Proc. Nail. Acad. Sci. USAVol. 89, pp. 11886-11890, December 1992Evolution

Major histocompatibility complex class II genes of zebrafishHIDEKI ONOtt, DAGMAR KLEIN§, VLADIMIR VINCEK§, FELIPE FIGUEROAt, COLM O'HUIGINt,HERBERT TICHYt, AND JAN KLEINt§tMax-Planck-Institut fur Biologie, Abteilung Immungenetik, 7400 Tfibingen, Federal Republic of Germany; and §Department of Microbiology and Immunology,University of Miami School of Medicine, Miami, FL 33101

Communicated by Max D. Cooper, August 21, 1992 (receivedfor review July 17, 1992)

ABSTRACT Twenty cDNA clones derived from b-chaln-encoding class H genes of the zebrafish (Brachydanio rerio)major histocompatibility complex (MHC) have been se-quenced. They fall into three groups identying three loci ofexpressed genes. The length and organization ofthese genes aresimilar to those of their mammiln homologs. Ampficationby polymerase chain reaction and sequencing of eic DNAfrom zebrafish collected at different locations in India indicatethe existence of a fourth group of sequences (fourth locus). Ahigh degree of polymorphism at the B. rerio MHC loci andconcentration of variability to the putative peptide-bindingregion of the (l1-domain-encoding part of the gene are alsoindicated. Large genetic distances between aleles suggetrans-specific evolution of fishMHC polymorphism. Zebrafshgenes appear to be derived from a different ancestor than thevarious class II gene families of other vertebrates. In spite ofgreat sequence divergence between fish and mammalian MHCgenes, there seems to be a strking conservation in their overallorganization.

The mammalian major histocompatibility complex (MHC) isa cluster of genes that encode cell-surface receptors capableof binding short self and nonself peptides (1, 2). MHCreceptors occupied by nonselfpeptides are in turn recognizedby T-cell receptors of thymus-derived lymphocytes and thisrecognition initiates the specific immune response. The MHCmolecules are heterodimers consisting ofa and ,8 polypeptidechains. The molecules fall into two classes (I and II), whichdiffer in their structure, tissue distribution, and function. Thea and ( chains of the class II molecules are both membranebound, they are predominantly expressed on lymphocytes,and they preferentially present nonselfpeptides to a subset ofT lymphocytes, the helper T cells. In the class I molecules,on the other hand, only the a chain is membrane bound, themolecules are ubiquitously distributed, and they preferen-tially present antigenic peptides to another subset of Tlymphocytes, the cytotoxic T cells. A typical class II geneconsists of exons encoding the leader peptide, the twoexternal (al and a2 or (31 and (2) domains, the transmem-brane region, and the cytoplasmic tail. The peptide-presenting function is carried out by a specialized peptide-binding region (PBR) assembled from the amino acid residuesof the al and (31 domains and encoded in exon 2 of thecorresponding genes (3, 4). The PBR sites of the functionalMHC genes vary considerably among individuals ofthe samespecies. This MHC polymorphism is characterized by twofeatures-a large number of alleles at a given functional locusand a large number of nucleotide differences between someof the alleles (5). Recent data indicate that the polymorphicdifferences accumulate over periods oftime much longer thanthe life span of a species and that they are passed on fromancestral to emerging species during speciation (6, 7). The

trans-species MHC polymorphism is driven by positive se-lection at the PBR sites (8, 9).

In addition to mammals, MHC genes have also beenisolated in birds (10, 11), amphibians (12), reptiles (13), bonyfishes (14), and cartilaginous fishes (15, 16). However, infor-mation about the functionally important features of thenonmammalian genes is lacking. It is not known, for exam-ple, whether the MHC genes oflower vertebrates function inthe same way as mammalian genes or whether differentvertebrate classes have found different solutions for themechanism of antigen presentation. This question is partic-ularly pertinent in the face of data indicating that differentvertebrate classes differ in the manner in which they generatediversity of immunoglobulin molecules, evolutionarily andfunctionally related to the MHC molecules (17). In thepresent study, we have therefore attempted to answer thisquestion by characterizing the class II genes of a teleost(bony fish), Brachydanio rerio, the zebrafish.1 We havechosen this particular species because it offers many advan-tages for genetic analysis and is rapidly becoming a popularexperimental model in a variety of studies (18).

MATERIALS AND METHODSFisbes. Zebrafish (B. rerio) were obtained from a dealer

(Aquarium Pelz, Tubingen, F.R.G.) and from a laboratorystock at the Max-Planck-Institut faur Entwicklungsbiologie(Tilbingen, F.R.G.). Additional specimens were collected inrivers during an expedition to India in 1991.

