bhatia, and C. M. Rice. 2010. 'Real-time imaging of hepatitis C virus infection using a fluorescent cell-based reporter system', Nat Biotechnol, 28: 167-71.
Jopling, C. L., S. Schutz, and P. Sarnow. 2008. 'Position-dependent function for a tandem microRNA miR-122-binding site located in the hepatitis C virus RNA genome', Cell Host Microbe, 4: 77-85.
Kalinina, O., H. Norder, and L. O. Magnius. 2004. 'Full-length open reading frame of a recombinant hepatitis C virus strain from St Petersburg: proposed mechanism for its formation', J Gen Virol, 85: 1853-7.
Kalinina, Olga, Helene Norder, Sergey Mukomolov, and Lars O. Magnius. 2002. 'A Natural Intergenotypic Recombinant of Hepatitis C Virus Identified in St. Petersburg', Journal of Virology, 76: 4034-43.
Katzourakis, A., and R. J. Gifford. 2010. 'Endogenous viral elements in animal genomes', PLoS Genet, 6: e1001191.
Kew, O., V. Morris-Glasgow, M. Landaverde, C. Burns, J. Shaw, Z. Garib, J. Andre, E. Blackman, C. J. Freeman, J. Jorba, R. Sutter, G. Tambini, L. Venczel, C. Pedreira, F. Laender, H. Shimizu, T. Yoneyama, T. Miyamura, H. van Der Avoort, M. S. Oberste, D. Kilpatrick, S. Cochi, M. Pallansch, and C. de Quadros. 2002. 'Outbreak of poliomyelitis in Hispaniola associated with circulating type 1 vaccine-derived poliovirus', Science, 296: 356-9.
Lanford, R. E., E. S. Hildebrandt-Eriksen, A. Petri, R. Persson, M. Lindow, M. E. Munk, S. Kauppinen, and H. Orum. 2010. 'Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection', Science, 327: 198-201.
Latysheva, N. S., T. Flock, R. J. Weatheritt, S. Chavali, and M. M. Babu. 2015. 'How do disordered regions achieve comparable functions to structured domains?', Protein Sci, 24: 909-22.
Lauring, A. S., J. Frydman, and R. Andino. 2013. 'The role of mutational robustness in RNA virus evolution', Nat Rev Microbiol, 11: 327-36.
Li, Y., T. Masaki, D. Yamane, D. R. McGivern, and S. M. Lemon. 2013. 'Competing and noncompeting activities of miR-122 and the 5' exonuclease Xrn1 in regulation of hepatitis C virus replication', Proc Natl Acad Sci U S A, 110: 1881-6.
62
Li, Y. P., J. M. Gottwein, T. K. Scheel, T. B. Jensen, and J. Bukh. 2011. 'MicroRNA-122 antagonism against hepatitis C virus genotypes 1-6 and reduced efficacy by host RNA insertion or mutations in the HCV 5' UTR', Proc Natl Acad Sci U S A, 108: 4991-6.
Li, Y. P., S. Ramirez, S. B. Jensen, R. H. Purcell, J. M. Gottwein, and J. Bukh. 2012. 'Highly efficient full-length hepatitis C virus genotype 1 (strain TN) infectious culture system', Proc Natl Acad Sci U S A, 109: 19757-62.
Liang, T. J. 2013. 'Current progress in development of hepatitis C virus vaccines', Nat Med, 19: 869-78. Lindenbach, B. D., M. J. Evans, A. J. Syder, B. Wolk, T. L. Tellinghuisen, C. C. Liu, T. Maruyama, R. O. Hynes,
D. R. Burton, J. A. McKeating, and C. M. Rice. 2005. 'Complete replication of hepatitis C virus in cell culture', Science, 309: 623-6.
Lindenbach, Brett D. 2013. 'Virion Assembly and Release.' in Ralf Bartenschlager (ed.), Hepatitis C Virus: From Molecular Virology to Antiviral Therapy (Springer Berlin Heidelberg: Berlin, Heidelberg).
Lohmann, V., F. Körner, J.-O. Koch, U. Herian, L. Theilmann, and R. Bartenschlager. 1999. 'Replication of Subgenomic Hepatitis C Virus RNAs in a Hepatoma Cell Line', Science, 285: 110-13.
Lohmann, Volker. 2013. 'Hepatitis C Virus RNA Replication.' in Ralf Bartenschlager (ed.), Hepatitis C Virus: From Molecular Virology to Antiviral Therapy (Springer Berlin Heidelberg: Berlin, Heidelberg).
Luna, J. M., T. K. Scheel, T. Danino, K. S. Shaw, A. Mele, J. J. Fak, E. Nishiuchi, C. N. Takacs, M. T. Catanese, Y. P. de Jong, I. M. Jacobson, C. M. Rice, and R. B. Darnell. 2015. 'Hepatitis C virus RNA functionally sequesters miR-122', Cell, 160: 1099-110.
