mast cell infiltration and chemokine expression in progressive renal disease1

Kidney International, Vol. 64 (2003), pp. 906–913

Mast cell infiltration and chemokine expression in progressiverenal disease1

SUSAN E. JONES,2 DARREN J. KELLY,2 ALISON J. COX, YUAN ZHANG, RENAE M. GOW,and RICHARD E. GILBERT

University of Melbourne Department of Medicine, St. Vincent’s Hospital, Fitzroy, Victoria, Australia

Mast cell infiltration and chemokine expression in progressiverenal disease.

Background. Mast cells are growth factor–rich, bone mar-row–derived cells that infiltrate injured tissue where they havebeen implicated in the pathogenesis of progressive fibrosis.

Methods. Mast cell infiltration and the expression of relatedchemoattractants was examined following 5/6 nephrectomy, amodel of progressive, nonimmune-mediated renal injury. Inaddition, expression of the profibrotic cytokine, transforminggrowth factor-� (TGF-�) within mast cells and the effects ofrenoprotective therapy with angiotensin-converting enzyme(ACE) inhibition were also determined.

Results. Renal injury was accompanied by mast cell infiltra-tion, in close proximity to areas of tubulointerstitial fibrosis.Mast cells displayed toluidine blue metachromasia and wereimmunopositive for TGF-�1 as well as chymase and tryptase.The expression of several mast cell chemokines, including stemcell factor, interleukin-8 (IL-8), and also TGF-�1, were in-creased in 5/6 nephrectomized kidneys. ACE inhibition withramipril led to a reduction in renal injury in association withattenuation of mast cell infiltration and chemokine expression.

Conclusion. Mast cell infiltration and related chemokine ex-pression are prominent and early features following renal massreduction and may contribute pathogenetically to progressiverenal injury.

Activation and phenotypic changes to resident renalcells, such as myofibroblasts, contribute to the pathogen-esis of progressive kidney disease [1]. Studies conductedover the past decade have also indicated a role for infil-trating inflammatory cells, principally macrophages inrenal disease progression [2, 3]. However, other cellularcomponents of the immune system, including mast cells,

1See Editorial by Rangan and Harris, p. 1134.

2 Dr. Jones and Dr. Kelly contributed equally to this manuscript.

Key words: mast cell, chemokine, fibrosis, nephrectomy.

Received for publication December 19, 2002,and in revised form March 26, 2003, and April 9, 2003Accepted for publication May 6, 2003

2003 by the International Society of Nephrology

906

have additionally been implicated in the pathogenesis ofnonimmune renal disease [4].

While mast cells are traditionally known for their rolein allergic immunoglobulin E (IgE)-mediated reactions,there is also a nonimmune-related mast cell phenotypethat predominates in connective tissue, rather than atmucosal surfaces [5]. These nonimmune mast cells partic-ipate in cell migration, differentiation, and, in particular,the synthesis of extracellular matrix and the formationof fibrotic scar tissue [5]. Indeed, mast cell infiltrationhas not only been documented in a wide range of humanrenal diseases [6–11], but a close relationship with theextent of interstitial fibrosis and impaired renal functionhas also been reported [8].

Mast cells, derived from hematopoietic progenitors,leave the bone marrow and migrate to areas of inflam-mation. A number of factors responsible for this direc-tional migration and tissue maturation of mast cells havebeen identified [12]. These include the CXC family ofchemokines [13], stem cell factor (also known as kit-ligand, steel factor, and mast cell growth factor) [14, 15],and transforming growth factor-� (TGF-�) [16].

The present study first sought to examine the develop-ment of mast cell infiltration and the expression of relatedchemoattractants following subtotal nephrectomy, a modelof progressive, nonimmune mediated renal injury. Thisstudy also sought to determine whether the profibroticcytokine, TGF-�, found in mast cells at other sites, wasalso present in kidney mast cells. In addition, the studyalso sought to determine the effects of renoprotectivetherapy with angiotensin-converting enzyme (ACE) in-hibition on mast cell numbers and chemokine expression.

