manipulating splicing by inducing terminal intron...

Manipulating Splicing by Inducing

Terminal Intron Retention

Bachelor of Forensics (Forensic Biology and Toxicology)

Bachelor of Science (Molecular Biology and Biomedical Science)

School of Veterinary and Life Sciences

Murdoch University, Western Australia

Supervisors:

Professor Steve Wilton

Professor Sue Fletcher

Division of Research and Development, Centre for Comparative

Genomics

This thesis is submitted for Honours degree in Molecular Biology at

Murdoch University, Western Australia.

November, 2015

Peilin Wang

(31397183)

Declaration

I declare this thesis is my own account of my research and contains as its main content

work which has not been previously submitted for a degree at any tertiary education

institution.

Peilin Wang

November, 2015

iii

Abstract

Regulation of gene expression can occur at the pre-mRNA level by alternative splicing.

As a type of alternative splicing, intron retention received attention only in recent years.

Specifically, there are few reports on endogenous terminal intron retention event in

different gene transcripts and only one report of antisense oligonucleotide induced

retention of the terminal intron in SMN transcripts. So far, there is no report of induced

terminal intron retention other gene transcripts. Terminal intron retention is proposed to

be inducible in human gene transcripts using antisense oligonucleotides, with an effect

on expression at the mRNA and/or protein levels. Five gene transcripts, LMNA, LMNC,

ITGA4, SOD1, and DMD, were selected and for each transcript, the terminal intron/exon

splice site and exon-internal sequences of the last exon were targeted for antisense

oligonucleotide annealing. It was found that terminal intron retention is inducible in

LMNC and ITGA4 transcripts, and possibly LMNA transcripts. Inclusion of the terminal

intron decreases full-length LMNC and ITGA4 mRNA expression whereas its effect on

protein expression is undetermined. Using the PMO chemistry resulted in a reduced

effect on terminal intron retention compared to when 2’-OMeAOs were used. In

addition, in both LMNC and ITGA4 transcripts, terminal intron retention led to

approximately 3% to 13% decrease in full-length mRNA expression. Changing

transfection parameters such as antisense oligonucleotide concentrations, transfection

reagent, and transfection duration can also influence transfection outcome. Possible

features that may predict terminal intron retention, including but not limited to, splicing

motifs, intron length and splice site strengths, were compared between transcripts with

and without retained terminal intron. However, no specific features for retention of the

terminal intron were observed. Overall, this project shows that terminal intron retention

is inducible in human gene transcripts other than SMN transcripts, but not in all gene

transcripts examined.

iv

Table of Contents

Front Page i

Declaration ii

Abstract iii

Table of Contents iv-viii

Acknowledgements ix

Abbreviations x

List of Figures xi-xiii

List of Tables xiv

1. Introduction 1-4

1.1 Mechanism and Regulation of Pre-mRNA Splicing 4

1.1.1 Mechanism of Splicing 4-5

1.1.2 Regulation of Splicing 6

1.2 Alternative Splicing 7

1.2.1 Common Types of Alternative Splicing 7-11

1.2.2 Alternative Splicing and Gene Expression 12

1.2.2.1 Negative Regulation 12-14

1.2.2.2 Positive Regulation: BCL-X 14-15

1.2.2.3 Indirect Regulation: Homer 15-16

1.2.3 Alternative Splicing and Neuronal Development 17-18

1.3 Using Antisense Oligonucleotides (AOs) to Manipulate Splicing 19-20

1.3.1 Antisense Oligonucleotide-Induced Splice Switching 20

1.3.1.1 Exon Retention and Exon Skipping 20

(i) Exon Retention 20-22

(ii) Exon Skipping 22-27

v

1.4 Rising Alternative Splicing Event: Intron Retention 27

1.4.1 Intron Retention 27-28

1.4.1.1 Intron Retention and Gene Expression 28

(i) Nuclear Retention and Degradation 28-29

(ii) Intron Retention and Nonsense-Mediated mRNA Decay

(NMD)

29-30

1.4.1.2 Cytoplasmic Intron-Retaining Transcripts (CIRTs) 30-31

1.4.1.3 Nuclear Intron-Retaining Transcripts 31-32

1.4.2 Pseudo-exon Activation 32-35

1.5 Why Study Terminal Intron Retention in Human Gene Transcripts? 35-38

1.6 Aims 38

2. Materials 39

2.1 2’-OMeAO Purification, Primers, PMOs and Leash Annealing 39

2.2 Cell Culture and Passaging 39-40

2.3 Transfection 41

2.4 Cell Harvest and RNA Extraction 42

2.5 RT-PCR, cDNA Synthesis, Long-range PCR 42-43

2.6 Gel Electrophoresis and Gel Visualisation 43

2.7 Product Isolation and DNA Sequencing 44

2.8 Semi-quantitative Analysis 44

vi

3. Methods 45

3.1 Antisense Oligonucleotide (AO) Design and Synthesis 45

3.2 AO Nomenclature 45-46

3.3 Purification of AOs 47

3.4 PCR Primer Design and Reconstitution 47-48

3.5 Cell Resurrection and Propagation 48-49

3.6 Cell Passage 49-50

3.7 Cell Transfection 50

3.7.1 2’-O-Methyl-Antisense Oligonucleotides (2’-OMeAOs) 50

3.7.1.1 Lipofectin® as Vehicle 50-51

3.7.1.2 Lipofectamine® 2000 as Vehicle 51-52

3.7.1.3 Lipofectamine® 3000 as Vehicle 52-53

3.7.2 Phosphorodiamidate Morpholino Oligomers (PMOs) 53-54

3.8 RNA Analysis 54

3.8.1 Total RNA Extraction 54

3.8.2 One-step RT-PCR 55

3.8.3 Two-step RT-PCR 55-56

3.9 Gel Electrophoresis and Product Analysis 56

3.9.1 Product Isolation and DNA Sequencing 56-57

3.9.2 Semi-quantitative Analysis 58

vii

4. Results 59

4.1 SMN-AOs Induced Terminal Intron Retention 59-62

4.2 Effects of Oligonucleotides on Transcript Splicing Patterns 62

4.2.1 Treatment of Normal Human Fibroblasts with LMNA-targeting

2’-OMeAOs

62-67

4.2.2 Treatment of Normal Human Fibroblasts with LMNC-targeting

2’-OMeAOs

67-70

4.2.2.1 Treatment of Normal Human Fibroblasts with LMNC-

targeting PMOs

71-72

4.2.3 Treatment of Normal Human Fibroblasts with ITGA4-targeting

2’-OMeAOs

73-75

4.2.3.1 Treatment of Normal Human Fibroblasts with ITGA4-

targeting PMOs

76-77

4.2.4 Treatment of Normal Human Fibroblasts with SOD1-targeting

2’-OMeAOs

77-80

4.2.5 Treatment of Normal Human Fibroblasts and Primary Myoblasts

with DMD-targeting 2’-OMeAOs

81-85

4.3 Evaluation of Different Transfection Reagents in Primary Human

Myoblasts and Normal Human Fibroblasts

86-89

5. Discussion 90

5.1 General Discussion 90

5.1.1 Primary Experiments on SMN Transcripts 90-91

5.1.2 Principle Findings 91-93

5.1.2.1 AO Concentration and Chemistry 94

5.1.2.2 Transfection Reagent 95

5.1.2.3 Transfection Duration 95-96

5.2 Possible Mechanism/Features of (Terminal) Intron Retention 96-100

5.3 Limitations 101-102

5.4 Future Directions and Implications 103

viii

5.4.1 Western Analysis 103

5.4.2 Experimental Modifications 103-105

5.4.3 Implications 105

6. Conclusion 106

References 107-120

Appendix 121

A. Recipes 121-122

B. Comparison of ITGA4 transcripts with retained terminal intron in L3K

transfection

123

C. Splicing Motif Analyses 124-130

D. Splice Site Scores 131

E. ESE and ESS Densities of Terminal Introns 132

ix

Acknowledgements

Hard. Challenging. This is what those who have gone through honours would say about

honours year. Indeed it was a challenging year, but it did not turn out to be as bad as I

had expected it to be. All thanks to the help and support from the people around me.

The first people to thank are of course my parents, for supporting me both financially

and psychologically. Without my beloved parents, I would not be able to study at

Murdoch for five years. Next, I want to thank my siblings (Peizhi, Peidi, Zhiheng) and

best friends (Rui Yin, Zhiying, Zhilin, Wen Rou) in Singapore for their moral support.

Though we did not talk much throughout the year when I was away from home, I know

very well that they are always there to encourage me whenever I feel stressed up. I also

want to thank my niece and nephew who cheered me up with their cute and funny acts

on the weekends through Skype.

The next group of people to thank is the Molecular Therapy Laboratory team at the

Centre for Comparative Genomics – Abbie, Loren, Iantha, May, Kristine, Kane, Niall,

Bao, and Russell. They had given me lots of help and great tips for my experiments. I

want to especially thank Loren for showing me the ropes to everything that I need to

know. Without her help, I would not be able to start and progress in my lab work.

I also want to express my thanks to Munik and Wing. Because we were going through

honours year together and worked at the same laboratory, we were able to understand

the problems each other faced and encourage each other. It was great to have someone

who understands what you are going through, to whine to about my failed experiments

and problems encountered.

Last but not least, I want to thank my supervisors, Professor Steve Wilton and Professor

Sue Fletcher. Nothing could express my gratitude to them for accepting me as their

honours student, and for their guidance, encouragement, and for editing my writings

despite their busy schedules and heavy workload.

Overall, honours year is indeed hard and challenging, but it was also worthy and

fulfilling.

x

Abbreviations

2’-OMeAO 2’-O-methyl modified antisense oligonucleotide on a

phosphorothioate backbone

AO Antisense oligonucleotide

CEE Chick embryo extract

DMEM Dulbecco's Modified Eagle Medium

dNTPs Deoxyribonucleoside triphosphates

EDTA Ethylenediaminetetraacetic acid

FBS Foetal bovine serum

HS Horse serum

L2K Lipofectamine® 2000 transfection reagent

L3K Lipofectamine® 3000 transfection reagent

MgCl2 Magnesium chloride

Opti-MEM Serum-free medium

PBS Phosphate buffered saline

PMO Phosphorodiamidate morpholino oligomer

rcf Relative centrifugal force

TAE Tris base, acetic acid and EDTA buffer

xi

List of Figures

Figure Title Page

Figure 1.1 Gene expression in a eukaryotic cell 1

Figure 1.2 Gene expression can be controlled at several levels 2

Figure 1.3 Pre-mRNA splicing in eukaryotic cells 5

Figure 1.4 Main models of alternative splicing 10-11

Figure 1.5 Alternative splicing and nonsense-mediated mRNA decay 14

Figure 1.6 Homer1 isoforms 16

Figure 1.7 Schematic representation of β -neurexin and neuroligin-1

transcripts that code for synaptic surface proteins

18

Figure 1.8 Schematic diagram showing the comparison of a complete

retention and partial retention of an intron

33

Figure 4.1 Schematic diagram of partial pre-mRNA showing AO

annealing sites and the location of RT-PCR primers used

60

Figure 4.2 SMN RT-PCR products amplified from normal human

fibroblasts transfected with SMN_8A(+57+81) and

SMN_8A(-10+15), using SMN primer set 5512a+5513a

61

Figure 4.3 RT-PCR of RNA extracted from normal human fibroblasts

treated with AO cocktails designed to induce terminal intron

retention in SMN transcripts

62

Figure 4.4 RT-PCR evaluating transfection of normal human fibroblasts

with the four LMNA-targeting 2’-OMeAOs designed to induce

terminal intron retention

64

Figure 4.5 Chromatogram of the 687bp LMNA RT-PCR product

amplified from RNA extracted from normal human fibroblasts

transfected with LMNA-targeting 2’-OMeAOs

64

Figure 4.6 RT-PCR evaluating transfection of normal human fibroblasts

with the four LMNA-targeting 2’-OMeAOs designed to induce

terminal intron retention

66

xii

Figure 4.7 Ratios of full-length LMNA transcripts in normal human

fibroblasts after transfection with LMNA-targeting 2’-

OMeAOs

67

Figure 4.8 RT-PCR evaluating the transfection of normal human

fibroblasts with the four 2’-OMeAOs targeting LMNC

transcripts designed to induce terminal intron retention

68

Figure 4.9 Chromatograms of LMNC RT-PCR products 69

Figure 4.10 Chromatogram of the ~300bp SMN RT-PCR product


transfected with LMNC_H10A(+66+90)

69

Figure 4.11 Semi-quantitative analysis of terminal intron retention

induced in LMNC transcripts

70

Figure 4.12 RT-PCR showing transfection with PMOs designed to induce

retention of the LMNC terminal intron

72

Figure 4.13 RT-PCR evaluating the transfection of normal human

fibroblasts with the four 2’-OMeAOs targeting ITGA4

transcripts designed to induce terminal intron retention

74

Figure 4.14 Chromatograms of ITGA4 RT-PCR products 75

Figure 4.15 Semi-quantitative analysis of terminal intron retention

induced in ITGA4 transcripts

75

Figure 4.16 RT-PCR showing transfection with PMOs designed to induce

retention of the ITGA4 terminal intron

76

Figure 4.17 Proportions of ITGA4 transcripts with retained terminal intron

when different AO chemistries were used

77


transfected with SOD1-targeting 2’-OMeAOs

78

Figure 4.19 Chromatogram of the 300bp SOD1 RT-PCR product


transfected with SOD1-targeting AOs

79

xiii


transfected with second generation of SOD1-targeting 2’-

OMeAOs

80


transfected with DMD-targeting 2’-OMeAOs

82

Figure 4.22 RT-PCR of RNA extracted from primary human myoblasts

transfected with DMD-targeting 2’-OMeAOs

83

Figure 4.23 Fibroblast and myoblast DMD RT-PCR products and

chromatograms of the amplified DMD RT-PCR products

85

Figure 4.24 RT-PCR of RNA extracted from myoblasts transfected with

DMD- and SMN-targeting 2’-OMeAOs

86

Figure 4.25 Repeat of LMNA and ITGA4 experiments using

Lipofectamine® 3000 (L3K) transfection reagent

88-89

Figure 4.26 Ratios of full-length LMNA and ITGA4 transcripts in normal

human fibroblasts after 24h and 48h transfections using

Lipofectamine® 3000 (L3K) transfection reagent

89

xiv

List of Tables

Table Title Page

Table 1.1 Four main models of alternative splicing events and resultant

gene transcripts

8-9

Table 1.2 Genes with alternatively spliced transcripts that trigger RUST 13

Table 2.1 2’-OMeAO Purification, Primers, PMOs and Leash Annealing 39

Table 2.2 Cell Culture and Passaging 39-40

Table 2.3 Transfection 41

Table 2.4 Cell Harvest and RNA Extraction 42

Table 2.5 RT-PCR, cDNA synthesis, Long-range PCR 42-43

Table 2.6 Gel Electrophoresis and Gel Visualisation 43

Table 2.7 Product Isolation and DNA Sequencing 44

Table 2.8 Semi-quantitative Analysis 44

Table 3.1 Sequences of 2'-OMeAOs used in the project 46

Table 3.2 Sequences of primers used in the project 48

Table 3.3 Sequences of PMOs and leashes used in PMO lipoplex

transfections

54

Table 3.4 RT-PCR cycling conditions for different gene transcripts 55

Chapter 1: Introduction

1

1. Introduction

For any gene to be expressed, it must first undergo transcription in the nucleus to

generate pre-mRNA, which has to be processed before it can be exported out of the

nucleus to be translated into protein in the cytoplasm (Figure 1.1) or used as non-coding

RNAs (e.g. miRNA, snoRNA, snRNA). Gene expression involves many steps, and

regulation of gene expression can occur at different levels: chromatin, DNA, pre-mRNA,

mature mRNA, and protein. At each level, gene expression may be controlled by

multiple factors (Figure 1.1).

Figure 1.1 Gene expression in a eukaryotic cell. There are four steps in gene expression: transcription, pre-mRNA splicing, nuclear export, and translation. Transcription and splicing occur in the nucleus while translation takes place at the ribosomes in the cytoplasm.

(Taken from O'Connor, C. M. & Adams, J. U. 2010. Essentials of Cell Biology.

Cambridge, MA: NPG Education.)


2

At the pre-mRNA level, numerous important processes have to occur in order for pre-

mRNA transcripts to undergo nuclear export, including 5’ capping, 3’ end cleavage, 3’

polyadenylation, splicing, deposition of exon junction complex, and recruitment of

mRNA nuclear export factors (Carmody and Wente, 2009). Splicing takes place in the

nucleus, removing introns (non-coding sequences) and joining exons (segments of the

mature gene transcript, including non-coding exons in untranslated regions). Selection

Figure 1.2 Gene expression can be controlled at several levels. The levels of control can include alteration of the molecule, or they can be categorised into the stages of transcription, post-transcription, translation, and post-translation. Alternative splicing is an example of post-transcriptional regulation that occurs at the pre-mRNA level. Alternative splicing generates isoforms of gene transcripts that may be degraded, sequestered in the nucleus, or exported to the cytoplasm and translated.

Chromatin/

Chromosome

DNA

Pre-mRNA

Mature mRNA

Protein

Histone

Modification

Acetylation/

Deacetylation

Chromosomal

Rearrangement

Inversion

Translocation

Methylation

Alternative

Promoter

Enhancer

Methylation

Transcription

Factors Alternative

Transcription

Start Site

Splicing

Alternative

Splicing

3’ Polyadenylation

5’ Capping

miRNA

mRNA half-life

Phosphorylation

Glycosylation

Ubiquitination

Lipidation

Cleavage

Nuclear

export Exon Junction

Complex

Nonsense-

mediated decay

3’-end cleavage


3

of specific exons by the splicing machinery may be regulated in a tissue or

developmentally specific manner to generate alternative transcripts (Boise et. al., 1993;

Unsworth et. al., 1999; Zheng et. al., 2012; Yap et. al., 2012; Wong et. al., 2013),

contributing to transcriptomic and hence, proteomic diversity. Such a mechanism

whereby diversity arises from a finite number of genes is termed alternative splicing

(Graveley, 2001; Brett et. al., 2002).

Alternative splicing can have a wide array of effects, particularly in regulating

neuronally-expressed genes (Li et. al., 2007) and hence, has a role in ensuring normal

physiological and developmental processes in neuronal cells (Zheng and Black, 2013;

Gamazon and Stranger, 2014). Alternative splicing is also involved in stem cell renewal

and differentiation, organ formation, and immune system development (Gamazon and

Stranger, 2014). Alternative splicing is an important and fundamental mechanism in

eukaryotes, and aberrant splicing can disrupt gene expression, leading to human disease

(for reviews, see Cáceres and Kornblihtt, 2002; Faustino and Cooper, 2003; Garcia-

Blanco et. al., 2004; Licatalosi and Darnell, 2006). Nevertheless, alternative splicing

may also be harnessed as a strategy for therapeutic intervention.

Aberrant splicing occurs due to gene mutation(s), producing abnormal gene transcripts,

and may be altered by using antisense oligonucleotides, which are short nucleotide

sequences complementary to the target sequence (Dominski and Kole, 1993; Van

Deutekom et. al., 2001; Castellanos et. al., 2013; Osman et. al., 2014; Staropoli et. al.,

2015; Palhais et. al., 2015). These studies demonstrated that antisense oligonucleotides

can reduce the impact of some mutations by manipulating exon selection in aberrantly

spliced gene transcripts.


4

This review will briefly discuss the mechanism and regulation of splicing, followed by

examination of the role of both constitutive and alternative splicing in regulating gene

expression. The application of antisense oligonucleotides to induce splice switching in a

number of disease-related gene transcripts will be discussed, and the review will

conclude with examination of terminal intron retention, which is the focus of this

project.

1.1 Mechanism and Regulation of Pre-mRNA Splicing

1.1.1 Mechanism of Splicing

Pre-mRNA splicing results in the generation of a mature mRNA that is then transported

across the nuclear membrane to the cytoplasm, where protein-encoding transcripts may

be then translated into proteins and non-coding transcripts perform other functions.

Splicing is facilitated by a ribonucleoprotein complex called the spliceosome that is

composed of five small nuclear ribonucleoproteins (snRNPs) and an array of non-

snRNP auxiliary factors (Will and Luhrmann, 2011). The five snRNPs, U1, U2, U4, U5,

and U6, are made up of a snRNA and associated proteins (Will and Luhrmann, 2011).

Briefly, the snRNPs and auxiliary factors are recruited to the intron sequentially to form

the spliceosome, which then excises the intron as a lariat, and joins the flanking exons

(Figure 1.3). The assembly of the spliceosome requires four features within the intron

that the snRNPs and auxiliary factors recognise and bind: 5’ splice site (5’-ss), branch

point (BP), polypyrimidine tract (PPT), and 3’ splice site (3’-ss) (Figure 1.3), and 145

other RNAs and proteins (Gygi et. al., 2002).


5

Figure 1.3 Pre-mRNA splicing in eukaryotic cells. The first step of splicing involves

the binding of U1 to the 5’-ss and U2AF to the polypyrimidine tract (PPT) and 3’-ss

to form the E complex. U2AF binding facilitates binding of U2 to the branch point

(A), and the A complex is formed. Subsequently, U6, U4, and U5 are recruited to the

complex to form the large spliceosome. U1 and U4 are then removed, forming the

active spliceosome that splices the exons together. (Adapted from Li et. al., 2007)

A

U1

U2AF

U2

A

U1

U2AF

Intron

Lariat Mature mRNA

E Complex

Large

Spliceosome

A Complex

U1 U4

+

A

U1

U2 U2AF

U6 U4

U5

5’-ss 3’-ss

A PPT

Branch point

A


6

1.1.2 Regulation of Splicing

Splicing is regulated by highly coordinated cis- and trans-acting elements. In addition to

the 5’-ss, 3’-ss, BP and PPT, cis-acting elements include exonic splicing enhancers

(ESEs), exonic splicing silencers (ESSs), intronic splicing enhancers (ISEs) and intronic

splicing silencers (ISSs) (Will and Luhrmann, 2011). These cis-acting elements are

found within the pre-mRNA and exert their effects on the transcript by interacting with

trans-acting elements. Additionally, the relative distance between cis-acting elements,

as well as RNA secondary structure that may mask or bring cis-acting elements closer,

can also dictate the splicing process (Coelho and Smith, 2014). Trans-acting elements

can be RNA binding proteins (RBP) that recognise and bind to the cis-acting sequence

elements, or non-coding RNAs such as microRNAs (miRNAs) (Boutz et. al., 2007a;

Kalsotra et. al., 2010) and small nucleolar RNAs (snoRNAs) (Kishore and Stamm, 2006)

that bind to the pre-mRNA transcript or a RBP. Two extensively studied RBP families

are the SR proteins and the heterogeneous nuclear ribonucleoproteins (hnRNP). SR

proteins typically enhance splicing (Manley and Tacke, 1996; Shepard and Hertel, 2009)

while hnRNPs typically have negative effects on splicing (Krecic and Swanson, 1999).

In addition to the cis- and trans-acting elements, splicing can be affected by the rate of

transcription, implying that splicing can be regulated by chromatin modifications (Luco

and Misteli, 2011) (Figure 1.2).


7

1.2 Alternative Splicing

1.2.1 Common Types of Alternative Splicing

Constitutive splicing is typically defined as the removal of introns and ligation of exons

in a pre-mRNA, such that the mature mRNA consists of all exons and no introns.

Alternative splicing differs from constitutive splicing in that the former alters the

mature transcript either by excluding an exon, including a mutually exclusive exon,

retaining an intron, altering the length of the constitutive exons, or in other ways that

resulted in a mature mRNA isoform that is different from that formed by constitutive

splicing. Alternative splicing is a common mechanism in eukaryotes that complicates

the definition of an exon and intron, where an exon may become an intron if skipped in

one particular transcript (Figure 1.4A), while intronic sequence could be regarded as

part of an exon if included in the mature mRNA (Figure 1.4B, C (right diagram), D

(right diagram)). Through high throughput deep sequencing, it was discovered that gene

transcripts from 92-95% of human multi-exon genes undergo alternative splicing (Pan

et. al., 2008; Wang et. al., 2008). Alternative splicing occurs when alternative splice

site(s) are recognised and used by the snRNPs to direct the spliceosome to process the

pre-mRNA in a different way. Four main models of alternative splicing – exon skipping,

intron retention, alternative 5’-ss, and alternative 3’-ss– are observed in the eukaryotic

transcriptome (Table 1.1, Figure 1.4).


8

Table 1.1 Four main models of alternative splicing events and resultant gene transcripts. The alternatively spliced isoforms may have functional roles, such as sex determination and development of the immune system. However, many isoforms do not have known biological functions. Some isoforms may be produced transiently to ensure developmental regulation of gene expression, and others are disease-associated.

Model Altered Gene Transcript Function of altered transcripts Reference

Exon skipping dsx (drosophila) Skipping of exon 4 gives rise to the

male sex

(Burtis and

Baker, 1989)

Eif4enif1 (mouse) Skipping of exon 11 forms the shorter

Eif4enif1-S (4E-Ts) isoform, which

promotes turnover of mRNAs for

endothelial transcription factors

(Chang et. al.,

2014)

Psd-95 (mouse) Excitatory synapse maturation (Zheng et. al.,

2012)

Intron retention hKLK (human) Diagnostic/ prognostic value in

prostate cancer

(Michael et. al.,

2005)

hDKC1 (human) Isoform 6 encodes a snoRNA

(SNORA36A) within the retained

intron

(Turano et. al.,

2013)

LMNA (human) Missense mutation in 5’-ss of intron 9

resulted in intron 9 retention, which

was identified in 12 limb girdle

muscular dystrophy-1B affected

members and 2 unaffected members

of a family

(Muchir et. al.,

2000)

LY6G5B (human) Transcripts with retained first intron

are found within majority of tissues,

suggesting a functional role of intron-

retaining transcripts

(Calvanese et.

al., 2008)

PABPN1 (human) Retention of terminal intron in

PABPN1 resulted in its nuclear

degradation, maintaining homeostatic

expression

(Bergeron et. al.,

2015)

ApoE (mouse) Intron 3 is retained to restrict

expression of apolipoprotein E4 that

is implicated in neurodegenerative

diseases

(Xu et. al., 2008)


9

Lmnb1 (mouse) Intron retention resulted in

downregulation of Lmnb1 in mature

granulocytes, and decreased amount

of circulatory granulocytes

(Wong et. al.,

2013)

Alternative 5’-ss BCL-X (human) Generates the shorter pro-apoptotic

BCL-XS isoform that is important in

immune system; Constitutively

spliced shorter isoform, BCL-XL, is

anti-apoptotic

(Boise et. al.,

1993)

ATM (human) Activation of cryptic 5’-ss in intron 11

resulted from pesudoexon insertion

and is implicated in ataxia-

telangiectasia

(Cavalieri et. al.,

2013)

TMEM165 (human) Activation of cryptic 5’-ss in intron 4

resulted from pesudoexon insertion

and is implicated in congenital

disorders of glycosylation

(Yuste-Checa et.

al., 2015)

Alternative 3’-ss CLN2 (human) Activation of cryptic 3’-ss in intron 7

found to be a novel mutation that

causes late infantile neuronal ceroid

lipofuscinosis

(Bessa et. al.,

2008)

HBB (human) Activation of cryptic 3’-ss in intron 1

generated a non-functional β-globin,

resulting in β+-thalassemia

(Busslinger et.

al., 1981)


10

A) Exon Skipping B) Intron Retention

C) Alternative 5’-ss

Alternative 5’-ss

Shorter blue exon

Alternative 5’-ss

Elongated blue exon

Alternative 3’-ss D) Alternative 3’-ss

Shorter

yellow exon

Alternative 3’-ss

Elongated yellow exon


11

Figure 1.4 Main models of alternative splicing. A) In the exon skipping model, one or more exon(s) are excluded from the final mRNA transcript, due to the use of a different pair of donor (5’-ss) and acceptor (3’-ss) splice sites. The central exon (blue) is not spliced into the mature mRNA transcript and is removed with the introns. B) In the intron retention model, an intron is retained in the mature mRNA transcript as a result of inactivation of splice sites, or blocking of a cis-acting motif or a trans-acting element binding site. The retained intron becomes an exon in the transcript. C) and D) In the alternative 5’ and 3’ splice site models, the 5’-ss and 3’-ss recognised by the snRNPs are different from the commonly used splice sites recognised in constitutive splicing. Activation of a cryptic 5’- or 3’-ss within an exon results in a shorter exon, while activation of a cryptic 5’- or 3’-ss within an intron results in an elongated exon. E) Constitutive splicing.

