macrophages, cytokines and complement as therapeutic ...... · ii . candidate statement . this...

Macrophages, cytokines and

complement as therapeutic targets in

retinal degeneration

Nilisha E. Fernando

June 2017

A thesis submitted for the degree of Doctor of Philosophy of The Australian National University

The John Curtin School of Medical Research The Australian National University

© Copyright by Nilisha E. Fernando 2017 All Rights Reserved

ii

Candidate Statement

This declaration certifies that the following work entitled ‘Macrophages, cytokines and

complement as therapeutic targets in retinal degeneration’ is the author's own original

work, complies with The Australian National University Research Award Rules and has

not been previously accepted for award of a degree or diploma to any other university or

institution of higher learning. This thesis was supported by an Australian Government

Research Training Program (AGRTP) Scholarship.

Word Count: 43,006

Signed: ___________________ Date: ___________________

iii

Acknowledgments

During my PhD candidature over the last four years, I have had the privilege of

working with some of the best and brightest researchers in vision science. The production

of this thesis would not have been possible without the immense support from the Provis

and Valter laboratories, for which I am truly grateful. First, I would like to thank Associate

Professor Krisztina Valter, who took me under her wing as an Honours student in 2012,

and then encouraged me to continue as a PhD student. Your enthusiasm and passion for

science and teaching is inspirational. Thank you for your supervision and guidance over

the years. Secondly, I would like to thank Dr Matt Rutar for imparting your remarkable

research skills and wealth of knowledge, helping me become a better researcher. I have

enjoyed learning and working with you on many projects that you are passionate about,

and I thank you for trusting me with these projects so that I too could grow as a scientist.

Third, I thank Dr Riccardo Natoli, whose guidance and mentorship has been

invaluable to my career. Your ability to bring people together under a common vision is

inspirational in both good times and bad, motivating me to keep going even when the road

seems long. Your support has been a turning point in my research career going forward.

Fourth, I would like to thank Professor Jan Provis, whose encouragement and wisdom has

allowed me to develop as a researcher. Your presence as a prominent leader in this field,

your strong support for early-career researchers, and your immense breadth of knowledge

has given me something to aspire towards.

My heartfelt thank you goes out to my 'lab family' - Angel, Tanja, Helen, Josh,

Riemke, Yvette, Dina, Kaz, Nunzio, Kartik and Zan-Min, for making the lab the best place

to work every day. Thank you all for many years of friendship and support. I would also

like to thank Dr Aude Fahrer and Dr Anne Bruestle for their advice and mentorship during

my PhD. Lastly, I am truly grateful for the support of my family and friends throughout the

many years of my studies, especially Mum, Dad and Dilini. Your unwavering support and

confidence in my abilities has been greatly appreciated.

iv

“Words are, in my not-so-humble opinion, our most inexhaustible source of magic…”

Albus Dumbledore

v

Abstract

Age-related macular degeneration (AMD) is the leading cause of blindness

amongst the Western population, with an annual cost of 350 billion dollars worldwide.

This disease affects a specialised region in the central retina, the macula, where

photoreceptors and the retinal pigment epithelium (RPE) cells begin to degenerate upon the

onset of AMD. In the more prevalent atrophic or ‘dry’ form of AMD, gradual

photoreceptor and RPE cell death leads to the formation of an expanding retinal lesion,

which causes irreversible blindness over time. Although AMD pathogenesis involves

multiple genetic and environmental factors, it is well understood that inflammation is

highly implicated in disease progression. The recruitment of retinal microglia and

macrophages, the production of cytokines and chemokines, and the deposition of

complement system components are key features of atrophic AMD.

This thesis identifies retinal microglia and macrophages as therapeutic targets for

slowing the progression of retinal degenerations such as AMD. In these studies, a rodent

model of photo-oxidative damage is used, which recapitulates features of atrophic AMD

including oxidative stress, inflammation and photoreceptor cell loss. This thesis first

provides a further understanding of the role of microglia and macrophages in contributing

to chronic complement activation and photoreceptor death in the degenerating retina. It is

shown that locally-derived complement component 3 (C3) is a major contributor to the

progression of retinal degeneration, and that microglia and macrophages are the primary

source of retinal C3, in both rodent retinal degeneration and human AMD.

The recruitment of microglia and macrophages in retinal diseases is caused by

increased chemokine signalling. It is demonstrated in this thesis that the use of a broad

spectrum chemokine inhibitor (NR58-3.14.3) is able to ameliorate the accumulation of

vi

microglia and macrophages in the outer retina, protecting the photoreceptors from further

damage. Finally, it is shown that interleukin-1β (IL-1β), a strong pro-inflammatory

cytokine, is primarily produced by microglia and macrophages in retinal degeneration.

Using therapeutic strategies to neutralise or inhibit IL-1β signalling, it is found that there is

a decrease in both macrophage recruitment and photoreceptor loss. Collectively, these

three studies implicate a major role for retinal microglia and macrophages in contributing

to pro-inflammatory cytokine production and complement synthesis. This thesis

demonstrates the therapeutic value of targeting microglia and macrophages as a strategy

for reducing inflammation and photoreceptor loss in retinal degenerations including AMD.

vii

Table of Contents

Candidate Statement .............................................................................................................. ii

Acknowledgments ................................................................................................................ iii

Abstract .................................................................................................................................. v

Table of Contents ................................................................................................................. vii

List of Figures ...................................................................................................................... xii

List of Publications ............................................................................................................. xiii

List of Presentations ............................................................................................................ xiv

List of Abbreviations ........................................................................................................... xv

1. INTRODUCTION ........................................................................................................ 1

1.1. General Introduction ............................................................................................... 2

1.2. The eye and retina ................................................................................................... 2

1.2.1. The eye – gateway to vision ............................................................................ 2

1.2.2. Organisation of the retina ................................................................................ 4

1.2.3. Photoreceptors ................................................................................................. 5

1.3. Degeneration of the retina ....................................................................................... 6

1.3.1. Ageing and retinal disease ............................................................................... 6

1.3.2. Age-related macular degeneration ................................................................... 6

1.3.3. Pathogenesis of AMD ...................................................................................... 9

1.4. Inflammation and AMD ........................................................................................ 10

1.4.1. Cytokine production in AMD ........................................................................ 10

1.4.2. Microglia and macrophages in AMD ............................................................ 12

1.5. Complement system and AMD ............................................................................. 13

1.5.1. The complement system ................................................................................ 13

1.5.2. Complement activation and AMD ................................................................. 16

1.5.3. Complement as a gateway to adaptive immunity .......................................... 17

1.6. Therapeutic targeting of inflammation .................................................................. 18

1.6.1. Strategies to manage inflammation in AMD ................................................. 18

1.6.2. Broad spectrum chemokine inhibition (BSCI) .............................................. 19

1.7. In vivo models of retinal degeneration .................................................................. 20

1.7.1. Animal models of retinal degeneration .......................................................... 20

viii

1.7.2. Complement activation in animal models ..................................................... 22

1.8. Summary and aims ................................................................................................ 23