METHODS

To determine the time course of mast cell infiltrationand chemoattractant expression, 40 male Sprague-Daw-ley rats weighing 200 to 250 g were randomized to fivegroups of 10 animals each. Ten animals were assigned toundergo sham surgery and the remaining 30 underwent

Jones and Kelly et al: Mast cell infiltration and chemokine expression 907

subtotal nephrectomy. Among the latter, rats were as-signed for sacrifice at 4 weeks and 12 weeks after surgery.Animals studied for 12 weeks were further assigned totreatment with or without the ACE inhibitor, ramipril(3 mg/L drinking water). Anesthesia was achieved bythe intraperitoneal administration of pentobarbital (6mg/100 g body weight) (Boehringer Ingelheim, Artar-mon, NSW, Australia). The control group underwentsham surgery consisting of laparotomy and manipulationof both kidneys before wound closure. The other 30 ratsall underwent subtotal nephrectomy performed by rightsubcapsular nephrectomy and infarction of approxi-mately two thirds of the left kidney by selective ligationof two of three to four extrarenal branches of the leftrenal artery [17]. Rats were housed in a temperature(22�C)-controlled room with ad libitum access to com-mercial standard rat chow (Norco Co-Operative Ltd.,Lismore, NSW, Australia) and water during the entirestudy. At sacrifice, the remnant (left) kidney was thensliced sagitally and one half immersion-fixed in 10% neu-tral buffered formalin and embedded in paraffin for his-tochemical and immunohistochemical studies. The re-maining half was snap-frozen in liquid nitrogen andstored at –80�C for subsequent gene expression analyses.All experiments adhered to the guidelines of the AnimalWelfare and Ethics Committee of St. Vincent’s Hospitaland the National Health and Medical Research Founda-tion of Australia.

Renal functionBody weight was measured weekly. Plasma urea and

creatinine were measured by autoanalyzer (BeckmanInstrumentals, Palo Alto, CA, USA) at the beginningand end of the study. Glomerular filtration rate (GFR)was measured prior to sacrifice by a single shot of 99m-technetium diethylenetriamine pentaacetic acid (Tc99m-DTPA) clearance [18]. Systolic blood pressure wasmeasured in conscious rats using an occlusive tail-cuffplethysmograph attached to a pneumatic pulse trans-ducer (Narco Bio-system, Inc., Houston, TX, USA) [19].Before sacrifice, rats were housed in metabolic cages for24 hours for subsequent measurement of urinary proteinexcretion using the Coomassie brilliant blue method.

Histochemistry and immunohistochemistryFour micron sections were cut and examined after

either histochemical or immunohistochemical staining.Histochemical staining comprised the use of either hema-toxlyin and eosin, Masson’s trichrome, and periodic-acidSchiff (PAS) stains to examine extracellular matrix. Mastcells were identified in serial sections stained with tolu-idine blue, chymase, tryptase, and TGF-�. Macrophageswere identified by immunostaining with a monoclonalantibody specific for the monocyte/macrophage antigen,ED-1 (Serotec, London, UK). Toluidine blue stainingwas performed by immersion of sections in 0.1% tolu-

idine blue (Sigma Chemical Co., St. Louis, MO, USA)for 1 minute at room temperature with mast cells, identi-fied by their characteristic metachromasia [20]. Mast cellsand macrophages were quantified in 25 randomly se-lected, nonoverlapping fields and expressed as the num-ber of mast cells/mm2. Immunostaining for chymase,tryptase, and TGF-�1 was also performed using a mono-clonal antichymase (Chemicon, Temecula, CA, USA),monoclonal antitryptase (Chemicon) and polyclonal rab-bit antihuman TGF-�1 (Santa Cruz Biotechnology, SantaCruz, CA, USA) antibodies. Stem cell factor (SCF-1)was localized using a polyclonal rabbit antirat antibody(Santa Cruz Biotechnology). Immunohistochemistry wasperformed, as previously described [21] with visualiza-tion using the indirect avidin-biotin complex (ABC)method.