Boxes represent exons and the blue lines represent introns. Red lines show constitutive splicing, while green lines indicate alternative splicing patterns. Resultant transcripts from different types of alternative splicing are shown in A) to D). E) shows constitutive splicing and the resultant transcript.

E) Constitutive Splicing


12

1.2.2 Alternative Splicing and Gene Expression

1.2.2.1 Negative Regulation

Splicing controls gene expression at several levels, from isoform production to nuclear

export. Similarly, alternative splicing may turn gene expression on or off, and there are

several mechanisms by which gene expression may be modulated by alternative splicing,

one of which is via the nonsense-mediated decay (NMD) pathway.

NMD is a degradation mechanism that removes mRNA transcripts carrying premature

termination codons (PTC). The process where alternative splicing introduces a PTC that

triggers NMD, is referred to as ‘regulated unproductive splicing and translation (RUST)

(Lareau et. al., 2007), and the expression of several genes under the control of RUST is

shown in Table 1.2. The spliceosome deposits an exon junction complex (EJC)

approximately 20 to 24 bases upstream of the splice junction on the pre-mRNA. Where

a premature termination codon (PTC) is located more than 50 nucleotides upstream of

the last EJC, via either insertion of an alternative exon or an intron with a stop codon, or

disruption of the reading frame, NMD will be triggered (Lewis et. al., 2003; Lareau et.

al., 2007) (Figure 1.5). However, there are exceptions to this model, as not all

transcripts with PTC that fulfil the 50-nucleotide rule elicit NMD (Lareau et. al., 2007),

with one example being the human Dyskeratosis congenita 1 (hDKC1) transcript

(Turano et. al., 2013). Furthermore, productive splicing can also be coupled to NMD, as

seen in the case of SC35 (SRSF2) auto-regulation (Stévenin et. al., 2001).

Overexpression of SC35 results in alternative splicing of its transcripts, generating 7

isoforms, one of which is a 1.7kb transcript with an additional exon. This isoform

retains full coding capacity, but is degraded by NMD because the stop codon is situated

209 bases upstream from the last EJC (Stévenin et. al., 2001). Nevertheless, auto-


13

regulation of SC35 is categorised as RUST in the literature (Green et. al., 2003; Lareau

et. al., 2007).

Table 1.2 Genes with alternatively spliced transcripts that trigger RUST.

Gene Organism Alternative Splicing Event Reference

Lmnb1 Mouse Intron retention (Wong et. al., 2013)

Hps1 Mouse Alternative 5’-ss (Hamid and Makeyev, 2014)

Ssat Mouse Exon insertion (Hyvonen et. al., 2006)

Psd-95 (Dlg4) Mouse Exon skipping (Zheng et. al., 2012)

nPtbp Mouse Exon skipping (Boutz et. al., 2007b)

PTBP1 Human Exon skipping (Wollerton et. al., 2004)

STAT3 Human Exon skipping (Ward et. al., 2014)

NDUFS4 Human Exon insertion (Petruzzella et. al., 2005)

*SC35 (SRSF2) Human Exon insertion (Stévenin et. al., 2001)

*Alternative splicing produces a functional isoform that is degraded by NMD.


14

Figure 1.5 Alternative splicing and nonsense-mediated mRNA decay. Alternative splicing that introduces a premature termination codon (PTC) more than 50 nucleotides upstream of the last exon junction complex (EJC) can elicit nonsense-mediated mRNA decay (NMD). A) Normal translation occurs when the termination codon is located downstream of the last EJC. Ribosome (purple complex) displaces all EJC and protein is produced. B) Intron retention may introduce a PTC located more than 50 nucleotides upstream of the last EJC. Ribosome stops before the last EJC, which triggers NMD, inhibiting protein translation. (Adapted from Green et. al., 2003)

1.2.2.2 Positive Regulation: BCL-X

Alternative splicing is an important process not only because it expands the eukaryotic

transcriptome and proteome, but also because of its role in generating gene products that

are essential in protecting cells from being destroyed. For example, the human BCL2-

like 1 gene (BCL2L1/BCL-X) gives rise to a short form, BCL-XS, by activating a

proximal 5’-ss within the second exon (Figure 1.4C, left diagram), and the canonical

long form, BCL-XL (Boise et. al., 1993). While BCL-XL has anti-apoptotic properties,

BCL-XS is pro-apoptotic, and the two isoforms exhibit tissue-specific expression (Boise

---AAAA G-Me

EJC EJC ---AAAA G-Me

NMD

A) B)

EJC EJC ---AAAA G-Me

>50nt

EJC ---AAAA G-Me

Transcription

Translation

Protein


15

et. al., 1993). In the human brain, BCL-XL is the only expressed form (Boise et. al.,

1993), an important feature necessary to ensure long-term survival of brain cells. In the

lymphoid system where high levels of BCL-X mRNA are also observed, the BCL-XS is

the predominant form in immature double positive thymocytes that form T-cells (Boise

et. al., 1993). Double positive thymocytes are immature T cells that express both CD4+

and CD8+ glycoproteins on the cell surface, while a mature T cell will express only

either CD4+ or CD8

+ glycoprotein. Expression of the BCL-XS form allows for deletion

of thymocytes that recognise and will hence attack cells within our body to cause

autoimmune diseases. BCL-XS is also predominantly expressed in activated T-cells in

response to foreign antigens (Boise et. al., 1993). Boise et. al. (1993) postulated that

induced expression of BCL-XS in activated T-cells plays a role in promoting

amplification of T-cells in an immune response. While expression of BCL-XS increases

the susceptibility of T-cells to apoptosis, anti-apoptotic BCL-2 was found to be up-

regulated during immune response. This suggests that BCL-2 expression far exceeds the

expression of BCL-XS in activated T-cells, preventing apoptosis and accumulation of T-

cells in an immune response (Boise et. al., 1993). From this example of alternative

splicing of BCL-X, we can see the importance of the balance of alternative splicing in

generating gene products that are essential for proper development and functioning of

our immune system.

1.2.2.3 Indirect Regulation: Homer 1

Alternative splicing may also regulate gene expression indirectly. Rather than through

alternative splicing of a particular gene (target) transcript, the splicing pattern of another

transcript that codes for a regulatory protein (i.e. regulation cascade) of the target

transcript is altered. Such alternative splicing-mediated indirect gene regulation is seen

in the regulation of the gonadotropin hormones, follicle-stimulating hormone (FSH) and


16

Figure1. 6 Homer1 isoforms. Alternative splicing of the longer isoforms, Homer1b and Homer1c, generates the short isoform, Homer1a. (Taken from Wang et. al., 2014)

Exon

Intron

luteinising hormone (LH) by Homer1 isoforms in mouse LβT2 cells (Wang et. al.,

2014). FSH and LH regulate menstrual cycle and ovulation, hence controlled regulation

of genes that code for these hormones is important, and is mediated by alternative

splicing and processing of Homer1. Alternative splicing of Homer1 is controlled by the

release of gonadotrophin-releasing hormone (GnRH) that induces the splicing of the

longer mouse Homer1b/c to generate the shorter Homer1a (Figure 1.6). All three

isoforms (Homer1a, 1b, and 1c) can alter expression of the FSH and LH beta-subunits

(FSHβ, LHβ) (Wang et. al., 2014). Homer1b and Homer1c suppress FSHβ expression

and to a lesser extent, LHβ expression, while Homer1a enhances FSHβ expression

(Wang et. al., 2014). This study shows that alternative splicing can produce different

isoforms that have opposing regulatory effects on another gene, demonstrating an

additional level of gene regulation via alternative splicing.


17

1.2.3 Alternative Splicing and Neuronal Development

Alternative splicing is particularly important in neuronal development and has pivotal

roles in: i) development of nervous tissues (neurogenesis), ii) synapse formation and

maturation (synaptogenesis), and iii) neuronal migration (Norris and Calarco, 2012).

For example, polypyrimidine tract binding proteins 1 and 2 (PTBP1 and PTBP2/nPTBP)

are hnRNPs that play a role in regulating synaptogenesis. They regulate the expression

of postsynaptic density protein 95 (Psd-95) that is involved in the maturation of

excitatory synapses (Zheng et. al., 2012). As such, Psd-95 expression is enhanced

during late neuronal development, and this is facilitated by PTBP1 and PTBP2

expression. Expression of PTBP1 and PTBP2 represses Psd-95 expression, by inducing

exon 18 skipping in mouse Psd-95 and introducing a PTC that elicits NMD (Zheng et.

al., 2012). PTBP1 is highly expressed in neuronal progenitor cells and this prevents

unnecessary expression of Psd-95 in non-neuronal cells. While PTBP2 is expressed in

neuronal cells, it is down-regulated in late neuronal differentiation, allowing Psd-95

expression and neuron maturation (Zheng et. al., 2012).

Vertebrate and neural-specific Ser/Arg repeat-related protein of 100 kDa

(nSR100/SRRM4) is an SR-related protein that can cause inclusion of a 6-nucleotide

micro-exon in mouse Unc13b/Munc13, a gene that is involved in formation of neurites

(Quesnel-Vallieres et. al., 2015). Exclusion of this micro-exon in wild-type neurons

resulted in shorter neurites than in unaltered wild-type neurons (Quesnel-Vallieres et. al.,

2015). Conversely, inclusion of the 6-nucleotide micro-exon in mutant cells lacking

nSR100 expression restored neurite lengths to levels observed in wild-types (Quesnel-

Vallieres et. al., 2015). Another example that illustrates the importance of alternative

splicing in neuronal development is the synaptic surface proteins, neuroligin-1 and β-

neurexin. Neuroligin-1 and β-neurexin can be alternatively spliced to form isoforms that


18

will determine if the synapse is excitatory or inhibitory (Ichtchenko et. al., 1995; Chih

et. al., 2006; Li et. al., 2007). Neuroligin-1 can undergo insertion of different exons at

sites A and/or B (Figure 1.7) (Chih et. al., 2006), while β-neurexin can be alternatively

spliced at two sites, S4 and S5, where a different exon is inserted depending on the site

(Figure 1.7). Neuroligin-1 with an exon insertion at B specifically binds to the β-

neurexin lacking an alternative exon at S4 (Ichtchenko et. al., 1995; Chih et. al., 2006),

forming an excitatory glutamatergic synapse (Chih et. al., 2006; Li et. al., 2007). In

contrast, β-neurexin with an insertion at S4 was found to drive formation of inhibitory

GABAergic synapse (Chih et. al., 2006).

Altogether, the above examples clearly illustrate some of the important roles of

alternative splicing in regulating gene expression and neuronal development.

Figure 1.7 Schematic representation of β -neurexin and neuroligin-1 transcripts that code for synaptic surface proteins. Both β -neurexin and neuroligin-1 have two alternative splicing sites where an exon can be inserted. (Taken from Li et. al., 2007)


19

1.3 Using Antisense Oligonucleotides (AO) to Manipulate Splicing

Mutations of cis-acting elements involved in regulating splicing can lead to abnormal

splicing, where an abnormal mRNA transcript and/or protein are produced. Aberrant

splicing has been associated with numerous human diseases, including cancers

(Goodison et. al., 1998; Le Hir et. al., 2002; Lokody, 2014), β-thalassemia (Busslinger

et. al., 1981), frontotemporal dementia and parkinsonism (FTDP) (Hutton et. al., 1998),

and rare diseases such as amyotrophic lateral sclerosis (Xiao et. al., 2008) and

neurofibromatosis type 1 (Pros et. al., 2009). The neurofibromin 1 (NF1) gene transcript

is particularly prone to splicing errors that can cause neurofibromatosis (Xu et. al.,

2014). Through genetic screening, Xu and colleagues (2014) found that aberrant

splicing accounted for approximately 25% of mutations in NF1 gene transcripts. In

addition, according to the Human Gene Mutation (HGMD Professional Release 2015.1),

aberrant splicing accounts for approximately 9% of all known human disease causing

mutations.

Since an altered splicing pattern can lead to disease, correcting the splicing pattern is

one possible therapeutic intervention for many such cases and could be achieved by

using antisense oligonucleotides (AOs). Steric blocking AOs may alter splicing patterns

through various mechanisms. AOs may be designed to alter splicing by blocking motifs

that interact with trans-acting splicing regulatory elements, such as the ESEs (Dominov

et. al., 2014; Palhais et. al., 2015), or by blocking cis-acting splice sites (Pros et. al.,

2009; Sanaker et. al., 2012; Yuste-Checa et. al., 2015), polypyrimidine tract (PPT), or

branch point (BP). Though theoretically, blocking of PPT or BP by using AOs may alter

the splicing pattern, no studies have yet demonstrated this mechanism to our knowledge.

AOs may also be used to induce splice-switching modifications in splicing regulatory


20

proteins, to inhibit formation of undesired transcripts or to enhance formation of desired

transcripts.

1.3.1 Antisense Oligonucleotide-Induced Splice Switching

A number of splice switching AOs have been explored as potential therapies for rare

diseases, such as spinal muscular atrophy (SMA) (Osman et. al., 2014), Duchenne

muscular dystrophy (DMD) (Aartsma-Rus et. al., 2003), neurofibromatosis (Pros et. al.,

2009; Castellanos et. al., 2013), Hutchinson-Gilford progeria syndrome (Osorio et. al.,

2011), Huntington’s disease (Evers et. al., 2014) and Pompe’s disease (Clayton et. al.,

2015). Many of these are only proof-of-concept studies, but some AOs have

successfully progressed through early stage clinical studies and are entering phase II and

III trials. Examples of these include the antisense drug, ISIS-SMNRx that causes exon 7

retention in the survival motor neuron 2 (SMN2) gene transcripts that is linked to SMA

(https://clinicaltrials.gov), as well as eteplirsen that can induce exon 51 skipping in the

dystrophin (DMD) gene transcript associated with DMD (https://clinicaltrials.gov).

1.3.1.1 Exon Retention and Exon Skipping

Exon retention and exon skipping are two types of alternative splicing shown to be

inducible in various gene transcripts (in vitro and in vivo), and are of particular interest

in the treatment of rare diseases.

(i) Exon Retention

Spinal muscular atrophy (SMA) is a common human recessive disease that is the most

prevailing cause of infant deaths and it is primarily caused by homozygous loss of

SMN1 on chromosome 5. Expression of SMN2 that encodes an identical protein to

SMN1should reduce the severity of SMA, however, approximately 80% of SMN2 is


21

inappropriately spliced, due to a C to T transition in SMN2 exon 7. This transition

decreases the strength of exon 7 3’-ss and simultaneously abrogates an exonic enhancer

and creates an exonic silencer motif, thereby promoting skipping of exon 7 from the

mature mRNA (Lim and Hertel, 2001). This means that a full length protein is not

produced in sufficient amounts for normal neuronal cell survival. Higher expression of

full length SMN2 transcripts is associated with better disease prognosis and so, SMN2

transcripts are a possible therapeutic target. Several antisense approaches that use AOs

to modulate splicing to retain SMN2 exon 7 have been developed over the past 15 years.

These approaches include targeting different regions on the gene transcript (Lim and

Hertel, 2001; Sivanesan et. al., 2013), using different AO chemistries (Mitrpant et. al.,

2013; Zhou et. al., 2013), using bifunctional AOs (Dickson et. al., 2008; Osman et. al.,

2012), and AOs that are attached to small nuclear RNA (snRNA) (Madocsai et. al.,

2005; Baughan et. al., 2009), and combinations of the above (Baughan et. al., 2009).

The intronic splicing silencer N1 (ISS-N1) is a 15bp sequence between nucleotides 10

and 24 of SMN2 intron 7 that has an inhibitory effect on the recognition of the 5’-ss of

exon 7, thereby promoting its exclusion from the mature SMN2 mRNA transcript (Singh

et. al., 2006). By masking ISS-N1 with appropriate AOs, exon 7 recognition by the

splicing machinery is enhanced and is thus retained in the mature transcript. ISS-N1-

targeting AOs explored thus far by different groups have varied in length, backbone,

and ribose sugar chemistry. Most of these AOs have a length of 18 to 25 bases

(Williams et. al., 2009; Hua et. al., 2010; Porensky et. al., 2012; Zhou et. al., 2013), but

interestingly, an 8 base AO (3UP8i) that covers the first five nucleotides of ISS-N1 (and

3 nucleotides upstream), has been reported to be effective in restoring exon 7 splicing

(Singh et. al., 2006; Keil et. al., 2014). However, Keil et. al. (2014) attributed the

stimulatory effect of 3UP8i to its blocking of the formation of an inhibitory hairpin via a


22

long distance interaction (LDI) that inhibits exon 7 splicing, rather than directly

blocking the ISS-N1 motif (Keil et. al., 2014). This inhibitory RNA structure, termed

internal stem through LDI-1 (ISTL1), was identified as part of another ISS region,

designated ISS-N2 (Singh et. al., 2013), another potential target region- in SMN2 for

splice modification. In a recent study, exon 7 incorporation in the mature mRNA was

achieved in vitro using an AO directed to ISS-N2 (Singh et. al., 2015).

Regardless of the AO design used, all studies investigating the effects of ISS-N1-

targeting AOs so far have shown that targeting this region can effectively alter the

SMN2 splicing pattern and induce exon 7 retention (Williams et. al., 2009; Hua et. al.,

2010; Passini et. al., 2011; Zhou et. al., 2013). Furthermore, these studies all

demonstrated increased SMN protein levels as well as improved phenotypes in muscle

function and body weight in transgenic mouse models with different SMA severities.

Nonetheless, how well the different types of AO work may vary, as the effect of AO-

modulated splicing is multi-factorial, and uptake of the AO in the CNS is a crucial step

in SMA therapy (Williams et. al., 2009; Passini et. al., 2011). AO efficacy may be

influenced by the combination of the different lengths, backbones, chemistries,

concentrations and administration method, as suggested by the differences in results of

in vitro and/or in vivo studies where comparative analysis was conducted (Hua et. al.,

2010; Mitrpant et. al., 2013; Zhou et. al., 2013; Osman et. al., 2014).

(ii) Exon skipping

One disease with unequivocal evidence for alternative splicing as a therapy is AO-

mediated exon skipping in Duchenne Muscular Dystrophy (DMD). This is an X-linked

a muscle wasting condition caused by mutations in the dystrophin gene (DMD) that


23

ablate or greatly reduce functional protein expression. Exon skipping can restore the

open reading frame in a number of mutated isoforms, generating functional protein.

Different research groups had induced skipping of different dystrophin exons in mouse

models and human cells (Mann et. al., 2001; Van Deutekom et. al., 2001; Aartsma-Rus

et. al., 2003; Aartsma-Rus et. al., 2007; Greer et. al., 2014), including, but not limited to,

the skipping of exon 51 (Aartsma-Rus et. al., 2003; Arechavala-Gomeza et. al., 2007),

and exons 45 to 55 (van Vliet et. al., 2008; Echigoya et. al., 2015). Notably, AO-

mediated skipping of all DMD exons, except the first and last, has been demonstrated to

be possible (Wilton et. al., 2007). Efficacy of exon 51 skipping is clearly illustrated by

the eteplirsen phase IIb clinical trial, with increased dystrophin-positive fibres,

significant improvement in 6 minute-walk distance (6MWD), compared to placebo

controls, and no reported adverse reactions (Mendell et. al., 2013). In contrast, a

drisapersen phase II clinical trial demonstrated no efficacy, with statistically

insignificant results in primary and secondary endpoints, which include 6MWD and

dystrophin quantitation, and adverse events (injection-site reactions, proteinuria,

haematuria) were reported (Voit et. al., 2014). Furthermore, a drisapersen phase III

clinical trial failed to meet the primary endpoint and was terminated recently (Lu et. al.,

2014). Although these trials were similar in principle and target, the drisapersen AO

chemistry (2’-O-methyl-phosphorothioate; 2’-OMeP) meant that the drug could only be

administrated at much lower concentrations due to toxicity, and was unable to induce

clinically significant dystrophin expression (Lu et. al., 2014; Voit et. al., 2014).

Conversely, eteplirsen is a phosphorodiamidate morpholino oligomer (PMO) and could

be safely administered at a dose 5 to 8 times higher than drisapersen (Mendell et. al.,

2013; Lu et. al., 2014; Voit et. al., 2014).


24

Multi-exon skipping of exons 45 to 55, the DMD mutation hotspot region in mdx52

mouse, using a vivo- phosphorodiamidate morpholino oligomer (vPMO) cocktail, has

recently been reported (Echigoya et. al., 2015). Interestingly, skipping of this region

was found to be insignificant in a previous in vitro study conducted using patient and

control cell cultures (van Vliet et. al., 2008). Possible reasons for the discrepancies in

results are differences in chemistry of AOs used, different AO sequences, different type

of studies, and different species employed. The mdx52 mouse model used is possibly

not the best model of human DMD. The model exhibits a milder form of muscular

dystrophy, and it does not present all dystrophic pathology observed in typical DMD

patients (Araki et. al., 1997; Willmann et. al., 2009). In addition, there is no supporting

data on the mdx52 model showing progressive dystrophinopathy development

(Willmann et. al., 2009). Furthermore, Echigoya et. al. (2015) set the end-point of their

study to 6 months, but muscle weakness is only observed in 18 month old mdx52 mice

(Willmann et. al., 2009). Hence, the promising results presented may not reflect the

actual outcome of the vPMO-mediated splice-switching and highlights the limitations in

working with animal models.

AO-mediated exon skipping has been applied to other disease-related gene transcript,

such as titin (TTN) (Gramlich et. al., 2015), microtubule-associated protein tau (MAPT)

(Sud et. al., 2014), mouse muscle glycogen synthase 1 (Gys1) (Clayton et. al., 2015),

and huntingtin (HTT) (Evers et. al., 2014). Frameshift mutations in the TTN gene can

result in titin-based dilated cardiomyopathy. An AO that masks the ESE motifs in TTN

exon 326 causes skipping of the target exon and results in increased TTN mRNA

transcripts and proteins, and phenotypic improvements (Gramlich et. al., 2015). MAPT

codes for tau proteins, which in excessive amounts can form aggregates and cause

tauopathies such as Alzheimer’s disease and frontotemporal lobar dementia-tau type


25

(Sud et. al., 2014). The most potent anti-tau AO reported to date targeted the 5’-ss of

exon 5, inducing skipping of exon 5 (Sud et. al., 2014). The loss of MAPT exon 5

disrupts the open reading frame (ORF), generating a premature termination codon,

which subsequently caused a reduction via NMD in tau mRNA and protein levels (Sud

et. al., 2014).

Unlike the more widely reported AO-mediated splice switching strategies, AO-

mediated exon skipping of Gys1 and HTT indirectly alleviates disease conditions.

Pompe’s disease results from an accumulation of lysosomal glycogen, due to mutations

in acid alpha glucosidase (GAA), an enzyme responsible for breaking glycogen down

into glucose (Clayton et. al., 2015). Rather than altering the splicing of the mutated

GAA transcripts, AOs were designed against Gys1 as part of a substrate reduction

approach (Clayton et. al., 2015). One of the AOs induced exon 6 skipping in the Gys1

gene transcript that encodes glycogen synthase, an enzyme that synthesises glycogen.

Suppressing this enzyme should block the accumulation of glycogen, thereby mitigating

the loss of function GAA enzyme, and alleviating disease symptoms (Clayton et. al.,

2015).

In the case of HTT, a gene mutated in familial Huntington’s disease patients, the goal is

not to reduce expression of mutant HTT, but to change the protein structure (Evers et.

al., 2014). An AO designed to target an ESE within HTT exon 12 induced a 135bp

partial skipping of this exon in patient-derived fibroblasts (Evers et. al., 2014). The AO

was postulated to function by causing activation of a cryptic 5’-ss that results in deletion

of caspase 3- and 6- cleavage sites found within HTT exon 12 (Evers et. al., 2014).

Cleavage of mutant HTT protein at caspase 3- and particularly, at caspase 6- cleavage

sites, produces shorter mutant HTT proteins that are implicated in enhanced cell toxicity.


26

By deleting the caspase cleavage sites, shorter mutant HTT proteins are not produced

and therefore do not aggregate to cause disease progression (Evers et. al., 2014). The

authors also demonstrated in vivo deletion of the cleavage sites in mice, which involved

injection of an AO cocktail that induced skipping of Htt exons 12 and 13, as the cryptic

5’-ss implicated in partial skipping of human HTT exon 12 is not present in mouse

(Evers et. al., 2014). Through in vitro and in vivo studies, Evers and colleagues (2014)

provided solid evidence that AO-mediated exon skipping is inducible in huntingtin gene

transcripts.

Splice switching examples above that were demonstrated in vivo (Hua et. al., 2010;

Osman et. al., 2012; Zhou et. al., 2013; Mitrpant et. al., 2013; Evers et. al., 2014) make

the development of these splice-switching AOs significant and valuable. Nonetheless,

the usefulness of mouse models as in vivo systems is debatable, as they may not

accurately reflect human conditions, as in the case of dystrophin-deficient mouse and

canine models (Willmann et. al., 2009). Disease phenotypes may differ between mdx

mouse models and human patients, where it is less severe in the mouse model (Manning

and O’Malley, 2015). Disease progression timescale may also differ considerably

(Manning and O’Malley, 2015). Furthermore, AO treatments may give positive results

in the animal models, but when used on human subjects, the results may be different. A

gene sequence may differ between human and animal models, which can lead to

different splicing patterns and different non-coding RNAs, and metabolic differences

may be another obstacle. However, in vivo studies using animal models are essential in

establishing reliability and feasibility of the interventions, and in understanding disease

pathobiology in many cases. Therefore, while these proof-of-concept studies require

further testing on human cells and/or patients, these, and the successful clinical trials to


27

date provide strong evidence for the feasibility of using AOs to modulate splicing

patterns of a wide range of gene transcripts.