2. METHODS .................................................................................................................. 24

2.1. In vitro experiments .............................................................................................. 25

2.1.1. Cell cultures ................................................................................................... 25

2.2. Animal experiments .............................................................................................. 25

2.2.1. Animal rearing and holding ........................................................................... 25

2.2.2. Intravitreal injections ..................................................................................... 26

2.2.3. Photo-oxidative damage ................................................................................ 27

2.2.4. Electroretinography (ERG) ............................................................................ 28

2.2.5. Optical Coherence Tomography (OCT) ........................................................ 29

2.2.6. Tissue collection ............................................................................................ 31

2.3. Histological and in situ molecular analysis ........................................................... 32

2.3.1. Embedding ..................................................................................................... 32

2.3.2. Cryosectioning ............................................................................................... 32

2.3.3. TUNEL assay ................................................................................................. 33

2.3.4. Immunohistochemistry .................................................................................. 34

2.3.5. In situ hybridisation ....................................................................................... 36

2.4. Molecular analysis ................................................................................................ 38

2.4.1. Fluorescence-activated cell sorting (FACS) .................................................. 38

2.4.2. RNA extraction .............................................................................................. 39

2.4.3. cDNA preparation .......................................................................................... 41

2.4.4. Quantitative real-time PCR ............................................................................ 41

2.4.5. Standard PCR ................................................................................................. 43

2.5. Imaging and statistical analysis ............................................................................. 44

2.5.1. Quantification of cell counts and ONL thickness .......................................... 44

2.5.2. Confocal imaging ........................................................................................... 44

2.5.3. Statistical analysis .......................................................................................... 45

3. RESULTS .................................................................................................................... 46

Retinal macrophages synthesize C3 and activate complement in AMD and in models of focal retinal degeneration

3.1. Abstract ................................................................................................................. 47

ix

3.2. Introduction ........................................................................................................... 48

3.3. Methods ................................................................................................................. 49

3.3.1. Experimental animals .................................................................................... 49

3.3.2. Photo-oxidative damage and tissue collection ............................................... 50

3.3.3. Optical Coherence Tomography (OCT) ........................................................ 50

3.3.4. Treatment of mice with cobra venom factor (CVF) ...................................... 51

3.3.5. Intravitreal injections of siRNA ..................................................................... 51

3.3.6. Immunohistochemistry and quantification of ONL thickness and ................... microglia/macrophages in cryosections ......................................................... 52

3.3.7. In situ hybridisation on human and rat retinas ............................................... 53

3.3.8. Quantitative real-time polymerase chain reaction (qPCR) ............................ 54

3.3.9. OCT and fundus images ................................................................................ 55

3.3.10. Statistics ..................................................................................................... 56

3.4. Results ................................................................................................................... 56

3.4.1. Localisation of C3 mRNA in human donor retinas: A role for ........................ macrophages .................................................................................................. 56

3.4.2. Complement activation and macrophage recruitment within rat retinal ........... lesions ............................................................................................................ 59

3.4.3. Suppression of local C3 inhibits retinal atrophy - mouse studies .................. 64

3.4.4. C3 knockouts ................................................................................................. 65

3.4.5. Local C3 inhibition using siRNA .................................................................. 68

3.4.6. Systemic C3 depletion using Cobra Venom Factor ....................................... 70

3.5. Discussion ............................................................................................................. 76

3.5.1. Role of complement in onset of retinal atrophy ............................................ 78

3.5.2. Local C3-expressing macrophages as a therapeutic target for reducing .......... retinal atrophy ................................................................................................ 79

3.5.3. Conclusions .................................................................................................... 81

4. RESULTS .................................................................................................................... 82

The broad spectrum chemokine inhibitor NR58-3.14.3 modulates macrophage-mediated inflammation in the diseased retina

4.1. Abstract ................................................................................................................. 83

4.2. Background ........................................................................................................... 84

4.3. Methods ................................................................................................................. 87

4.3.1. Animal handling and rearing ......................................................................... 87

x

4.3.2. Preparation of NR58-3.14.3 and intravitreal injections ................................. 87

4.3.3. Light damage ................................................................................................. 88

4.3.4. Retinal localisation of injected NR58-3.14.3 via fluorescein ........................ 88

4.3.5. Tissue collection and processing of whole retinas ......................................... 89

4.3.6. Fluorescence-activated cell sorting (FACS) of retinal macrophages ............ 89

4.3.7. TUNEL assay and quantification of photoreceptor survival ......................... 90

4.3.8. Immunohistochemistry .................................................................................. 90

4.3.9. Quantification of infiltrating macrophages .................................................... 90

4.3.10. Polymerase chain reaction (PCR) .............................................................. 91

4.3.11. In situ hybridisation.................................................................................... 92

4.3.12. Statistical analysis ...................................................................................... 92

4.4. Results ................................................................................................................... 93

4.4.1. Stability and localisation of NR58-3.14.3 in injected retinas ........................ 93

4.4.2. Tolerance of NR58-3.14.3 within the retinal environment ............................ 93

4.4.3. Effect of NR58-3.14.3 on macrophage accumulation following light ............. damage ........................................................................................................... 97

4.4.4. Change in photoreceptor integrity following NR58-3.14.3 injection and ........ light damage ................................................................................................. 100

4.4.5. Cytokine and chemokine expression following NR58-3.14.3 injection and ..... light damage ................................................................................................ 100

4.4.6. Change in expression of inflammatory factors by macrophages following ...... NR58-3.14.3 injection and light damage .................................................... 104

4.5. Discussion ........................................................................................................... 108

4.5.1. Conclusion ................................................................................................... 112

5. RESULTS .................................................................................................................. 113

Microglia-derived IL-1β promotes chemokine expression by Müller cells and RPE in focal retinal degeneration

5.1. Abstract ............................................................................................................... 114

5.2. Background ......................................................................................................... 115

5.3. Methods ............................................................................................................... 116