Renal structureChanges in kidney structure were assessed in a masked

protocol in at least 25 randomly selected tissue sectionsfrom each group studied. Sections were stained witheither Mayer’s hematoxylin and eosin to examine cellstructure, PAS, or Masson’s modified trichrome to dem-onstrate collagen matrix [22].

Glomerulosclerosis. In 4 �m kidney sections stainedwith PAS, 50 to 80 glomeruli from rats were examined.The degree of sclerosis in each glomerulus was subjec-tively graded on a scale of 0 to 4 as previously described[23]: grade 0, normal; grade 1, sclerotic area up to 25%(minimal); grade 2, sclerotic area 25% to 50% (moder-ate); grade 3, sclerotic area 50% to 75% (moderate tosevere); and grade 4, sclerotic area 75% to 100% (se-vere). A glomerulosclerotic index (GSI) was then calcu-lated using the formula:

4

GSI � � Fi (i)

i � 0

where Fi is the % of glomeruli in the rat with a givenscore (i) [18].

Tubulointerstitial fibrosis. The accumulation of matrixwithin the tubulointerstitium was estimated on Masson’strichrome–stained sections using computer-assisted im-age analysis, as previously reported [24, 25]. Briefly, fiverandom nonoverlapping fields from each rat were cap-tured and digitized using a BX50 microscope attachedto a Fujix HC5000 digital camera (Fuji, Tokyo, Japan).Digital images were then loaded onto a Pentium III IBMcomputer (Gateway, Los Angeles, CA). An area of blueon a trichrome-stained section was selected for its colorrange and the proportional area of tissue with this rangeof color was then quantified. Calculation of the propor-tional area stained blue (matrix) was then determinedusing image analysis (AIS, Analytical Imaging StationVersion 6.0, Toronto, Ontario, Canada).

Jones and Kelly et al: Mast cell infiltration and chemokine expression908

Table 1. Primers and probes for rat interleukin-8 (IL-8)/gro-�, stemcell factor (SCF) and transforming growth factor-� (TGF-�1)

IL-8/gro-�Forward primer AGAACATCCAGAGTTTGAAGGTGATReverse primer GTGGCTATGACTTCGGTTTGGProbe CCGCCAGGACCCCACTGCA

SCFForward primer CAGTAATAGGAAAGCCGCAAAGTCReverse primer GCCGGCAGTGCCATTGProbe CTGAAGACCCGGGCCTACAATGGAC

TGF-ß1Forward primer AGAAGTCACCCGCGTGCTAReverse primer TGTGTGATGTCTTTGGTTTTGTCAProbe TGGTGGACCGCAACAACGCAAT

RNA extraction and cDNA synthesis

Frozen kidney tissue, stored at �80�C, was homoge-nized (Polytron, Kinematica Gmbh, Littau, Switzerland)and total RNA was isolated using TRIzol reagent (LifeTechnologies, Grand Island, NY, USA). The purifiedRNA was dissolved in sterile water and quantified spec-trophotometrically (OD260). RNA quality was verifiedon a 1% denaturing agarose gel. Four micrograms oftotal RNA was treated with RQ1 DNase (1 U/�L) (Pro-mega, Madison, WI, USA) to remove genomic DNA.The DNase treated RNA was reverse transcribed with1 �L (2 �g/�L) random hexamers (Roche Diagnostics,Mannheim, Germany) and incubated for 5 minutes at70�C. After cooling on ice for 5 minutes, 5 �L of 5 �avian myelomatosis virus (AMV) reaction buffer, 2.5 �Lof 10 mmol/L desoxynucleoside triphosphate (dNTP)mix, 0.5 �L RNase inhibitor (40 U/�L) (Roche Diagnos-tics, Mannheim, Germany), 0.5 �L AMV reverse tran-criptase (25 U/�L) (Roche Diagnostics) and 4.5 �L ofdiethyl pyrocarbonate (DEPC) water was added. Tubeswere incubated at 37�C for 60 minutes, after which cDNAsamples were stored at �20�C for future use.