1.4. Rising Alternative Splicing Event: Intron Retention

Of the various alternative splicing events, complete exon skipping is the most common,

accounting for 40% of alternative splicing events in humans and mice, and intron

retention is the least common at 3% (Sugnet et. al., 2004). Most studies on AO-

mediated splicing modification focus on exon skipping, but the first study on AO-

mediated splice switching actually explored the use of AOs targeting intronic sequences

of β-globin gene transcripts to promote the use of canonical splice sites in thalassemia

(Dominski and Kole, 1993). There have been few studies on intron retention in human

gene transcripts, with minimal focus on inducing intron retention using AOs, since

intron retention as an endogenous mechanism of gene expression regulation has only

been observed in recent years. Nevertheless, there are some situations where terminal

intron retention may be of therapeutic benefit. Relatively unexplored, it will be

intriguing to determine if intron retention is a generally widespread phenomenon,

whether it may be consistently induced by AOs, and to explore the effect(s) on gene

expression. This section will discuss why it is worthwhile to look into intron retention

and pseudo-exon activation, a type of intron retention.

1.4.1 Intron retention

Intron retention is recognised as a rare alternative splicing event in humans, accounting

for 3% of all alternative splicing events in humans and mice (Sugnet et. al., 2004).

However, intron retention in human gene expression may not be as rare as initially

thought, especially as better methods for detecting intron retention are developed, such

as IRFinder (Wong et. al., 2013), and IRcall and IRclassifier (Bai et. al., 2015). Of note,


28

the IRcall and IRclassifier algorithms were used to analyse plant mRNA (Arabidopsis

thaliana), which means that future studies using human gene transcripts are required to

test the efficacies of IRcall and IRclassifier in detecting intron retention in humans.

Nevertheless, intron retention is common in some, and possibly most, human gene

transcripts and has been found to be a common splicing event in the human Kallikrein

(hKLK) gene family (Michael et. al., 2005), and in human Dyskeratosis congenita 1

(hDKC1) (Turano et. al., 2013). Retention of intron 3 was found to occur in 6 out of 15

isoforms of hKLK (Michael et. al., 2005). While for hDCK1, there are 5 intron-retaining

isoforms. (Turano et. al., 2013).

1.4.1.1 Intron Retention and Gene Expression

Intron retention may potentially function as an additional on/off switch in gene

expression by: i) promoting nuclear retention and degradation (nuclear quality control),

ii) channelling the mRNA into the NMD pathway (cytoplasmic quality control), or by

iii) producing small (non-coding) regulatory RNAs (section 5.1.2).

(i) Nuclear Retention and Degradation

Pre-mRNAs not spliced completely are typically retained in the nucleus and targeted for

degradation by the nuclear exosomes or Rat1p/Xrn2, a 5′–3′ exonuclease (Egecioglu

and Chanfreau, 2011). For example, (terminal) intron retention within the human

poly(A)-binding protein nuclear 1 (PABPN1) transcripts prevents nuclear export and

promotes degradation of the unspliced transcripts by nuclear exosomes (Bergeron et. al.,

2015). Similarly, (terminal) intron retention within mouse Stxb1, Vamp2, Sv2a, and

Kif5a that code for presynaptic proteins, retained the incompletely spliced transcripts

within the nucleus (Yap et. al., 2012). These intron-retaining transcripts are then


29

eliminated by nuclear exosomes, in the presence of certain nuclear RNA surveillance

components (Yap et. al., 2012).

Notably, not all unspliced pre-mRNAs retained in the nucleus are degraded. They may

be sequestered in the nucleus until activated in response to a particular stimulus. One

example of this is the mouse apolipoprotein E4 (ApoE), a gene constitutively

transcribed but incompletely spliced, retaining intron 3 (ApoE-I3) (Xu et. al., 2008). By

examining the nuclear and cytosolic fractions of Neuro-2a cells, more than 98% of

ApoE-I3 transcripts were found to be present in the nucleus, while approximately 60%

of the intron-less ApoE transcripts were found in the cytosol (Xu et. al., 2008). This

finding was further supported by western-blotting assay. Expression of ApoE is

regulated by retention/splicing of intron 3. Retention of ApoE intron 3 causes the ApoE

transcripts to remain within the nucleus and hence, ApoE is not translated and expressed

in the cytoplasm (Xu et. al., 2008). Conversely, splicing of intron 3 resulted in ApoE

expression, suggesting that intron retention has a functional role in ApoE expression.

(ii) Intron Retention and Nonsense-mediated mRNA Decay

Some intron-retaining transcripts may escape nuclear degradation and get exported to

the cytoplasm, where they may be degraded by NMD. In their study, Wong et. al. (2013)

demonstrated that intron retention has a role in normal granulocyte differentiation via

the NMD pathway. Using an algorithm (IRFinder) and heatmap analysis, Wong et. al.

(2013) found that intron retention was common in granulocytes, accounting for 12.8%

of alternatively spliced isoforms. The intron-retaining transcripts were exported from

the nucleus to the cytoplasm, but were not translated into proteins, suggesting that the

intron retention was coupled with NMD (IR-NMD) (Wong et. al., 2013). By inhibiting

the NMD pathway, mRNA expression increased and conversely, protein expression


30

decreased when intron retention levels were high (Wong et. al., 2013). This study shows

that intron retention can lead to NMD, thereby resulting in decreased gene expression at

the mRNA and protein levels. IR-NMD of the granulocyte genes has been found to be

essential in the formation of normal granulocytes. Lmnb1 is one of the intron-retaining

genes present in mouse granulocytes and expression of intron-less Lmnb1 at later stages

of granulopoiesis resulted in decreased amounts of granulocytes in the peripheral blood,

suggesting an inhibition of granulocyte formation (Wong et. al., 2013). Expression of

intron-less Lmnb1 also resulted in an altered nuclear shape and increased nuclear

volume, but had no effect on cell function (Wong et. al., 2013). Nonetheless, the

authors noted that the altered morphology may affect the efficiency of granulocyte

differentiation or distribution (Wong et. al., 2013). Collectively, Wong et. al. (2013)

showed that IR-NMD has regulatory and functional importance in granulopoiesis,

where intron-retaining Lmnb1 ensures proper granulocyte formation. While the study

was conducted using mouse granulocytes, the authors showed that intron retention in

mouse granulocytes is conserved in human granulocytes, providing evidence of the role

intron retention plays in regulating gene expression in humans, indirectly.

1.4.1.2 Cytoplasmic Intron-retaining Transcripts (CIRTs)

Interestingly, intron retention does not always lead to decreased mRNA and protein

expressions. This is contrary to what would have been expected, as normally, only

intron-less mature mRNAs are exported to the cytoplasm and translated into proteins.

Incompletely spliced mRNAs are usually degraded within the nucleus, or if exported,

are degraded by NMD. However, some intron-retaining mRNAs have been found to be

able to pass through the nuclear envelope and escape cytoplasmic NMD (Calvanese et.

al., 2008; Bell et. al., 2008; Wong et. al., 2013). Such transcripts are termed

“cytoplasmic intron-retaining transcripts” (CIRTs) (Buckley et. al., 2014). Some CIRTs


31

may have biological roles, such as proinsulin and rat Kcnma1 that codes for the α-

subunit of the big potassium channel (BKCa). Proinsulin isoforms with retained intron 1

appeared to have a role in early cardiogenesis in chickens (Mansilla et. al., 2005), while

Kcnma1 with retained intron 16 helps to maintain excitability of the hippocampal

neurons (Bell et. al., 2008), but the mechanism of the functional relationship was not

mentioned in either study. Khaladkar et. al. (2013) found a high prevalence of CIRTs in

rat and mouse dendritic gene transcripts, approximately 44% and 60%, respectively. Of

these CIRTs, Khaladkar’s group performed gene ontology analysis on transcripts with

at least one retained intron that is greater than 265bp, and it was shown that these CIRTs

are greatly involved in neuronal development, cell projection organisation, and protein

localisation (Khaladkar et. al., 2013). Furthermore, some CIRTs code for non-coding

RNAs (ncRNAs) such as snRNAs, miRNAs and snoRNAs, contributing to another

layer of gene regulation (Mollet et. al., 2010; Turano et. al., 2013; Khaladkar et. al.,

2013).

1.4.1.3 Nuclear Intron-retaining Transcripts

Intron-retaining gene transcripts within the nucleus that are not degraded may have

functional roles. ApoE-I3 aforementioned is an example. Another example is the intron-

retaining isoform (Id3a) of the gene transcript coding for rat helix-loop-helix

transcription factor (Id3). Id3a functions as a negative feedback on Id3 (Forrest et. al.,

2004). Id3a has retained intron 1, within which is a stop codon, and hence it encodes a

truncated protein (Forrest et. al., 2004). Expression of Id3 is induced during vascular

injury, and it promotes smooth muscle cell (SMC) proliferation, as a form of repair

mechanism (Forrest et. al., 2004). However, Id3 levels gradually drop and Id3a levels

increase as days after injury pass (Forrest et. al., 2004). It was discovered that the Id3a

isoform decreases the levels of Id3 by inhibiting its transcription, and so, Id3a functions


32

as an important negative feedback, inhibiting further SMC proliferation that can lead to

vascular lesion (Forrest et. al., 2004). Although the exact mechanism of the negative

feedback is unknown, this example illustrates the role of intron retention in maintaining

homeostasis.

As shown above, intron retention potentially has diverse roles in regulating gene

expression via multiple pathways. It is thus interesting to investigate artificially induced

intron retention in a selection of gene transcripts, and ascertain what effect(s) it may

have on gene expression at the mRNA and protein levels. Should down-regulation occur

for one particular gene transcript, intron retention may be developed as a mechanism in

treatment of disease associated with over expression of that gene. Should up-regulation

occur, intron retention may be used to treat diseases arising from low levels of protein

expression. In addition, upregulating intron retention may also be applied to create

animal models for in vivo evaluation.

1.4.2 Pseudo-exon Activation

A pseudo-exon is part of an intronic sequence that is retained in the mature mRNA

transcript and spliced with the exons (Figure 1.8). Therefore, pseudo-exon activations

may be considered as a subset of intron retention. Pseudo-exons typically arise from

deep intronic mutations that result in the activation of cryptic acceptor (3’) and/or donor

(5’) splice sites (ss) (Spena et. al., 2007; Sanaker et. al., 2012; Dominov et. al., 2014;

Yuste-Checa et. al., 2015). For example, an intronic point mutation in the fibrinogen

gamma chain (FGG) gene increases the strength of a cryptic 5’-ss within the intron

(Spena et. al., 2007). This activated cryptic 5’-ss then cooperates with the downstream

canonical 3’-ss, while a normally silenced 3’-ss within the intron recognises the

upstream canonical 5’-ss and cause the splicing of a pseudo-exon in the mature mRNA


33

transcript (Spena et. al., 2007). Pseudo-exon activation arising from deep intronic

mutations was also observed in DMD. Mutations within introns 11, 25, 45, 47 and 62

create novel splice sites that activate a cryptic pairing splice site and result in the

splicing of a pseudo-exon in the mature mRNA transcript (Tuffery-Giraud et. al., 2003;

Gurvich et. al., 2008).

The mechanism of pseudo-exon activation may also involve the deletion or creation of a

cis-acting splicing regulatory element, and its interaction with a trans-acting element.

Deep intronic mutations may activate a cis-acting element that a trans-acting element

binds to and then enhances splicing of the pseudo-exon in the mature gene transcript

(Homolova et. al., 2010; Rimoldi et. al., 2013). Pseudo-exon activation in the human

methionine synthase reductase (MTRR) gene transcript is mediated by creation of a

SF2/ASF binding ESE motif (Homolova et. al., 2010). While in the fibrinogen gamma-

chain (FGG) gene transcript, pseudo-exon activation involves the creation of a cis-

Figure 1.8 Schematic diagram showing the comparison of a complete retention and partial retention of an intron. Pseudo-exon activation may be thought of as partial intron retention. A pseudo-exon originates from an intron, and it is only a part of the intron that gets spliced into the mature gene transcript. Activation of a cryptic or creation of a novel 5’- and/or 3’-ss within the intron results in pseudo-exon activation.

Green rectangle represents exon and orange rectangle represents intron.

Full intron retention Partial intron retention

(Pseudo-exon activation)


34

acting 3 G-run motif recognised by the trans-acting hnRNP F splicing factor (Rimoldi

et. al., 2013). Noticeably, hnRNPs are typically associated with inhibiting splicing by

binding to ESSs, but in FGG pseudo-exon, hnRNP F binds to an ESE (3 G-run motif)

and activates pseudo-exon inclusion. Nonetheless, in the absence of the 25bp region that

consists of the 3 G-run motif, hnRNP F binds to two other G-run motifs within the

pseudo-exon that function as ESSs, and inhibits pseudo-exon activation (Rimoldi et. al.,

2013). Another possible mechanism of pseudo-exon activation is via deletion of ESS

motifs downstream of the pseudo-exon (Greer et. al., 2015). Other rare pseudo-exon

activation mechanisms include genomic rearrangements, genomic inversions, and loss

of upstream 5’-ss or downstream 3’-ss (Dhir and Buratti, 2010). Examples of genomic

rearrangement and inversion that resulted in pseudo-exon activation are documented in

the DMD gene (Cagliani et. al., 2004; Madden et. al., 2009; Khelifi et. al., 2011) and

they are speculated to cause pseudo-exon activation by narrowing the distance between

splice sites (Dhir and Buratti, 2010), creating novel splice sites (Khelifi et. al., 2011),

deleting intronic splicing enhancers (ISE) (Khelifi et. al., 2011), or by creating exonic

splicing enhancers (ESE) within the pseudo-exon (Madden et. al., 2009). To summarise,

pseudo-exon activation may involve activation of cryptic splice sites, creation of novel

splice sites, deletion or creation of a cis-acting regulatory sequence, or complex

interactions between cis- and trans- acting splicing regulatory elements, suggesting

possible, yet challenging manipulations of pseudo-exon inclusion from different

directions.

Many studies have explored pseudo-exon skipping to remove those sequences that

cause disease (Sanaker et. al., 2012; Blazquez et. al., 2013; Dominov et. al., 2014;

Yuste-Checa et. al., 2015). On the other hand, activation of pseudo-exons is an area that

has not been investigated in detail. This could be because pseudo-exons are often


35

associated with diseases (Spena et. al., 2007; Kollberg et. al., 2009; Cavalieri et. al.,

2013; Flanagan et. al., 2013). Typically, an out-of-frame pseudo-exon results in a

premature termination codon (PTC) (Kollberg et. al., 2009; Sanaker et. al., 2012;

Dominov et. al., 2014) that may induce elimination of the transcript by NMD (Dominov

et. al., 2014). This suggests the possibility of deliberately activating pseudo-exons to

down-regulate gene expression linked to disease, such as dominant conditions and

cancers. Pseudo-exon activation may also be applied to create a model system for

studying of diseases. Therefore, pseudo-exon activation produced by AOs designed to

block silencers, is a new area worthy of investigation.

With the limited knowledge on intron retention and pseudo- exon activation, it calls for

studies into these alternative splicing events in different gene transcripts and

examination of the effects of such events within each specific gene transcript. This will

not only contribute to an expansion of knowledge, but may also lay the groundworks for

future development of therapies and/or animal models.

1.5 Why Study Terminal Intron Retention in Human Gene Transcripts?

We now know that intron retention is not as rare as initially thought. It is a common

event in some human gene families (Michael et. al., 2005; Turano et. al., 2013). Intron

retention may determine the spatial and temporal expression of a gene, and it has also

been implicated in the production of small regulatory (non-coding) RNAs, showing the

importance of intron retention in gene regulation (Hube and Francastel, 2015). Despite

an increasing focus on intron retention, terminal intron retention has yet to be studied in

depth. Of the studies that established the importance of intron retention in ensuring

biological functions, they mostly involve internal, and not terminal, introns.


36

So far, endogenous terminal intron retention has been reported in SC35 splicing

regulatory protein (Stévenin et. al., 2001), gene transcripts from some genes (Stxb1,

Vamp2, Sv2a, Kif5) that code for the presynaptic proteins in mouse neuroblastoma cell

lines (Yap et. al., 2012), as well as in human PABPN1 transcripts (Bergeron et. al.,

2015). Overexpression of SC35 proteins in HeLa cells triggers alternative splicing of

the SC35 gene transcripts, producing multiple isoforms, including two with retained

terminal intron (Stévenin et. al., 2001). Other isoforms have an exon cassette included.

The various isoforms have full coding capacity, but result in down-regulation of SC35

expression by lowering mRNA stability. Nonetheless, isoforms with retained terminal

introns are less abundant than those with exon inclusion (Stévenin et. al., 2001). A more

robust example of terminal intron retention is seen in the presynaptic protein coding

gene transcripts. Terminal intron retention in Stxb1, Vamp2, Sv2a, Kif5a is controlled by

Ptbp1 expression, where splicing of the terminal 3’-intron is repressed in the presence

of Ptbp1 proteins (Yap et. al., 2012). Ptbp1 proteins bind to its complementary

polypyrimidine sequence within the last intron of Stxb1 transcripts, inhibiting splicing

of the terminal intron (Yap et. al., 2012). Akin to SC35 gene transcripts, PABPN1 gene

transcripts are also auto-regulated (Bergeron et. al., 2015). Two isoforms are transcribed

from PABPN1, the spliced and terminal intron-retaining forms, with the latter making

up a fifth of the PABPN1 transcripts (Bergeron et. al., 2015). The ratio of the spliced to

incompletely spliced forms decreases as the amount of PABPN1 proteins increases,

suggesting that PABPN1 represses its expression by interfering with splicing (Bergeron

et. al., 2015). It was found that the PABPN1 binds specifically to an A-rich region that

is approximately 70 bases downstream of the 3’-ss of the terminal intron. This prevents

the binding of the splicing regulatory protein, SRSF 10, to the transcript, thereby

interfering with splicing of the terminal intron (Bergeron et. al., 2015).


37

Until now, induced terminal intron retention has only been reported in SMN2 (Lim and

Hertel, 2001; Price, unpublished data). There are two known studies where induced

retention of the terminal intron 7 of SMN2 has been discovered unintentionally in an

attempt to induce exon inclusion using AO (Lim and Hertel, 2001; Price, unpublished

data). In one of the studies, retention of SMN2 intron 7 was induced by an AO designed

to anneal at the 3’-ss junction of the terminal exon, but not by AOs designed to bind to

the branch point sequence or the polypyrimidine tract (Lim and Hertel, 2001). While the

study by Lim and Hertel (2001) showed promising exon 7 inclusion results, all

experiments were carried out at the mRNA level and hence, the effect of exon 7

inclusion together with intron 7 retention is unknown at the protein level. An increase in

full-length mRNA expression may indicate a consequential increase in SMN2 protein

levels, but surprisingly, in the other study, it was shown that a down-regulation of

expression at the protein level occurred at high levels of full-length mRNA expression

(Price, unpublished data). The discovery was made while trying to retain exon 7 using

an AO designed to anneal to a region within the terminal exon. Retention of the last

intron in the SMN2 gene lengthens the 3’ untranslated region (3’ UTR) but does not

alter the protein coding region. The last intron was found to contain binding sites for

two motifs, the BRD box and K box, which are known to affect translation in other gene

transcripts and could be repressing full-length SMN expression (Price, unpublished

data). Overall, these studies show that terminal intron retention could be induced using

AOs, but the effects on gene expression at both the mRNA and protein levels are

unpredictable. Therefore, terminal intron retention has to be examined on a gene-by-

gene basis.

For another very simple reason, terminal intron was chosen as the focus of current

project because all gene transcripts that undergo splicing will have a terminal intron.


38

There are many other introns that could be examined: the first, the largest or the

smallest in a transcript. However, since the number of internal introns varies between

different gene transcripts, and it is not possible to study all internal introns, the terminal

intron was selected for this project. Furthermore, induced terminal intron retention has

already been demonstrated in the SMN2 gene transcript at our laboratory. Our

laboratory has considerable experience in various aspects of exon skipping and retention,

but very little on intron retention. This is why the focus of this project will be on using

AO strategies to include the terminal intron in different mature gene transcripts, and

evaluate the effects, if any, on gene expression. The targeted transcripts are LMNA/C,

ITGA4, SOD1 and DMD. These genes were selected for study because of the experience

with working with these genes at the laboratory and because these genes are associated

with serious disease. If terminal intron retention is demonstrated to have potentially

beneficial effects on gene expression, the project could be a proof-of-concept study for

the use of terminal intron retention for therapeutic intervention.

1.6 Aims

To conclude, most studies on intron retention involve internal introns, not terminal

introns and induced terminal intron retention in humans has not been studied in depth.

Furthermore, it is apparent that to date, AO-induced terminal intron retention has only

been observed for SMN2. Therefore, the aims of the project are to i) investigate if

terminal intron retention can be induced in human gene transcripts (in vivo) by AO

targeting of LMNA/C, ITGA4, SOD1, and DMD, ii) study the effects of terminal intron

retention on gene expression at the mRNA and protein levels, and iii) find out if

different AO chemistries (2’-O-methyl AO on a phosphorothioate backbone and

phosphorodiamidate morpholino) will have similar, enhanced, or reduced effect on

terminal intron retention.

Chapter 2: Materials

39

2. Materials

2.1 2’-OMeAO Purification, Primers, PMOs and Leash Annealing

Material/Reagent Supplier

2’-OMeAOs TriLink BioTechnologies,

San Diego, California

PMOs Gene Tools, Philomath,

Oregon

PMO DNA leashes GeneWorks, Adelaide,

Australia

Primers GeneWorks, Adelaide,

Australia

Illustra NAP-10 Columns prepacked with

Sephadex G-25 DNA Grade

GE Healthcare Life Sciences,

Sydney, Australia

Molecular grade water Sigma-Aldrich, Sydney,

Australia

ND-1000 Spectrophotometer NanoDrop Technologies,

Wilmington, Delaware

2.2 Cell Culture and Passaging


Normal human fibroblasts &

Primary human myoblasts

Donated with informed

consent

Phosphate buffered saline Prepared in-house; chemicals

from Sigma-Aldrich

Horse serum Gibco® Thermo Fisher

Scientific, Melbourne,

Australia

Foetal bovine serum Gibco® Thermo Fisher


Australia


40

Dulbecco's modified eagle medium

(High glucose, pyruvate)

Gibco® Thermo Fisher


Australia

Ham’s F-10 medium Gibco® Thermo Fisher


Australia

Chick embryo extract US Biological Life Sciences,

Salem, Massachusetts

Matrigel In Vitro Technologies,

Melbourne, Australia

Poly-D-lysine Sigma-Aldrich, Sydney,

Australia

Trypsin Ambion® Thermo Fisher


Australia

Trypan blue Sigma-Aldrich, Sydney,

Australia

NuncTM

15ml/50ml conical sterile

polypropylene centrifuge tubes

Thermo Fisher Scientific,


NuncTM

SpheraTM

T75/T175 flasks Thermo Fisher Scientific,

Melbourne Australia

NuncTM

cell-culture treated 24-well plates Thermo Fisher Scientific,


Cell counting chamber Hawksley, Sussex, UK

Eclipse TS100 microscope Nikon Australia, Sydney,

Australia


41

2.3 Transfection


2′-O-methyl modified antisense

oligonucleotides

TriLink BioTechnologies,

San Diego, California

Phosphorodiamidate morpholino oligomers

(PMO)

Gene Tools, Philomath,

Oregon

PMO leash (DNA oligonucleotide) GeneWorks, Adelaide,

Australia

Lipofectin® transfection reagent Invitrogen® Thermo Fisher


Australia

Lipofectamine® 2000 transfection reagent Invitrogen® Thermo Fisher


Australia

Lipofectamine® 3000 transfection reagent Invitrogen® Thermo Fisher


Australia

Dulbecco's modified eagle medium

(High glucose, pyruvate)

Gibco® Thermo Fisher


Australia

Opti-MEM Gibco® Thermo Fisher


Australia

Foetal bovine serum Gibco® Thermo Fisher


Australia

10X Phosphate buffered saline Prepared in-house; chemicals

from Sigma-Aldrich


Australia

1.5ml eppendorf tubes Sarstedt, Nümbrecht,

Germany


42

2.4 Cell Harvest and RNA Extraction


Tri-reagent Zymo Research, Irvine,

California

Direct-zolTM

RNA MiniPrep kit Zymo Research, Irvine,

California

100% ethanol Sigma-Aldrich, Sydney,

Australia


Australia


Germany

Microfuge Sarstedt, Nümbrecht,

Germany

2.5 RT-PCR, cDNA synthesis, Long-range PCR


SuperScript® III One-Step RT-PCR System

with Platinum® Taq DNA Polymerase

Invitrogen® Thermo Fisher


Australia

SuperScript® IV Reverse Transcriptase Invitrogen® Thermo Fisher


Australia

Random hexamers Invitrogen® Thermo Fisher


Australia

RNaseOUT inhibitor Invitrogen® Thermo Fisher


Australia

TaKaRa LA Taq® Scientifix, Victoria, Australia


Australia


Australia


43


Germany

0.2ml strip tubes Sarstedt, Nümbrecht,

Germany

ND-1000 Spectrophotometer NanoDrop Technologies,

Wilmington, Delaware

2.6 Gel Electrophoresis and Gel Visualisation


Agarose Scientifix, Victoria, Australia

1X Tris base, acetic acid and EDTA

(TAE) buffer

Prepared in-house; chemicals

from Sigma-Aldrich

Red SafeTM

nucleic acid staining solution Scientifix, Victoria, Australia

Gel Red nucleic acid gel stain Biotium, Hayward, California

Loading dye Prepared in-house; chemicals

from Sigma-Aldrich

Loading buffer Prepared in-house; chemicals

from Sigma-Aldrich

Loading dye GeneWorks, Adelaide,

Australia

100bp ladder (DMW-100M) GeneWorks, Adelaide,

Australia

1kb DNA ladder New England BioLabs,

Essex, Massachusetts

Fusion-FX gel doc

Vilber Lourmat, Marne-la

Valle, France


44

2.7 Product Isolation and DNA Sequencing


AmpliTaq Gold® DNA Polymerase with

GeneAmp® 10X PCR Gold Buffer

Thermo Fisher Scientific,


Diffinity RapidTip® Diffinity Genomics,

Henrietta, New York

Agarose Scientifix, Victoria, Australia

50X Tris base, acetic acid and EDTA

(TAE) buffer

Prepared in-house; chemicals

from Sigma-Aldrich

Ethidium bromide stain Prepared in-house; chemicals

from Sigma-Aldrich

Transilluminator Fotodyne Incorporated,

Hartland, Wisconsin

Macherey-Nagel NucleoSpin®

Gel & PCR Clean-up kit

Scientifix, Victoria, Australia

Scalpel


Australia


Australia

2.8 Semi-quantitative Analysis


BIO1D software Vilber Lourmat, Marne-la

Valle, France

Chemismart 3000 Gel Doc Vilber Lourmat, Marne-la

Valle, France

Excel Microsoft

Chapter 3: Methods

45

3. Methods

3.1 Antisense Oligonucleotide (AO) Design and Synthesis

Genomic and mRNA sequences of LMNA/C, ITGA4, SOD1, and DMD were obtained

from GenBank. Each mRNA sequence was aligned to the respective genomic sequence

using the online alignment tool, “SPIDEY” (http://www.ncbi.nlm.nih.gov/spidey/), to

determine the intron/exon junction between the terminal intron and terminal exon of

each gene. Initially, a 25-base antisense oligonucleotide (AO) covering the last intron-

exon junction of each gene transcript was designed, with no specific position. Three

additional exon-internal AOs were designed by micro-walking. A total of 4 AOs were

designed to target each gene transcript (Table 3.1) and synthesized as 2′-O-methyl

modified (2’-OMe) AOs on a phosphorothioate backbone (TriLink BioTechnologies,

San Diego, California). Five additional AOs targeting the SOD1 transcript were

designed and prepared in-house on an Expedite 8909 Nucleic Acid synthesizer. Four

AOs that did alter transcript structure were resynthesized as phospohrodiamidate

morpholino oligomers (PMOs) by Gene Tools (Philomath, Oregon).