5.3.1. Animals and photo-oxidative damage ......................................................... 116

5.3.2. Intravitreal injections ................................................................................... 117

5.3.3. RPE and Müller cell cultures ....................................................................... 118

5.3.4. TUNEL and immunohistochemistry ............................................................ 119

xi

5.3.5. Polymerase chain reaction (PCR) ................................................................ 120

5.3.6. In situ hybridisation ..................................................................................... 122

5.3.7. Quantitative and statistical analysis ............................................................. 122

5.4. Results ................................................................................................................. 123

5.4.1. Expression of retinal IL-1β in relation to chemokine up-regulation and ........... macrophage infiltration following photo-oxidative damage ...................... 123

5.4.2. Effect of IL-1β suppression on photoreceptor death, macrophage ................... accumulation, and chemokine expression ................................................... 123

5.4.3. Effect of IL-1β stimulation on chemokine expression in Müller and RPE ...... cell cultures .................................................................................................. 127

5.4.4. Changes in chemokine expression and macrophage infiltration following ...... intravitreal delivery of IL-1β protein ........................................................... 131

5.5. Discussion ........................................................................................................... 135

5.5.1. Conclusions .................................................................................................. 138

6. SUMMARY ............................................................................................................... 139

7. REFERENCES ......................................................................................................... 144

7.1. Complete Reference List ..................................................................................... 145

xii

List of Figures

Figure Title Page 1.1 Anatomy of the eye and retina 3 1.2 The pathogenesis of AMD 8 1.3 Schematic representation of the complement system 15 3.1 C3 expression in human AMD retinas 57 3.2 Outer nuclear layer thickness ratio changes following photo-oxidative

damage in rats 60

3.3 Complement gene expression in rat retinas following photo-oxidative damage

62

3.4 Infiltration of IBA1+ microglia/macrophages into the outer rat retina following photo-oxidative damage

63

3.5 Infiltration of C3-expressing cells and C3d protein deposition in the outer rat retina following photo-oxidative damage

65

3.6 C3 expression in C57BL/6J wild-type and C3-/- mouse retinas 68 3.7 Inhibition of retinal C3 expression using C3 siRNA and 7 days of photo-

oxidative damage 71

3.8 Depletion of systemic complement using cobra venom factor at 7 days of photo-oxidative damage

73

Supp 3.1 Characterisation of dim-reared C57BL/6J wild-type and C3-/- mouse retinas

76

4.1 Stability and localisation of intravitreally injected NR58-3.14.3 94 4.2 Tolerance of NR58-3.14.3 within the retinal environment in relation to

stress and macrophage recruitment 96

4.3 Macrophage/microglia recruitment to the outer retina following injection of NR58-3.14.3 and light damage

98

4.4 Change in photoreceptor integrity following injection of NR58-3.14.3 and light damage

101

4.5 Expression of chemokines and cytokines in whole retinas following injection of NR58-3.14.3 and light damage

103

4.6 Effect of NR58-3.14.3 on the pathogenic phenotype of the retinal macrophage population following light damage

105

4.7 In situ hybridisation for Ccl3 mRNA following NR58-3.14.3 injections and light damage

107

5.1 Temporal relation of IL-1β to chemokine expression and macrophage infiltration following photo-oxidative damage

124

5.2 Effect of IL-1β inhibition on photoreceptor apoptosis and macrophage infiltration following photo-oxidative damage

127

5.3 Effect of IL-1β inhibition on chemokine expression following photo-oxidative damage

129

5.4 Chemokine expression in RPE and Müller cell cultures stimulated with IL-1β

132

5.5 Change in retinal chemokine expression and macrophage infiltration in retinas following intravitreal injection of IL-1β protein

133

xiii

List of Publications

A list of publications that were produced during this PhD are listed below (* denotes equal first author):

1. Natoli, R.*, Fernando, N.*, Jiao, H.*, Racic, T., Madigan, M., Barnett, N.L., Chu-Tan, J.A., Valter, K., Provis, J., Rutar, M. (2017) Retinal macrophages synthesize C3 and activate complement in AMD and in models of focal retinal degeneration. Invest. Ophthalmol. Vis. Sci. 58, pp. 2977-90, doi:10.1167/iovs.17-21672. 2. Natoli, R.*, Fernando, N.*, Madigan, M., Chu-Tan, J.A., Valter, K., Provis, J., Rutar, M. (2017) Microglia-derived IL-1β promotes chemokine expression by Müller cells and RPE in focal retinal degeneration. Mol. Neurodegener. 12, 31, doi:10.1186/s13024-017-0175-y. 3. Fernando, N.*, Natoli, R.*, Valter, K., Provis, J., Rutar, M. (2016) The broad spectrum chemokine inhibitor NR58-3.14.3 modulates macrophage-mediated inflammation in the diseased retina. J. Neuroinflammation. 13, 47, doi:10.1186/s12974-016-0514-x. 4. Natoli, R.*, Jiao, H.*, Barnett, N., Fernando, N., Valter, K., Provis, J., Rutar, M. (2016) A model of progressive photo-oxidative degeneration and inflammation in the pigmented C57BL/6J mouse retina. Exp. Eye Res. 147, pp. 114-27, doi: 10.1016/j.exer.2016.04.015. 5. Kotwal, G., Fernando, N., Zhou, J., Valter, K. (2014) Exploring the potential benefits of vaccinia virus complement control protein in controlling complement activation in pathogenesis of the central nervous system diseases. Mol. Immunol. 61 pp. 204-9, doi:10.1016/j.molimm.2014.06.022. 6. Fiorani, L.*, Maccarone, R.*, Fernando, N., Colecchi, L., Bisti, S., Valter, K. (2014) Slow-release drug delivery through Elvax 40W to the rat retina: Implications for the treatment of chronic conditions. J. Vis. Exp. 91, e51563, doi:10.3791/51563.

xiv

List of Presentations

Data from this thesis was presented at the following international and national conferences:

Chapter 3: "Chronic accumulations of complement-expressing microglia/macrophages accompany the progressive expansion of the retinal lesion in an animal model of atrophic AMD" Global Young Scientists Summit (GYSS) 2017 - Singapore University of Technology and Design, Singapore, 15-20 January 2017 Association for Research in Vision and Ophthalmology (ARVO) 2016 Annual Meeting - Washington State Convention Center, Seattle, WA, USA, 1-5 May 2016 (abstract published in IOVS, 57, 12: 2222) 6th Neuroimmunology Australia Workshop 2016 - St Vincent's Centre for Applied Medical Research, Sydney, Australia, 19 August 2016 (platform presentation) Canberra Health Annual Research Meeting (CHARM) - The Canberra Hospital, Canberra, Australia, 10 August 2016 (platform presentation) Australian Society for Medical Research - ACT New Investigators Forum - The John Curtin School of Medical Research, The Australian National University, Canberra, Australia, 8 June 2016 Chapter 4: "The broad spectrum chemokine inhibitor NR58-3.14.3 protects the retina from light-induced degeneration" 2nd European Molecular Biology Laboratory (EMBL) Australia PhD Symposium - Bio21 Institute, Melbourne, Australia, 25-27 November 2015 (platform presentation) Canberra Health Annual Research Meeting (CHARM) - The Canberra Hospital, Canberra, Australia, 11-14 August 2015 (platform presentation) Australian Society for Medical Research - ACT New Investigators Forum - The John Curtin School of Medical Research, The Australian National University, Canberra, Australia, 2 June 2015 (platform presentation) Chapter 5: "IL1B inhibition reduces chemokine-mediated inflammation in retinal degeneration" Invited Speaker at the XXII Biennial Meeting of the International Society for Eye Research (ISER) - Keio Plaza Hotel, Tokyo, Japan, 25-29 September 2016 (platform presentation) XVII International Symposium on Retinal Degeneration - Kyoto International Conference Centre, Kyoto, Japan, 19-24 September 2016 Australian Society for Medical Research - ACT New Investigators Forum - The John Curtin School of Medical Research, The Australian National University, Canberra, Australia, 7 June 2017

xv

List of Abbreviations

ΔΔCt – comparative cycle threshold

ACTB – beta actin

AEEC – Animal Experimentation Ethics Committee

AMD – age-related macular degeneration

ANOVA – analysis of variance

ANU – Australian National University

APOE – apolipoprotein E

ARPE-19 – ATCC CRL-2302 (human RPE cell line)

ART – automatic real time

ARVO – Association for Research in Vision and Ophthalmology

ATP – adenosine triphosphate

BCIP – 5-bromo-4-chloro-3-indolyl phosphate

BRB – blood-retinal barrier

BSA – bovine serum albumin

BSCI – broad spectrum chemokine inhibitor

C – choroid

C1 – complement component 1

C1q – complement component 1q

C1r – complement component 1r

C1s – complement component 1s


C2a – complement component 2a



C3b – complement component 3b

C3-/- – C3 knockout

C3d – complement component 3d











C57BL/6J – C57 black 6 Jax mouse

Cas9 – CRISPR-associated protein-9 nuclease

CASP-1 – caspase 1

CASP-8 – caspase 8

CCL2 – chemokine (C-C) motif ligand 2

CCL3 – chemokine (C-C motif) ligand 3



CCR1 – chemokine (C-C) motif receptor 1


xvi


CD11b – cluster of differentiation 11b

CD200 – cluster of differentiation 200

CD200R – cluster of differentiation 200 receptor

cDNA – complementary DNA

CEP – carboxyethylpyrrole

CFB – complement factor B

CFD – complement factor D

CFH – complement factor H

CFI – complement factor I

CNS – central nervous system

CNTF – ciliary neurotrophic factor

CNV – choroidal neovascularisation

CO2 – carbon dioxide

CRISPR – clustered regularly interspaced short palindromic repeats

cSLO – confocal scanning laser ophthalmoscopy

Ct – cycle threshold

CVF – cobra venom factor

CX3CL1 – chemokine (C-X3-C) motif ligand 1

CX3CR1 – chemokine (C-X3-C) motif receptor 1

CXCL1 – chemokine (C-X-C) motif ligand 1



CXCR3 – chemokine (C-X-C) motif receptor 3

DHA – docosahexaenoic acid

DIG – digoxigenin

DMEM – Dulbecco’s Modified Eagle’s Medium

DNA – deoxyribonucleic acid

dUTP – 2’-deoxyuridine 5’-triphosphate

EDTA – ethylenediaminetetraacetic acid

ERG – electroretinography

FACS – fluorescence activated cell sorting

FBS – fetal bovine serum

FGF2 – fibroblast growth factor 2

GA – geographic atrophy

GAPDH – glyceraldehyde-3-phosphate dehydrogenase

GCL – ganglion cell layer

GFAP – glial fibrillary acidic protein

GWAS – genome-wide association study

GVHD – graft-versus-host disease

HBSS – Hank's balanced salt solution

hr(s) – hour(s)

HNPP – 2-hydroxy-3-naphthoic acid-2’-phenylanilide phosphate

I – inferior

IBA-1 – ionised calcium binding adaptor molecule 1

IgG – immunoglobulin G

xvii

IHC – immunohistochemistry

IL-1 –interleukin 1

IL-1α – interleukin 1α

IL-1β – interleukin 1β

IL-1r1 – interleukin 1 receptor type I

IL-1ra – interleukin 1 receptor antagonist

IL-1rap – interleukin 1 receptor accessory protein

IL-4 – interleukin 4








ILM – inner limiting membrane

INL – inner nuclear layer

IPL – inner plexiform layer

IR – ischemia-reperfusion

IS – inner segments

ISH – in situ hybridisation

IVC – individually ventilated cage

JCSMR – John Curtin School of Medical Research

LED – light-emitting diode

LD – light damage

LPS – lipopolysaccharide

LSD – least significant difference

MAC – membrane attack complex (C5b-9)

MASP1 – MBL-associated serine protease 1

MASP2 – MBL-associated serine protease 2

MBL – mannose-binding lectin

MDA – malondialdehyde

MIO-M1 – Müller 1 Moorefields Institute of Ophthalmology (human Müller cell line)

miRNA – microRNA

MQ-H2O – Milli-Q water

mRNA – messenger RNA

MTT – 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

NBF – neutral buffered formalin

NBT – nitro blue tetrazolium

NF-κB – nuclear factor kappa-light-chain-enhancer of activated B cells

NFL – nerve fibre layer

NGS – normal goat serum

NHS-fluorescein – N-hydroxy-succinimidyl-ester fluorescein

NLRP3 – nucleotide-binding domain, leucine-rich-containing family, pyrin domain-containing-3