Quantitative real-time polymerase chain reaction

Using rat specific sequence primers (Table 1), the geneexpression of three mast cell chemokines, interleukin-8(IL-8)/gro-�, SCF-1, and TGF-�1, were quantified byreal-time reverse transcription-polymerase chain reac-tion (RT-PCR), as previously described [26]. A commer-cial, predeveloped 18S control kit with [TAMRA] onthe 3� end (PE Biosystems, Foster City, CA, USA) wasused as the housekeeping gene to control for inequalitiesof loading. Primers and probes for target genes wereobtained from PE Biosystems. Both probes included afluorescence reporter (6-carboxyfluorescein [FAM]) atthe 5�-end and a fluorescent quencher (6-carboxytetra-methylrhodamine [TAMRA]) at the 3�-end. For the rela-tive quantification of the target gene and the endogenousreference 18S ribosomal RNA (18S), real-time quantita-tive RT-PCR was performed using an GeneAmp 5700

Sequence Detector (PE Biosystems) according to themanufacturer’s instructions. The derived normalized val-ues were the averages of four runs. Results were ex-pressed as the ratio of IL-8/gro-�, TGF-�1, or SCF mRNAto 18S relative to sham kidney, which were arbitrarilyassigned a value of 1.

Statistics

All data are shown as mean SEM unless otherwisespecified. Data were analyzed by analysis of variance(ANOVA) using the StatView IV program (Brainpower,Calabasas, CA, USA) on a Macintosh G4. Comparisonsbetween group means were performed by Fisher’s leastsignificant difference method. A P value of less than 0.05was considered statistically significant.

RESULTS

Clinical parameters

Subtotal nephrectomy led to the development of pro-gressive renal scarring with associated hypertension, pro-teinuria and impaired glomerular filtration rate (GFR).All of these changes were attenuated with ramipril treat-ment (Table 2).

Mast cells and macrophages

Only an occasional mast cell was identified in the kid-neys of sham-operated rats. In contrast, significant infil-tration of toluidine blue–positive mast cells were notedin the tubulointerstitium of rats that had undergone sub-total nephrectomy (Fig. 1). In particular, mast cells werenoted in areas of tubular dilatation and interstitial fibro-sis, but not noted within the glomerular tuft. The extentof mast cell infiltration was greater at 12 weeks than at4 weeks and was significantly reduced in kidneys fromramipril-treated rats. In serial sections, toluidine blue–stained mast cells also showed positive immunostainingfor chymase, tryptase, and TGF-�1 (Fig. 2). Mast cellswere mostly found in areas that also included abundantED-1–labeled macrophages (Fig. 3). At 12 weeks, theratio of macrophages to mast cells was 15:1 (macro-phages 404 11/mm2, mast cells 26 6/mm2; P 0.01).

Mast cell chemokines

Expression of IL-8/gro-� was increased at 4 weeks andto a greater extent at 12 weeks after subtotal nephrec-tomy (Fig. 4). TGF-� mRNA followed a similar chronol-ogy. In contrast, SCF was not elevated at 4 weeks butonly at 12 weeks after renal mass reduction. The over-expression of all three mast cell chemokines, IL-8/gro-�,TGF-�, and SCF, was attenuated by ramipril (Fig. 4).SCF expression was mostly undetectable in sham-oper-ated rats but was present in tubules of rats that hadundergone 5/6 nephrectomy (Fig. 5).


Table 2. Clinical parameters at end of study

12 weeks � angiotensin-convertingSham 4 weeks 12 weeks enzyme inhibitor

Number 10 10 10 10Body weight g 49113 3249 43619 40123Systolic blood pressure mm Hg 1153 1768a 180 15a 121 8b

Glomerular filtration rate mL/min/L 4.00.2 0.60.3a 0.7 0.2a 1.7 0.1a,b

Urinary protein g/day 132 2616a 211 86a 236b

Glomerulosclerotic index 0.30.0 2.00.3a 3.1 0.4a 1.5 0.4a

Tubulointerstitial fibrosis % area 0.00.1 2.00.6a 3.6 1.0a 1.4 0.4a,b

Data expressed as mean SEM.aP 0.01 vs. sham; bP 0.01 vs. 12 weeks

Fig. 1. Mast cells in subtotal nephrectomy. ACEI is angiotensin-con-verting enzyme inhibitor.