Magiorkinis, G., F. Ntziora, D. Paraskevis, E. Magiorkinis, and A. Hatzakis. 2007. 'Analysing the evolutionary history of HCV: puzzle of ancient phylogenetic discordance', Infect Genet Evol, 7: 354-60.
Masaki, T., K. C. Arend, Y. Li, D. Yamane, D. R. McGivern, T. Kato, T. Wakita, N. J. Moorman, and S. M. Lemon. 2015. 'miR-122 stimulates hepatitis C virus RNA synthesis by altering the balance of viral RNAs engaged in replication versus translation', Cell Host Microbe, 17: 217-28.
Mathiesen, C. K., T. B. Jensen, J. Prentoe, H. Krarup, A. Nicosia, M. Law, J. Bukh, and J. M. Gottwein. 2014. 'Production and characterization of high-titer serum-free cell culture grown hepatitis C virus particles of genotype 1-6', Virology, 458-459: 190-208.
Moradpour, Darius, and François Penin. 2013. 'Hepatitis C Virus Proteins: From Structure to Function.' in Ralf Bartenschlager (ed.), Hepatitis C Virus: From Molecular Virology to Antiviral Therapy (Springer Berlin Heidelberg: Berlin, Heidelberg).
Niepmann, Michael. 2013. 'Hepatitis C Virus RNA Translation.' in Ralf Bartenschlager (ed.), Hepatitis C Virus: From Molecular Virology to Antiviral Therapy (Springer Berlin Heidelberg: Berlin, Heidelberg).
Nora, T., C. Charpentier, O. Tenaillon, C. Hoede, F. Clavel, and A. J. Hance. 2007. 'Contribution of recombination to the evolution of human immunodeficiency viruses expressing resistance to antiretroviral treatment', J Virol, 81: 7620-8.
Ottosen, S., T. B. Parsley, L. Yang, K. Zeh, L. J. van Doorn, E. van der Veer, A. K. Raney, M. R. Hodges, and A. K. Patick. 2015. 'In vitro antiviral activity and preclinical and clinical resistance profile of miravirsen, a novel anti-hepatitis C virus therapeutic targeting the human factor miR-122', Antimicrob Agents Chemother, 59: 599-608.
Pawlotsky, J. M. 2016. 'Hepatitis C Virus Resistance to Direct-Acting Antiviral Drugs in Interferon-Free Regimens', Gastroenterology, 151: 70-86.
Pawlotsky, Jean-Michel. 2003. 'Hepatitis C virus genetic variability: pathogenic and clinical implications', Clinics in Liver Disease, 7: 45-66.
Peterhans, E., C. Bachofen, H. Stalder, and M. Schweizer. 2010. 'Cytopathic bovine viral diarrhea viruses (BVDV): emerging pestiviruses doomed to extinction', Vet Res, 41: 44.
Pham, S. T., R. A. Bull, J. M. Bennett, W. D. Rawlinson, G. J. Dore, A. R. Lloyd, and P. A. White. 2010. 'Frequent multiple hepatitis C virus infections among injection drug users in a prison setting', Hepatology, 52: 1564-72.
Popow, J., M. Englert, S. Weitzer, A. Schleiffer, B. Mierzwa, K. Mechtler, S. Trowitzsch, C. L. Will, R. Luhrmann, D. Soll, and J. Martinez. 2011. 'HSPC117 is the essential subunit of a human tRNA splicing ligase complex', Science, 331: 760-4.
63
Popow, J., A. Schleiffer, and J. Martinez. 2012. 'Diversity and roles of (t)RNA ligases', Cell Mol Life Sci, 69: 2657-70.
Ramirez, S., L. S. Mikkelsen, J. M. Gottwein, and J. Bukh. 2016. 'Robust HCV Genotype 3a Infectious Cell Culture System Permits Identification of Escape Variants With Resistance to Sofosbuvir', Gastroenterology, 151: 973-85 e2.
Reiter, J., G. Perez-Vilaro, N. Scheller, L. B. Mina, J. Diez, and A. Meyerhans. 2011. 'Hepatitis C virus RNA recombination in cell culture', J Hepatol, 55: 777-83.
Ross, R. S., J. Verbeeck, S. Viazov, P. Lemey, M. Van Ranst, and M. Roggendorf. 2008. "Evidence for a complex mosaic genome pattern in a full-length hepatitis C virus sequence." In Evolutionary bioinformatics online, 249-54.
Schaller, T., N. Appel, G. Koutsoudakis, S. Kallis, V. Lohmann, T. Pietschmann, and R. Bartenschlager. 2007. 'Analysis of hepatitis C virus superinfection exclusion by using novel fluorochrome gene-tagged viral genomes', J Virol, 81: 4591-603.
Scheel, T. K., A. Galli, Y. P. Li, L. S. Mikkelsen, J. M. Gottwein, and J. Bukh. 2013. 'Productive homologous and non-homologous recombination of hepatitis C virus in cell culture', PLoS Pathog, 9: e1003228.