3.2 AO Nomenclature

The AOs were named according to the target gene transcript abbreviation, organism,

exon, donor or acceptor site, and annealing position of the AO, as described by Mann et

al., 2002. For example, LMNA_H12A(-16+9) denotes Lamin A gene transcript, human,

exon 12, acceptor site. The -/+ sign and numbers represent the annealing coordinates in

the intronic and exonic domains respectively, hence implying 16 bases into intron 11

and 9 bases into exon 12. The donor site is denoted by ‘D’.

Chapter 3: Methods

46

Table 3.1 Sequences of 2'-OMeAOs used in the project. All AOs target either the terminal splice site or terminal exon.

Name Sequence (5' to 3')

LMNA _H12A(-16+9) CUGGGGGCUCUAAGAGAGAAAACAG

LMNA_H12A(+10+34) UCCCAGAUUACAUGAUGCUGCAGUU

LMNA_H12A(+35+59) UCCACCCCCACCCCUGCCUGGCAGG

LMNA_H12A(+60+84) UGAGGUGAGGAGGACGCAGGAAGCC

LMNC_H10A(-10+15)1 GCGCAUGGCCACUUCCUGGUGGGGA

LMNC_H10A(+16+40)1 # CCACAGUCACUGAGCGCACCAGCUU

LMNC_H10A(+41+65)1 # CCAUCCUCAUCCUCGUCGUCCUCAA

LMNC_H10A(+66+90)1 GUGGUGGUGAUGGAGCAGGUCAUCU

ITGA4_H28A(-6+19) # GUCUUUUAAAGAAGCCAGCCUGAAA

ITGA4_H28A(+20+44) # UCUUCUUGUAGGAUAGAUUUGUAUU

ITGA4_H28A(+45+69) AUAACUCCAACUGUCUCUUCUGUUU

ITGA4_H28A(+70+94) AAUCAUCAUUGCUUUUACUGUUGAU

DMD_H79A(-9+16) CUUCCUACAUUGUGUCCUGGAAAAC

DMD_H79A(+17+41) CAAAUCAUCUGCCAUGUGGAAAAGA

DMD_H79A(+42+66) AUACUAAGGACUCCAUCGCUCUGCC

DMD_H79A(+67+91) GCUCCUUCUUCAUCUGUCAUGACUG

SOD1_H5A(-5+20) UCAUCUGCUUUUUCAUGGACCUGUA

SOD1_H5A(+21+45) UUCUUCAUUUCCACCUUUGCCCAAG

SOD1_H5A(+46+70) UUCCAGCGUUUCCUGUCUUUGUACU

SOD1_H5A(+71+95) CCAAUUACACCACAAGCCAAACGAC

SOD1_H5A(+14+38)* UUUCCACCUUUGCCCAAGUCAUCUG

SOD1_H5A(+18+42)* UUCAUUUCCACCUUUGCCCAAGUCA

SOD1_H5A(+24+48)* ACUUUCUUCAUUUCCACCUUUGCCC

SOD1_H4D(+99-5)* CUUACCACCAGUGUGCGGCCAAUGA

SOD1_H4D(+108-14)* UUAUGAAAACUUACCACCAGUGUGC

SMN_H8A(-10+15) CUAUGCCAGCAUUUCCUGCAAAUGA

SMN_H8A(+57+81) CUUCUAUAACGCUUCACAUUCCAGA 1AO sequences are also present within LMNA transcripts #Resynthesized as PMOs

*Synthesized using Expedite 8909 Nucleic Acid synthesizer

Chapter 3: Methods

47

3.3 Purification of AOs

The 2’-OMeAOs were purified by desalting. To desalt, the powdered 2’-OMeAOs were

first dissolved in 1ml molecular grade water (Sigma-Aldrich, Sydney, Australia) and

then flushed through Illustra NAP-10 Columns prepacked with Sephadex G-25, DNA

Grade (GE Healthcare Life Sciences, Sydney, Australia). The AOs were eluted in water

and the concentrations determined using ND-1000 Spectrophotometer (NanoDrop

Technologies, Wilmington, Delaware).

3.4 PCR Primer Design and Reconstitution

Forward and reverse primers for each gene transcript were designed using PrimerBlast

(http://www.ncbi.nlm.nih.gov/tools/primer-blast/). The primers were synthesized by

GeneWorks (Adelaide, Australia) and the sequences are shown in Table 3.2. The

primers were first dissolved in molecular grade water (Sigma-Aldrich, Sydney,

Australia) and the concentrations determined using ND-1000 Spectrophotometer

(NanoDrop Technologies, Wilmington, Delaware). Primers were then diluted and

dispensed into 50ng/µl aliquots.

Chapter 3: Methods

48

Table 3.2 Sequences of primers used in the project. The primers were named according to the target gene transcript, followed by the exon.

Primer No. Name Sequence (5' to 3')

4970 LMNA_ Ex9F^* ATCAACTCCACTGGGGAAGAAGT

4969 LMNA_ Ex12R^* ATGTGGAGTTTCCTGGAAGCAG

5255 LMNC_Ex6F1 ^ CAGCAGCAGCTGGACGAGTA

6107 LMNC_Ex8F1 * TTGCTGACTTACCGGTTCCC

5259 LMNC_Ex10R^* GCCGCGGCTACCACTCAC

6003 ITGA4_Ex21F^ GCACAGCAGAGTGACTGTAG

6110 ITGA4_Ex27F* GAAGGACTACATCATCAAAGACCC

5597 ITGA4_Ex28R^* GCTGAGATTTTCCCCTTGCATG

6007 SOD1_Ex3F^* TCTATCCAGAAAACACGGTGGG

6008 SOD1_Ex5R^* AGTTAAGGGGCCTCAGACTACA

6004 DMD_Ex75OutF^ GAGTCACAGTTACACAGGCT

4894 DMD_Ex79OutR^ TGCTCCTTCTTCATCTGTC

6005 DMD_Ex76InF* AGGCAGAGGCCAAAGTGAAT

6006 DMD_Ex79InR * TCCATCGCTCTGCCCAAATC

5512a SMN_Ex4F^* AGGTCTCCTGGAAATAAATCAG

5513a SMN_Ex8R^* AGAGCAGCACTAAATGACACCA

F: forward R: reverse Out: outer primer In: inner primer 1 Primer also anneals to LMNA transcripts

^Used for amplification *Used for DNA sequencing

3.5 Cell Resurrection and Propagation

To resurrect cryopreserved normal human fibroblasts, the cryo-vial was thawed and the

cell suspension transferred to 9ml 10% HS DMEM (Gibco® Thermo Fisher Scientific,

Melbourne, Australia) warmed to room temperature. The cell suspension was then

centrifuged at 1.0 rcf for 4 minutes. The pellets were collected and re-suspended in 1mL

10% FBS DMEM (Gibco® Thermo Fisher Scientific, Melbourne, Australia) and

transferred to a T75 culture flask containing 9ml 10% FBS DMEM (Gibco® Thermo

Fisher Scientific, Melbourne, Australia). The flask was incubated at 37oC in 5% CO2/air.

When cell confluence reached 70% to 80%, the cells were trypsinized (see Section 3.6)

Chapter 3: Methods

49

and transferred to a T175 flask in 20mL 10% FBS DMEM (Gibco® Thermo Fisher

Scientific, Melbourne, Australia) for further propagation.

As the full length DMD isoform is expressed in muscle cells, experiments on retaining

terminal intron in DMD transcripts were also conducted in primary human myoblasts.

Using both fibroblasts and myoblasts also allowed comparative analysis of splice-

switching in different cell types. Muscle samples were provided by Royal Perth

Hospital and primary human myoblasts were prepared as described by Rando and Blau

(prepared by Kane Greer). The purified myoblasts were allowed to propagate in 20%

FBS Ham’s F10 (Gibco® Thermo Fisher Scientific, Melbourne, Australia)

supplemented with 0.5% chick embryo extract (US Biological Life Sciences, Salem,

Massachusetts).

3.6 Cell Passage

When the fibroblasts reached 70-80% confluence, they were seeded into 24-well plates

for subsequent transfection. Cell culture media was aspirated from the culture flask and

approximately 10ml phosphate buffered saline (PBS) was used to wash the flask and

was aspirated. Six ml 1X trypsin in PBS was then added to the flask and incubated at

37oC for approximately 1 minute. Following incubation, the flasks were checked under

the microscope to ensure that the cells were dislodged from the flask surface. The

trypsin was inactivated by the immediate addition of 14ml 10% HS DMEM (Gibco®

Thermo Fisher Scientific, Melbourne, Australia). The cells were transferred to a

centrifuge tube and centrifuged at 1.0 rcf for 4 minutes. The supernatant was aspirated

and cell pellets were re-suspended in 1ml 10% FBS DMEM (Gibco® Thermo Fisher

Scientific, Melbourne, Australia). To determine the volume of cells required for

distribution into 24 well plates, the cells were counted after dilution (1:10) in 0.4%

Chapter 3: Methods

50

trypan blue solution (Sigma-Aldrich, Sydney, Australia). Each well was seeded with

15,000 fibroblasts in 500µl 10% FBS DMEM media (Gibco® Thermo Fisher Scientific,

Melbourne, Australia). The plates were then incubated at 37oC in 5% CO2/air for one

day before transfection.

Prior to seeding primary myoblasts into 24-well plates for transfection, the plates were

treated with 200µl 50mg/ml poly-D-lysine (Sigma-Aldrich, Sydney, Australia) for one

hour at room temperature. The poly-D-lysine solution was then aspirated and replaced

with 200µl of MatrigelTM

(In Vitro Technologies, Melbourne, Australia) and incubated

at 37oC for one hour. The myoblasts were harvested from the flasks by trypsinzation as

above, and then re-suspended in 1ml 5% HS DMEM (Gibco® Thermo Fisher Scientific,

Melbourne, Australia) and counted as above. A total of 2.75x104 cells in 500µl 5% HS

DMEM (Gibco® Thermo Fisher Scientific, Melbourne, Australia) was seeded into each

well and the plates were then incubated at 37oC in 5% CO2/air for 3 days before

transfection.

3.7 Cell Transfection

3.7.1 2’-O-methyl-antisense Oligonucleotides (2’-OMeAOs)

3.7.1.1 Lipofectin® as vehicle

The 24-well plates were examined under the microscope to check cell quality and when

the cells reached a confluence of 50% to 60%, they were transfected with the AOs. To

enhance cellular uptake of the AO, the LMNA/C, ITGA4 and SOD1 2’-OMeAOs were

conjugated with Lipofectin® transfection reagent (Invitrogen® Thermo Fisher

Scientific, Melbourne, Australia) to form a cationic lipoplex at a previously optimized

ratio of 1:2 2’-OMeAO:Lipofectin® (w/v) (Mann et. al., 2001). The 2’-OMeAO was

prepared at a final concentration of 400nM in 1ml 1% FBS DMEM (Gibco® Thermo

Chapter 3: Methods

51

Fisher Scientific, Melbourne, Australia). Firstly, Lipofectin® was diluted in DMEM

(Gibco® Thermo Fisher Scientific, Melbourne, Australia) to a total volume of 200µl

and incubated at room temperature for 10 minutes. After incubation, 2’-OMeAO was

added and this was followed by 20 minutes incubation at room temperature. A serial

dilution of the AO:lipoplex was prepared to yield AO concentrations at 200nM, 100nM,

and 50nM for each AO. Transfection with the positive control 2’-OMeAO was only

carried out at 100nM. The lipoplex mixture was diluted to 1ml with 1% FBS DMEM

(Gibco® Thermo Fisher Scientific, Melbourne, Australia). The media was then

aspirated from the cells in 24-well plates and each concentration of lipoplex mixture

was added to 2 wells, 500µl per well. The cells were incubated for 48 hours, at 37oC in

an incubator supplying 5% CO2/air.

3.7.1.2 Lipofectamine® 2000 as vehicle

Transfection of myoblasts with DMD transcript targeting 2’-OMeAOs was done using

Lipofectamine® 2000 transfection reagent (L2K; Invitrogen® Thermo Fisher Scientific,

Melbourne, Australia), at a 1:1, 2’-OMeAO:L2K (w/v) ratio. As for transfection using

Lipofectin®, the amount of 2’-OMeAO used in myoblast transfection was calculated to

yield a final concentration of 400nM in 1ml serum free media. Firstly, L2K and

2’OMeAO were separately diluted in Opti-MEM (Gibco® Thermo Fisher Scientific,

Melbourne, Australia), in a final volume of 100µl, and incubated at room temperature

for 5 minutes. Following the incubation, the diluted L2K and 2’-OMeAO were mixed

and incubated at room temperature for 20 minutes. Transfection mixtures with AO

concentrations of 200nM, 100nM, and 50nM for each 2’-OMeAO were prepared by

serial dilution whereas the positive control 2’-OMeAO was only transfected at 100nM.

Media was aspirated from the 24-well plates, and each transfection mix were added to

Chapter 3: Methods

52

duplicate wells, 500µl per well. The plates were then incubated for 24 hours at 37oC in

an incubator supplying 5% CO2/air.

3.7.1.3 Lipofectamine® 3000 as vehicle

As a comparative analysis, transfection using Lipofectamine® 3000 (L3K; Invitrogen®

Thermo Fisher Scientific, Melbourne, Australia) was initially carried out for two target

gene transcripts showed positive induced terminal intron retention. Firstly, each of the

2’-OMeAOs was diluted in 50µl of DMEM (Gibco® Thermo Fisher Scientific,

Melbourne, Australia). Except for the positive control 2’-OMeAO, the amount of 2’-

OMeAO used was calculated to give a final concentration of 400nM in 1ml media. As

above, serial dilutions of the test AOs were prepared to yield 2’-OMeAO lipolexes at

200nM, 100nM, and 50nM whereas the positive control 2’-OMeAO was used at 100nM.

Next, 3µl of L3K diluted in DMEM (Gibco® Thermo Fisher Scientific, Melbourne,

Australia) to a volume of 25µl, was added to each of the diluted 2’-OMeAOs and

incubated for 5 minutes at room temperature. Following incubation, 1% FBS DMEM

(Gibco® Thermo Fisher Scientific, Melbourne, Australia) was added to a final total

volume of 1ml. Finally, the media was aspirated from the 24-well plates, and each

concentration of transfection mixtures was added to duplicate wells, 500µl per well and

the cells were incubated for 48 hours at 37oC in an incubator supplying 5% CO2/air.

Due to a high level of cell death at the higher concentrations of 2’-OMeAO (50-200nM),

transfection using L3K was subsequently carried out at lower concentrations (50nM,

25nM, 12.5nM) and at two time points (24h and 48h). Each of the 2’-OMeAOs,

including the positive control 2’-OMeAO, was diluted in 50µl of DMEM (Gibco®

Thermo Fisher Scientific, Melbourne, Australia) to a final concentration of 100nM in

1ml media. The 50nM, 25nM, and 12.5nM 2’-OMeAOs were prepared by serial

Chapter 3: Methods

53

dilution, whereas the positive control 2’-OMeAO was diluted to 50nM and 25nM

concentrations. As above, the diluted L3K was added to the diluted 2’-OMeAOs that

were then diluted to 1ml with 1% FBS DMEM (Gibco® Thermo Fisher Scientific,

Melbourne, Australia), and added to the cells. The cells were then incubated for 24 and

48 hours at 37oC in an incubator supplying 5% CO2/air.

3.7.2 Phosphorodiamidate Morpholino Oligomers (PMOs)

The PMOs and a scrambled sequence control (5'-CCT CTT ACC TCA GTT ACA ATT

TAT A 3') purchased from Gene Tools (Philomath, Oregon) were reconstituted using

molecular grade water (Sigma-Aldrich, Sydney, Australia), to prepare a 1000µM stock

solution. The PMOs were first tested in naked transfection to assess transfection

efficiency and determine if enhanced transfection would be required. A day prior to

transfection, cells were seeded into 24-well plates (see Section 3.6). On the day of

transfection, the media was aspirated from the wells and 500µl 1% FBS DMEM

(Gibco® Thermo Fisher Scientific, Melbourne, Australia) was added to each well. For

naked transfection, a 400µM PMO working stock was prepared and added to duplicate

wells at three concentrations (20µM, 10µM and 5µM) for each PMO. The cells were

incubated over 7 days, and each well was topped up with 100µl of 20% FBS DMEM

(Gibco® Thermo Fisher Scientific, Melbourne, Australia) on day 4.

PMOs were also transfected by annealing to a DNA leash and forming a complex with

Lipofectin® transfection reagent (Thermo Fisher Scientific, Melbourne, Australia).

Complementary leashes were designed for each PMO (Table 3.3) and were synthesized

as DNA sequences by GeneWorks (Adelaide, Australia). A working stock of 50µM of

PMO-leash mix was prepared by mixing 50µM PMO, 50µM leash, and 4 X PBS

(diluted from 10 X PBS) in a final volume of 25µl. The PMO and leash were annealed

Chapter 3: Methods

54

using a gradient protocol: 95oC for 10min, 85

oC for 1min, 75

oC for 1min, 65

oC for 5min,

55oC for 1min, 45

oC for 1min, 35

oC for 5min, 25

oC for 1min, 15

oC for 1min. The PMO-

leash was then used to form a complex with Lipofectin® at a 1:2 ratio

(leash:Lipofectin®, w/w). Transfection was carried out in the same way as for 2’-

OMeAOs (see Section 3.7.1.1), except that the amount of PMO-leash complex was

prepared at a final concentration of 800nM in 1ml media, and then diluted as before to

yield transfection mixtures with PMO-leash concentrations of at 400nM, 200nM, and

100nM. Lipoplex/PMO transfection was carried out for 72 hours at 37oC in an incubator

supplied with 5% CO2/air.

Table 3.3 Sequences of PMOs and leashes used in PMO lipoplex transfections.

Name PMO sequence (5’ to 3’) Leash sequence (5' to 3')

LMNC_H10A(+16+40) CCACAGTCACTGAGCGCACCAGCTT AAGCTGGTGCGCTCAGTGACTGTGG

LMNC_H10A(+41+65) CCATCCTCATCCTCGTCGTCCTCAA TTGAGGACGACGAGGATGAGGATGG

ITGA4_H28A(-6+19) GTCTTTTAAAGAAGCCAGCCTGAAA TTTCAGGCTGGCTTCTTTAAAAGAC

ITGA4_H28A(+20+44) TCTTCTTGTAGGATAGATTTGTATT AATACAAATCTATCCTACAAGAAGA

SMN_H8A(-10+15) CTATGCCAGCATTTCCTGCAAATGA TCATTTGCAGGAAATGCTGGCATAG

Scrambled control CCTCTTACCTCAGTTACAATTTATA TATAAATTGTAACTGAGGTAAGAGG

3.8 RNA Analysis

3.8.1 Total RNA Extraction

Following transfection, total RNA was isolated using Tri-reagent (Zymo Research,

Irvine, California) and purified using Direct-zolTM

RNA MiniPrep kit (Zymo Research,

Irvine, California; protocol ver 1.1.0). Slight changes made to the manufacturer’s

protocol include centrifuging at 12 000rcf for all steps, using 800µl RNA prewash and

centrifuging for 2 minutes in the prewash step, and using 30µl molecular grade water

(Sigma-Aldrich, Sydney, Australia) for elution. cDNAs were then synthesized and

amplified using either one-step or two-step RT-PCR, as indicated below.

Chapter 3: Methods

55

3.8.2 One-step RT-PCR

One-step RT-PCR was carried out on RNA samples from cells treated with SMN-,

LMNA/C- and ITGA4- targeting AOs, using the SuperScript® III One-Step RT-PCR

System with Platinum® Taq DNA Polymerase (Invitrogen® Thermo Fisher Scientific,

Melbourne, Australia). Each reaction consisted of 0.35µl SuperScript® III RT/

Platinum® Taq Mix, 1x reaction mix, 25ng forward primer, 25ng reverse primer, 50ng

RNA, and water to a final volume of 12.5µl. Depending on the primer pair and the size

of the expected product, the cycling conditions differed slightly for each targeted gene

transcript (Table 3.4).

Table 3.4 RT-PCR cycling conditions for different gene transcripts. Cycle number applies to the amplification step that includes denaturation, annealing, and extension.

Transcript cDNA

synthesis Initial

denaturation No. of cycles

Denaturation Annealing Extension (1min/kb)

SMN

55oC for 30min

94oC for 2min

25 94oC for 40s 56oC for 1min

68oC for 1min

LMNA/C 30 94oC for 30s 60oC for 1min

68oC for 2min

ITGA4 25 94oC for 40s 58oC for

1min

68oC for

1min 30s

3.8.3 Two-step RT-PCR

As the expected size of SOD1 transcripts with retained terminal intron is approximately

5 times the size of the constitutively spliced transcript, long range PCR was carried out,

using TaKaRa LA Taq® (Scientifix, Victoria, Australia). DMD transcripts were also

amplified using long range PCR as the product of interest (approximately 5kb) is larger

than that readily amplified using SuperScript® III One-Step RT-PCR (Invitrogen®

Thermo Fisher Scientific, Melbourne, Australia). Prior to carrying out long range PCR,

cDNA was synthesized according to SuperScript® IV reverse transcriptase

(Invitrogen® Thermo Fisher Scientific, Melbourne, Australia) protocol, but using half

of the reaction volume (10µl). 50µM random hexamers (Invitrogen® Thermo Fisher

Chapter 3: Methods

56

Scientific, Melbourne, Australia) was used as the primer, and 5µl of RNA sample with

the lowest concentration in each experiment was set as the amount of template RNA to

use for each reaction, where approximately 100ng of RNA from fibroblasts and 200ng

of RNA from myoblasts were used.

The synthesized cDNAs were then used in TaKaRa LA Taq® long range PCR. Each

12.5µl PCR reaction contained 1X LA buffer (Mg2+

plus), 0.625U LA Taq DNA

polymerase, 5nmol dNTP mixture, 12.5ng forward primer, 12.5ng reverse primer, 1µl

cDNA, and water. Long range PCR was programmed with initial denaturation at 94oC

for 1min, followed by 35 cycles of denaturation at 94oC for 30s, annealing at 58

oC for

30s, and extension at 72oC, 1min/kb. The extension time for amplification of SOD1 and

DMD transcripts was 2 and 6 minutes, respectively.

3.9 Gel Electrophoresis and Product Analysis

Except for DMD amplicons, all PCR products were fractionated on 2% agarose gel with

1x TAE gels at 100V. Amplified DMD cDNA were fractionated on 1% agarose gel with

1x TAE gel at 60V. All gel images were captured using the Vilber Lourmat Fusion-FX

gel documentation system (Marne-la Valle, France).

3.9.1 Product Isolation and DNA Sequencing

Amplification products of interest were re-fractionated on 2% agarose gel with 1x TAE

buffer and stained with ethidium bromide. The gel was visualised using a

transilluminator and bands were either stabbed using a P200 tip, or excised with a

scalpel. Generally, bands with sizes corresponding to those of intron-less transcripts

were stabbed, while bands of larger sizes were excised. Following stabbing, the P200

Chapter 3: Methods

57

tip was inoculated into a reaction mix that consisted of 1x GeneAmp® PCR Gold

Buffer (Thermo Fisher Scientific, Melbourne, Australia), 0.25µmol dNTPs, 5µmol

MgCl2, 37.5ng forward and reverse primers each, 1U AmpliTaq gold (Thermo Fisher

Scientific, Melbourne, Australia), and water (50µl in total). The cycling conditions were:

initial denaturation at 94oC for 6min, followed by 30 cycles of denaturation at 94

oC for

30s, annealing at 5oC less than the original annealing temperature, for 1min, and

extension at 72oC for 2min, followed by holding at 25

oC. The reamplified products were

re-examined on agarose gels to check that the bands of interest were amplified, before

being purified using Diffinity RapidTip® (Diffinity Genomics, Henrietta, New York) as

described by the manufacturer. For samples with multiple PCR products, a clean DNA

could not be isolated from the larger bands using band stab method. Therefore, DNA

from PCR products with sizes greater than the smallest sized band were extracted and

purified for DNA sequencing using the band excision method. Agarose gel stained with

ethidium bromide was visualised using a transilluminator and bands of interest were

excised using a scalpel. DNA was extracted and purified using Macherey-Nagel

NucleoSpin® Gel & PCR Clean-up kit (Scientifix, Victoria, Australia), according to the

manufacturer’s protocol.

Purified DNA was prepared for sequencing by the Australian Genome Research Facility

Ltd (AGRF) in 12µl sequencing reaction. Each sequencing reaction consisting of

approximately 19.2pmol forward or reverse primer, purified DNA in the amount

recommended by AGRF (www.agrf.org.au) and water.

Chapter 3: Methods

58

3.9.2 Semi-quantitative Analysis

Optical densities (ODs) of RT-PCR products were determined using the Vilber Lourmat

Fusion-FX gel documentation system (Marne-la Valle, France) and BIO1D software

(Vilber Lourmat, Marne-la Valle, France). The data were then presented in graphs

prepared using Excel (Microsoft). The proportions of terminal intron-retaining and full-

length transcripts were generated by the following formula:

𝑂𝐷𝑇𝐼𝑅/𝐹𝐿/𝑈𝑛𝑖𝑑𝑒𝑛𝑡𝑖𝑓𝑖𝑒𝑑

𝑂𝐷𝑡𝑜𝑡𝑎𝑙

The ratios of full-length transcripts were generated by using the following formula:

ODFL target transcript (treated OR untreated)× ODFL 𝑆𝑀𝑁 (treated OR untreated)

ODFL 𝑆𝑀𝑁 (untreated)⁄

ODFL target transcript (untreated)

Statistical analyses were done using R statistical software (downloaded online).