DISCUSSION

The pathogenesis of progressive renal injury followingan initial insult remains incompletely understood. Whilethe role of macrophages and their chemotactic factorsin kidney disease has been widely examined [2, 27], otherbone marrow–derived cells have not been extensivelystudied. The present study identifies a number of novelfindings in relation to the pathogenesis of renal injurythat follows renal mass reduction, a nonimmune modelof progressive of renal disease [28]. First, mast cell infil-tration was a prominent and early feature following renalinjury. Second, mast cells in the injured kidney werefound to contain TGF-�1, as well as chymase and tryp-tase. Third, we found that a range of mast cell chemo-kines were elevated in the setting of renal injury, withearly induction of TGF-� and IL-8/gro-�, while SCF wasexpressed later in the course of disease. Finally, ACEinhibitor treatment was associated with attenuation inchemokine expression and mast cell infiltration.

In addition to their well-established role in allergicdisease, mast cells have also been repeatedly implicatedin the pathogenesis of fibrotic scarring [29]. For instance,mast cells are particularly abundant at the site of activelesions in scleroderma [30], a chronic disorder character-ised by progressive skin and extradermal fibrosis affect-ing multiple tissue sites, including the kidney. Mast cellinfiltration has also been documented in a range of kid-ney diseases where their presence in the tubulointerstit-ium correlates closely with collagen–synthesizing myo-fibroblasts [31]. In particular, mast cells have been notedto be most abundant in diabetic nephropathy [11], IgAnephropathy [7], and in rapidly progressive glomerulo-nephritis, where mast cells numbers correlates closelywith both tubulointerstitial pathology and decliningGFR [8].

Mast cells secrete a range of factors that may contrib-ute to renal injury, including endothelin [21], growthfactors, and the proteolytic enzymes implicated in thepathogenesis of renal disease. For instance, the majormast cell enzyme, tryptase, promotes renal fibroblastproliferation and collagen synthesis, particularly in com-bination with heparin, another mast cell secretory prod-uct [10]. Chymase, in addition to its potential role inangiotensin II generation, also converts the latent, bio-logically inactive form of TGF-� into an active formrecognized by its type II receptor [32]. TGF-� is a potentprofibrotic growth factor that is widely implicated in thepathogenesis of progressive renal disease [33]. WhileTGF-� containing mast cells have been previously re-ported [32, 34], the present study is the first to identifythem within the kidney. Indeed, the presence of bothTGF-� and chymase within mast cell granules, as demon-strated in this study, suggests that mast cell degranulationwill be followed by the liberation and subsequent activa-tion of TGF-�.

Identification of TGF-� containing mast cell infiltra-tion suggests a role in renal fibrosis. Other TGF-� con-taining bone marrow–derived cells, such as macrophages,were also identified in the present study as even moreabundant. However, the enormous secretory, storage,and synthetic capacity of the mast cell [35] suggests that


Fig. 2. Photomicrographs of mast cells withinthe kidney of subtotally nephrectomized rats.Chymase-positive mast cells (A ) (arrows) lo-calized to the cortical interstitium (magnifica-tion �280). Serial sections showing an intersti-tial mast cell in close proximity to a vessel (*)demonstrating toluidine blue metachromasia(B), and positive immunostaining for tryptase(C) and transforming growth factor-� (TGF-�)(D) (magnification �1020).

Fig. 3. Serial sections showing (A) toluidineblue–stained mast cells (arrows) and (B) ED-1immunopositive macrophages (arrows) local-ized to the interstitium and adjacent to a tu-bule (*) (magnification �520).

it may contribute disproportionately to the quantity ofTGF-� in the local milieu.