OCT – optical coherence tomography

OCT – optimal cutting temperature

OLM – outer limiting membrane

ON – optic nerve

ONL – outer nuclear layer

xviii

OPL – outer plexiform layer

OS – outer segments

PBS – phosphate-buffered saline

PCR – polymerase chain reaction

PD – photo-oxidative damage

qPCR – quantitative real-time PCR

RHOD – rhodopsin

RNA – ribonucleic acid

RNAi – RNA interference

RNP – ribonucleoprotein

ROS – reactive oxygen species

RPE – retinal pigment epithelium

S – superior

SD – Sprague-Dawley

SEM – standard error mean

SERPING1 – serpin family G member 1

siRNA – small interfering RNA

SOD – superoxide dismutase

SSC – saline-sodium citrate

Tdt – terminal deoxynucleotidyl transferase

TNF – tumor necrosis factor

TNFa – tumor necrosis factor α

TUNEL – terminal deoxynucleotidyl transferase dUTP nick end labelling

UV – ultraviolet

V – vasculature

VEGF – vascular endothelial growth factor

VEGFA – vascular endothelial growth factor A

VEGFR1 – vascular endothelial growth factor receptor 1

VIM – vimentin

WT – wild type

1

1. INTRODUCTION

2

1.1. General Introduction

Age-related macular degeneration (AMD) is a disease of the neural retina, which

includes the light-sensitive photoreceptors that transduce light into electrical signals, which

can be interpreted by the brain. With the onset of AMD, photoreceptors in a localised

region of the retina begin to degenerate and a lesion develops. This form of retinal

degeneration is the leading cause of blindness, costing the Australian economy 5 billion

dollars and the global economy 350 billion dollars annually [1, 2]. Although the aetiology

of AMD involves multiple genetic and environmental factors, it is well-established that

dysregulation of the innate immune system is highly implicated in the pathogenesis of this

disease [3]. A key feature of AMD is the activation and recruitment of resident microglia

and blood-borne macrophages to the site of degeneration, which are associated with

photoreceptor loss and further progression of the disease [4, 5].

In this chapter, I will provide an overview of the current understanding of the

pathogenesis of AMD, and will introduce the immunological aspects of AMD progression,

including the role of chemokines. I will also highlight the use of therapeutic molecules that

target the innate immune system as a strategy for slowing the progression of retinal

degenerative diseases such as AMD.

1.2. The eye and retina

1.2.1. The eye – gateway to vision

Most people, when questioned, regard vision as being the most important of their

special senses. The eye (Figure 1.1) comprises an outer protective layer, the sclera, which

together with the transparent cornea at the anterior surface, form a continuous external

3

Figure 1.1. Anatomy of the eye and retina (adapted from Kolb, 1995 [6]). Light passes

through the pupil of the eye and is focused onto the retina, a multi-layered structure at the

posterior of the eye. The photoreceptors are contained in the outer nuclear layer (ONL).

4

barrier around the globe [6]. Internally there is an anterior and a posterior chamber. Light

passes through the anterior chamber and into the eye through the pupil, the size of which is

adjusted by the iris, to allow more or less light to enter the eye. The lens focuses the light

onto the retina, a sensory structure that lines the posterior surface of the eye. The light

passes through the vitreous chamber, is absorbed by opsins in the photoreceptor outer

segments, and is transduced into electrical signals. Photoreceptors feed this signal via the

bipolar cells, to ganglion cells whose axons project to the brain via the optic nerve [6, 7].

1.2.2. Organisation of the retina

The human retina is made up of ten distinct layers which differ in both structure

and function [8]. The inner retina consists of the inner limiting membrane (ILM), nerve

fibre layer (NFL), ganglion cell layer (GCL), inner plexiform layer (IPL), inner nuclear

layer (INL), and outer plexiform layer (OPL). The INL houses multiple cell types

including bipolar cells, amacrine cells and horizontal cells, as well as the Müller cell

bodies [8]. Müller cells are radial glial cells that span the whole retina providing structural

support [9]. They also functionally support neurons by recycling neurotransmitters, and

promote the survival of photoreceptors through a range of homeostatic signalling

mechanisms to control neuronal activity, metabolism and outer segment recycling

(reviewed in [9-12]). Müller cells also function as ‘light guides’, directly contributing to

vision [13]. Upon retinal injury, Müller cells can undergo gliosis and proliferation to fill

gaps in the photoreceptor layer [10, 14, 15], and may even proliferate to generate retinal

neurons [16, 17] and photoreceptors [18, 19].

The outer retina is made up of the outer nuclear layer (ONL), the outer limiting

membrane (OLM), and the inner and outer segments (IS and OS) of the photoreceptors in

the sub-retinal space [8]. A monolayer of retinal pigment epithelium (RPE) cells - which

are part of the neural retina - form the outer blood-retinal barrier (BRB), between the retina

5

and the underlying Bruch’s membrane. Transporters and tight junctions of the RPE cells

allow for the selective movement of ions, proteins and water in and out of the retina, whilst

maintaining the immune privilege of the eye by inhibiting the passage of immune cells into

the retina [20, 21]. The choroid is a network of blood vessels under the Bruch’s membrane

which delivers nutrients and oxygen to the outer retina, and removes waste and heat from

the retina [22].

1.2.3. Photoreceptors

Photoreceptors are made up of three major parts: cell bodies which make up the

ONL, inner segments (IS), which act as the powerhouse for the photoreceptors, and outer

segments (OS), which contain one of four different light-sensitive opsins (in humans) that

absorb light of specific frequencies to provide for phototransduction [6, 23]. There are two

types of photoreceptor cells: rods and cones. The outer segments of rod cells comprise

membranous disks of opsin and retinal, which combine to form rhodopsin. Rods are very

light sensitive, and are useful only in dim light conditions. Cone photoreceptors contain

one of three different opsins which combine with retinal to form cone opsins, having a

particular range of spectral sensitivities (short, medium and long wavelengths) that both

broadens the range of visible frequencies as well as allows for the processing of ‘colour-

coded’ signals, and colour vision. Cone opsins do not saturate in bright light, and mediate

virtually all of our useful vision [6, 23].

The human retina comprises approximately 120 million rods and 6 million cones

[24]. Cones are dominant in the macular region of the retina, the centre of the visual field.

Cones, but not rods, provide input into retinal circuits which are highly adapted to extract

information that provides for high spatial resolution (acuity) as well as colour. The fovea

centralis within the macula is a rod-free and vessel-free area where light scattering is

minimal, allowing for the maximum amount of light to be absorbed by the cones [6].

6

However, most likely due to the unique and highly specialised design and

microenvironment of the macula, where blood supply is limited and there is high density of

oxygen-demanding photoreceptors, the macula is subject to degeneration over time [25].

1.3. Degeneration of the retina

1.3.1. Ageing and retinal disease

Tissue homeostasis is a key element to preserving the health of the retina. Under

basal conditions, the immune system in the retina can maintain homeostasis, and low levels

of tissue stress are regulated by the microglia, the resident immune cells of the retina [5].