Probes and Primers. The SE1 probe is the PCR productobtained with the primers Tu45 and Tu46 and subcloned intothe Bluescript II EcoRV-digested vector. The BC122a probeis a 328-base-pair (bp) EcoRI/Kpn I fragment derived fromcDNA class II clone BC122 and encompassing exons 3-5 ofthe zebrafish class II gene. The BC1241 probe is a cDNAclone encompassing most of exon 2 and the entire 3' part ofthe coding sequence. The PCR primers were as follows:Tu45, 5 '-TG(T/C)(C/A)(G/T)(G/T)G(T/C)C(A/T)(C/A)TG(G/A)(T/C)TTCTA(T/C)CC-3'; Tu46, 5'-(A/G)(A/G)GCTG(G/C)(T/C)GTG(C/A)(T/A)(T/C)CAC(A/C)(T/A)(G/C)(A/G)CA-3'; Tu385, 5'-TGCTGTCG(A/G)CATT-TACTGGAAC-3'; Tu360, 5 'TGCTTTATCACG(G/T)ACAGCTGA-3'; Tu386, 5'-CCAGAGGTAACAATC(C/A)AGTCAGTGA-3'; and Tu387, 5'-CCATTCTTTAGTAA-(T/G)AGGTTGA-3'. The Tu45 and Tu46 primers, based oncarp sequence (14), correspond to exon 3 codons 118-125 and174-181 of the zebrafish class II MHC genes. All otherprimers were designed on the basis of the zebrafish class IIsequences. Primer Tu385 is identical to the nucleotide se-

Abbreviations: MHC, major histocompatibility complex; PBR, pep-tide-binding region.*Permanent address: Department of Dermatology, Yokohama CityUniversity School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yoko-hama 236, Japan.IThe sequences reported in this paper have been deposited in theGenBank data base (accession nos. L04805-L04824).

11886

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 6,

202

0

Proc. Natl. Acad. Sci. USA 89 (1992) 11887

quence of exon 1 codons -5 to +3; Tu360 is complementaryto codons 89-95 of exon 2; Tu386 corresponds to codons98-106 of exon 3; and Tu387 is the reverse sequence of exon3 codons 182-189. Methods of cDNA library constructionand screening, as well as DNA sequencing, are describedelsewhere (19-24).

Construction of Dendrograms. The inferred protein se-quences of Brachydanio cDNA clones were aligned to othervertebrate MHC class II sequences using the CLUSTAL Vcomputer program (25). The percentage amino acid identitybetween aligned sequences was used to construct distancematrices. The evolutionary relationships were then evaluatedby neighbor-joining analysis (26). One hundred bootstrapreplications were performed to determine the reliability of thebranching order.

RESULTS

Characterization of cDNA Clones. To obtain clones derivedfrom zebrafish class 11 3-chain-encoding genes, we screenedtwo cDNA libraries. The screening of the first library withprobe 5E1 produced 21 positive clones, of which 15 were

positive on second screening. Of these, we sequenced 8clones completely, but they all turned out to be truncated andhence provided only partial coding sequences. Screening ofthe second library with probe BC122a produced 55 positiveclones, of which 38 were positive on second screening. Ofthese, we sequenced 12 clones, 5 of which encompassedalmost the entire coding sequence.

Altogether we sequenced 20 cDNA clones (Figs. 1 and 2).Based on sequence similarity, the 20 clones could be dividedinto three groups with intergroup similarity of near completesequences ranging from 88% to 90%6 and intragroup similarity

Group Clone

B 3-2

3X4

BC 122

BC 331

2 9-2

BC 551

B 1-1

B 8-3

B 6-3

B 4.2

1 B 4-4

BC 511

BC 1231

Length (bp)1400

1028

953

895

1392 +

545 +

1358 *

1354 *

1312 *

946 *

915 *

555 *

875 *

BC 1031 911 *

BC 1241 1190 *

L 1l2 ,yI I I I

Eco RI Epn I

3'UT

i---

I .: :

. I

* I ~~(A)n

I ---I (A)n

I . IIA~1 -- 1--

i

Baa HI

FIG. 1. Length of zebrafish cDNA clones analyzed in the presentstudy. Top line indicates known or postulated position of exons (seetext). L, leader peptide; (31 and (32, (31 and (2 domains; TM,transmembrane region; CY, cytoplasmic tail; (A), poly(A) tail.Informative restriction sites are indicated. Length is expressed in bp.In addition to the listed clones, which were fully sequenced, clonesB2-3, B4-1, B1O-1, B12-6, and B13-1 were partially sequenced; thefirst of these was identical to B3-2, whereas the remaining four wereidentical to group 1 clones.

ranging from 99%6 to 100%. Group 1 contained 13 clones(Bl-1, B8-3, B6-3, B4-2, B4-4, BC1241, B10-1, B12-6, B13-1,B4-1, BC511, BC1231, and BC1031), all of which had iden-tical sequences in their regions of overlap. Group 2 containedtwo clones (B9-2 and BC551), which again had identicalsequences in their overlap regions. Group 3 contained twopairs of identical clones (B3-2, B2-3; and BC122, BC331), aswell as clone BC111. The presence of a fourth group isinferred from the intron sequences (see below). We assumethat the groups represent four different loci, which wedesignate Brre-DABI (group 1), Brre-DAB2 (group 2), Brre-DAB3 (group 3), and Brre-DAB4 (group 4). In these symbols,Brre designates B. rerio (27), D is for class II, A is for theparticular family of loci, and B specifies that the loci encode13 chains. Alleles at these loci are designated by two-digitserial numbers separated from the locus symbol by anasterisk.