The profibrotic contents of the mast cell suggest thatit has an active, pathogenetic role in renal fibrosis, ratherthan that of a bystander [12]. In the present study, mastcells were closely associated with areas of tubulointersti-tial fibrosis and tubular atrophy. While not specificallytested in the kidney, the active role of the mast cell inthe process of organ injury has recently been definitivelyshown in a mouse model of heart failure [36]. Using theW/Wv mouse, Hara et al [36] demonstrated a significantreduction in both cardiac fibrosis and ventricular dys-

function when these mast cell–deficient animals weresubjected to aortic banding.

Several factors have been identified as mast cell che-moattractants. These include chemokines such as IL-8,growth factors like TGF-�, and the ligand for the mastcell c-kit receptor, SCF [14–16]. Chemokines are a familyof cytokines responsible for the chemotaxis of inflamma-tory cells. It consists of four subfamilies that are classifiedon the basis of their constituent cysteine residues as C,CC, CXC, and C(X3)C chemokines [37]. Recent studieshave indicated that of this array, only a subtype of theCXC chemokines, those with a conserved glutamate-


Fig. 4. Mast cell chemokines. Graphs showing gene expression of (A)stem cell factor (SCF), (B) interleukin-8 (IL-8/gro-�) and (C) trans-forming growth factor-�1 (TGF-�1) relative to the housekeeping gene18S, as assessed by real-time polymerase chain reaction (PCR). Resultsare expressed in arbitrary units relative to sham, assigned a value of 1.*P 0.01 vs. sham; †P 0.01 vs. 12 weeks.

leucine-arginine (ELR) motif are chemotactic for mastcells [13]. In the present study, IL-8/gro-� was dramati-cally up-regulated early in the course of renal disease andalso increased in the later disease stages, commensuratewith both progressive injury and mast cell infiltration.

In the present study, early up-regulation of TGF-�was also noted. While TGF-� in the kidney is mostlyknown for its role in tissue fibrosis, its other actionsinclude it being a potent chemoattractant for mast cells[16]. Thus, the finding in the present study that TGF-�is expressed in renal mast cells raises the potential fora vicious cycle, whereby TGF-� produced by mast cellsleads to TGF-�–dependent mast cell chemotaxis, moreTGF–�, and an exuberant fibrotic response in neigh-boring tissues.

In contrast to most other bone marrow–derived cells,mast cells are extruded as immature precursor cells thatdifferentiate and mature at the site of their migration[38]. The cellular and soluble components that lead tomast cell differentiation and maturation are not wellunderstood, although SCF acting through its cognatereceptor, c-kit, is thought to play a pivotal role in a rangeof aspects of mast cell differentiation and function [14].Consistent with findings in chronic glomerulonephritis[9], the present study also documented increased SCFin association with renal injury and localized its expres-sion to areas of tubulointerstitial injury, as previouslyreported in human biopsies [9]. In addition to its chemo-tactic actions, SCF, through its interaction with c-kit, isalso a potent mediator of mast cell degranulation [39].


Fig. 5. Photomicrograph showing stem cellfactor (SCF)–stained tubular epithelium (brown)in an area of tubulointerstitial injury, adjacentto a glomerulus (*) from a 5/6 nephrectomizedrat (magnification �280).

The finding in the present study of the late overexpres-sion of SCF suggests that this factor may have a role inthe perpetuation of mast cell–mediated renal injuryrather than the initiation of the pathologic process.

In the present study, ACE inhibition not only attenu-ated the structural and functional injury in subtotal ne-phrectomized rats, but also reduced mast cell infiltrationand chemokine expression. In particular, IL-8/gro-�, dra-matically overexpressed following subtotal nephrectomy,was normalized by ACE inhibition. Together, the find-ings of the present study indicate that mast cell infiltra-tion and related chemokine expression are prominentand early features following renal mass that may contrib-ute pathogenetically to progressive renal injury.