Scheel, T. K., J. M. Gottwein, L. S. Mikkelsen, T. B. Jensen, and J. Bukh. 2011. 'Recombinant HCV variants with NS5A from genotypes 1-7 have different sensitivities to an NS5A inhibitor but not interferon-alpha', Gastroenterology, 140: 1032-42.
Scheel, T. K., and C. M. Rice. 2013. 'Understanding the hepatitis C virus life cycle paves the way for highly effective therapies', Nat Med, 19: 837-49.
Scheel, T. K., P. Simmonds, and A. Kapoor. 2015. 'Surveying the global virome: identification and characterization of HCV-related animal hepaciviruses', Antiviral Res, 115: 83-93.
Sedano, C. D., and P. Sarnow. 2014. 'Hepatitis C virus subverts liver-specific miR-122 to protect the viral genome from exoribonuclease Xrn2', Cell Host Microbe, 16: 257-64.
Sentandreu, V., N. Jimenez-Hernandez, M. Torres-Puente, M. A. Bracho, A. Valero, M. J. Gosalbes, E. Ortega, A. Moya, and F. Gonzalez-Candelas. 2008. 'Evidence of recombination in intrapatient populations of hepatitis C virus', PLoS One, 3: e3239.
Simmonds, P., B. Becher, J. Bukh, E.A. Gould, G. Meyers, T. Monath, S. Muerhoff, A. Pletnev, R. Rico-Hesse, D.B. Smith, J.T. Stapleton, and ICTV Report Consortium. 2017. 'ICTV Virus Taxonomy Profile: Flaviviridae', Journal of General Virology, 98: 2-3.
Simon-Loriere, E., and E. C. Holmes. 2011. 'Why do RNA viruses recombine?', Nat Rev Microbiol, 9: 617-26. Steinmann, E., F. Penin, S. Kallis, A. H. Patel, R. Bartenschlager, and T. Pietschmann. 2007. 'Hepatitis C virus
p7 protein is crucial for assembly and release of infectious virions', PLoS Pathog, 3: e103. Todt, D., B. Schlevogt, K. Deterding, A. Grundhoff, M. P. Manns, H. Wedemeyer, N. Fischer, M. Cornberg,
and E. Steinmann. 2017. 'Successful retreatment of a patient with chronic hepatitis C genotype 2k/1b virus with ombitasvir/paritaprevir/ritonavir plus dasabuvir', J Antimicrob Chemother.
Tscherne, D. M., M. J. Evans, T. von Hahn, C. T. Jones, Z. Stamataki, J. A. McKeating, B. D. Lindenbach, and C. M. Rice. 2007. 'Superinfection exclusion in cells infected with hepatitis C virus', J Virol, 81: 3693-703.
van der Ree, Meike H., J. Marleen de Vree, Femke Stelma, Sophie Willemse, Marc van der Valk, Svend Rietdijk, Richard Molenkamp, Janke Schinkel, Ad C. van Nuenen, Ulrich Beuers, Salah Hadi, Marten Harbers, Eva van der Veer, Kai Liu, John Grundy, Amy K. Patick, Adam Pavlicek, Jacqueline Blem, Michael Huang, Paul Grint, Steven Neben, Neil W. Gibson, Neeltje A. Kootstra, and Hendrik W. Reesink. 2017. 'Safety, tolerability, and antiviral effect of RG-101 in patients with chronic hepatitis C: a phase 1B, double-blind, randomised controlled trial', The Lancet, 389: 709-17.
Vignuzzi, M., J. K. Stone, J. J. Arnold, C. E. Cameron, and R. Andino. 2006. 'Quasispecies diversity determines pathogenesis through cooperative interactions in a viral population', Nature, 439: 344-8.
Wakita, T., T. Pietschmann, T. Kato, T. Date, M. Miyamoto, Z. Zhao, K. Murthy, A. Habermann, H. G. Krausslich, M. Mizokami, R. Bartenschlager, and T. J. Liang. 2005. 'Production of infectious hepatitis C virus in tissue culture from a cloned viral genome', Nat Med, 11: 791-6.
64
Wozniak, A. L., S. Griffin, D. Rowlands, M. Harris, M. Yi, S. M. Lemon, and S. A. Weinman. 2010. 'Intracellular proton conductance of the hepatitis C virus p7 protein and its contribution to infectious virus production', PLoS Pathog, 6: e1001087.
Wyled. 2012. 'Beyond Telaprevir and Boceprevir: Resistance and New agents for Hepatitis C Virus Infection ', Topic in antiviral medicine.
Xiao, Y., I. M. Rouzine, S. Bianco, A. Acevedo, E. F. Goldstein, M. Farkov, L. Brodsky, and R. Andino. 2016. 'RNA Recombination Enhances Adaptability and Is Required for Virus Spread and Virulence', Cell Host Microbe, 19: 493-503.
Yen, Tommy, Emmet B. Keeffe, and Aijaz Ahmed. 2003. 'The Epidemiology of Hepatitis C Virus Infection', Journal of Clinical Gastroenterology, 36: 47-53.