Exon-intron junctions (indicated by vertical lines in Fig. 2)have been deduced from comparisons with class II sequencesof other vertebrates, with the carp sequence of Hashimotoand co-workers (14), and with the zebrafish class II genomicsequence (see below; H. Sultmann, W. E. Mayer, and J.K.,unpublished data). As in other vertebrates, exon 1 encodes astring of hydrophobic amino acid residues (specified bycodons -1to -16), presumably the leader peptide, as well asthree nonhydrophobic residues, presumably the beginning ofthe (31 domain. Assuming that the ATG at the 5' end of thecDNA clones is the initiation codon, the putative leaderpeptide of the Brre-DAB molecules would be only 16 residueslong, which is shorter than that of most other class II genes(1). It is possible, however, that there is another initiationcodon upstream from -16 that would make the Brre-DABleader peptide longer. Exons 1 and 2 are separated by intron1, which is 200-270 bp long (see below). Exon 2 encodes theremainder of the (1 domain (residues 4-95) and exon 3encodes the (32 domain (residues 96-189). The rest of thecoding sequence specifies a short connecting peptide (resi-dues 190-201), followed by a hydrophobic segment of 19residues, presumably the transmembrane region (specifiedby codons 202-220), and then by 14 largely hydrophilicresidues, presumably the cytoplasmic tail. The 3' untrans-lated region is =650 bp long, ending with a canonical poly-adenylylation signal (AATAAA), followed after an additional11-18 bp by the poly(A) tail.Polymorphism of the Brre-DAB Genes. Genomic DNA was

isolated from different stocks of zebrafish and from fishcollected at different localities in India. The DNA wasamplified by PCR using primers Tu385 and Tu360, as well asTu386 and Tu387. The former pair primed amplification ofsequences extending from the 3' end of exon 1 to the 3' endof exon 2 and included the entire intron 1, whereas the latterpair amplified sequences encompassing most of exon 3. Theamplified fragments were subcloned and sequenced (Fig. 2).The intron 1 sequences (Fig. 2) support the assignment of thecoding sequences to four loci: they fall into four distinctgroups, each group characterized by a specific set of dele-tions and insertions, as well as high intragroup sequencesimilarity. The exon 2 sequences are the most variable of theentire coding segment. To evaluate the distribution of vari-ability a Wu-Kabat plot was produced (Fig. 3). Within theexon, the variability is concentrated into three regions (res-idues 9, 11, and 13; residues 27, 29, 31, and 36; and residues68, 71, 72, and 75). Of the seven most variable residues, sixcorrespond to residues thought to constitute part of the PBRof mammalian genes (4). Sixty-five percent of the variabilityfound in the second exon is associated with residues of theputative PBR. This degree of association is similar to thatfound in functional mammalian MHC class II genes. Puta-tively allelic exon 2 sequences differ by multiple nucleotidesubstitutions (e.g., the Brre-DAB2*01 and Brre-DAB2*04

Evolution: Ono et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 6,

202

0

11888 Evolution: Ono et al. Proc. Natl. Acad. Sci. USA 89 (1992)

Izoul1 -19 -9 -1 1Bzre-DADX1'01 ... GTC AAA AT0 TAT CTG CTA ATA CT? TTT CTT 0CC ATA TTG ATG CTG TCG ACA TTT ACT OQA ACA GjBzre-DAD2*01 .T? --A --T -- ----------- C-- ---- 0- G----0 --I----Brz-e-DAD4*01.....-.-.._T-A C---------C--

Intronl 1 l 11i 21 31 41 51 61 71 81 91 101 111 121B-reo-flB1'01-Gl---------T----G----*TG----G*-AC--T--ATGG--0---------------**CCA0CGGT--T--A-'--GO- T.--Brze-DAB2'02 ----T--------G--*G-' -----*A----C-G-A-TGA----A..---T-T- --'--- -------------

Brre-DAB2'03-Gl----T-------A-T----'*T-----*A----C-G-A-TGA---AA-- .. ---TAT-T--'--'--*-------------C-Bzre-fl&2'03-G2----T--------G--*G -------*A----C-G-A-TGA---A-- ----A- .----.A----TA--------C-Brre-DA82*04 ----T-0------G--*T-'? ----*A----C-G-A-TGA----AA-.'A---TAT-T- ----?--T------------C-Brre-DA&2'05 ----T--------G--*T-'? ----*A----C-0;-A-TGA----C---T-CAT0CC .*****A---TAT-T--' ------o--------C-Brre-DAB3*02 0CAA0AAATACAAAAACTATTQACTT TA GAATCWATAACOT'TT0CTT'OCATOAATTAA?BrBrB30r- -----3-------Brzo-DAB3*O4 -T.------A -A-- --.- - -A .--Brze-DABd'03.-----------G --* .---- *-A---T--CA-TOA .T--A.----A .--------Brre-DAB4*04-0----------G--*T-'----G*-A---T--CA-TA-- T-A.----A---------

131 141 151 161 171 181 191 201 211 221 231 241 251B3xz*-flA1'01-Gl-----.*--.TA.G-G*-AC**-AT-22 -----.Brze-DAD2'02...----- --TA.-----T -**TCG-- .--- ---T.----------Bzre--DAB2*0,3-G1-----T----C_ --C ---'.-------TA-------T---**----*------T----------

Bzze*-DA.2'03-G2 .----T .---C--C-- -------- ---.TA.-----T .- *T-C-O *------.T.----------Brre-DAB2*04 -----T----C--C.------------TA------T---"'*T-C-0;--C --- T-----------Bzze*-DAB2'05 .----T .---C--C.--- ----------TA.-----T---"*T-C-0 -- *- - ---T.----------BBz D9*2T~QGIMAGGTACe-CCDA83G'AGTTACAATAAT0**2TLAGCMAAGAfTTTTTA TPCTATTACAACGABZrT AB * 3 - ----D--A*'- -A---3-C----A-- - -- -

