BRIEF REPORTS 121

protein genes will be an important step toward understand-Mapping of the Human Ribosomal ing this process. Several ribosomal protein small subunit(RPS) genes have now been mapped to specific regions inSmall Subunit Protein Gene RPS24the human genome. For example, RPS8 has been mapped toto the Chromosome chromosome 1p32–p34.1 (1), chromosome 11q23.3 containsthe locus for RPS25 (3), and RPS14 has been assigned to10q22–q23 Boundarychromosome 5q23–q33 (5). We isolated a cDNA clone encod-ing the human 40S ribosomal subunit protein S24 during aAnne-Marie Jones,* Rosalia Marzella,†cDNA selection protocol using YAC DNA. The sequence of theMariano Rocchi,† and Jane E. Hewitt*,1

RPS24 locus has been determined (6), but its chromosomal*School of Biological Sciences, The University of Manchester, 3.239 location was unknown. Based on the primer sequences de-Stopford Building, Oxford Road, Manchester, M13 9PT, United scribed by Xu and Roufa (6), an STS for RPS24 was designed.Kingdom; and †Instituto di Genetica, Via Amendola 165/A, These primers, P1 (5* GACACCGTAACTATCCGCACTAG70126 Bari, Italy 3 *) and P2 (5* CCTTCCCGGGGTGAAGGACATC 3 *), were

predicted to amplify a 183-bp product from exon II to exonReceived August 8, 1996; accepted October 9, 1996III of the RPS24 gene (6). Many ribosomal pseudogenes havebeen reported (2). Therefore, primers that flanked an intronwere used to differentiate between products from the intron-containing locus and any processed RPS24 pseudogenes. PCREukaryotic ribosomes are known to be composed of at leastwas carried out in a 25-ml total volume using 50 ng genomic80 protein subunits. The regulation of ribosomal subunit geneDNA, 20 pmol of each primer, 200 mM dNTPs, 0.2 U Dyna-expression is thought to be a coordinated process. Identifica-zyme (Flowgen), and buffer supplied by the manufacturer.tion of the chromosomal localization of these many ribosomalThermocycling conditions were 30 cycles of 30 s at 947C, 30s at 687C, and 30 s at 727C. A product of the expected size1 To whom correspondence should be addressed. Telephone: /44was amplified from human DNA; no product was produced161 275 5246. Fax: /44 161 275 3915. E-mail: jhewitt@hgmp.mrc.

ac.uk. from mouse or hamster DNA.

FIG. 1. Idiogram of human chromosome 10. The chromosome 10 content of each cell line is indicated by vertical bars. The horizontalline shows the position of the RPS24 gene. The photograph shows the result of the PCR analysis of these lines for the presence of theRPS24 gene. Cell lines 82, 89, 167, and 132 are positive; (/) and (0) indicate positive and negative controls, respectively.

GENOMICS 39, 118–120 (1997)ARTICLE NO. GE9644840888-7543/97 $25.00Copyright q 1997 by Academic PressAll rights of reproduction in any form reserved.

AID Genom BREP / 6r21$$441x 12-31-96 07:30:13 gnmbr AP: Genomics

BRIEF REPORTS122

of its chromosomal location at 1p32–p34.1. Genomics 15: 68–This STS was used initially to screen a somatic cell hybrid75.panel from BIOS Laboratories, which mapped the RPS24

gene to human chromosome 10 (data not shown). To localize 2. Feo, S., Davies, B., and Fried, M. (1992). The mapping of seventhe gene more precisely, a panel of well-characterized chro- intron-containing ribosomal protein genes shows they are un-mosome 10 subchromosomal radiation and somatic cell hy- linked in the human genome. Genomics 13: 201–207.brids (4) were then screened with this STS. The results of 3. Imai, T., Sudo, K., and Miwa, T. (1994). Assignment of thethis PCR and the chromosome 10 content of each cell line are human ribosomal protein S25 gene (RPS25) to chromosomeshown in Fig. 1 and place the RPS24 gene at the 10q22– 11q23.3 by sequence analysis of the marker D11S456. Genomicsq23 boundary. This is the first ribosomal protein gene to be 20: 142–143.mapped to human chromosome 10.

4. Moschonas, N. K., Spurr, N. K., and Mao, J. (1996). Report ofthe first international workshop on human chromosome 10ACKNOWLEDGMENTS mapping 1995. Cytogenet. Cell Genet. 72: 99–112.

A-M.J. is supported by an HGMP Studentship from the Medical 5. Nakamichi, N. N., Kao, F. T., Wasmuth, J., and Roufa, D. J.Research Council. This work was supported by Telethon and AIRC. (1986). Ribosomal gene sequences map to human chromosomes

5, 8, and 17. Somat. Cell Mol. Genet. 12: 225 –236.REFERENCES

6. Xu, W. B., and Roufa, D. J. (1996). The gene encoding humanribosomal protein S24 and tissue-specific expression of differen-1. Davies, B., and Fried, M. (1993). The structure of the human

intron-containing S8 ribosomal protein gene and determination tially spliced messenger RNAs. Gene 169: 257 –262.

AID Genom BREP / 6r21$$441x 12-31-96 07:30:13 gnmbr AP: Genomics