However, constant exposure to noxious conditions, such as overload with reactive oxygen

species (ROS) over time may lead to chronic tissue stress, in which para-inflammation may

occur [26]. Para-inflammation is an intermediate inflammatory response that returns the

stress levels in the retina back to homeostasis [27]. If para-inflammation persists, such as in

ageing, this may result in release of pro-inflammatory cytokines, that can propagate a full

inflammatory response [26]. Ageing is defined as the accumulation of temporal changes

that increase susceptibility to disease with increasing lifespan [28]. Para-inflammation in

ageing can contribute to the onset of many retinal degenerative diseases later in life,

including diabetic retinopathy, glaucoma and age-related macular degeneration (AMD)

[26]. Onset and progression of retinal degenerative diseases including AMD, glaucoma,

retinitis pigmentosa, diabetic retinopathy and retinal detachment share several features in

common, including increases in both oxidative stress and inflammation [8, 29-31].

1.3.2. Age-related macular degeneration

Age-related macular degeneration (AMD) is the leading cause of blindness in the

Western World, primarily affecting the population aged over 65, with the projected number

7

of people with the disease estimated to be 288 million worldwide by 2040 [32]. AMD

poses a significant economic burden, with an annual global cost of 350 billion dollars for

the treatment and healthcare of visually impaired patients [2]. Early/intermediate AMD is

clinically diagnosed by the presence of drusen surrounding the macular region (Figure 1.2).

Drusen are yellow deposits of debris that form between the RPE and Bruch’s membrane

[33, 34]. The presence of drusen, which may coalesce over time, can lead to the

degeneration of RPE cells overlaying the drusen deposits [35, 36]. At this stage, the

photoreceptor layer is still largely intact, and there is an absence of neovascularisation.

There are two types of late-stage AMD (Figure 1.2). Neovascular or “wet” AMD,

accounts for 10% of all cases, and can lead to sudden loss of vision due to choroidal

neovascularisation (CNV). In wet AMD, new blood vessels derived from the choroid enter

the subretinal space near the photoreceptors. Prolonged leakage of blood, serum and lipids

into the outer retina from these fenestrated, or non-barriered blood vessels disrupts

photoreceptor alignment and alters the neural microenvironment, promoting Müller cell

gliosis, scarring and visual impairment [34, 37].

Atrophic or “dry” late-stage AMD is characterised by the emergence of geographic

atrophy (GA), in which a lesion in the RPE, photoreceptors and choriocapillaris of the

macula develops and progressively expands over time [34]. This is in part due to drusen

deposition around the macula, which may cause the degeneration of RPE and

photoreceptor cells in these areas, leading to the development of a focal outer retinal lesion

[38]. This atrophy is usually accompanied by reduced blood flow in the choroid and

thinning of the choriocapillaris [39, 40]. The progressive loss of outer retinal cells and the

expansion of the atrophic lesion results in a large drop in visual function in patients with

the disease [41]. Development of a two millimetre lesion in the foveal region can result in

legal blindness [25].

8

Figure 1.2. The pathogenesis of AMD (from Ambati et al. 2013 [3]). There are two forms

of late-stage AMD that can develop from early or intermediate dry AMD; geographic

atrophy (dry AMD), where photoreceptors and RPE deteriorate, and neovascular AMD

(wet AMD), where the growth of new blood vessels can cause oedema and cell death.

9

1.3.3. Pathogenesis of AMD

The pathogenesis of AMD is multifactorial and the precise causes of onset and

progression of this disease remain unclear. However, several factors are strongly

implicated in increasing the risk of developing AMD, including a range of genetic and

environmental factors [34, 42]. Advancing age remains the highest risk factor for all forms

of the disease [43-46]. Genetic predispositions regarding the immune system are heavily

linked to the development of the disease, especially the dysregulation of complement

system genes, which strongly increases the risk of developing AMD [47, 48]. There is

some evidence suggesting that autoimmunity may also contribute to the progression of the

disease, as autoantibodies have been detected in the blood of AMD patients [49, 50].

A key component of AMD onset and progression has been linked to mechanisms

that cause oxidative stress and retinal damage, which can be initiated by a number of

environmental factors [29, 30]. The retina is subject to oxidative stress over time, due to

the generation of ROS from high light exposure and oxygen consumption, as well as the

continual inhibitory mechanisms of the RPE against immune cells in the choroid [22, 51,

52]. Environmental factors including cigarette smoking [45, 53-56] and systemic

hypertension [57, 58] have also been linked to the prevalence of AMD.

Additionally, photo-oxidative damage resulting from excessive exposure to light

causes lipid peroxidation of the outer segments, and may be a factor in AMD pathogenesis

[59]. Continual phagocytic activity of the RPE cells generate lipofuscins, which are

pigment granules containing remnants of lysosomal digestion [60]. Lipofuscin

accumulation in the RPE is also thought to cause RPE cell degeneration and photoreceptor

loss adjacent to the degenerating RPE [61].

Analysis of drusen composition has identified over 100 different proteins [62],

many of which were covalently cross-linked with carboxyethylpyrrole (CEP), a by-product

10

of docosahexaenoic acid (DHA) oxidation, in which fragmentation occurs under oxidative

stress conditions [63]. The generation and accumulation of CEP-adducted proteins in the

outer retina is heavily implicated in the pathogenesis of AMD [64, 65]. Another oxidative

stress by-product found in drusen is malondialdehyde (MDA), produced through the

oxidation of phosphatidylcholine [66]. MDA is known to interact with complement factor

H (CFH), a critical regulator of the complement system [67]. Induction of the innate

immune system following oxidative stress is known to contribute to the progression of

AMD [68-70].

Although there are a wide range of factors that may contribute to AMD

pathogenesis, the significance of immunological processes in AMD has been well

established. Dysregulation of the immune system is critically linked to the development of

geographic atrophy, including the recruitment of activated resident microglia to the outer

retina, and the persistent accumulation of subretinal macrophages [4, 5, 71-75]. Under

normal conditions, the eye has an ocular immune privilege, and is protected from

inflammation by separation from the choroidal vasculature by the BRB, as well as through

the production of immune system inhibitors in the eye [76, 77]. However, once damage

occurs to the RPE and photoreceptors in retinal diseases such as AMD, the BRB is

breached which may remove this immune privilege and allow inflammation to occur [31].