BrBz B3 0 -C---A---3---0*-----C--A-----Brrrre-DA 3----BC-----------AC------ C---0---0-TA---- T-TTA-------C--**TC- --- A----TA-T0----AC--G---C-T-CBB o-AB*0e----AC--------------AC----- C--- 0 --0-TA----T-GTA------T---C-TCG0--- A----TAA-T----0T-AG---C-T-C

261 271 281 291 4 Ixon 2 14 24Brre-DABZ1'01................... C? GAT OGA TAT TAT CAG TAT ACA ATO TTA ORA TOC ATC TAC AGC ACC AG? OAT TAC AG? OAT ATO GTOBrz-.-DA81'01-01 -T-----T---C?---C--TTTTTTTTTTT-----------------------------------------------

Brre-DAB2'01................... - -CG-C - 0-G-A- -AT --T--------------T--------Bre-DAB2'02 ------C--------- ---------CG0-C- 0- -A- --T- T --------------TT --------Bzr~e-Dl82'03-G1-----C------- -T--C A-C--TTG -A- GOT--T--------------T -Br~re-DA2'03-G2 -----C------- -T--C A-C --- TTO -A- GOTG-T--------------T--------Brrz-e-D2'04------C------- ----------CG0-C--T -A- 0-? -T--------------T--------A~rre-DAD2'05 ------C--------- -- -C--C---TO -A- -AT --T--------------T--------Bzre-DAB3'01.0.........................: : ..~ . . . . ---

Brre-DAB3'02 TOCTAACTTTATTTTCTTTTTT"""""'-A- ---CAA-C A A----TO-A-CG T-------G--------------Bkrre-DAB3'03 -A------------ --C TOT 0-- -TO -AT OCT-----T---Bzre-DAB3'0 ------------- - ---------CA-C --- 000 -AC CA------ T-------G--------------Brre-DABd'01.....................- --CG0-C ---TC -A- CAG C---T--Brre-DADA'03------C------- ----------CG0-C ---TC,-A- CAG C-- -T--Brre-DAB4'Od------C------- ----------CG0-C ----0 -A- AAT-----T- -C ----

27 37 47 57Brre-DAD1'01 TTO C?? GAA TCA GGT TCT TTC AAT AAA OTT GTO OAT OTT CAG TAC AAC AQC ACT MTO 000 AAG TAT GA 000 TAC AC? GAG CAG GOA GTO AT? TTTBr*re-flA---B---'-0-1-----G-1-- -

Brr.-DAB2'01 --T --- C-- --GTA- --C-------A--------A---G-----CAA-A-0-T-G------T-----------AAL---Bzre-DAD2'02 -AC---- TO--C --T-----T------A--A- -A-A---- -T------------AA---Bzre-flL82'03-G1 -AC A--T TTO --C-------T--------A-- -0- -A -A- T G-------T------------A -0-RBzw-flA2'03-G2 -AC A--T TTO --C-------T--------A-G------A -A-0--------- -----------Ak -0-Brre-DA82'Od --T ------GTT---C-------T------A-- A---G-----CAR-A-0--- -----TO--A ---------AA---Bkrre-DAB2'05 -AT --- A-- --GOT?---C-------T--------A--G-- -A-A-0--- ---------A---------AA---Bkrre-DAB3*01 C-? --- AT? --- TA- --C -------------AC-T-----T-----0-----G----------------A AG-Brre-DAB3'02 C-T --- TTT --- TA- --C -------A-----AC-------T--------T0--G---------------A-Brre-DAD3'03 C-? --- -C? --- TA- --C--------C- T--- AC-- - T C? ---------AA-Brze-DAD3'O4 --T --- CTT --- TA- --C -------C- ----A--T-----T--------T - -----------------AA---Brz.-flA84'01 -AT---C?--- TA- --C-------------AC-------T--------T-0-G--------A---Brre-DA9d'03 -AT----C?--- TA- --C-------------AC-- - T0 -A-----C-- --A ---Brre-DA9d'04 -AT --- CTT --- TA- --C-------------AC-- - - T0 -A----C--A-

59 69 79 89Bzre-DA81'01 OCA COA AAC TTC AAC AAA AAC CAG OCA TAC CTO CAG CAA COO AAA OC? GAO GTG GLA AG? TTT TOC AGA CAT AAT 0C? CAG ATC TCG GAC TCA GC?BrBDr10rl--e------3-1-'---O-1-----G----1- - -

Brre-DAB2'01 --- GAG -0-------G- --A --- AT- ?-? -----CA ----C -CA --C ----------0G- ?-T------Brz-e-DAB2'02 ---GAG -0-------G- --A --- AT-0-----C -?-----TCA ----C-CA--C----------0G- ?---......Brre-DA82'03-Gl1---GAG -0-------G- --A---OT-----A-C-?-----TCA----C-CA C-C-----A-0----TG------T......Bzrre-DL2'03-G2 --- GAGO-0-------G- --A --- G?-----A-C -T-----TCA ----C -CA C-C-----A-0----G-----T --......Brre-DAB2'04 A--OGAC --T --G-0---G-A-A ----- A-C-?-----TCA ----C-CA"'*-- ------- 0-TG------T......Brre-DAB2'05 --- GAG------------A--TC?-0-----C-?-----TCA--- -C -CA--C-- 0-T---------G-----T......Bzreo-DAD3'01 --- GAO ----------C---?- -------GA----C -CA --C-----------------T ------Bz-re-DAB3'02 ---OGAT---------------C---?- -------GA ----C -CA --C ----------------T . .