Chapter 4: Results

59

4. Results

4.1 SMN-AOs Induced Terminal Intron Retention

As proof-of-concept that terminal intron retention is inducible, and can alter expression

of a human gene transcript using antisense oligonucleotides (AO), two 2’-O-methyl

antisense oligonucleotides (2’-OMeAOs) on a phosphorothioate backbone known to

induce terminal intron retention in human SMN gene transcripts (Price, personal

communication) were evaluated for use as a positive control. One of the AOs targets the

last acceptor splice site (SMN_H8A(-10+15)), while the other targets a region within

the terminal SMN exon (SMN_H8A(+57+81)). Normal human fibroblasts were

transfected with both AOs as cationic lipoplexes at 200nM, 100nM, and 50nM. RNA

extracted from the transfected fibroblasts was then amplified via RT-PCR using SMN

primer pair (5512a+5513a) (Figure 4.1A). SMN RT-PCR products without the terminal

intron (intron 7) are 404bp, while those with retained intron 7 are 848bp. The 848bp

products are present in greater abundance in treated samples than in the untreated,

confirming that both AOs were able to induce terminal intron retention in SMN

transcripts at all concentrations tested (Figure 4.2). Since terminal intron retention is

inducible at all three concentrations tested, the middle AO concentration (100nM) was

chosen as the concentration of the positive control 2’-OMeAO for subsequent

transfections.

Chapter 4: Results

60

8 7 6 5 4 444nt

3

5512a 5513a

Figure 4.1 Schematic diagrams of partial pre-mRNAs showing AO annealing sites and the location of RT-PCR primers used. A: SMN, B: LMNA, C: LMNC, D: ITGA4, E: SOD1, F: DMD pre-mRNAs. Primers 6107, 6110, 6005 and 6006 were used for sequencing only. The size of the terminal intron is indicated. The arrow and number underneath represent PCR primers. Blue lines represent introns, while boxes represent exons and the number within refers to the exon number. Black lines represent AOs. Diagrams are not drawn to scale.

322nt 12 11 10 9 8

4970 4969

10 9 8 7 6 421nt

5

5255 5259 6107

28 27 26 22 21 496nt

20

6003 5597 6110

1095nt 5 4 3 2 1

6007 6008

79 78 77 76 75 4711nt

74

6004 4894 6005 6006

A

B

F

E

D

C

Chapter 4: Results

61

Figure 4.2 SMN RT-PCR products amplified from normal human fibroblasts transfected with SMN_8A(+57+81) and SMN_8A(-10+15), using SMN primer pair (5512a+5513a). -ve: PCR negative control

UT: untreated TIR: transcripts with terminal intron retained FL: full-length transcripts (terminal intron excised)

100b

p la

dder

100b

p la

dder

200n

M

100n

M

50nM

200n

M

100n

M

50nM

SMN TIR

(848bp)

SMN FL (404bp)

-ve

It was speculated that transfection with an AO cocktail composed of an AO blocking

the donor splice site and an AO that causes intron retention, could enhance the intron

retention effect. Transfection was carried out using two SMN-targeting AO cocktail,

consisting of the AO that targets the donor splice site of the terminal intron

(SMN_H7D(+17-13)) and a terminal intron retention inducing AO, SMN_H8A(+57+81)

or SMN_H8A(-10+15). RT-PCR analysis shows that the addition of SMN_H7D(+17-13)

does not have a synergistic effect on terminal intron retention (Figure 4.3). In fact, there

was a decrease in the amount of mRNA transcripts with retained terminal intron

compared to when SMN_H8A(+57+81) or SMN_H8A(-10+15) was used alone (Figure

4.2). As SMN_H7D(+17-13) can induce SMN exon 7 skipping, there was also an

expected increase in transcripts missing SMN exon 7 (Figure 4.3).

UT

Chapter 4: Results

62

100b

p la

dder

200n

M

100n

M

50nM

200n

M

100n

M

50nM

Figure 4.3 RT-PCR of RNA extracted from normal human fibroblasts treated with AO cocktails designed to induce terminal intron retention in SMN transcripts.

-ve: PCR negative control


H7D(+17-13)

H8A(+57+81)

H7D(+17-13)

H8A(-10+15)

SMN TIR (848bp)

SMN FL

(404bp)

SMN Δ7

(350bp)

UT

100b

p la

dder

-ve

4.2 Effects of Oligonucleotides on Transcript Splicing Patterns

4.2.1 Treatment of Normal Human Fibroblasts with LMNA-targeting 2’-OMeAOs

The LMNA gene can give rise to multiple isoforms by alternative splicing of the pre-

mRNA (http://www.ncbi.nlm.nih.gov/gene/4000). LMNA and LMNC are two major

transcripts encoded by LMNA gene and they code for lamin A and C proteins,

respectively, that have structural roles in maintaining nuclear shape and size

(http://www.omim.org/entry/150330). The effect of 2’-OMeAOs designed to induce

terminal intron retention within LMNA transcripts (intron 11), and later, LMNC

transcripts (intron 9), were evaluated in human fibroblasts.

Chapter 4: Results

63

RT-PCR of RNA extracted from normal human fibroblasts transfected with LMNA-

targeting 2’-OMeAOs and the positive control 2’-OMeAO was carried out using LMNA

primer pair (4970+4969) (Figure 4.1B), and SMN primer pair (5512a+513a),

respectively. The untreated sample was also amplified using LMNA primer pair. Full-

length LMNA RT-PCR products (687bp) are present in all, except for one, of the

samples of AO-treated, positive control-treated, and untreated samples (Figure 4.4) and

sequencing of this 687bp product confirmed it represents full-length transcripts without

terminal intron (Figure 4.5). No larger RT-PCR product of the desired size of 1009bp,

indicating terminal intron retention within LMNA transcripts, was evident after

transfection with the four LMNA-targeting 2’-OMeAOs designed. However, there was

variation in the abundance of full-length LMNA RT-PCR products, and signs of a dose-

dependent response for samples treated with LMNA_H12A(+10+34) and

LMNA_H12A(+35+59), where the amount of full-length LMNA products decreases

with increasing AO concentration (Figure 4.4).

Chapter 4: Results

64

Last base

of exon 11

First base of

exon 12

Figure 4.5 Chromatogram of the 687bp LMNA RT-PCR product amplified from RNA extracted from normal human fibroblasts transfected with LMNA-targeting 2’-OMeAOs.

100b

p la

dder

100b

p la

dder

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

Figure 4.4 RT-PCR evaluating transfection of normal human fibroblasts with the four LMNA-targeting 2’-OMeAOs designed to induce terminal intron retention. Amplification was carried out using LMNA primer pair (4970+4969) and only full-length LMNA products were amplified. The positive control sample (+ve) was amplified using SMN primer pair (5512a+ 5513a).

+ve: transfection positive control 2’-MeAO, SMN_8A(+57+81)



LMNA FL

(687bp)

UT +ve -ve

SMN TIR

(848bp)

SMN FL

(404bp)

Chapter 4: Results

65

It was necessary to determine if variation in the abundance of full-length LMNA RT-

PCR products is due to down-regulation of LMNA mRNA expression or cell death

following AO transfection. There was also a need to distinguish between a dose-

dependent response to AO transfection and variability in full-length LMNA RT-PCR

product levels, due to transfection-associated cell death, the transfection was repeated.

Therefore, the extracted RNA amplified by RT-PCR using both LMNA primer pair

(4970+4969) and SMN primer pair (5512a+5513a). SMN transcripts are not expected to

be targeted by the AOs used to transfect the cells and thus they serve as an internal

control to indicate transfection associated cell death. A relatively consistent band for

full-length SMN transcripts across the AO-treated samples would suggest down-/up-

regulation of the LMNA transcript or a dose-dependent response, whereas variability in

the intensity of the SMN product would suggest cell death due to AO or transfection

reagent toxicity. There appears to be an increase in the abundance of full-length LMNA

products as AO concentration decreases after transfection with LMNA_H12A(+10+34)

and LMNA_H12A(+60+84) (Figure 4.6A), with no significant variability in the

abundance of full-length SMN products across the three AO concentrations (Figure

4.6B). The ratio of full-length LMNA products from AO-treated samples was compared

to untreated sample, after being normalized to the respective full-length SMN products,

and shows clear variation in the abundance of full-length LMNA products, with

transfection of LMNA_H12A(+10+34), LMNA_H12A(+35+59) and

LMNA_H12A(+60+84), all resulting in a down-regulation of full-length LMNA

transcripts (Figure 4.7).

Chapter 4: Results

66

100b

p la

dder

100b

p la

dder

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

SMN TIR

(848bp)

SMN FL (404bp)

LMNA FL (687bp)

Figure 4.6 RT-PCR evaluating transfection of normal human fibroblasts with the four LMNA-targeting 2’-OMeAOs designed to induce terminal intron retention. A: RT-PCR using LMNA primer pair (4970+4969). B: RT-PCR using SMN primer pair (5512a+5513a).




UT +ve -ve

A

B

The RT-PCR shows a greater abundance of SMN transcripts with retained terminal

intron (848bp) for the positive control than for the untreated sample, indicating

acceptable transfection efficiency (Figure 4.6B). Interestingly, while transfection of

LMNA-targeting AOs did not cause a change in the splicing pattern of LMNA transcripts,

the AOs did appear to have influence the SMN splicing pattern. Specifically,

LMNA_H12A(+10+34), LMNA_H12A(+35+59) and LMNA_H12A(+60+84) resulted

in additional ~500bp SMN products (Figure 4.6B).

Chapter 4: Results

67

Figure 4.7 Ratios of full-length LMNA transcripts in normal human fibroblasts after transfection with LMNA-targeting 2’-OMeAOs. The ratios were determined as specified in Section 3.9.2. The ratio was undetermined for 200nM LMNA_H12A(-16+9) as no full-length SMN products were detected. UT: untreated

0

0.2

0.4

0.6

0.8

1

200nM 100nM 50nM 200nM 100nM 50nM 200nM 100nM 50nM 200nM 100nM 50nM

LMNA_H12A(-16+9) LMNA_H12A(+10+34) LMNA_H12A(+35+59) LMNA_H12A(+60+84) UT

Rat

io

4.2.2 Treatment of Normal Human Fibroblasts with LMNC-targeting 2’-OMeAOs

While intron 9 of the LMNA gene is not the terminal intron of the gene, it is referred to

as the “terminal intron” of LMNC transcripts, where transcription terminates within

LMNA exon 10. Like the LMNA experiment, RT-PCR amplification of LMNC

transcripts, after transfection with AOs designed to induce LMNC terminal intron

retention, were conducted in two sets, using the LMNC primer pair (5255+5259) (Figure

4.1C) and the SMN primer pair (5512a+5513a). A 660bp RT-PCR product is observed

in all samples amplified using LMNC primers (Figure 4.8A). Sequencing shows that this

product represents full-length LMNC transcripts without retained terminal intron (Figure

4.9A). Transfection with LMNC_H10A(+16+40), LMNC_H10A(+41+65) and

LMNC_H10A(+66+90) resulted in partial retention of the terminal intron in LMNC

transcripts (Figure 4.8A), confirmed by DNA sequencing (Figure 4.9B). Where LMNC

products with retained terminal intron (1081bp) were amplified, there was also a smaller

product (~1000bp) that could not be identified despite numerous attempts at DNA

sequencing. Additionally, LMNC-targeting 2’-OMeAOs that induced terminal intron

Chapter 4: Results

68

SMN Δ5

(308bp)

100b

p la

dder

100b

p la

dder

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

LMNC TIR (1081bp)

Unidentified product (~1000bp)

LMNC FL

(660bp)

UT +ve -ve

Figure 4.8 RT-PCR evaluating the transfection of normal human fibroblasts with the four 2’-OMeAOs targeting LMNC transcripts designed to induce terminal intron retention. A: RT-PCR using LMNC primer pair (5255+5259). B: RT-PCR using SMN primer pair (5512a+5513a).




SMN TIR

(848bp)

SMN FL

(404bp)

A

B

retention also altered the SMN splicing pattern, resulting in a 500bp RT-PCR product

(Figure 4.8B) and interestingly, DNA sequencing shows that LMNC_H10A(+66+90)

causes skipping of SMN exon 5 (Figure 4.10).

Chapter 4: Results

69

Figure 4.9 Chromatograms of LMNC RT-PCR products. A: Chromatogram of the 660bp RT-PCR product amplified from RNA extracted from normal human fibroblasts transfected with LMNC-targeting AOs. B: Chromatogram of the 1081bp product amplified from RNA extracted from normal human fibroblasts transfected with LMNC-targeting AOs that cause a change in splicing pattern of

LMNC transcripts.

Last base

of exon 9

First base

of exon 10

5’ end of

intron 9

3’ end of

intron 9

A

B

Last base

of exon 4

First base of

exon 6

Figure 4.10 Chromatogram of the ~300bp SMN RT-PCR product amplified from RNA extracted from

normal human fibroblasts transfected with LMNC_H10A(+66+90).

Chapter 4: Results

70

Figure 4.11 Semi-quantitative analysis of terminal intron retention induced in LMNC transcripts. Although the proportions of transcripts with retained terminal intron are low, they are significantly different from transcripts derived from the untreated cells. Error bar is included for samples with terminal intron retention and sample size n=2. ^Results are from a single experiment. * p-value <0.001 UT: untreated

TIR: transcripts with terminal intron retained FL: full-length transcripts (terminal intron excised)

0

0.2

0.4

0.6

0.8

1


LMNC_H10A(-10+15) LMNC_H10A(+16+40) LMNC_H10A(+41+65)LMNC_H10A(+66+90)^ UT

Pro

po

rtio

n

TIR

Unidentified

FL

* * * * *

* * * *

Terminal intron retention induced by LMNC_H10A(+66+90) was sporadic, detected

only on a single occasion. Densitometry shows that transfection with LMNC-targeting

2’-OMeAOs decreased full-length mRNA expression by 3% to 13%, and

LMNC_H10A(+16+40) and LMNC_H10A(+41+65) have dose-dependent effects on

terminal intron retention, where the proportion of transcripts with retained terminal

intron increases as AO concentration increases (Figure 4.11).

Chapter 4: Results

71

4.2.2.1 Treatment of Normal Human Fibroblasts with LMNC-targeting PMOs

Following confirmation of terminal intron retention in LMNC transcripts induced by

LMNC-targeting 2’-OMeAOs, the two most promising sequences that induced terminal

intron retention, LMNC_H10A(+16+40) and LMNC_H10A(+41+65), were

resynthesized as phosphorodiamidate morpholinos (PMOs) for comparison between

different AO chemistries and to determine if the more stable PMO chemistry could

induce a stronger effect. The PMOs were tested at 400nM, 200nM, and 100nM, while

the highest concentration of 2’-OMeAOs tested was 200nM. PMOs are less efficiently

taken up by cells in vitro and were thus tested at the higher concentration range of

100nM to 400nM, previously optimized for SMN targeting (Price, personal

communication). Using PMOs, terminal intron retention was weaker than that induced

by the 2’-OMeAOs, and retention was only observed at the higher concentrations.

LMNC_H10A(+16+40) PMO induced terminal intron retention at 400nM and 200nM,

while LMNC_H10A(+41+65) PMO induced terminal intron retention at 400nM (Figure

4.12A).

Chapter 4: Results

72

Scrambled

control UT -ve 100b

p la

dder

100b

p la

dder

Figure 4.12 RT-PCR showing transfection with PMOs designed to induce retention of the LMNC terminal intron. A: RT-PCR using LMNC primer pair (5255+5259). B: RT-PCR using SMN primer pair (5512a+5513a).



400n

M

200n

M

100n

M

400n

M

200n

M

100n

M

400n

M

200n

M

100n

M

LMNC TIR (1081bp)

Unknown product (~1000bp)

LMNC FL (660bp)

SMN TIR

(848bp)

SMN FL

(404bp)

A

B

Chapter 4: Results

73

4.2.3 Treatment of Normal Human Fibroblasts with ITGA4-targeting 2’-OMeAOs

The ITGA4 gene comprises of 28 exons and codes for ITGA4 protein that belongs to the

integrin alpha chain family of proteins. ITGA4 proteins are ubiquitously expressed

adhesion molecules that have a role in cell signaling

(http://www.omim.org/entry/192975), and ITGA4 down-regulation using antisense

strategy is being investigated as a potential therapy for multiple sclerosis (Thander,

personal communication). Four 2’-OMeAOs were designed to retain the ITGA4

terminal intron (intron 27) and their effects were investigated.

To distinguish between a dose-dependent response to AO transfection and variability in

transcript levels due to transfection-associated cell death, the extracted RNA samples

were amplified by RT-PCR using ITGA4 primer pair (6003+5597) (Figure 4.1D) and

SMN primer pair (5512a+5513a). 2’-OMeAOs, ITGA4_H28A(-6+19),

ITGA4_H28A(+20+44) and ITGA4_H28A(+45+69) induced some degree of terminal

intron retention, as suggested by the presence of 1472bp bands (Figure 4.13A).

Sequencing of the 1472bp RT-PCR product confirmed retention of the ITGA4 terminal

intron and sequencing of the smaller band (976bp) confirmed that it represents full-

length, intron-less ITGA4 transcripts (Figure 4.14). Densitometry on the gel images

shows that ITGA4-targeting 2’-OMeAOs decreased full-length mRNA expression by 7%

to 13% (Figure 4.15).

http://www.omim.org/entry/192975

Chapter 4: Results

74

100b

p la

dder

100b

p la

dder

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

100n

M

UT +ve -ve

SMN FL

(404bp)

ITGA4 TIR (1472bp)

ITGA4 FL

(976bp)

SMN TIR (848bp)

Figure 4.13 RT-PCR evaluating the transfection of normal human fibroblasts with the four 2’-OMeAOs targeting ITGA4 transcripts designed to induce terminal intron retention. A: RT-PCR using ITGA4 primer pair (6003+5597). B: RT-PCR using SMN primer pair (5512a+5513a).




A

B

Chapter 4: Results

75

Figure 4.15 Semi-quantitative analysis of terminal intron retention induced in ITGA4 transcripts. Although the proportions of transcripts with retained terminal intron are considerably low, they are significantly different from transcripts of the untreated sample. Error bar is included (n=2). ^Results are from a single experiment. * p-value <0.001 UT: untreated TIR: transcripts with terminal intron retained FL: full-length transcripts (terminal intron excised)

0

0.2

0.4

0.6

0.8

1


ITGA4_H28A(-6+19) ITGA4_H28A(+20+44) ITGA4_H28A(+45+69) ITGA4_H28A(+70+94) UT

Pro

po

rtio

n

TIR

FL

* * * * * * * * *

5’ end of

intron 27

3’ end of

intron 27

Last base

of exon 27

First base of

exon 28 A

B

Figure 4.14 Chromatograms of ITGA4 RT-PCR products. A: Chromatogram of the 976bp RT-PCR product amplified from RNA extracted from normal human fibroblasts transfected with ITGA4-targeting AOs. B: Chromatogram of the 1472bp RT-PCR product amplified from RNA extracted from normal human fibroblasts transfected with ITGA4-targeting AOs that result in a different splicing pattern.

Chapter 4: Results

76

Scrambled

control UT -ve 100b

p la

dder

100b

p la

dder

400n

M

200n

M

100n

M

400n

M

200n

M

100n

M

400n

M

200n

M

100n

M

ITGA4 TIR

(1472bp)

ITGA4 FL

(976bp)

Figure 4.16 RT-PCR showing transfection with PMOs designed to induce retention of the ITGA4 terminal intron. A: RT-PCR using ITGA4 primer pair (6003+5597). B: RT-PCR using SMN primer pair (5512a+5513a).



SMN FL

(404bp)

SMN TIR

(848bp)

A

B

4.2.3.1 Treatment of Normal Human Fibroblasts with ITGA4-targeting PMOs

Following confirmation of terminal intron retention, two AO sequences,

ITGA4_H28A(-6+19) and ITGA4_H28A(+20+44), were resynthesized as PMOs. The

PMOs induced terminal intron retention (Figure 4.16A), but at the 200nM and 100nM

PMO concentrations, the effect was less pronounced that that induced by 2’-OMeAOs

at the same concentrations (Figure 4.17).

Chapter 4: Results

77

4.2.4 Treatment of Normal Human Fibroblasts with SOD1-targeting 2’-OMeAOs

The SOD1 gene has 5 exons and codes for a homodimeric enzyme that breaks down

free superoxide radicals that can cause deleterious damage to the cell when present at

high levels (http://www.ncbi.nlm.nih.gov/gene/6647). Induced retention of SOD1

terminal intron (intron 4) using SOD1-targeting 2’-OMeAOs was also investigated.

RNA samples extracted from normal human fibroblasts, transfected with SOD1-

targeting AOs, were amplified by two-step RT-PCR, using SOD1 primer pair

(6007+6008) (Figure 4.1E). The positive control and untreated samples were also

amplified by one-step RT-PCR, using SMN primer pair (5512a+5513a). Analysis of the

two-step RT-PCR products showed multiple randomly amplified products, with a

consistent, intense 300bp product across all samples, while there is obvious product of

*

Figure 4.17 Proportions of ITGA4 transcripts with retained terminal intron when different AO chemistries were used. Even though there is a hint of TIR transcripts amplified from RNA extracted from cells treated with 100nM ITGA4_H28A(+20+44), optical density analysis was not possible.

* p-value <0.001 TIR: transcripts with terminal intron retained

0

0.02

0.04

0.06

0.08

0.1

0.12

0.14

200nM 100nM 200nM 100nM

ITGA4_H28A(-6+19) ITGA4_H28A(+20+44)

Pro

po

rtio

n o

f T

IR T

ran

scri

pts

PMO

2'-OMeAO

*

*

Chapter 4: Results

78

A

Figure 4.18 RT-PCR of RNA extracted from normal human fibroblasts transfected with SOD1-targeting 2’-OMeAOs. A: Two- step long range RT-PCR using SOD1 primer pair (6007+6008). B: One-step RT-PCR using SMN primer pair (5512a+5513a).




SOD1 FL (300bp)

Potential SOD1 TIR

(1395bp)

100b

p la

dder

100b

p la

dder

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

UT -ve

100b

p la

dder

UT -ve +ve

SMN FL (404bp)

SMN TIR (848bp)

B

the anticipated size of 1395bp (Figure 4.18A). DNA sequencing shows that the 300bp

product represents full-length transcripts without terminal intron (Figure 4.19).

Chapter 4: Results

79

While no clear product-of-interest was observed, the gel image suggests a hint of intron-

retaining products amplified from cells transfected with SOD1_H5A(+21+45) 2’-

OMeAO (Figure 4.18A). Therefore, three additional 2’-OMeAOs were designed around

the region targeted by the SOD1_H5A(+21+45) 2’-OMeAO. Additionally, two 2’-

OMeAOs that target the donor splice site of SOD1 exon 4 were designed and

synthesised, to determine if blocking the donor splice site will induce retention of the

terminal intron. RT-PCR analysis of RNA extracted from cells transfected with the

second generation 2’-OMeAOs did not show any 1395bp bands (Figure 4.20A),

indicating that attempts to induce terminal intron retention in SOD1 transcripts using

these 2’-OMeAOs was not successful.

Last base

of exon 4

First base

of exon 5

Figure 4.19 Chromatogram of the 300bp SOD1 RT-PCR product amplified from RNA extracted from normal human fibroblasts transfected with SOD1-targeting AOs.

Chapter 4: Results

80

100b

p la

dder

100b

p la

dder

UT -ve

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

Figure 4.20 RT-PCR of RNA extracted from normal human fibroblasts transfected with second generation of SOD1-targeting 2’-OMeAOs. A: Two- step long range RT-PCR using SOD1 primer pair (6007+6008). B: One-step RT-PCR using SMN primer pair (5512a+5513a).




SMN FL

(404bp)

SMN TIR

(848bp)

100b

p la

dder

UT -ve +ve

SOD1 FL (300bp)

A

B

Chapter 4: Results

81

4.2.5 Treatment of Normal Human Fibroblasts and Primary Myoblasts with DMD-

targeting 2’-OMeAOs

At approximately 2.4Mb, DMD is the largest human gene known to date. DMD

comprises of 79 exons, and encodes dystrophin, a large cytoskeletal protein that is

important in maintaining muscle fibre integrity (Muntoni et. al., 2003). Multiple tissue-

specific DMD transcripts are generated by alternative promoter usage, poly(A) tail

addition sites, and splicing (http://www.ncbi.nlm.nih.gov/gene/1756).

To determine if transfection of different cell types with DMD-targeting 2’-OMeAOs

designed to induce retention of the DMD terminal intron (intron 78) will result in

different splicing patterns, transfections were carried out in normal human fibroblasts

and normal primary human myoblasts. RNA was then extracted and amplified via two-

step long range RT-PCR, using the outer DMD primer pair (6004+4894) (Figure 4.1F),

and to determine if transfection was successful, the positive control and untreated

samples were also amplified by one-step RT-PCR, using SMN primer pair

(5512a+5513a). DMD RT-PCR shows no product of the anticipated size of 5091bp in

either fibroblast or myoblast samples, but smaller bands are present in both types of

samples (Figure 4.21A and 4.22A). Three RT-PCR products, slightly smaller than

500bp, were observed in fibroblast samples (Figure 4.21A). However, amplification of

myoblast DMD cDNA produced multiple random bands and two consistent bands with

size slightly less than 500bp, across all samples (Figure 4.22A).

Chapter 4: Results

82

1kb

ladd

er

1kb

ladd

er

UT -ve +ve

500bp

1kb

1.5kb

2kb

3kb

4kb

10kb

5kb

8kb 6kb

Figure 4.21 RT-PCR of RNA extracted from normal human fibroblasts transfected with DMD-targeting 2’-OMeAOs. A: Two-step long range RT-PCR using DMD primer pair (6004+4894). RT-PCR products were fractionated on 1% agarose gel in 1x TAE. B: One-step RT-PCR using SMN primer pair (5512a+5513a). RT-PCR products were fractionated on 2% agarose gel in 1x TAE.




200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

SMN FL (404bp)

SMN TIR

(848bp)

100b

p la

dder

UT -ve +ve

A

B

Chapter 4: Results

83

1kb

ladd

er

1kb

ladd

er

UT -ve +ve

Figure 4.22 RT-PCR of RNA extracted from primary human myoblasts transfected with DMD-targeting 2’-OMeAOs A: Two-step long range RT-PCR using DMD primer pair (6004+4894). RT-PCR products were fractionated on 1% agarose gel in 1x TAE. B: One-step RT-PCR using SMN primer pair (5512a+5513a). RT-PCR products were fractionated on 2% agarose gel in 1x TAE.




200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

SMN FL (404bp)

SMN TIR

(848bp)

100b

p la

dder

UT -ve +ve

500bp

1kb

1.5kb

2kb

3kb

4kb

10kb

5kb

8kb 6kb

A

B

Chapter 4: Results

84

As the anticipated size of DMD RT-PCR products with retained terminal intron is

approximately 5kb, fractionation of the products was carried out using 1% agarose gel

for good separation of large products. However, the amplified RT-PCR products were

smaller than 500bp, which did not separate well in low percent agarose gel. To better

estimation the product sizes, RT-PCR products amplified from fibroblasts and

myoblasts transfected with 200nM 2’-OMeAO were re-fractionated on a 2% agarose gel,

using the 100bp ladder as a size standard. Three products, not evident on the 1% gel

were observed when the myoblast samples were fractionated on the 2% agarose gel.