1.4. Inflammation and AMD

1.4.1. Cytokine production in AMD

Cytokines are a large family of inflammatory molecules that are involved in many

aspects of both the innate and adaptive immune system, including leukocyte activation and

recruitment, antigen presentation, bone marrow differentiation and adhesion molecule

11

expression [78]. Cytokines can be classified as either pro-inflammatory (e.g. tumour

necrosis factor (TNF), interleukin-1 (IL-1), IL-6, IL-12) or anti-inflammatory (e.g. IL-4,

IL-10, IL-13) [79]. A specialised sub-group of cytokines that are primarily involved in

leukocyte migration are the chemokines, a group of small chemoattractant molecules that

form chemotactic gradients for the activation and recruitment of leukocytes expressing the

appropriate chemokine receptors [80]. Chemokines and their receptors are classified into

four sub-groups depending on their characteristic cysteine motifs; C (γ chemokines), CC (α

chemokines), CXC (β chemokines) and CXC3 (δ chemokines) [81]. In the central nervous

system, chemokines are produced by neurons, astrocytes and microglial cells at lower

levels [82]. Upon activation of stress or inflammatory signalling pathways, higher levels of

chemokines are expressed, leading to recruitment of blood-borne leukocytes to areas of

damage [81]. These leukocytes are primarily monocytes (precursors of macrophages),

neutrophils, lymphocytes and eosinophils [83].

In AMD, chemokines attract leukocytes to areas of outer retinal tissue damage [84].

A genome-wide association study (GWAS), involving 68 human donor eyes from normal

and AMD patients, demonstrated that several chemokines involved in leukocyte

recruitment (CCL2, CXCL1 and CXCL10) were upregulated in both wet and dry AMD

eyes [47]. Studies involving animal models of retinal degeneration have demonstrated that

expression of Ccl2, Cxcl1 and Cxcl10 is coordinated by RPE and Müller cells to activate

resident microglia and recruit blood-borne macrophages to the degenerating retina [85-87].

In addition, it has been shown that culturing RPE and Müller cells with lipopolysaccharide

(LPS)-stimulated microglia can induce the expression of Ccl2 and Il-6, indicating that

prolonged chemokine expression may occur through the continual expression of

chemokines by these retinal cells [86, 88]. Upregulation of a suite of chemokines and pro-

inflammatory cytokines, which includes CCL2 [85, 89-92], CCL3 [93, 94], CCL4 [95] and

IL-6 [96, 97] are strongly implicated in the progression of retinal diseases.

12

Interleukin-1β (IL-1β) is a pro-inflammatory cytokine primarily produced through

the activation of the inflammasome [98, 99]. The inflammasome is an oligomer protein

complex that leads to the maturation and secretion of IL-1β and IL-18 into the extracellular

environment [100]. The assembly and activation of the inflammasome is stimulated by

several mechanisms, including toll-like receptor signalling and purinergic receptor

signalling, the latter which is activated by extracellular ATP released by dying cells [100,

101]. Although inflammasome signalling is thought to play both detrimental and protective

roles in atrophic and neovascular AMD due to the production of IL-18 [102-109], the

synthesis of mature IL-1β is known to be involved in the pathogenesis of central nervous

system (CNS) diseases [110], including both forms of AMD [111, 112]. This has also been

supported in several studies involving animal models of retinal degenerations,

demonstrating that IL-1β is secreted by activated microglia [113-117].

1.4.2. Microglia and macrophages in AMD

Microglia are the resident immune cells of the CNS, existing in a ramified immune

surveillance state in the normal brain and retina [118]. Microglia are derived from

primitive yolk sac macrophages in development [119], and have a distinct phenotype from

blood-borne macrophages [120]. In the healthy retina, microglia are highly motile, which

allows them to constantly sense the microenvironment and interact with other retinal cells

such as Müller cells and photoreceptors, using highly mobile processes [121, 122]. As well

as monitoring the inflammatory environment, microglia have a key role in neurogenesis,

neuronal survival and synaptic maintenance in CNS development [123-125], as well as

maintaining synaptic function in the mature retina [126]. Under normal retinal conditions,

mechanisms to inhibit microglial activity are in place, including the CD200:CD200R

signalling axis [127, 128] and the CX3CL1:CX3CR1 signalling axis [129, 130]. Microglia

normally reside in the plexiform layers of the inner retina [5], however, upon receiving

13

inflammatory cues such as chemokine signalling or purinergic signalling from damaged

photoreceptors, RPE and Müller cells, microglia can migrate to sites of tissue damage

[131]. During ageing, there are higher numbers of microglia in the retina, which begin to

accumulate in the outer retina with age [132, 133].

In age-related retinal diseases such as AMD, the accumulation of leukocytes in the

outer retina is a well-established feature of disease pathogenesis [4, 71-75]. This outer

retinal leukocyte population primarily consists of activated microglia and infiltrating

blood-borne macrophages from the retinal vasculature [5]. Microglial activation and

macrophage recruitment are strongly implicated in the pathogenesis of several retinal

diseases, including AMD [4, 47, 75, 134, 135], glaucoma [136, 137], retinitis pigmentosa

[134], and diabetic retinopathy [138]. There are two types of macrophages, M1 (pro-

inflammatory) macrophages that are involved in the clearance of cell debris, pathogens and

apoptotic cells [116, 134, 139], and M2 (anti-inflammatory) macrophages, which are

involved in wound healing and angiogenesis [113]. However, phagocytosis by these cells

has also been found to contribute to the degeneration of living photoreceptors adjacent to

damaged photoreceptors [116, 134]. Additionally, retinal microglia and macrophages are

known to express complement system components [140-144]. The role that these cells play

in contributing to prolonged disease progression is not fully understood.

1.5. Complement system and AMD

1.5.1. The complement system

The complement system is a key component of the innate immune system. It

comprises a cascade of over 30 proteins circulating in the plasma and on cell surfaces

[145], that are sequentially lysed to form a terminal complex initiating the destruction of a

14

pathogen or foreign body, which has been associated with cell debris [145, 146]. It is an

ancient system that is evolutionarily conserved as a critical mechanism for host defence

[147, 148]. The complement system consists of three pathways of activation (Figure 1.3);

classical, lectin and alternative pathways [149].