Bkrre-DAB3'03 ---GAG--------0-G-----C---?- ---- T-------CA ----C-CA --C ----------------G .

Brre-DAB3*04 --- GAG --------------C--T----T - ?? ---A --- -GC CAA "'* --- -C- A-- -T --......Brre-DAB4'01 ---OGAG--------0-G-----C---?-- --T---??-----C-A ----C-CA --C ----------------GBrre-DAB4*03 --- OAO------ 0-G-----C --- T-- --T --- ?-----C-A ----C -CA --C ----------------G .

Brre-DABd'04 ---OGAG--------------CGT-T-O-T-----A-? ----C--A --C -T----------------......91 Izon 3 101 ill 121

Brre-DAB1'01 GTC COT OAT AAA OCA 0 TA AAA CCO AAG GTA ACA A?? CAG TCA OTO ATO CAG OCT OALA GOT ALA CAT CCA GC? ATO CTG CTO TOC OAT OCA TAT GAG TTCBrre-DAB1'01-G2.Brre-DAB2'O1 --A----------- -GA--- -C-0---------T------AG-------A---Brre-DAB2'01-Gl......................A---------C -0---------T------AG-------A--Bzre-DAB3'01 ------C?-------4 A G--------CA-- -C-0------- -T----?- AG-------A---Brre-ZILBd'01 --A -----------C?---AOG- ------CA-- -C- -0------ -T----?- AG-------A ---Brre-DABd'O5.0............ . ...............G -C -0-0------G T------AG-------A--Brro-DAB4*06......A--C -G0-0------ -T----?- AG ------A---

124 134 144 154Brre-LILB1*01 TAC CC? AAA AM A?? AAA ATO TM? TOG CTO A"L OAT OAT MA MG GOTO ACC TCA OAT GTG ACC TCC AC? ATA OAG ATO OCT AAT GOT AAC TOG TAC TATBrre-DlA1B1--'---O-1-------Brre-DAB2*01 -----------C------AC --C----CAG-----A-A T----------?- C--G0------------------Brro-DL82'01-GO1----------C-----AC --C----C AG------A-A T----------?- C--G0------------------Brre-DAB3'O1 ------- -A------C---------G A-----------------C-G----- ---G- --A G--Br~re-DABdO1 ------- -C------C -0--------G A------- -G------0- G- --A G--------BZ,-D 2 *0----D---AB---4--'----2-C- C-0-----0-------------A-- G- --Brze-DABd'05------- -C------C ---------G A-----------------0-0----G- --AG--Bzre-DA94*06 ------- -C------C--------- A-----------------C--G------0-G- --AG--

157 167 177 187BrTo-lD"1'01 CAG A?? CAC TC? CAC CT? GAA TAC AC? CCC AAA TCT WSA OAG MAG ATC CAA TOT GTO GTG GAG CAC 0CC AOC TCA AC? CAA CC? A?? ACT AAA GAL TOGBrTo-fl881'01-2 ------------------------------------------------------------Brre-D882'01 -0--------- -C--T --- AA---------0-A----------------

Brre- U2 01G - --G--'-- --C -T -A1-0---------CG----T------- -- ---A---0-- - -

BrB -W 3*1--e----T --33----'-0--------T-0--------C--?--------T------C----C- -TBzre-DABd'01------T-0---- ------C--? -- T------------T--------C-------T--BrB-Az *2--e----T--A- ----'0C --------T-0--------C--?------------T-- - - C---C- -TBrz.-DAB4'05 --A ---T-0---- ------C--? ---------------T-- . . . . . . .

BzoDA 406--e---D -B-----'0T--6-----T- 0------C--?-------TT-T---.... .... . .... .

Rzon 4 to termination codon 200 210 220Bzrr-DAAB1 '01 A AT CC? CAT ATC TCT GAG TCC OAC AGO AAT AAL T?? 0CC ATA OGA 0CC TCT GOT CTG OTO CO GGA A?? A?? ATA GCG A?? OC? GSA CTC A?? TAC TACBr* DA 2 01 - -- T ---C-C--A--T------C- A-C--C-Brzre-D13301 -i- --C ----------T---------------C---A-0--------G--C--C ------------------Brze-fl8Bd'01 -i- --C ----------T---------------C----A--------------C--C C------------------Brre-DA8d'02 - -- --- ----------T----A-----C-C --C----A--------------C--C ------------------

223 233 1 3'untranslated region 31 41 51 61 71Brre-DAB1 '01 AAG AAG AAA TCA ACA 000 AGO ATC CTG GTC CCA ALC TOA AAGCAOTGLATCT"'TACOTOTCTLALOCTATOCATGTCTCTAACCBrre-DA33'01 ---------------------A------- C--O-----AhT-----TA---A----SA---------------- --CT?----Brre-DAD3*01--------- -A-------A------- C-----G--0 *----T----A----GA--------T-----C--------Brre-DAB4*01--------- -A------ A------- C--G----~_ALT ----T----A----GA--------T-----C--------Br3-AB*0e--D-A------'--2-A------ -A-A - C-G-----ALT----T--------A-A---SAA -------- CC- ------ C ---------