Expectedly, three products were present in the fibroblast samples. Nonetheless, there is

a clear difference between fibroblast and myoblast samples, where myoblast samples

have a much more intense 380bp product than fibroblast samples (Figure 4.23). DNA

sequencing shows that the 380bp product represents full-length DMD transcripts

without the terminal intron, and the lower ~350 product represents DMD transcripts

missing exon 78, while sequencing of the larger ~400bp product is inconclusive and this

product remains unidentified (Figure 4.23).

Chapter 4: Results

85

Last base

of exon 78

First base of

exon 79

Figure 4.23 Fibroblast and myoblast DMD RT-PCR products and chromatograms of the amplified DMD RT-PCR products. The three RT-PCR products were amplified using DMD primers (6004+4894) in both fibroblast and myoblast samples. Chromatograms of bands A and B are shown. Multiple attempts at sequencing band C were not successful.

F: fibroblast M: myoblast

Last base

of exon 77

First base of

exon 79

C Unidentified product

F 100b

p la

dder

100b

p la

dder

B DMD FL (380bp) A DMD Δ78 (348bp)

M F M F M F M

B

A

Chapter 4: Results

86

100b

p la

dder

100b

p la

dder

UT -ve +ve

Figure 4.24 RT-PCR of RNA extracted from myoblasts transfected with DMD- and SMN-targeting 2’-OMeAOs. Amplification was carried out using SMN primer pair (5512a+5513a).




SMN FL

(404bp)

SMN TIR (848bp)

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

200n

M

100n

M

50nM

4.3 Evaluation of Different Transfection Reagents in Primary Human Myoblasts

and Normal Human Fibroblasts

Initially, transfection of myoblasts with DMD-targeting 2’-OMeAOs was carried out

using Lipofectin® as the cationic delivery agent. After a single failed transfection of

myoblasts with Lipofectin®, subsequent myoblast transfections were carried out using

Lipofectamine® 2000 (L2K), which was previously determined to be a more suitable

transfection vehicle for myoblast transfection (Adams, personal communication). When

using Lipofectin® to form lipoplexes with the positive control SMN-targeting 2’-

OMeAO for transfection into myoblasts, terminal intron retention in SMN transcripts

was not induced (Figure 4.24). However, SMN terminal intron was retained in

myoblasts using L2K (Figure 4.22).

Chapter 4: Results

87

In addition, Lipofectamine® 3000 (L3K) was evaluated in other studies in our

laboratory during the course of this project and found to be superior to Lipofectin®

(Price and Pitout, personal communication). Thus, some experiments were repeated

using L3K as the transfection reagent. LMNA and ITGA4 were selected to examine if

L3K would actually enhance transfection and terminal intron retention. Quite

unexpectedly, there was no increase in the proportion of LMNA and ITGA4 transcripts

showing intron retention 24h after transfection (Figure 4.25A and E). Interestingly,

potential terminal intron retention was observed for LMNA transcripts after 48h

transfection, however, this was not confirmed by DNA sequencing, as there is

insufficient product for sequencing (Figure 4.25C). Nonetheless, variability in the

abundance of full-length LMNA products between and within each AO group is

observed (Figure 4.25A, C). Notably, transfection of normal human fibroblasts with

50nM LMNA_H12A(-16+9) (24h and 48h), 50nM (48h) and 25nM (24h)

LMNA_H12A(+10+34), and 50nM LMNA_H12A(+35+59) (48h) resulted in more than

or close to 50% reduction in the levels of full-length LMNA transcripts (Figure 4.26A).

Surprisingly, transfection with LMNA_H12A(+35+59) and LMNA_H12A(+60+84)

generally caused an up-regulation of full-length LMNA transcripts (Figure 4.26A).

Interestingly, for ITGA4 experiment at the 48h time point, there was a consistent

indication of transfection-associated cell death at the higher concentrations (50nM),

suggested by decreased abundance of both full-length ITGA4 and SMN products (Figure

4.25G, H). Semi-quantitative analysis shows down-regulation of full-length ITGA

transcripts in normal human fibroblasts following transfection with the 4 ITGA4-

targeting 2’-OMeAOs, with significant down-regulation when 50nM of AO was used

(Figure 4.26B).

Chapter 4: Results

88

LMNA FL

(687bp) 10

0bp

ladd

er

100b

p la

dder

UT +ve -ve

50nM

25nM

12.5

nM

50nM

25nM

12.5

nM

50nM

25nM

12.5

nM

50nM

25nM

12.5

nM

50nM

25nM

LMNA FL (687bp)

A

24h

48h

LMNA TIR (1008bp)

C

B

D

SMN TIR (848bp)

SMN FL (404bp)

SMN TIR (848bp)

SMN FL

(404bp)

100b

p la

dder

100b

p la

dder

UT +ve -ve

50nM

25nM

12.5

nM

50nM

25nM

12.5

nM

50nM

25nM

12.5

nM

50nM

25nM

12.5

nM

50nM

25nM

E

24h

48h

ITGA4 TIR

(1472bp)

ITGA4 FL

(976bp)

ITGA4 TIR

(1472bp)

ITGA4 FL

(976bp)

G

F

H

SMN TIR (848bp)

SMN FL

(404bp)

SMN TIR (848bp)

SMN FL

(404bp)

Chapter 4: Results

89

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

50nM 25nM 12.5nM 50nM 25nM 12.5nM 50nM 25nM 12.5nM 50nM 25nM 12.5nM

LMNA_H12A(-16+9) LMNA_H12A(+10+34) LMNA_H12A(+35+59) LMNA_H12A(+60+84) UT

Rat

io

24h

48h

0

0.2

0.4

0.6

0.8

1

50nM 25nM 12.5nM 50nM 25nM 12.5nM 50nM 25nM 12.5nM 50nM 25nM 12.5nM

ITGA4_H28A(-6+19) ITGA4_H28A(+20+44) ITGA4_H28A(+45+69) ITGA4_H28A(+70+94) UT

Rat

io

24h

48h

A

B

Figure 4.26 Ratios of full-length LMNA and ITGA4 transcripts in normal human fibroblasts after 24h and 48h transfections using Lipofectamine® 3000 (L3K) transfection reagent. The ratios were determined as specified in Section 3.9.2 Semi-quantitative Analysis. A: Ratios of full-length LMNA products of AO-treated samples to that of untreated samples. B: Ratios of full-length ITGA4 products of AO-treated samples to that of untreated samples.

UT: untreated

Figure 4.25 Repeat of LMNA and ITGA4 experiments using Lipofectamine® 3000 (L3K) transfection reagent. RT-PCR of RNA extracted from normal human fibroblasts treated with 2’-OMeAOs targeting LMNA A, B: 24h and C, D: 48h after transfection, and RT-PCR of RNA extracted from normal human fibroblasts treated with 2’-OMeAOs targeting ITGA4 transcripts after E, F: 24h and G, H: 48h transfection. A and C were amplified using LMNA primer pair (4970+4969). E and G were amplified using ITGA4 primer pair (6003+5597). B, D, F and H were amplified using SMN primer pair (5512a+5513a).




Chapter 5: Discussion

90

5. Discussion

Data from the experiments show that terminal intron retention is not inducible in all of

the human gene transcripts examined and not all target sites can mediate intron retention.

In addition, changing AO chemistry and transfection reagent led to different results.

These findings suggest that terminal intron retention is influenced by multiple factors.

Besides offering possible explanations for the experimental results, this discussion will

also examine possible mechanism and features that support terminal intron retention.

Limitations and improvements, as well as future directions will also be discussed.

5.1 General Discussion

5.1.1 Preliminary Experiments on SMN Transcripts

Two 2’-OMeAOs known to induce terminal intron retention in SMN transcripts were

validated for use as positive controls, prior to investigating AO-mediated terminal

intron retention in other target gene transcripts. Furthermore, to determine if blocking

the donor splice site simultaneously would enhance the effect of intron retention

induced by AOs directed to other target gene transcripts, transfection of fibroblasts was

carried out using an AO cocktail comprising of an SMN-targeting AO that binds at the

donor splice site of the terminal intron (SMN_H7D(+17-13)) and one of the previously

developed terminal intron retention-inducing AOs, SMN_H8A(+57+81) or

SMN_H8A(-10+15). The addition of SMN_H7D(+17-13) has no synergistic effect on

terminal intron retention and there appeared to be a decrease in the abundance of

transcripts with retained terminal intron. As SMN_H7D(+17-13) is an exon skipping-

inducing AO, there was also an expected increase in transcripts with SMN exon 7

skipping. This shows that the SMN exon 7 skipping AO overrides the effect of the SMN

intron 7 inclusion AO. While this leads to the conclusion that the inclusion of an AO

targeting the donor splice site does not enhance the effect of a terminal intron retention-


91

inducing AO in SMN transcripts, the result has its limitations. Firstly, the donor splice

site-targeting AO causes exon skipping and secondly, only one donor splice site AO

was tested. Results based on a single AO cocktail may not be representative, therefore,

more cocktail combinations should be tested. Nevertheless, the result confirms that

terminal intron retention is inducible by selected AOs, validating SMN terminal intron

retention as a suitable positive control for this project.

5.1.2 Principle Findings

Overall, the experimental results suggest that terminal intron retention is not readily

inducible using AOs. Only 40% of gene transcripts (n=5) investigated showed some

terminal intron retention following transfection with 2’-OMeAOs. Furthermore, within

the LMNC and ITGA4 transcripts where terminal intron retention was detected, only a

few of the AOs designed were able to induce detectable retention of the last intron when

total cellular RNA was examined, again showing that terminal intron retention is not

easily inducible, and that the effective AO target sites are somewhat constrained.

Notably, the proportion of transcripts with retained terminal intron was consistently low,

ranging from approximately 3% to 13%. Such low levels of transcripts with retained

terminal intron could be due to degradation via nonsense-mediated decay (NMD)

activated by intron retention, as further discussed in the next paragraph.

No 1009bp LMNA RT-PCR product representing LMNA transcripts with retained

terminal intron was amplified, however, some variations in the abundance of full-length

LMNA products were observed. Down-regulation of full-length LMNA transcripts was

observed following transfection of normal human fibroblasts with

LMNA_H12A(+10+34), LMNA_H12A(+35+59) and LMNA_H12A(+60+84). A

possible explanation for this is that terminal intron retention did occur, but resulted in


92

highly unstable intron-retaining LMNA transcripts that were rapidly degraded by NMD

and hence, were not detected by RT-PCR amplification. The terminal intron of LMNA

transcripts contains 2 premature in-frame termination codons (PTCs) that could explain

rapid turnover by NMD (Lewis et. al., 2003, Lareau et. al., 2007). However, the

terminal introns of LMNC and ITGA4 transcripts have more PTCs (5 and 13,

respectively), yet terminal intron retention is evident from RT-PCR. This suggests that

NMD is not wholly dependent on the presence of PTCs, and is probably not influenced

by the number of PTCs.

Although the LMNA-targeting 2’-OMeAOs, LMNA_H12A(+10+34),

LMNA_H12A(+35+59) and LMNA_H12A(+60+84) did not obviously alter the

splicing pattern of LMNA transcripts, SMN RT-PCR products of approximately 500bp

were amplified. 500bp SMN products were also amplified from LMNC_H10A(+16+40)

and LMNC_H10A(+41+65) transfected fibroblasts. These 500bp SMN products were

overlooked initially and were not submitted for sequence analysis, but it is speculated

that they could be heteroduplexes and hence, a PCR artefact.

Interestingly, a LMNC-targeting AO, LMNC_H10A(+66+90), caused skipping of SMN

exon 5. This non-specific effect could have been due to a similarity between the LMNC

target sequence and the SMN sequence. To determine if this might offer an explanation

for the skipping of SMN exon 5, a BLAST search

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) of the targeted LMNC sequence was performed,

but SMN was not a possible match. Another possible reason for the non-specific effect

is similarity between the targeted LMNC sequence and a splicing factor that then has an

effect on skipping of SMN exon 5.


93

Sequencing difficulties were encountered when analysing the LMNC and DMD

experiments, where clean sequencing chromatograms were not achieved. The ~1000bp

product amplified from LMNC cDNA could only be speculated to be due to cryptic

splicing or it could be a heteroduplex, while the ~400bp DMD product is speculated to

be a minor isoform in both fibroblasts and myoblasts.

Besides the ~400bp product, two other products were amplified from DMD cDNA.

These three RT-PCR products most likely represent the different isoforms, driven by

internal promotors in the DMD gene. Consistently expressed at a higher level in

myoblasts, the ~380bp product probably represents the full-length skeletal muscle

isoform, whereas the ~350bp band represents the major isoform in fibroblasts. None of

these three products represent DMD transcripts with retained terminal intron.

The finding that terminal intron retention could only be induced in 40% of gene

transcripts examined cannot be considered conclusive, as only four, 25 base AOs were

designed for each gene transcript. Since properties such as length, sequence and target

site can influence efficacy of an AO in altering a splicing pattern, the lack of success at

inducing terminal intron retention in LMNA, SOD1, and DMD transcripts does not

necessarily mean that induced terminal intron retention is impossible. It has been shown

in some cases that longer 2’-OMeAOs and PMOs have higher efficacies than their

shorter counterparts at inducing exon skipping in DMD transcripts (Harding et. al.,

2007). While other studies have shown opposing results, these studies also showed rare

occurrence of higher efficacy in longer AOs (Adams et. al., 2007; Heemskerk et. al.,

2009). Absence of terminal intron retention induced in 60% of the gene transcripts

examined only implies possible design of non-ideal AOs and/or target site selection.

Furthermore, other factors such as AO concentrations, AO chemistry, cell type,


94

transfection reagent, and duration of transfection, can also affect AO transfection

outcome.

5.1.2.1 AO Concentration and Chemistry

Compared to 2’-OMeAOs, a higher PMO concentration range (100nM-400nM) was

used because un-complexed PMOs are not efficiently taken up by cells in vitro, and

were found to be more efficient at inducing terminal intron retention in SMN transcripts

at the higher concentrations (Price, personal communication). A previous study on

inducing DMD exon skipping also used PMOs at a higher concentration (500nM)

(Arechavala-Gomeza et. al., 2007). To determine if AO chemistries influences

transfection outcomes, a semi-quantitative analysis was carried out for ITGA4-targeting

2’-OMeAOs and PMOs with the same sequence (except where U’s in 2’-OMeAOs were

changed to T’s in the PMOs). Using the PMO chemistry, there was an overall decrease

in the proportion of ITGA4 transcripts with retained terminal intron, relative to when the

2’-O-methyl phosphorothioate chemistry was used. This result is similar to that found

when attempting to induce SMN intron 7 retention (Price, unpublished data). However,

PMOs appeared to be more effective than 2’-OMeAOs at inducing exon skipping in

DMD transcripts (Heemskerk et. al., 2009). The difference in efficacies of PMOs at

promoting intron retention and exon skipping suggests that AO chemistry influences

splicing efficacy and that different chemistries might be better suited to the various

alternative splicing events.


95

5.1.2.2 Transfection Reagent

Lipofectin® efficiently transfected AOs into fibroblasts, but was less effective in

transfecting primary myoblasts, where transfection failed on the first attempt. However,

myoblast transfections using Lipofectamine® 2000 (L2K) were successful, indicating

that the selection of transfection reagent is important, and is likely to differ with each

cell type. Nevertheless, myoblast transfection using Lipofectin® was only carried out

once and hence, it is possible that the failure of this single experiment was not due to

the transfection reagent used. However, L2K has generally been an effective

transfection reagent in several cell strains in our laboratory, and the fact that transfection

using L2K succeeded on the first trial suggests that L2K could be a better vehicle than

Lipofectin® for AO transfection into myoblasts.

It was shown during the course of this honours investigation that L3K has significantly

higher transfection efficiency than Lipofectin® (Pitout, Price, personal communication).

A hint of terminal intron retention within LMNA transcripts after 48h transfection gave

support to the higher transfection efficacy of L3K over Lipofectin®. However, expected

enhancement of ITGA4 terminal intron retention was not observed at both time points

tested. These unexpected results suggest that the target gene transcripts and/or AO

sequences may influence the choice of transfection reagent.

5.1.2.3 Transfection Duration

Selected experiments using L3K also show that transfection duration is another possible

parameter impacting on the detection of AO-induced intron retention. Transfections of

fibroblasts with LMNA- and ITGA4-targeting 2’-OMeAOs using L3K were carried out

for 24h and 48h. In the LMNA experiments, terminal intron retention was evident only

after 48h transfection. Nonetheless, the presence of a light smear in the lanes (of the 24h


96

gel image) corresponding to those in the 48h gel image where terminal intron retention

was suggested, could have obscured the larger band that represents terminal intron-

retaining transcripts. Comparing the results of 24h and 48h transfections for ITGA4

transcripts shows a significant decrease in the abundance of RT-PCR product

representing full-length ITGA4 transcripts at the highest AO concentration (50nM)

across the four 2’-OMeAOs tested, and this decrease might be due to the down-

regulation of full-length ITGA4 transcripts at 50nM AO. Although explainable by a

down-regulation, the decreased abundance could also be the result of transfection or

AO-associated toxicity, as there is also a significant decrease in the abundance of RT-

PCR product representing full-length SMN transcripts. Several other housekeeping

genes like GAPDH can be used in place of SMN, to confirm whether there is a true

knock-down of ITGA4 transcripts. There was also a general decrease in the proportions

of ITGA4 transcripts with retained terminal intron with longer transfection (see

Appendix B). Collectively, the 24h and 48h transfections suggest enhanced AO

transport across the cell membrane with longer transfection duration.

5.2 Possible Mechanism of (Terminal) Intron Retention

Besides being alterable by AOs, splicing is also influenced by interactions between cis-

and trans-acting splicing factors (Will and Luhrmann, 2011), RNA secondary structure

(Hiller et. al., 2007) and more. Furthermore, splicing can be developmental stage-

and/or tissue-specific. While the attempt to alter the DMD transcript splicing pattern

was unsuccessful in both fibroblasts and myoblasts, a distinct difference in the

abundance of different DMD products between the two cell types supports tissue

specificity of splicing.


97

With detectable terminal intron retention being inducible by AOs only in LMNC and

ITGA4 transcripts, it is speculated that these transcripts may possess similar features

that are not present in or are different from LMNA, SOD1 and DMD transcripts, or that

the LMNA, SOD1 and DMD target sites evaluated were inappropriate. Intron retention

may arise when intronic splicing silencers (ISSs; Singh et. al., 2006) and/or exonic

splicing enhancers (ESEs) are blocked by AOs. Blocking of ESE(s) by the AOs could

possibly explain terminal intron retention in LMNC and ITGA4 transcripts, as all

LMNC- and ITGA4-targeting 2’-OMeAOs that induced terminal intron retention

targeted the last exon, with ITGA4_H28A(-6+19) that extends 6 bases into the last

intron as the only exception. Analysis of putative splicing factor binding sites using the

online software, SpliceAid 2 (http://193.206.120.249/splicing_tissue.html), showed that

the terminal intron retention-inducing 2’-OMeAOs cover ESEs where splicing factors

such as SR proteins and Tra2β bind (Appendix C). However, putative ESEs are also

present within LMNA, SOD1, and DMD sequences targeted by the 2’-OMeAOs, yet

terminal intron retention did not occur. On the other hand, blocking of the acceptor

splice site could explain terminal intron retention induced by ITGA4_H28A(-6+19).

Although terminal intron retention in LMNC and ITGA4 transcripts could not be

explained by the blocking of ESEs, it might have occurred via other mechanisms

discussed below.

Weak splice sites can potentially render a transcript more susceptible to intron retention,

and using Human Splicing Finder (http://www.umd.be/HSF3/HSF.html), it was found

that the retainable SMN terminal intron has a weak donor splice site, compared to the

pairing acceptor splice site (Price, personal communication; Appendix D). Therefore, a

possible cause of terminal intron retention within LMNC and ITGA4 transcripts is

decreased strength of the acceptor and donor splice sites of the terminal intron, as a


98

result of AO annealing. However, there is no trend in splice site strength that could

explain why terminal intron retention occurred in LMNC and ITGA4 transcripts only.

LMNC transcripts exhibit a similar trend to SMN transcripts, with a slightly weaker

donor splice site (87.66) relative to the acceptor splice site, whereas ITGA4 transcripts

have a strong donor splice site (96.87). A strong donor splice site for ITGA4 transcripts

that exhibit induced terminal intron retention once again indicates interplay of factors in

intron retention events, especially when SOD1 and DMD transcripts, which did not

show terminal intron retention, also have strong donor splice sites (Appendix D).

Notably, LMNA terminal intron has a very strong donor splice site (98.84), however, it

has a relatively weak acceptor splice site (84.59) that could possibly result in alternative

splicing and hence, explain the decreased levels of full-length LMNA transcript

expression. Collectively, the lack of a trend in splice site strength suggests that it is not

a major determining factor of intron retention and that other factors are involved. This

finding is in agreement with Sakabe’s and de Souza’s (2007) finding of a weak negative

correlation between splice site strength (measured using the Shapiro and Senapathy

scoring scheme) and intron retention frequency.

Short introns tend to be retained more readily, compared to longer introns. Retained

introns were reported to have a median length of 145±479nt (Zheng et. al., 2005), and a

mean length of 219±209nt (Sakabe and de Souza, 2007), showing that there is no clear

definition of a short intron. Six members of the human Kallikrein gene family (KLK)

exhibit retention of intron III and each of these genes has a short intron III (<150nt)

(Michael et. al., 2005), supporting an association between short intron length and intron

retention. This association is also justified by Dyskeratosis congenital 1 gene (DKC1),

where intron retention is also a common splicing event, and it has different isoforms

with retained introns ranging from 370nt to 596nt (Turano et. al., 2005). LMNC and


99

ITGA4 transcripts have terminal introns that are relatively similar in length (421nt and

496nt, respectively). Considering 421nt and 496nt introns short, the association between

short intron length and intron retention holds, and this feature becomes a possible

explanation for terminal intron retention in LMNC and ITGA4 transcripts. On the other

hand, SOD1 and DMD transcripts, which did not exhibit induced terminal intron

retention, have much longer terminal introns (1095nt and 4711nt, respectively).

Therefore, it seems likely that short intron length may determine whether terminal

intron retention is inducible. However, LMNA terminal intron (322nt) is shorter than

LMNC and ITGA4 terminal introns. Yet, detectable terminal intron retention was not

induced in LMNA transcripts, although AO intervention did appear to down-regulate the

full length, splice transcript. This supports the general consensus that splicing events are

dependent on interactions between multiple factors.

Lastly, RESCUE ESEs are present at lower densities within the retained terminal LMNC

and ITGA4 introns than in the SOD1 and DMD terminal introns that were not retained

(Appendix E), similar to the trend noted by Zheng et. al.(2005) and Sakabe and de

Souza (2007). Sakabe and de Souza (2007) also found that retained introns had slightly

higher densities (number of motifs/nucleotide) of SELEX-ESEs (SC35, SF2/ASF,

SRp40 and SRp55) than non-retained introns. LMNC terminal intron was found to have

a higher SELEX-ESE density than SOD1 and DMD terminal introns (Appendix E). This

could explain why the LMNC terminal intron was retained but not the SOD1 and DMD

terminal introns. However, SELEX-ESE density would not be useful in explaining

ITGA4 terminal intron retention, where the retained terminal intron has a lower SELEX-

ESE density than LMNA, SOD1, and DMD terminal introns (Appendix E). Noticeably,

LMNA terminal intron has the second highest SELEX-ESE density, which may support

the postulation of transient terminal intron retention in LMNA transcripts that was not


100

detected in RT-PCR analysis. Furthermore, Sakabe and de Souza (2007) found that

retained introns have higher densities of Class 2 FAS-ESSs (hex3 ESS set) and ISE

trinucleotide, GGG. Zheng et. al.(2005) also reported similar finding about higher ESS

frequency within retained introns compared to constitutive introns. Class 2 ESSs consist

of ESSs other than those containing TAGT or TAGGT (Wang et.al., 2006). LMNC and

SOD1 terminal introns, and ITGA4 and DMD terminal introns, were found to have

similar Class 2 ESS density, respectively (Appendix E). An explanation for terminal

intron retention in LMNC, and not SOD1, transcripts (in ITGA4 and not DMD), though

they have very similar ESS density, could be that long intron length overrides ESS

effects, since SOD1 terminal intron is approximately 2.5 times that of LMNC and DMD

terminal intron is approximately 10 times that of ITGA4. Even with a higher ESS

density, the relatively short LMNA terminal intron was not retained. Therefore, high

Class 2 ESS density and short intron length together could increase a transcript’s

susceptibility to induced terminal intron retention.

Overall, no features examined above can predict whether induced terminal intron

retention will occur. Nevertheless, there might be unexamined features that could

influence retention of the terminal intron. Moreover, the number of different gene

transcripts examined is too small to yield a well-substantiated conclusion on features

influencing AO-induced terminal intron retention.


101

5.3 Limitations

Besides the limitations of a small number of AOs tested for each gene transcript, and a

lack of variability in AO characteristics aforementioned, a major limitation encountered

in this project was the low proportion of terminal intron-retaining transcripts detected,

compared to full-length transcripts. However, the observation that AOs designed to

induce terminal intron retention did, in some instances, reduce the abundance of full-

length transcript product, is an important finding.

Preferential amplification of smaller sized products might have resulted in lower yields

of the larger terminal intron-retaining products, making RT-PCR product isolation and

DNA sequencing difficult. To overcome the difficulty in DNA isolation and sequencing

of the transcripts of interest, DNA cloning might be a solution, where purified DNA can

be cloned by inserting it into a plasmid vector. With multiple copies of the DNA-of-

interest, more DNA sample will be available for sequencing. Additionally, performing a

nuclear RNA extraction may also mean a greater proportion of transcripts with retained

terminal intron that will then lead to enhanced amplification of transcripts-of-interest

and hence, allow for better RT-PCR product isolation and DNA sequencing.

Another limitation encountered is that the lengths of the sequencing reads were

generally shorter than that of the DNA template. This means that the sequencing result

can only confirm whether the terminal intron was retained or not, and not whether the

transcript is the correct, entire full-length transcript with retained terminal intron. While

the terminal introns appeared to entirely retained, it is not known if alternative splicing

might have occurred at another site along the transcript resulting in a different sequence

that has similar length to full-length transcript with retained terminal intron. Since

shorter fragments were sequenced unexpectedly, multiple small fragments can be


102

sequenced using different primers and aligned to form the complete sequence, to check

for any alternative splicing at another site along the transcript. Alternatively, for DMD

experiments where the terminal intron is considerably large, two sets of primers

amplifying from an exon further upstream (e.g. exon 75) to a few hundred nucleotides

into the terminal intron (intron 78), and from a few hundred nucleotides of intron 78 3’-

end to somewhere within exon 79, could be used to check for intron retention. However,

these were not done due to time constraints as multiple gene transcripts were examined

and terminal intron retention in DMD was examined last. Incomplete sequencing could

be due to poor DNA quality and/or quantity that can be enhanced using nuclear RNA

extraction and cloning.