ACKNOWLEDGMENTS

The authors wish to thank Mariana Pacheco and Sylvia Glowackafor their expert technical assistance. Studies were supported, in part,by grants from the National Health and Medical Research Foundationof Australia and Juvenile Diabetes Research Foundation International.Susan Jones was the recipient of a postdoctoral research fellowshipfrom Aventis Pharma.

Reprint requests to Richard E. Gilbert, University of Melbourne,Department of Medicine, St. Vincent’s Hospital, 41 Victoria Parade,Fitzroy, Victoria, Australia.E-mail: [email protected]

REFERENCES

1. Weber KT: Fibrosis, a common pathway in organ failure: Angio-tensin II and tissue repair. Semin Nephrol 17:467–491, 1997

2. Atkins RC: Macrophages in renal injury. Am J Kidney Dis 31:45–47, 1998

3. Schena FP, Gesualdo L, Grandaliano G, Montinaro V: Pro-gression of renal damage in human glomerulonephritides: is theresleight of hand in winning the game? Kidney Int 52:1439–1457,1997

4. Rodriguez-Iturbe B, Pons H, Herrera-Acosta J, Johnson RJ:Role of immunocompetent cells in nonimmune renal diseases.Kidney Int 59:1626–1640, 2001

5. Church MK, Levischaffer F: The human mast cell. J Allergy ClinImmunol 99:155–160, 1997

6. Yamada M, Ueda M, Naruko T, et al: Mast cell chymase expressionand mast cell phenotypes in human rejected kidneys. Kidney Int59:1374–1381, 2001

7. Ehara T, Shigematsu H: Contribution of mast cells to the tubulo-interstitial lesions in IgA nephritis. Kidney Int 54:1675–1683, 1998

8. Hiromura K, Kurosawa M, Yano S, Naruse T: Tubulointerstitialmast cell infiltration in glomerulonephritis. Am J Kidney Dis32:593–599, 1998

9. El-Koraie AF, Baddour NM, Adam AG, et al: Role of stem cellfactor and mast cells in the progression of chronic glomerulo-nephritides. Kidney Int 60:167–172, 2001

10. Kondo S, Kagami S, Kido H, et al: Role of mast cell tryptase inrenal interstitial fibrosis. J Am Soc Nephrol 12:1668–1676, 2001

11. Ruger BM, Hasan Q, Greenhill NS, et al: Mast cells and typeVIII collagen in human diabetic nephropathy. Diabetologia 39:1215–1222, 1996

12. Eddy AA: Mast cells find their way to the kidney. Kidney Int60:375–377, 2001

13. Nilsson G, Mikovits JA, Metcalfe DD, Taub DD: Mast cellmigratory response to interleukin-8 is mediated through interac-tion with chemokine receptor CXCR2/interleukin-8RB. Blood93:2791–2797, 1999

14. Valent P: The riddle of the mast cell: Kit(CD117)-ligand as themissing link? Immunol Today 15:111–114, 1994

15. Nilsson G, Butterfield JH, Nilsson K, Siegbahn A: Stem cellfactor is a chemotactic factor for human mast cells. J Immunol153:3717–3723, 1994

16. Gruber BL, Marchese MJ, Kew RR: Transforming growth factor-beta 1 mediates mast cell chemotaxis. J Immunol 152:5860–5867,1994

17. Wu L, Cox A, Roe C, et al: Transforming growth factor �1 andrenal injury following subtotal nephrectomy in the rat: Role of therenin-angiotensin system. Kidney Int 51:1553–1567, 1997

18. Gilbert RE, Berka-Wilkinson JL, Johnson DW, et al: Renalexpression of �ig-h3 (transforming growth factor-� inducible gene-h3) in normal and diabetic rats. Kidney Int 54:1052–1062, 1998

19. Bunag RD: Validation in awake rats of a tail-cuff method formeasuring systolic pressure. J Appl Physiol 34:279–282, 1973