81 91 101 111 121 131 141 151 161 171 181 191 201 211Brrz-Dl*101 A___****CA___AC___C__Bzrr.-DA82'01 -T--- ??*--T--A----A-G--TAA"*-G-T-"*-OA-TA-T--T-TC------"'*A--A---??TA-----'-0-*------C-------------TA------Brre-DIAB3*01 -T ---TTTTTT--T--A------G-TOA*-A-G-T----OA-TA-T--T-T-C-------**AAA--- A-A ----G-0---C*-------------- ---------------T----T-- -- -

Bzre-DAB4*01 -T--- **"*"*--T--A ------T---AA**-G-T-----O-?A-T--T-T-C-------**AAA-AC--?TA----G-0--- TV------------C------------------T----T------- T-T--Brre-DAB4*02 -T---****ST--T--A ------T---AA**-GOT---GOA-TA-T--T-T-C-'-----*-ALA-AC--TTA----a-Q--- T*-------------C------------------T----T------- -T--

FIG. 2. (Figure continues on the opposite page.)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 6,

202

0

Proc. Natl. Acad. Sci. USA 89 (1992) 11889

221 231 241 251 261 271 281 291 301 311 321 331 341Brre-DAB1'01 GTAATATTGTTT ATAAACAAATTATTTCT*Ga_TT*TTTOT CAAAGAT * CTCTGBrre-DAB2'01 ---------A------- A---T--CA--*'---- AC----------- G-A--TTA--T- ----C------- C----------AT**------ T------- A--------- A-a ------------A ------

Brre-DAB3*'01 --------- A-------A---T--C--- **----AC----------- G-A---TA---T--A-C ------C----G---C-A-T**--------------A--------- * ------ c--------------Brre-DAB4*'01 A --------A------- A---T--CA--** ---- AC----------- G-A---TA---T--A-C -------C---- G------ T** --------------A--------- A-G ------C--------------Brre-DAB4'02 ----A----A------- A---T--C --- **---- AC-------------A---TA---T--A-C C----G-A -----A--G---- C--------------

351 361 371 381 391 401 411 421 431 441 451 461 471Brre-DA81 '01 CCvfTTA*******TAATTT*A'"AAAAATTTATTCA TGBrre-DAB2'01 --A-Q---GTTTATA--C ----CTA-AAC-A-TTG--A----- A--A------- C------------------- T---------------- A--------- TCAG------ A-*--GC-G-C-- -----Brre-DAB3*'01 --A-----****TA--C-----CTA-AAC-A-TT-.................................................................................................Brre-DAB4'01 --A--A--C-***'*TA--C ---CTA-A*C-A-TT -------------A-------- C------------------- A------- T--C--A-G---GA------- AC------- '-------OC-----------Brre-DA84'02 --A----- *****TA--C ----CTA-A*C-A-TT------------- A-------- C------------------- A---------- C------G A------- AC---'----* -GC-0-------

481 491 501 511 521 531 S41 551 561 571 581 591 601 611Brre-DB101 ****C OCCCTCCTCA TCTTAATCC* T TT A *** **************************************AATATATTGAACBrre-DAB2'01 TCY---T-----CT-OCA----CCA------------ATTAATGATG___TA-C ---AA--------CAG-Brre-DaB '01 OCCTC---------C------------------A---AS QCGCA----CCA--------G-A--Do ----a--G --- C----------Brre-DAB4 '02 OCTCT--------------------------------- GCCA----CCA-------A--ATTTAAT-A-AGC -G -0----- A-----

621 631 641 651 661 671 681Brre-DABl '01 ATTTTT******AATAT =ATTTA ATT TACAAACAAAA ABzre-DABI'01 ------****TA---C--------A..........................................Brre-DAB4'01 ------ TTTTTA ---T-T--------------------C----------*******------------Brre-DAB4'02 ------TTTT'**--T--...............-.-

FIG. 2. Nucleotide sequences of zebrafish cDNA clones and PCR fragments. Identity with the DABI*OJ or DAB3*02 sequence is indicatedby dashes, unavailability of information is indicated by dots, and deletions (insertions) are indicated by asterisks. Known or postulated exonborders are indicated by vertical lines. The putative polyadenylylation signal is boxed. Origins of donors of individual alleles: DABI*01,DAB1*O1-G1 and -G2, DAB2*01, DAB3*01, DAB4*01, and DAB4*02, derived from the Tubingen stock; DAB2*01-Gl, DAB2*02, DAB2*03,DAB2*04, DAB3*02, and DAB4*05, from one region in North Bengal, India; DAB3*03 and DAB3*04, from another region in North Bengal;DAB4*03, *04, *06, as well as DAB2*05, from Calcutta, India. DABJ*OJ-G1 and -G2 are genomic sequences identical in exons 2 and 3,respectively, to the cDNA clone B1-1. DAB2*01-Gl is a genomic sequence identical to the cDNA clone B9-2. DAB2*03-G1 and -G2 are genomicsequences identical to each other in their exons but with different introns.

alleles differ by 24 substitutions). Large allelic distances arecharacteristic of MHC genes in higher vertebrates, wherethey are indicative of trans-species evolution ofMHC poly-morphism (6, 7). It is therefore likely that fish MHC alleles,too, evolve trans-specifically. Compared to exon 2, onlylimited variability is detectable in exon 3 and the rest of thesequence (Fig. 2), an observation that underscores the con-centration of polymorphism in the putative PBR in exon 2 ofthe Brre-DAB genes.