While terminal intron retention was consistently induced by two LMNC-targeting AOs

and three ITGA4-targeting AOs, the RT-PCR product representing transcripts with

retained terminal intron was missing in one to two samples in some experiments. This

means that results from these experiments cannot be used for semi-quantitative analysis.

In the end, only results from two experimental sets could be used, and the small sample

size compromises any statistical significance. In some cases, a trace of the band of

interest was visible when the gel was examined, but densitometry analysis was

impossible as the band was too faint to be detected and analysed by the software. In

other cases, the band was detectable on the image, but since the product abundance was

so low, the peak was small, making quantitative estimation difficult and probably

inaccurate. Nonetheless, the semi-quantitative analyses still provides an indication of

the magnitude of the AO effect on mRNA expression for these genes, but digital droplet

RT-PCR may be used to get a better and more accurate quantification of the terminal

intron-retaining transcripts that are present in low abundance.


103

5.4 Future Directions and Implications

Data from this pilot study on AO-induced terminal intron retention have provided

evidence that terminal intron retention could be induced, and that it appears to modulate

gene expression. The data will provide the basis for a more in-depth exploration of the

technique that could result in the novel application of induced terminal intron retention

as a strategy to downregulate the expression of genes associated with disease.

5.4.1 Western Analysis

Initially cited as an aim of the project, western analysis was not conducted due to time

constraints. Analysis of LMNC and ITGA4 in protein extracts from cells treated with

AOs designed to induce terminal intron retention, would be an important next step,

because a significant decrease in full-length mRNA expression could result in a

significant effect at the protein level. Therefore, the next step is to examine the effect of

terminal intron retention on LMNC and ITGA4 protein expression.

5.4.2 Experimental Modifications

As discussed above, low RNA yields and hence low amount of cDNA, of the desired

transcripts (i.e. transcripts with retained terminal intron) is one limitation encountered in

this project. Low nucleic acid yields can be due to intrinsic or extrinsic factors. Intrinsic

factors would include difficulty in inducing terminal intron retention within the specific

gene transcripts studied, and susceptibility to rapid degradation of transcripts with

retained terminal intron (Green et. al., 2003). Extrinsic factors could be associated with

experimental design, including but not limited to, the AO sequence, length, and

chemistry, transfection reagent, delivery method, transfection cell types and RNA

extraction method. While intrinsic factors are unchangeable, experimental design may

be modified to determine if terminal intron retention is impossible because it just cannot


104

be induced in that gene transcript, or is it because some extrinsic factors are preventing

it. Moreover, changing some elements of the experiment might even enhance the results

of terminal intron retention and modulation of full-length transcripts. For example, a

ratio of 2:1 (µl Lipofectin®:µg leashed PMO) was used in the project, but it was found

that using a ratio of 4:1 was most effective at inducing DMD exon skipping

(Arechavala-Gomeza et. al., 2007). Even though this was tested to be the best ratio to

use for exon skipping, it is also likely to be applicable to AO transfection for terminal

intron retention. In addition, since PMOs were determined to work better at higher

concentrations, transfections could be carried out using concentrations higher than

400nM, or using reagents, such as cell pentrating peptides used in nucleofection, to

enhance PMO uptake by the cells. In short, a small step forward from this project would

be to try altering some aspects of the experimental design, such as testing higher AO

concentrations and AOs with variable lengths, and examining nuclear RNA instead of

total cellular RNA, which were not done in this project. After optimal AO sequences are

identified, other modifications such as changing the chemistry of all or some

nucleotides of the AO, and testing cocktails of different AOs may be made.

Coincidentally, the gene transcripts selected for this project have the terminal intron

located within the normal protein coding region. It would be important to also study

induced retention of terminal introns located within the 3’-untranslated region (UTR),

as introns within the 3’- (and 5’-) UTRs have been discovered to play important roles in

regulation of gene expression as well, by interfering with nuclear export of intron-

retaining transcripts, translation, or eliciting NMD (Bicknell et. al., 2012). Moreover,

retained introns were found to be more prevalent in UTRs and non-coding RNAs, than

in protein coding regions of genes (Braunschweig et. al., 2014). Tissue-specific

expression and conservation of genes with intron within the 3’-UTR among human,


105

mice, and rats, suggest that such intron has some function (Bicknell et. al., 2012).

Besides being able to regulate gene expression by triggering NMD (Bicknell et. al.,

2012), 3’-UTR introns were also found to contain putative miRNA binding sites, and

this finding indicates another potential form of gene regulation provided by 3’-UTR

introns (Price, unpublished data; Tan et. al., 2007), making investigating retention of

terminal introns within 3’-UTRs an interesting topic.

5.4.3 Implications

Retaining the terminal intron within a gene transcript by using an AO, as shown to be

possible in this project, may ultimately be developed as a novel therapeutic strategy if

sufficient impact on gene expression is achieved. Decreased levels of full-length LMNC

and ITGA4 transcripts due to terminal intron retention could have a therapeutic effect by

down-regulating expression of a transcript transcribed from mutated LMNA/C and in

diseases such as multiple sclerosis, where ITGA4 is implicated in excessive

inflammatory response, respectively.

Chapter 6: Conclusion

106

6. Conclusion

In summary, the results show that terminal intron retention is inducible in LMNC and

ITGA4 transcripts using 2’-OMeAOs, while it is postulated to have occurred in LMNA

transcripts. Inclusion of the terminal intron decreases full-length LMNC and ITGA4

mRNA expression, whereas the effect on protein expression was not determined. In

addition, using the PMO chemistry resulted in a reduced effect on induced terminal

intron retention compared to when 2’-OMeAOs were used. Overall, this project is just a

preliminary study demonstrating that terminal intron retention is inducible in human

gene transcripts other than SMN transcripts, and a larger scale study involving more

gene transcripts and/or increased range of factors would be required to draw better

conclusions.

Reference

107

Reference

Aartsma-Rus, A., Janson, A. A., Kaman, W. E., Bremmer-Bout, M., Den Dunnen, J. T.,

Baas, F., Van Ommen, G. J. & Van Deutekom, J. C. 2003. Therapeutic

antisense-induced exon skipping in cultured muscle cells from six different

DMD patients. Hum Mol Genet, 12(8): 907-914.

Aartsma-Rus, A., Janson, A. A., Van Ommen, G. J. & Van Deutekom, J. C. 2007.

Antisense-induced exon skipping for duplications in Duchenne muscular

dystrophy. BMC Med Genet, 8: 43. doi:10.1186/1471-2350-1188-1143.

Adams, A. M., Harding, P. L., Iversen, P. L., Coleman, C., Fletcher, S. & Wilton, S. D.

2007. Antisense oligonucleotide induced exon skipping and the dystrophin gene

transcript: cocktails and chemistries. BMC Mol Biol, 8: 57.

Araki, E., Nakamura, K., Nakao, K., Kameya, S., Kobayashi, T., Kobayashi, O.,

Nonaka, I. & Katsuki, M. 1997. Targeted Disruption of Exon 52 in the Mouse

Dystrophin Gene Induced Muscle Degeneration Similar to That Observed in

Duchenne Muscular Dystrophy. Biochemical and biophysical research

communications, 238(2): 492-497.

Arechavala-Gomeza, V., Graham, I. R., Popplewell, L. J., Adams, A. M., Aartsma-Rus,

A., Kinali, M., Morgan, J. E., Van Deutekom, J. C., Wilton, S. D., Dickson, G.

& Muntoni, F. 2007. Comparative analysis of antisense oligonucleotide

sequences for targeted skipping of exon 51 during dystrophin pre-mRNA

splicing in human muscle. Hum Gene Ther, 18(9): 798-810.

Bai, Y., Ji, S. & Wang, Y. 2015. IRcall and IRclassifier: two methods for flexible

detection of intron retention events from RNA-Seq data. BMC Genomics, 16

(Suppl 2): S9.

Baughan, T. D., Dickson, A., Osman, E. Y. & Lorson, C. L. 2009. Delivery of

bifunctional RNAs that target an intronic repressor and increase SMN levels in

an animal model of spinal muscular atrophy. Human molecular genetics, 18(9):

1600-1611.

Bell, T. J., Miyashiro, K. Y., Sul, J. Y., Mccullough, R., Buckley, P. T., Jochems, J.,

Meaney, D. F., Haydon, P., Cantor, C., Parsons, T. D. & Eberwine, J. 2008.

Cytoplasmic BK(Ca) channel intron-containing mRNAs contribute to the

intrinsic excitability of hippocampal neurons. Proc Natl Acad Sci U S A, 105(6):

1901-1906.

Bergeron, D., Pal, G., Beaulieu, Y. B., Chabot, B. & Bachand, F. 2015. Regulated

Intron Retention and Nuclear Pre-mRNA Decay Contribute to PABPN1

Autoregulation. Molecular and cellular biology, 35(14): 2503-2517.

Reference

108

Bessa, C., Teixeira, C. A., Dias, A., Alves, M., Rocha, S., Lacerda, L., Loureiro, L.,

Guimaraes, A. & Ribeiro, M. G. 2008. CLN2/TPP1 deficiency: the novel

mutation IVS7-10A>G causes intron retention and is associated with a mild

disease phenotype. Mol Genet Metab, 93(1): 66-73.

Bicknell, A. A., Cenik, C., Chua, H. N., Roth, F. P. & Moore, M. J. 2012. Introns in

UTRs: why we should stop ignoring them. Bioessays, 34(12): 1025-1034.

Blazquez, L., Aiastui, A., Goicoechea, M., Martins De Araujo, M., Avril, A., Beley, C.,

Garcia, L., Valcarcel, J., Fortes, P. & Lopez De Munain, A. 2013. In vitro

correction of a pseudoexon-generating deep intronic mutation in LGMD2A by

antisense oligonucleotides and modified small nuclear RNAs. Hum Mutat,

34(10): 1387-1395.

Boise, L. H., González-García, M., Postema, C. E., Ding, L., Lindsten, T., Turka, L. A.,

Mao, X., Nuñez, G. & Thompson, C. B. 1993. bcl-x, a bcl-2-related gene that

functions as a dominant regulator of apoptotic cell death. Cell, 74(4): 597-608.

Boutz, P. L., Chawla, G., Stoilov, P. & Black, D. L. 2007a. MicroRNAs regulate the

expression of the alternative splicing factor nPTB during muscle development.

Genes Dev, 21(1): 71-84.

Boutz, P. L., Stoilov, P., Li, Q., Lin, C. H., Chawla, G., Ostrow, K., Shiue, L., Ares, M.,

Jr. & Black, D. L. 2007b. A post-transcriptional regulatory switch in

polypyrimidine tract-binding proteins reprograms alternative splicing in

developing neurons. Genes Dev, 21(13): 1636-1652.

Braunschweig, U., Barbosa-Morais, N. L., Pan, Q., Nachman, E. N., Alipanahi, B.,

Gonatopoulos-Pournatzis, T., Frey, B., Irimia, M. & Blencowe, B. J. 2014.

Widespread intron retention in mammals functionally tunes transcriptomes.

Genome Res, 24(11): 1774-1786.

Brett, D., Pospisil, H., Valcarcel, J., Reich, J. & Bork, P. 2002. Alternative splicing and

genome complexity. Nat Genet, 30(1): 29-30.

Buckley, P. T., Khaladkar, M., Kim, J. & Eberwine, J. 2014. Cytoplasmic intron

retention, function, splicing, and the sentinel RNA hypothesis. Wiley Interdiscip

Rev RNA, 5(2): 223-230.

Burtis, K. C. & Baker, B. S. 1989. Drosophila doublesex gene controls somatic sexual

differentiation by producing alternatively spliced mRNAs encoding related sex-

specific polypeptides. Cell, 56(6): 997-1010.

Busslinger, M., Moschonas, N. & Flavell, R. A. 1981. Beta + thalassemia: aberrant

splicing results from a single point mutation in an intron. Cell, 27(Pt 1): 289-298.

Reference

109

Cáceres, J. F. & Kornblihtt, A. R. 2002. Alternative splicing: multiple control

mechanisms and involvement in human disease. Trends Genet, 18(4): 186-193.

Cagliani, R., Sironi, M., Ciafaloni, E., Bardoni, A., Fortunato, F., Prelle, A., Serafini,

M., Bresolin, N. & Comi, G. P. 2004. An intragenic deletion/inversion event in

the DMD gene determines a novel exon creation and results in a BMD

phenotype. Human genetics, 115(1): 13-18.

Calvanese, V., Mallya, M., Campbell, R. D. & Aguado, B. 2008. Regulation of

expression of two LY-6 family genes by intron retention and transcription

induced chimerism. BMC Molecular Biology, 9: 81. doi:10.1186/1471-2199-

1189-1181.

Carmody, S. R. & Wente, S. R. 2009. mRNA nuclear export at a glance. Journal of cell

science, 122(12): 1933-1937.

Castellanos, E., Rosas, I., Solanes, A., Bielsa, I., Lazaro, C., Carrato, C., Hostalot, C.,

Prades, P., Roca-Ribas, F., Blanco, I., Serra, E. & Hugtip-Ico-Imppc, N. F. M. C.

2013. In vitro antisense therapeutics for a deep intronic mutation causing

Neurofibromatosis type 2. Eur J Hum Genet, 21(7): 769-773.

Cavalieri, S., Pozzi, E., Gatti, R. A. & Brusco, A. 2013. Deep-intronic ATM mutation

detected by genomic resequencing and corrected in vitro by antisense

morpholino oligonucleotide (AMO). Eur J Hum Genet, 21(7): 774-778.

Chang, S. H., Elemento, O., Zhang, J., Zhuang, Z. W., Simons, M. & Hla, T. 2014.

ELAVL1 regulates alternative splicing of eIF4E transporter to promote postnatal

angiogenesis. Proc Natl Acad Sci U S A, 111(51): 18309-18314.

Chih, B., Gollan, L. & Scheiffele, P. 2006. Alternative splicing controls selective trans-

synaptic interactions of the neuroligin-neurexin complex. Neuron, 51(2): 171-

178.

Clayton, N. P., Nelson, C. A., Weeden, T., Taylor, K. M., Moreland, R. J., Scheule, R.

K., Leger, A. J., Phillips, L., Cheng, S. H. & Wentworth, B. M. 2015. Antisense

oligonucleotide-mediated suppression of muscle glycogen synthase 1 synthesis

as an approach for substrate reduction therapy of Pompe disease. Molecular

genetics and metabolism, 3: e206. doi:210.1038/mtna.2014.1057.

Coelho, M. B. & Smith, C. W. J. 2014. Regulation of alternative pre-mRNA splicing. In

Spliceosomal Pre-mRNA Splicing: Methods and Protocols, Methods in

Molecular Biology, edited by Klemens J. Hertel, 55-82. Springer

Science+Business Media.

Reference

110

Dhir, A. & Buratti, E. 2010. Alternative splicing: role of pseudoexons in human disease

and potential therapeutic strategies. FEBS J, 277(4): 841-855.

Dickson, A., Osman, E. & Lorson, C. L. 2008. A negatively acting bifunctional RNA

increases survival motor neuron both in vitro and in vivo. Human Gene Therapy,

19(11): 1307-1315.

Dominov, J. A., Uyan, O., Sapp, P. C., Mckenna-Yasek, D., Nallamilli, B. R., Hegde, M.

& Brown, R. H., Jr. 2014. A novel dysferlin mutant pseudoexon bypassed with

antisense oligonucleotides. Ann Clin Transl Neurol, 1(9): 703-720.

Dominski, Z. & Kole, R. 1993. Restoration of correct splicing in thalassemic pre-

mRNA by antisense oligonucleotides. Proc Natl Acad Sci U S A, 90(18): 8673-

8677.

Echigoya, Y., Aoki, Y., Miskew, B., Panesar, D., Touznik, A., Nagata, T., Tanihata, J.,

Nakamura, A., Nagaraju, K. & Yokota, T. 2015. Long-term efficacy of systemic

multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-

morpholinos in mdx52 mice. Mol Ther Nucleic Acids, 4:

e225.doi:210.1038/mtna.2014.1076.

Egecioglu, D. E. & Chanfreau, G. 2011. Proofreading and spellchecking: a two-tier

strategy for pre-mRNA splicing quality control. RNA, 17(3): 383-389.

Evers, M. M., Tran, H.-D., Zalachoras, I., Meijer, O. C., Den Dunnen, J. T., Van

Ommen, G.-J. B., Aartsma-Rus, A. & Van Roon-Mom, W. M. C. 2014.

Preventing Formation of Toxic N-Terminal Huntingtin Fragments Through

Antisense Oligonucleotide-Mediated Protein Modification. Nucleic acid

therapeutics, 24(1): 4-12.

Faustino, N. A. & Cooper, T. A. 2003. Pre-mRNA splicing and human disease. Genes

Dev, 17(4): 419-437.

Flanagan, S. E., Xie, W., Caswell, R., Damhuis, A., Vianey-Saban, C., Akcay, T.,

Darendeliler, F., Bas, F., Guven, A., Siklar, Z., Ocal, G., Berberoglu, M.,

Murphy, N., O'sullivan, M., Green, A., Clayton, P. E., Banerjee, I., Clayton, P.

T., Hussain, K., Weedon, M. N. & Ellard, S. 2013. Next-generation sequencing

reveals deep intronic cryptic ABCC8 and HADH splicing founder mutations

causing hyperinsulinism by pseudoexon activation. Am J Hum Genet, 92(1):

131-136.

Forrest, S. T., Barringhaus, K. G., Perlegas, D., Hammarskjold, M.-L. & Mcnamara, C.

A. 2004. Intron Retention Generates a Novel Id3 Isoform That Inhibits Vascular

Lesion Formation. Journal of Biological Chemistry, 279(31): 32897-32903.

Reference

111

Gamazon, E. R. & Stranger, B. E. 2014. Genomics of alternative splicing: evolution,

development and pathophysiology. Hum Genet, 133(6): 679-687.

Garcia-Blanco, M. A., Baraniak, A. P. & Lasda, E. L. 2004. Alternative splicing in

disease and therapy. Nat Biotechnol, 22(5): 535-546.

Goodison, S., Yoshida, K., Churchman, M. & Tarin, D. 1998. Multiple Intron Retention

Occurs in Tumor Cell CD44 mRNA Processing. The American Journal of

Pathology, 153(4): 1221-1228.

Gramlich, M., Pane, L. S., Zhou, Q., Chen, Z., Murgia, M., Schotterl, S., Goedel, A.,

Metzger, K., Brade, T., Parrotta, E., Schaller, M., Gerull, B., Thierfelder, L.,

Aartsma-Rus, A., Labeit, S., Atherton, J. J., Mcgaughran, J., Harvey, R. P.,

Sinnecker, D., Mann, M., Laugwitz, K. L., Gawaz, M. P. & Moretti, A. 2015.

Antisense-mediated exon skipping: a therapeutic strategy for titin-based dilated

cardiomyopathy. EMBO Mol Med, doi:10.15252/emmm.201505047.

Graveley, B. R. 2001. Alternative splicing: increasing diversity in the proteomic world.

Trends Genet, 17(2): 100-107.

Green, R. E., Lewis, B. P., Hillman, R. T., Blanchette, M., Lareau, L. F., Garnett, A. T.,

Rio, D. C. & Brenner, S. E. 2003. Widespread predicted nonsense-mediated

mRNA decay of alternatively-spliced transcripts of human normal and disease

genes. Bioinformatics, 19(1): i118-i121.

Greer, K., Mizzi, K., Rice, E., Kuster, L., Barrero, R. A., Bellgard, M. I., Lynch, B. J.,

Foley, A. R., O Rathallaigh, E., Wilton, S. D. & Fletcher, S. 2015. Pseudoexon

activation increases phenotype severity in a Becker muscular dystrophy patient.

Molecular Genetics & Genomic Medicine: n/a-n/a.

Greer, K. L., Lochmuller, H., Flanigan, K., Fletcher, S. & Wilton, S. D. 2014. Targeted

exon skipping to correct exon duplications in the dystrophin gene. Mol Ther

Nucleic Acids, 3: e155. doi:110.1038/mtna.2014.1038.

Gurvich, O. L., Tuohy, T. M., Howard, M. T., Finkel, R. S., Medne, L., Anderson, C. B.,

Weiss, R. B., Wilton, S. D. & Flanigan, K. M. 2008. DMD pseudoexon

mutations: splicing efficiency, phenotype, and potential therapy. Ann Neurol,

63(1): 81-89.

Gygi, S. P., Zhou, Z., Licklider, L. J. & Reed, R. 2002. Comprehensive proteomic

analysis of the human spliceosome. Nature, 419(6903): 182-185.

Hamid, F. M. & Makeyev, E. V. 2014. Regulation of mRNA abundance by

polypyrimidine tract-binding protein-controlled alternate 5' splice site choice.

PLoS genetics, 10(11): e1004771. doi:1004710.1001371/journal.pgen.1004771.

Reference

112

Harding, P. L., Fall, A. M., Honeyman, K., Fletcher, S. & Wilton, S. D. 2007. The

influence of antisense oligonucleotide length on dystrophin exon skipping. Mol

Ther, 15(1): 157-166.

Heemskerk, H. A., De Winter, C. L., De Kimpe, S. J., Van Kuik-Romeijn, P.,

Heuvelmans, N., Platenburg, G. J., Van Ommen, G. J., Van Deutekom, J. C. &

Aartsma-Rus, A. 2009. In vivo comparison of 2'-O-methyl phosphorothioate and

morpholino antisense oligonucleotides for Duchenne muscular dystrophy exon

skipping. J Gene Med, 11(3): 257-266.

Hiller, M., Zhang, Z., Backofen, R. & Stamm, S. 2007. Pre-mRNA secondary structures

influence exon recognition. PLoS Genet, 3(11): e204.

Homolova, K., Zavadakova, P., Doktor, T. K., Schroeder, L. D., Kozich, V. & Andresen,

B. S. 2010. The deep intronic c.903+469T>C mutation in the MTRR gene

creates an SF2/ASF binding exonic splicing enhancer, which leads to

pseudoexon activation and causes the cblE type of homocystinuria. Human

mutation, 31(4): 437-444.

Hua, Y., Sahashi, K., Hung, G., Rigo, F., Passini, M. A., Bennett, C. F. & Krainer, A. R.

2010. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a

type III SMA mouse model. Genes and Development, 24(15): 1634-1644.

Hube, F. & Francastel, C. 2015. Mammalian Introns: When the Junk Generates

Molecular Diversity. Int J Mol Sci, 16(3): 4429-4452.

Hutton, M., Lendon, C. L., Rizzu, P., Baker, M., Froelich, S., Houlden, H., Pickering-

Brown, S., Chakraverty, S., Isaacs, A., Grover, A., Hackett, J., Adamson, J.,

Lincoln, S., Dickson, D., Davies, P., Petersen, R. C., Stevens, M., De Graaff, E.,

Wauters, E., Van Baren, J., Hillebrand, M., Joosse, M., Kwon, J. M., Nowotny,

P., Che, L. K., Norton, J., Morris, J. C., Reed, L. A., Trojanowski, J., Basun, H.,

Lannfelt, L., Neystat, M., Fahn, S., Dark, F., Tannenberg, T., Dodd, P. R.,

Hayward, N., Kwok, J. B., Schofield, P. R., Andreadis, A., Snowden, J.,

Craufurd, D., Neary, D., Owen, F., Oostra, B. A., Hardy, J., Goate, A., Van

Swieten, J., Mann, D., Lynch, T. & Heutink, P. 1998. Association of missense

and 5'-splice-site mutations in tau with the inherited dementia FTDP-17. Nature,

393(6686): 702-705.

Hyvonen, M. T., Uimari, A., Keinanen, T. A., Heikkinen, S., Pellinen, R., Wahlfors, T.,

Korhonen, A., Narvanen, A., Wahlfors, J., Alhonen, L. & Janne, J. 2006.

Polyamine-regulated unproductive splicing and translation of

spermidine/spermine N1-acetyltransferase. RNA, 12(8): 1569-1582.

Reference

113

Ichtchenko, K., Hata, Y., Nguyen, T., Ullrich, B., Missler, M., Moomaw, C. & Sudhof,

T. C. 1995. Neuroligin 1: a splice site-specific ligand for beta-neurexins. Cell,

81(3): 435-443.

Kalsotra, A., Wang, K., Li, P. F. & Cooper, T. A. 2010. MicroRNAs coordinate an

alternative splicing network during mouse postnatal heart development. Genes

Dev, 24(7): 653-658.

Keil, J. M., Seo, J., Howell, M. D., Hsu, W. H., Singh, R. N. & Didonato, C. J. 2014. A

short antisense oligonucleotide ameliorates symptoms of severe mouse models

of spinal muscular atrophy. Mol Ther Nucleic Acids, 3: e174.

doi:110.1038/mtna.2014.1023.

Khaladkar, M., Buckley, P. T., Lee, M. T., Francis, C., Eghbal, M. M., Chuong, T.,

Suresh, S., Kuhn, B., Eberwine, J. & Kim, J. 2013. Subcellular RNA sequencing

reveals broad presence of cytoplasmic intron-sequence retaining transcripts in

mouse and rat neurons. PLoS One, 8(10): e76194.

doi:76110.71371/journal.pone.0076194.

Khelifi, M. M., Ishmukhametova, A., Khau Van Kien, P., Thorel, D., Mechin, D.,

Perelman, S., Pouget, J., Claustres, M. & Tuffery-Giraud, S. 2011. Pure intronic

rearrangements leading to aberrant pseudoexon inclusion in dystrophinopathy: a

new class of mutations? Hum Mutat, 32(4): 467-475.

Kishore, S. & Stamm, S. 2006. The snoRNA HBII-52 Regulates Alternative Splicing of

the Serotonin Receptor 2C. Science, 311(5758): 230-232.

Kollberg, G., Tulinius, M., Melberg, A., Darin, N., Andersen, O., Holmgren, D.,

Oldfors, A. & Holme, E. 2009. Clinical manifestation and a new ISCU mutation

in iron-sulphur cluster deficiency myopathy. Brain, 132(Pt 8): 2170-2179.

Krecic, A. M. & Swanson, M. S. 1999. hnRNP complexes: composition, structure, and

function. Current opinion in cell biology, 11(3): 363-371.

Lareau, L. F., Brooks, A. N., Soergel, D. a. W., Meng, Q. & Brenner, S. E. 2007. The

coupling of alternative splicing and nonsense-mediated mRNA decay. In

Alternative splicing in the postgenomic era, edited by Benjamin J. Blencowe and

Brenton R. Graveley, 190-212. Landes Bioscience.

Le Hir, H., Charlet-Berguerand, N., De Franciscis, V. & Thermes, C. 2002. 5'-End RET

splicing: absence of variants in normal tissues and intron retention in

pheochromocytomas. Oncology, 63(1): 84-91.

Reference

114

Lewis, B. P., Green, R. E. & Brenner, S. E. 2003. Evidence for the widespread coupling

of alternative splicing and nonsense-mediated mRNA decay in humans. Proc

Natl Acad Sci U S A, 100(1): 189-192.