20. Qu ZH, Kayton RJ, Ahmadi P, et al: Ultrastructural immunolocali-


zation of basic fibroblast growth factor in mast cell secretory gran-ules—Morphological evidence for bFGF release through degranu-lation. J Histochem Cytochem 46:1119–1128, 1998

21. Gilbert RE, Rumble JR, Cao ZM, et al: Endothelin receptorantagonism ameliorates mast cell infiltration, vascular hypertro-phy, and epidermal growth factor expression in experimental dia-betes. Circ Res 86:158–165, 2000

22. Kelly DJ, Wilkinson-Berka JL, Allen TJ, et al: A new modelof diabetic nephropathy with progressive renal impairment in thetransgenic (mRen-2) 27 rat. Kidney Int 54:343–352, 1998

23. Heart Outcomes Prevention Evaluation Study Investigators:Effects of ramipril on cardiovascular and microvascular outcomesin people with diabetes mellitus: Results of the HOPE study andMICRO-HOPE Substudy. Lancet 355:253–259, 2000

24. Lehr HA, Mankoff DA, Corwin D, et al: Application of pho-toshop-based image analysis to quantification of hormone receptorexpression in breast cancer. J Histochem Cytochem 45:1559–1565,1997

25. Lehr HA, van der Loos CM, Teeling P, Gown AM: Completechromogen separation and analysis in double immunohistochemi-cal stains using Photoshop-based image analysis. J Histochem Cyto-chem 47:119–126, 1999

26. Jandeleit-Dahm K, Hannan KM, Farrelly CA, et al: Diabetes-induced vascular hypertrophy is accompanied by activation ofNa(�)-H(�) exchange and prevented by Na(�)-H(�) exchangeinhibition. Circ Res 87:1133–1140, 2000

27. Nikolic-Paterson DJ, Lan HY, Atkins RC: Macrophages in im-mune renal injury, in Immunologic Renal Disease, edited by Neil-son EG, Couser WG, Philadelphia, Raven Press, 1997, pp 575–592

28. Brenner BM: Hemodynamically mediated glomerular injury and

the progressive nature of kidney disease. Kidney Int 23:647–655,1983

29. Levischaffer F, Rubinchik E: Mast cell role in fibrotic diseases.Isr J Med Sci 31:450–453, 1995

30. Gruber BL: Mast cells in scleroderma. Clin Dermatol 12:397–406,1994

31. Toth T, Toth-Jakatics R, Jimi S, et al: Mast cells in rapidly progres-sive glomerulonephritis. J Am Soc Nephrol 10:1498–1505, 1999

32. Lindstedt KA, Wang Y, Shiota N, et al: Activation of paracrineTGF-beta1 signaling upon stimulation and degranulation of ratserosal mast cells: A novel function for chymase. FASEB J 15:1377–1388, 2001

33. Sharma K, Ziyadeh FN: The transforming growth factor-� systemand the kidney. Semin Nephrol 13:116–128, 1993

34. Moller A, Henz BM, Grutzkau A, et al: Comparative cytokinegene expression: Regulation and release by human mast cells.Immunology 93:289–295, 1998

35. Dvorak AM, Morgan ES, Lichtenstein L, et al: RNA is closelyassociated with human mast cell secretory granules, suggesting arole(s) for granules in synthetic processes. J Histochem Cytochem48:1–12, 2000

36. Hara M, Ono K, Hwang MW, et al: Evidence for a role of mast cellsin the evolution to congestive heart failure. J Exp Med 195:375–381,2002

37. Rollins BJ: Chemokines. Blood 90:909–928, 199738. Church MK, Levi-Schaffer F: The human mast cell. J Allergy

Clin Immunol 99:155–160, 199739. Taylor AM, Galli SJ, Coleman JW: Stem-cell factor, the kit

ligand, induces direct degranulation of rat peritoneal mast cells invitro and in vivo: Dependence of the in vitro effect on period ofculture and comparisons of stem-cell factor with other mast cell-activating agents. Immunology 86:427–433, 1995

mast cell infiltration and chemokine expression in progressive renal disease1

Documents