Phylogenetic Evaluation. In a genetic distance dendrogrambased on amino acid sequences of class II (3 chains fromrepresentatives of different vertebrate classes (Fig. 4), theBrre polypeptides form a distinct branch that is not directlyrelated to any other known families of class II genes. Thesimplest interpretation of this result is that the Brre genesoriginated from a different ancestral gene than the variousclass 11(3chain-encoding genes of amphibians, birds, andmammals.

DISCUSSIONAlthough the amino acid sequence similarity between fishand mammalian MHC class II proteins (DR, DP, DO, DQ) islow (26-34%), in all other respects the correspondencebetween them is striking. The genes (and presumably theencoded proteins as well) are organized in the same way,sequence variability is focused in similar short regions, andthe polymorphism is apparently evolving in a similar manner.The concentration of polymorphism into variable regions(presumably PBR) of the (31 domain in the fish genes in turnimplies that the function of these genes is probably the sameas that of the mammalian MHC-initiation of immune re-sponses against parasites. Hence, except for their sequence,the MHC genes have changed very little during their 800million years of evolution that separate extant bony fishesfrom extant mammals (38). This conservatism stands instriking contrast to the evolution of the immunoglobulins,which are the second of the three important players invertebrate immunity. Not only do different vertebrate taxapossess different immunoglobulin molecules, they also differfundamentally in the organization of their genes, in the

5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95Position

FIG. 3. Wu-Kabat variability plot of Brre ,81 domain amino acidresidues translated from the nucleotide sequences in Fig. 2. Vari-ability score (ordinate) is given by the number ofdifferent amino acidresidues/frequency of the most common residue for each site (28).Horizontal axis shows position of each site in the Brachydaniosequences. Solid bars indicate residues corresponding to the PBR ofthe mammalian class II ,8 chains (4). Apparent insertion has occurredat residue 23 ofBrachydanio sequences relative to their mammaliancounterparts. In the three-dimensional model ofthe class II molecule(4), this residue is located in a loop region and therefore does notaffect the structure of the PBR. Because of the location of the intron1/exon 2 splice site, the (1 domain of Brre-DAB molecules islengthened by an additional amino acid residue.

Mouse (H-2Mb)Human (HLA-DMB)

- Dog (Cafa-DRB)-Human (HLA-DRB)- Wallaby (Maru-DABI)

Pig (Susc-DQB)-Human (HLA-DPBI)Wallaby (Maru-DBB)

Human (HLA-DOB)Fowl (Gaga-B-LB)

- Clawed toad (Xele)- Zebrarish (Brre-DAB4*01)- Zebrarish (Brre-DABI$01)- Zebrafish (Brre-DAB2*01)

i

0.0 0.1 0.2 0.3 0.4Genetic distance

FIG. 4. Phylogenetic tree of representative class 11( chains fromdifferent vertebrate classes. Sequence sources: HLA-DOB (29),HLA-DPB (30), Gaga-B-LB (11), Susc-DQB (31), Cafa-DRB (32),HLA-DRB (33), HLA-DMB (34), H-2-Mb (35), Maru-DBB (36), andXele (37). Scale shows genetic distances expressed as proportion ofnonidentical amino acids. Numbering on nodes shows number oftimes a particular branch is recovered per 100 bootstrap replications.

Evolution: Ono et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 6,

202

0

Proc. Natl. Acad. Sci. USA 89 (1992)

manner in which they generate antibody diversity, and in thespecificity of their antibody molecules (17).Sequence variability has apparently been an important

feature in the evolution ofMHC genes. It is achieved not onlyby diversification of existing genes, but also by repeatedcycles of expansion through gene duplications and contrac-tions through gene deletions. The close relationship amongidentified Brre loci suggests that they originated by duplica-tion from a common ancestral gene. This ancestor was,however, apparently different from the ancestors that gaverise to (3-chain-encoding class II genes of other vertebrateclasses. Thus, in eutherian (placental) mammals, the class IIregion of the MHC consists of five (-chain-encoding genefamilies-DMB, DOB, DPB, DQB, and DRB (39). Several13-chain-encoding gene families also exist in marsupials (36),which separated from eutherian mammals some 120 millionyears ago (38), but the expressed marsupial MHC genes areequidistant from all the eutherian genes (36), indicating thatthey arose from different ancestors (40). Similarly, no or-thologous relationship can be found between avian class II(-chain-encoding genes and either marsupial or eutheriangenes (40, 41), as well as between amphibian, avian, andmammalian genes (16, 40). In each of these vertebrate(sub)classes, therefore, the expressed class II (-chain-encoding genes apparently originated from a separate ances-tral element by gene duplication. It seems, therefore, thatexpansion and contraction are important means of adaptingthe MHC genes to the needs posed by the changing environ-ment.

We thank Lynne Yakes for editorial assistance, Anica Milosev forpreparation of graphics, and Holger Sultmann for advice and sharingof unpublished data. The work was supported in part by Grant AI23667 from the National Institutes of Health (Bethesda, MD).

1. Klein, J. (1986) Natural History of the Major Histocompati-bility Complex (Wiley, New York).

2. Bjorkman, P. J. & Parham, P. (1990) Annu. Rev. Biochem. 59,253-288.

3. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S.,Strominger, J. L. & Wiley, D. C. (1987) Nature (London) 329,512-518.