Li, Q., Lee, J. A. & Black, D. L. 2007. Neuronal regulation of alternative pre-mRNA

splicing. Nat Rev Neurosci, 8(11): 819-831.

Licatalosi, D. D. & Darnell, R. B. 2006. Splicing Regulation in Neurologic Disease.

Neuron, 52(1): 93-101.

Lim, S. R. & Hertel, K. J. 2001. Modulation of survival motor neuron pre-mRNA

splicing by inhibition of alternative 3' splice site pairing. J Biol Chem, 276(48):

45476-45483.

Lokody, I. 2014. Alternative splicing: aberrant splicing promotes colon tumour growth.

Nat Rev Cancer, 14(6): 382-383.

Lu, Q. L., Cirak, S. & Partridge, T. 2014. What Can We Learn From Clinical Trials of

Exon Skipping for DMD? Molecular Therapy-Nucleic Acids, 3(3): e152.

doi:110.1038/mtna.2014.1036.

Luco, R. F. & Misteli, T. 2011. More than a splicing code: integrating the role of RNA,

chromatin and non-coding RNA in alternative splicing regulation. Current

opinion in genetics & development, 21(4): 366-372.

Madden, H. R., Fletcher, S., Davis, M. R. & Wilton, S. D. 2009. Characterization of a

complex Duchenne muscular dystrophy-causing dystrophin gene inversion and

restoration of the reading frame by induced exon skipping. Human mutation,

30(1): 22-28.

Madocsai, C., Lim, S. R., Geib, T., Lam, B. J. & Hertel, K. J. 2005. Correction of

SMN2 Pre-mRNA splicing by antisense U7 small nuclear RNAs. Molecular

Therapy, 12(6): 1013-1022.

Manley, J. L. & Tacke, R. 1996. SR proteins and splicing control. Genes and

Development, 10(13): 1569-1579.

Mann, C. J., Honeyman, K., Cheng, A. J., Ly, T., Lloyd, F., Fletcher, S., Morgan, J. E.,

Partridge, T. A. & Wilton, S. D. 2001. Antisense-induced exon skipping and

synthesis of dystrophin in the mdx mouse. Proc Natl Acad Sci U S A, 98(1): 42-

47.

Mann, C. J., Honeyman, K., Mcclorey, G., Fletcher, S. & Wilton, S. D. 2002. Improved

antisense oligonucleotide induced exon skipping in the mdx mouse model of

muscular dystrophy. J Gene Med, 4(6): 644-654.

Reference

115

Manning, J. & O’malley, D. 2015. What has the mdx mouse model of duchenne

muscular dystrophy contributed to our understanding of this disease? Journal of

muscle research and cell motility, 36(2): 155-167.

Mansilla, A., Lopez-Sanchez, C., De La Rosa, E. J., Garcia-Martinez, V., Martinez-

Salas, E., De Pablo, F. & Hernandez-Sanchez, C. 2005. Developmental

regulation of a proinsulin messenger RNA generated by intron retention. EMBO

Rep, 6(12): 1182-1187.

Mendell, J. R., Rodino-Klapac, L. R., Sahenk, Z., Roush, K., Bird, L., Lowes, L. P.,

Alfano, L., Gomez, A. M., Lewis, S., Kota, J., Malik, V., Shontz, K., Walker, C.

M., Flanigan, K. M., Corridore, M., Kean, J. R., Allen, H. D., Shilling, C., Melia,

K. R., Sazani, P., Saoud, J. B., Kaye, E. M. & Eteplirsen Study, G. 2013.

Eteplirsen for the treatment of Duchenne muscular dystrophy. Ann Neurol, 74(5):

637-647.

Michael, I. P., Kurlender, L., Memari, N., Yousef, G. M., Du, D., Grass, L., Stephan, C.,

Jung, K. & Diamandis, E. P. 2005. Intron Retention: A Common Splicing Event

within the Human Kallikrein Gene Family. Clinical chemistry, 51(3): 506-515.

Mitrpant, C., Porensky, P., Zhou, H., Price, L., Muntoni, F., Fletcher, S., Wilton, S. D.

& Burghes, A. H. 2013. Improved antisense oligonucleotide design to suppress

aberrant SMN2 gene transcript processing: towards a treatment for spinal

muscular atrophy. PLoS One, 8(4):

e62114.doi:62110.61371/journal.pone.0062114.

Mollet, I. G., Ben-Dov, C., Felicio-Silva, D., Grosso, A. R., Eleuterio, P., Alves, R.,

Staller, R., Silva, T. S. & Carmo-Fonseca, M. 2010. Unconstrained mining of

transcript data reveals increased alternative splicing complexity in the human

transcriptome. Nucleic Acids Res, 38(14): 4740-4754.

Muchir, A., Bonne, G., Van Der Kooi, A. J., Van Meegen, M., Baas, F., Bolhuis, P. A.,

De Visser, M. & Schwartz, K. 2000. Identification of mutations in the gene

encoding lamins A/C in autosomal dominant limb girdle muscular dystrophy

with atrioventricular conduction disturbances (LGMD1B). Hum Mol Genet, 9(9):

1453-1459.

Muntoni, F., Torelli, S. & Ferlini, A. 2003. Dystrophin and mutations: one gene, several

proteins, multiple phenotypes. Lancet Neurology, 2(12): 731-740.

Norris, A. D. & Calarco, J. A. 2012. Emerging Roles of Alternative Pre-mRNA

Splicing Regulation in Neuronal Development and Function. Front Neurosci,

6.doi: 10.3389/fnins.2012.00122.

Reference

116

Osman, E. Y., Miller, M. R., Robbins, K. L., Lombardi, A. M., Atkinson, A. K., Brehm,

A. J. & Lorson, C. L. 2014. Morpholino antisense oligonucleotides targeting

intronic repressor Element1 improve phenotype in SMA mouse models. Hum

Mol Genet, 23(18): 4832-4845.

Osman, E. Y., Yen, P.-F. & Lorson, C. L. 2012. Bifunctional RNAs targeting the

intronic splicing silencer N1 increase SMN levels and reduce disease severity in

an animal model of spinal muscular atrophy. Molecular Therapy, 20(1): 119-126.

Osorio, F. G., Navarro, C. L., Cadinanos, J., Lopez-Mejia, I. C., Quiros, P. M., Bartoli,

C., Rivera, J., Tazi, J., Guzman, G., Varela, I., Depetris, D., De Carlos, F., Cobo,

J., Andres, V., De Sandre-Giovannoli, A., Freije, J. M., Levy, N. & Lopez-Otin,

C. 2011. Splicing-directed therapy in a new mouse model of human accelerated

aging. Sci Transl Med, 3(106): 106ra107.

Palhais, B., Praestegaard, V. S., Sabaratnam, R., Doktor, T. K., Lutz, S., Burda, P.,

Suormala, T., Baumgartner, M., Fowler, B., Bruun, G. H., Andersen, H. S.,

Kozich, V. & Andresen, B. S. 2015. Splice-shifting oligonucleotide (SSO)

mediated blocking of an exonic splicing enhancer (ESE) created by the prevalent

c.903+469T>C MTRR mutation corrects splicing and restores enzyme activity

in patient cells. Nucleic Acids Res, doi: 10.1093/nar/gkv275.

Pan, Q., Shai, O., Lee, L. J., Frey, B. J. & Blencowe, B. J. 2008. Deep surveying of

alternative splicing complexity in the human transcriptome by high-throughput

sequencing. Nat Genet, 40(12): 1413-1415.

Passini, M. A., Bu, J., Richards, A. M., Kinnecom, C., Sardi, S. P., Stanek, L. M., Hua,

Y. M., Rigo, F., Matson, J., Hung, G., Kaye, E. M., Shihabuddin, L. S., Krainer,

A. R., Bennett, C. F. & Cheng, S. H. 2011. Antisense Oligonucleotides

Delivered to the Mouse CNS Ameliorate Symptoms of Severe Spinal Muscular

Atrophy. Science Translational Medicine, 3(72): 72ra18.

Petruzzella, V., Panelli, D., Torraco, A., Stella, A. & Papa, S. 2005. Mutations in the

NDUFS4 gene of mitochondrial complex I alter stability of the splice variants.

FEBS Lett, 579(17): 3770-3776.

Porensky, P. N., Mitrpant, C., Mcgovern, V. L., Bevan, A. K., Foust, K. D., Kaspar, B.

K., Wilton, S. D. & Burghes, A. H. M. 2012. A single administration of

morpholino antisense oligomer rescues spinal muscular atrophy in mouse.

Human molecular genetics, 21(7): 1625-1638.

Pros, E., Fernandez-Rodriguez, J., Canet, B., Benito, L., Sanchez, A., Benavides, A.,

Ramos, F. J., Lopez-Ariztegui, M. A., Capella, G., Blanco, I., Serra, E. & Lazaro,

C. 2009. Antisense therapeutics for neurofibromatosis type 1 caused by deep

intronic mutations. Hum Mutat, 30(3): 454-462.

Reference

117

Quesnel-Vallieres, M., Irimia, M., Cordes, S. P. & Blencowe, B. J. 2015. Essential roles

for the splicing regulator nSR100/SRRM4 during nervous system development.

Genes Dev, 29(7): 746-759.

Rando, T. A. & Blau, H. M. 1994. Primary mouse myoblast purification,

characterization, and transplantation for cell-mediated gene therapy. J Cell Biol,

125(6): 1275-1287.

Rimoldi, V., Solda, G., Asselta, R., Spena, S., Stuani, C., Buratti, E. & Duga, S. 2013.

Dual role of G-runs and hnRNP F in the regulation of a mutation-activated

pseudoexon in the fibrinogen gamma-chain transcript. PLoS One, 8(3): e59333.

doi:59310.51371/journal.pone.0059333.

Sakabe, N. J. & De Souza, S. J. 2007. Sequence features responsible for intron retention

in human. BMC Genomics, 8: 59.

Sanaker, P. S., Toompuu, M., Mcclorey, G. & Bindoff, L. A. 2012. Antisense

oligonucleotide corrects splice abnormality in hereditary myopathy with lactic

acidosis. Gene, 494(2): 231-236.

Shepard, P. J. & Hertel, K. J. 2009. The SR protein family. Genome Biol, 10(10): 242.

Singh, N. K., Singh, N. N., Androphy, E. J. & Singh, R. N. 2006. Splicing of a critical

exon of human Survival Motor Neuron is regulated by a unique silencer element

located in the last intron. Mol Cell Biol, 26(4): 1333-1346.

Singh, N. N., Lawler, M. N., Ottesen, E. W., Upreti, D., Kaczynski, J. R. & Singh, R. N.

2013. An intronic structure enabled by a long-distance interaction serves as a

novel target for splicing correction in spinal muscular atrophy. Nucleic acids

research, 41(17): 8144-8165.

Singh, N. N., Lee, B. M. & Singh, R. N. 2015. Splicing regulation in spinal muscular

atrophy by an RNA structure formed by long-distance interactions. Ann N Y

Acad Sci, 1341: 176-187.

Sivanesan, S., Howell, M. D., Didonato, C. J. & Singh, R. N. 2013. Antisense

oligonucleotide mediated therapy of spinal muscular atrophy. Transl Neurosci, 4.

doi:10.2478/s13380-013-0109-2.

Spena, S., Asselta, R., Plate, M., Castaman, G., Duga, S. & Tenchini, M. L. 2007.

Pseudo-exon activation caused by a deep-intronic mutation in the fibrinogen

gamma-chain gene as a novel mechanism for congenital afibrinogenaemia.

British journal of haematology, 139(1): 128-132.

Reference

118

Staropoli, J. F., Li, H., Chun, S. J., Allaire, N., Cullen, P., Thai, A., Fleet, C. M., Hua,

Y., Bennett, C. F., Krainer, A. R., Kerr, D., Mccampbell, A., Rigo, F. & Carulli,

J. P. 2015. Rescue of gene-expression changes in an induced mouse model of

spinal muscular atrophy by an antisense oligonucleotide that promotes inclusion

of SMN2 exon 7. Genomics, 105(4): 220-228.

Stévenin, J., Soret, J., Dooghe, Y., Sureau, A. & Gattoni, R. 2001. SC35 autoregulates

its expression by promoting splicing events that destabilize its mRNAs. The

EMBO journal, 20(7): 1785-1796.

Sud, R., Geller, E. T. & Schellenberg, G. D. 2014. Antisense-mediated Exon Skipping

Decreases Tau Protein Expression: A Potential Therapy For Tauopathies. Mol

Ther Nucleic Acids, 3: e180. doi:110.1038/mtna.2014.1030.

Sugnet, C. W., Kent, W. J., Ares, J. M. & Haussler, D. 2004. Transcriptome and

genome conservation of alternative splicing events in humans and mice. Pacific

Symposium on Biocomputing.Pacific Symposium on Biocomputing: 66.

Tan, S., Guo, J., Huang, Q., Chen, X., Li-Ling, J., Li, Q. & Ma, F. 2007. Retained

introns increase putative microRNA targets within 3' UTRs of human mRNA.

FEBS Lett, 581(6): 1081-1086.

Tuffery-Giraud, S., Saquet, C., Chambert, S. & Claustres, M. 2003. Pseudoexon

activation in the DMD gene as a novel mechanism for Becker muscular

dystrophy. Hum Mutat, 21(6): 608-614.

Turano, M., Angrisani, A., Di Maio, N. & Furia, M. 2013. Intron retention: a human

DKC1 gene common splicing event. Biochem Cell Biol, 91(6): 506-512.

Unsworth, B. R., Hayman, G. T., Carroll, A. & Lelkes, P. I. 1999. Tissue-specific

alternative mRNA splicing of phenylethanolamine N-methyltransferase (PNMT)

during development by intron retention. Int J Dev Neurosci, 17(1): 45-55.

Van Deutekom, J. C. T., Bremmer-Bout, M., Janson, A. a. M., Ginjaar, I. B., Baas, F.,

Den Dunnen, J. T. & Van Ommen, G.-J. B. 2001. Antisense-induced exon

skipping restores dystrophin expression in DMD patient derived muscle cells.

Human molecular genetics, 10(15): 1547-1554.

Van Vliet, L., De Winter, C. L., Van Deutekom, J. C., Van Ommen, G. J. & Aartsma-

Rus, A. 2008. Assessment of the feasibility of exon 45-55 multiexon skipping

for Duchenne muscular dystrophy. BMC Med Genet, 9: 105. doi:110.1186/1471-

2350-1189-1105.

Reference

119

Voit, T., Topaloglu, H., Straub, V., Muntoni, F., Deconinck, N., Campion, G., De

Kimpe, S. J., Eagle, M., Guglieri, M., Hood, S., Liefaard, L., Lourbakos, A.,

Morgan, A., Nakielny, J., Quarcoo, N., Ricotti, V., Rolfe, K., Servais, L.,

Wardell, C., Wilson, R., Wright, P. & Kraus, J. E. 2014. Safety and efficacy of

drisapersen for the treatment of Duchenne muscular dystrophy (DEMAND II):

an exploratory, randomised, placebo-controlled phase 2 study. Lancet Neurol,

13(10): 987-996.

Wang, E. T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., Kingsmore, S.

F., Schroth, G. P. & Burge, C. B. 2008. Alternative isoform regulation in human

tissue transcriptomes. Nature, 456(7221): 470-476.

Wang, Q., Chikina, M. D., Pincas, H. & Sealfon, S. C. 2014. Homer1 alternative

splicing is regulated by gonadotropin-releasing hormone and modulates

gonadotropin gene expression. Mol Cell Biol, 34(10): 1747-1756.

Ward, A. J., Norrbom, M., Chun, S., Bennett, C. F. & Rigo, F. 2014. Nonsense-

mediated decay as a terminating mechanism for antisense oligonucleotides.

Nucleic acids research, 42(9): 5871-5879.

Will, C. L. & Luhrmann, R. 2011. Spliceosome structure and function. Cold Spring

Harb Perspect Biol, 3:a003707. doi: 10.1101/cshperspect.a003707.

Williams, J. H., Schray, R. C., Patterson, C. A., Ayitey, S. O., Tallent, M. K. & Lutz, G.

J. 2009. Oligonucleotide-mediated survival of motor neuron protein expression

in CNS improves phenotype in a mouse model of spinal muscular atrophy. J

Neurosci, 29(24): 7633-7638.

Willmann, R., Possekel, S., Dubach-Powell, J., Meier, T. & Ruegg, M. A. 2009.

Mammalian animal models for Duchenne muscular dystrophy. Neuromuscul

Disord, 19(4): 241-249.

Wilton, S. D., Fall, A. M., Harding, P. L., Mcclorey, G., Coleman, C. & Fletcher, S.

2007. Antisense oligonucleotide-induced exon skipping across the human

dystrophin gene transcript. Mol Ther, 15(7): 1288-1296.

Wollerton, M. C., Gooding, C., Wagner, E. J., Garcia-Blanco, M. A. & Smith, C. W.

2004. Autoregulation of polypyrimidine tract binding protein by alternative

splicing leading to nonsense-mediated decay. Mol Cell, 13(1): 91-100.

Wong, J. J., Ritchie, W., Ebner, O. A., Selbach, M., Wong, J. W., Huang, Y., Gao, D.,

Pinello, N., Gonzalez, M., Baidya, K., Thoeng, A., Khoo, T. L., Bailey, C. G.,

Holst, J. & Rasko, J. E. 2013. Orchestrated intron retention regulates normal

granulocyte differentiation. Cell, 154(3): 583-595.

Reference

120

Xiao, S., Tjostheim, S., Sanelli, T., Mclean, J. R., Horne, P., Fan, Y., Ravits, J., Strong,

M. J. & Robertson, J. 2008. An Aggregate-Inducing Peripherin Isoform

Generated through Intron Retention Is Upregulated in Amyotrophic Lateral

Sclerosis and Associated with Disease Pathology. Journal of Neuroscience,

28(8): 1833-1840.

Xu, Q., Walker, D., Bernardo, A., Brodbeck, J., Balestra, M. E. & Huang, Y. 2008.

Intron-3 retention/splicing controls neuronal expression of apolipoprotein E in

the CNS. J Neurosci, 28(6): 1452-1459.

Xu, W., Yang, X., Hu, X. & Li, S. 2014. Fifty-four novel mutations in the NF1 gene

and integrated analyses of the mutations that modulate splicing. Int J Mol Med,

34(1): 53-60.

Yap, K., Lim, Z. Q., Khandelia, P., Friedman, B. & Makeyev, E. V. 2012. Coordinated

regulation of neuronal mRNA steady-state levels through developmentally

controlled intron retention. Genes and Development, 26(11): 1209-1223.

Yuste-Checa, P., Medrano, C., Gamez, A., Desviat, L. R., Matthijs, G., Ugarte, M.,

Perez-Cerda, C. & Perez, B. 2015. Antisense-mediated therapeutic pseudoexon

skipping in TMEM165-CDG. Clin Genet, 87(1): 42-48.

Zheng, C. L., Fu, X. D. & Gribskov, M. 2005. Characteristics and regulatory elements

defining constitutive splicing and different modes of alternative splicing in

human and mouse. RNA, 11(12): 1777-1787.

Zheng, S. & Black, D. L. 2013. Alternative pre-mRNA splicing in neurons: growing up

and extending its reach. Trends Genet, 29(8): 442-448.

Zheng, S., Gray, E. E., Chawla, G., Porse, B. T., O'dell, T. J. & Black, D. L. 2012. PSD-

95 is post-transcriptionally repressed during early neural development by PTBP1

and PTBP2. Nature neuroscience, 15(3): 381-389.

Zhou, H., Janghra, N., Mitrpant, C., Dickinson, R. L., Anthony, K., Price, L., Eperon, I.

C., Wilton, S. D., Morgan, J. & Muntoni, F. 2013. A novel morpholino oligomer

targeting ISS-N1 improves rescue of severe spinal muscular atrophy transgenic

mice. Hum Gene Ther, 24(3): 331-342.

Appendix

121

Appendix

A. Recipes

0.5M EDTA (pH8)

186.1g EDTA

800ml Milli-Q water

50x TAE

484g Trizma Base

114.2ml glacial acetic acid

200ml 0.5M EDTA (pH8)

Make up to final volume of 2L with Milli-Q water.

Adjust pH to 8.2 using acetic acid.

1x TAE

400ml 50x TAE

Make up to a final volume of 20L using Milli-Q water.

1x PBS

16g NaCl

0.4g KCl

2.88g Na2HPO4

0.48g KH2PO4

Make up to a final volume of 2L using Milli-Q water.

Adjust pH to 7.4 using HCl.

Autoclave on liquid cycle.

10x PBS

80g NaCl

2g KCl

14.4g Na2HPO4

2.4g KH2PO4

Dissolve the salts in 800ml Milli-Q water.

Make up to a final volume of 1L.

Appendix

122

1% Agarose Gel

4.0g agarose

400ml 1x TAE

2% Agarose Gel

8.0g agarose

400ml 1x TAE

RedSafe Staining Solution

10µl Red SafeTM

nucleic acid staining solution

250ml 1x TAE

Ethidium Bromide Staining Solution

10 µl ethidium bromide (10mg/ml)

100ml 1x TAE

Appendix

123

0

0.02

0.04

0.06

0.08

0.1

0.12

0.14

0.16

0.18

50nM 25nM 12.5nM 50nM 25nM 12.5nM 50nM 25nM 12.5nM

ITGA4_H28A(-6+19) ITGA4_H28A(+20+44) ITGA4_H28A(+45+69)

Pro

po

rtio

n

L3K (24h)

L3K (48h)

Figure B1 Proportions of ITGA4 transcripts with retained terminal intron in normal human fibroblasts transfected with ITGA4-targeting 2’-OMeAOs using Lipofectamine® 3000 transfection reagent. The proportions of terminal intron retaining ITGA4 transcripts present after 24 hours and 48 hours of transfection were compared. Except for one anomaly (12.5nM ITGA4_H28A(-6+19)), the proportion of ITGA4 transcripts

with retained terminal intron decreased with longer transfection duration.

B. Comparison of ITGA4 transcripts with retained terminal intron in L3K

transfections.

Appendix

124

C. Splicing Motif Analyses

Putative motifs within targeted sites of each gene transcripts that splicing factors bind to are identified

using the online software, SpliceAid 2 (http://193.206.120.249/splicing_tissue.html). Positions of each AO

designed to target each gene transcript examined in this project are shown. Both AOs that induced

terminal intron retention (underlined) and AOs that did not (not underlined), cover exonic splicing

enhancers such as SR proteins and Tra2β binding sites.

http://193.206.120.249/splicing_tissue.html

Appendix

125

LM

NA

_H12

A(-

16+

9)

LM

NA

_H12

A(+

10+

34)

LM

NA

_H12

A(+

35+

59)

LM

NA

_H12

A(+

60+

84)

i.

LM

NA

Appendix

126

ii.

LM

NC

LM

NC

_H10

A(-

10+

15)

LM

NC

_H10

A(+

16+

40)

LM

NC

_H10

A(+

41+

65)

LM

NC

_H10

A(+

66+

90)

Appendix

127

iii.

IT

GA

4

ITG

A4_

H28

A(-

6+19

) IT

GA

4_H

28A

(+20

+44

) IT

GA

4_H

28A

(+45

+69

) IT

GA

4_H

28A

(+70

+94

)

Appendix

128

SO

D1_

H5A

(-5+

20)

SO

D1_

H5A

(+21

+45

) S

OD

1_H

5A(+

46+

70)

SO

D1_

H5A

(+71

+95

)

SO

D1_

H5A

(+14

+38

)

SO

D1_

H5A

(+18

+42

)

SO

D1_

H5A

(+24

+48

)

iv. S

OD

1

Appendix

129

SO

D1_

H4A

(+99

-5)

SO

D1_

H4A

(+10

8-14

)

Appendix

130

v. D

MD

DM

D_H

79A

(-9+

16)

DM

D_H

79A

(+17

+41

) D

MD

_H79

A(+

42+

66)

DM

D_H

79A

(+67

+91

)

Appendix

131

D. Splice Site Scores

Table D1 Splice site scores of the terminal intron’s donor and acceptor splice sites. The scores were calculated using Human Splicing Finder, version 3.0 (http://www.umd.be/HSF3/HSF.html).

Gene Transcript

(Terminal) Intron

Splice site type

Motif New potential splice

site Consensus

value (0-100)

SMN* 7 Donor GGAgtaagt GGAgtaagt 82.81

Acceptor tctcatttgcagGA tctcatttgcagGA 91.9

LMNA^ 11 Donor CAGgtgagt CAGgtgagt 98.84

Acceptor tttctctcttagAG tttctctcttagAG 84.59

LMNC* 9 Donor GAAgtaagt GAAgtaagt 87.66

Acceptor tgtccccaccagGA tgtccccaccagGA 90.83

ITGA4* 27 Donor AAGgtaagc AAGgtaagc 96.87

Acceptor tgctattttcagGC tgctattttcagGC 90.45

SOD1 4 Donor GTGgtaagt GTGgtaagt 93.49

Acceptor aattttttacagGT aattttttacagGT 90.5

DMD 78 Donor GAGgttagt GAGgttagt 93.22

Acceptor tttgttttccagGA tttgttttccagGA 94.45 * terminal intron retention is evident

^ terminal intron retention is suspected

Appendix

132

E. ESE and ESS Densities of Terminal Intron

Table E1 Density of RESCUE-ESEs within the terminal intron of the 5 gene transcripts chosen for the

project. The number of RESCUE-ESE motifs was determined using the RESCUE-ESE web server

(http://genes.mit.edu/burgelab/rescue-ese/).

Gene Transcript

RESCUE-ESEs Terminal Intron Length Density

(no. of ESE motifs/nucleotide)

LMNA 5 322nt 0.0155

LMNC 25 421nt 0.0594

ITGA4 28 496nt 0.0565

SOD1 76 1095nt 0.0694

DMD 410 4711nt 0.0870

Table E2 Density of SELEX-ESEs within the terminal intron of the 5 gene transcripts chosen for the project. The number of SELEX-ESE motifs was determined using ESEfinder3.0 (http://rulai.cshl.edu/cgi-bin/tools/ESE3/esefinder.cgi?process=home).

Gene Transcript

SELEX-ESEs Terminal Intron Length

Density (no. of ESE

motifs/nucleotide) SF2/ASF SC35 SRp40 SRp55

LMNA 17 16 14 9 322nt 0.1739

LMNC 21 24 25 11 421nt 0.1924

ITGA4 8 13 18 10 496nt 0.0988

SOD1 16 25 34 18 1095nt 0.0849

DMD 100 123 168 101 4711nt 0.1044

Table E3 Density of Class 2 FAS-ESSs within the terminal intron of the 5 gene transcripts chosen for the

project. The number of FAS-ESS motifs was determined using the FAS-ESS web server

(http://genes.mit.edu/fas-ess/).

Gene Transcript

FAS-ESSs Terminal Intron Length Density

(no. of ESS motifs/nucleotide)

LMNA 31 322nt 0.0963

LMNC 15 421nt 0.0356

ITGA4 9 496nt 0.0181

SOD1 37 1095nt 0.0338

DMD 88 4711nt 0.0187

manipulating splicing by inducing terminal intron...

Documents