4. Brown, J. H., Jerdetzky, T., Saper, M. A., Samraoui, B.,Bjorkman, P. J. & Wiley, D. C. (1988) Nature (London) 332,845-850.

5. Klein, J. & Figueroa, F. (1986) CRC Crit. Rev. Immunol. 6,295-386.

6. Klein, J. (1980) in Immunology 80, eds. Fougereau, M. &Dausset, J. (Academic, London), pp. 239-253.

7. Klein, J., Satta, Y., O'hUigin, C. & Takahata, N. (1993) Annu.Rev. Immunol. 11, in press.

8. Klitz, W., Thomson, G. & Baur, M. P. (1986) Am. J. Hum.Genet. 39, 340-349.

9. Hughes, A. L. & Nei, M. (1988) Nature (London) 335,167-170.10. Bourlet, Y., Bdhar, G., Guillemot, F., Frechin, N., Billault, A.,

Chauss6, A.-M., Zoorob, R. & Auffray, C. (1988) EMBO J. 7,1031-1039.

11. Kroemer, G., Zoorob, R. & Auffray, C. (1990) Immunogenetics31, 405-409.

12. Flajnik, M. F., Canel, C., Kramer, J. & Kasahara, M. (1991)Proc. Natl. Acad. Sci. USA 88, 537-541.

13. Grossberger, D. & Parham, P. (1992) Immunogenetics 36,166-174.

14. Hashimoto, K., Nakanishi, T. & Kurosawa, Y. (1990) Proc.Natl. Acad. Sci. USA 87, 6863-6867.

15. Hashimoto, K., Nakanishi, T. & Kurosawa, Y. (1992) Proc.Natl. Acad. Sci. USA 89, 2209-2212.

16. Kasahara, M., Vazquez, M., Sato, K., McKinney, E. C. &Flajnik, M. F. (1992) Proc. Natl. Acad. Sci. USA 89, 6688-6692.

17. Amemiya, C. T. & Litman, G. W. (1991) Am. Zool. 31, 558-569.

18. Laale, H. W. (1977) J. Fish Biol. 10, 121-173.19. Ono, H., Figueroa, F., O'hUigin, C. & Klein, J. (1993) Immu-

nogenetics, in press.20. Vincek, V., Sertic, J., Zaleska-Rutczynska, Z., Figueroa, F. &

Klein, J. (1990) Immunogenetics 31, 45-51.21. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132,

6-13.22. Holmes, D. S. & Quigley, M. (1981) Anal. Biochem. 114,

193-197.23. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.

Acad. Sci. USA 74, 5463-5467.24. Davis, L. G., Dibner, M. D. & Battey, J. F. (1986) Basic

Methods in Molecular Biology (Elsevier, New York).25. Higgins, D. G., Bleasby, A. J. & Fuchs, R. (1992) Comput.

Appl. Biosci. 8, 189-191.26. Saitou, N. & Nei, M. (1987) Mol. Biol. Evol. 4, 406-425.27. Klein, J., Bontrop, R. E., Dawkins, R. L., Erlich, H. A.,

Gyliensten, U. B., Heise, E. R., Jones, P. P., Parham, P.,Wakeland, E. K. & Watkins, D. I. (1990) Immunogenetics 31,217-219.

28. Wu, T. T. & Kabat, E. A. (1970) J. Exp. Med. 12, 211-250.29. Jonsson, A. K. & Rask, L. (1989) Immunogenetics 29, 411-

413.30. Kelly, A. & Trowsdale, J. (1985) Nucleic Acids Res. 13,

1607-1621.31. Gustafsson, K., LeGuern, C., Hirsch, F., Pratt, K. & Sachs,

D. H. (1990) J. Immunol. 145, 1946-1951.32. Sarmiento, U. M. & Storb, R. (1990) Immunogenetics 31,

396-399.33. Young, J. A. T., Wilkinson, D., Bodmer, W. F. & Trowsdale,

J. (1987) Proc. Natl. Acad. Sci. USA 84, 4929-4933.34. Kelly, A. P., Monaco, J. J., Cho, S. & Trowsdale, J. (1991)

Nature (London) 353, 571-573.35. Cho, S., Attaya, M. & Monaco, J. J. (1991) Nature (London)

353, 573-576.36. Schneider, S., Vincek, V., Tichy, H., Figueroa, F. & Klein, J.

(1991) Mol. Biol. Evol. 8, 753-766.37. Sato, K., Flajnik, M. F., Du Pasquier, L., Katagiri, M. &

Kasahara, M. (1992) J. Immunol., submitted.38. Carroll, R. L. (1988) in Vertebrate Paleontology and Evolution

(Freeman, New York), p. 3.39. Carson, S. & Trowsdale, J. (1986) Oxford Surv. Euk. Genes 3,

63-94.40. Klein, J., Ono, H., Klein, D. & O'hUigin, C. (1993) in Progress

in Immunology, eds. Gergely, J. & Petranyi, G. (Springer,Heidelberg), Vol. 8, in press.

41. Xu, Y., Pitcovski, J., Peterson, L., Auffray, C., Bourlet, Y.,Gerndt, B. M., Nordskog, A. W., Lamont, S. J. & Warner,C. M. (1989) J. Immunol. 142, 2122-2132.

11890 Evolution: Ono et A

Dow

nloa

ded

by g

uest

on

Nov

embe

r 6,

202

0