The classical pathway of the complement system is activated through the binding of

foreign antibodies on pathogenic surfaces, which initiates activation of the complement

component 1 (C1) complex. This complex is comprised of a C1q hexamer molecule bound

to C1r and C1s, which together when activated form a serine protease which goes on to

cleave the next proteins in the pathway, C4 and C2. Two fragments generated during this

interaction, C4b and C2a, form the C3 convertase enzyme (C4b2a) that facilitates the

hydrolysis of C3, a central molecule of all pathways of the complement system. C3

hydrolysis generates smaller C3 fragments that are used up further downstream for several

complement system functions. These C3 convertase enzymes are attached to the

pathogenic cell surfaces, largely limiting complement activity to these bound surfaces. The

lectin pathway consists of a similar chain of proteins, whereby the C1 complex is replaced

with a mannose-binding lectin (MBL) protein, which binds specifically to mannose

residues on pathogenic cell surfaces. MBL-associated serine proteases 1 and 2 (MASP-1

and MASP-2) cleave the C4 and C2 proteins, generating C4b and C2a fragments necessary

for the formation of the C3 convertase [145-147, 149].

The alternative pathway operates under a spontaneous hydrolysis mechanism. The

constant hydrolysis of C3 allows for C3 convertases to be formed at lower levels. C3

convertase (C3bBb) formation via this pathway is regulated by a number of factors.

Complement factor B (CFB) and complement factor D (CFD) are positive regulators of C3

hydrolysis, whereas complement factor H (CFH) and complement factor I (CFI) negatively

15

Figure 1.3. Schematic representation of the complement system (adapted from Murphy et

al. 2008 [149]). There are three pathways of complement activation; classical, lectin and

alternative. These pathways all lead to the hydrolysis of C3, which triggers the downstream

formation of the membrane attack complex (MAC). This marks the destruction of

pathogens, apoptotic cells and debris.

16

regulate this pathway and inhibit the hydrolysis of C3. Properdin (factor P) may bind to the

C3 convertase and enhance its stability upon binding to pathogenic cell surfaces [149].

Upon C3 hydrolysis by each of the three complement pathways, a number of fragments are

produced including C3a, C3b and C3d (inactive component). The larger fragment C3b

forms part of a C5 convertase which lyses C5 into C5a and C5b. This C5b fragment

combines with C6, C7, C8 and 16 molecules of C9 to form the membrane attack complex

(MAC, C5b-9) terminal complement product, which assembles on the pathogenic cell

surface and essentially forms a membrane pore in the surface, facilitating the destruction of

pathogens, foreign bodies or cell debris via lysis [145-147, 149].

This key function of the complement system not only plays a vital role in host

defence against pathogens, but also clears debris as well as dead, damaged and apoptotic

cells, which may protect against autoimmunity [149]. Complement may also lead to a

prolonged activation of the innate immune system via several mechanisms. Complement

contributes to the opsonisation of pathogens for phagocytic destruction, by coating the

cells in C3b (short-lived) or C3d (inactive long-lasting) molecules. The hydrolysis of C3

and C5 also generate C3a and C5a anaphylatoxins, which propagate local inflammation by

recruiting phagocytic cells to the site of injury [145-147, 149]. Additionally, C1q is

thought to activate the inflammasome, another component of the innate immune system, by

affecting the phagolysosomal process to trigger inflammasome activation [106]. Increases

in MAC are also associated with activation of the inflammasome [150].

1.5.2. Complement activation and AMD

Under normal conditions, the complement system pathways are under tight

regulation. However, in neurodegenerative diseases such as age-related macular

degeneration (AMD), complement activation is uncontrolled, leading to the continuous

production of complement which can contribute to disease onset and progression [3, 151,

17

152]. Genetic factors are strongly implicated in the pathogenesis of AMD, especially those

involving the innate immune system. In 2005, multiple studies revealed that a single

nucleotide polymorphism (Y402H variant) in CFH, a negative regulator of the alternative

complement pathway, was responsible for the onset of almost 50% of all cases of AMD

[48, 153-156]. Additionally, polymorphisms in C2, CFB and C3 have also been associated

with disease onset [157, 158]. GWAS analysis indicated that there is a link between

complement activation and the progressive expansion of the macular lesion in geographic

atrophy, demonstrating that there was a global upregulation of a suite of complement genes

in the neural retina, including C3, C4, C1s, CFI and SERPING1 [47].

Numerous histopathological investigations have shown that a large range of

complement components and factors (e.g. CFH, CFB, C3, C5, C5b-9) are present in drusen

that have accumulated in the outer retinas of AMD retinas [62, 153, 157, 159-162].

Furthermore, although the terminal membrane attack complex (MAC, C5b-9) is present in

the choriocapillaris as early as three years of age, the significantly increased presence of

MAC in the choriocapillaris of AMD retinas may be indicative of the contribution of

complement to outer retinal cell loss [163-165]. However, even though it is well

established that complement system dysregulation is linked to chronic lesion expansion in

human atrophic AMD, the cellular events mediating this process are unclear.

1.5.3. Complement as a gateway to adaptive immunity

Complement component C1q is often considered to be the bridging molecule

between the innate and adaptive immune system [146, 147, 166]. C1q provides the link to

the adaptive immune response through the binding of antibodies complexed to antigens,

which is part of the classical pathway [167-169]. In addition, the activation of complement

may increase the efficiency of the adaptive immune system [146, 147]. In retinal

degenerative diseases, adaptive immune system cells including T-cells and neutrophils

18

may contribute to RPE degeneration [170, 171]. The anaphylatoxin protein fragment C5a

mediates recruitment of pro-inflammatory T-cells into the eye in a model of neovascular

AMD [172], and C5a increases production of pro-inflammatory cytokines IL-17 and IL-22

by T-cells in AMD patient sera [173]. In neovascular AMD human tissue and animal

models, it is thought that IL-17 is produced primarily by γδT-cells [172, 174, 175].

However, further studies are needed to elucidate the role of the adaptive immune system in

contributing to the progression of retinal degenerations.

1.6. Therapeutic targeting of inflammation

1.6.1. Strategies to manage inflammation in AMD

Therapeutic strategies involved in the treatment of AMD have so far been only

effective in patients with the neovascular ‘wet’ form of the disease. Vascular endothelial

growth factor A (VEGFA)-targeted therapies have proven highly beneficial for

neovascular AMD, with market compounds available to inhibit abnormal blood vessel

growth such as Ranibizumab (Lucentis; Genentech/Novartis) [176], and Aflibercept

(VEGF Trap-Eye/Eylea; Regeneron/Bayer) [177]. However, there are currently no

effective treatments for atrophic ‘dry’ AMD, the most prevalent form of the disease.

Immune-based therapies are being explored as the most likely drug candidates for clinical

trials, including a number of complement system inhibitors [3, 178]. Several clinical trials

are currently underway involving the use of C5 inhibitors [179, 180] and a complement

factor D inhibitor (Lampalizumab, Genentech) [178]. However, the complement system

has a high degree of redundancy, comprising more than 30 different protein components

[145]. Therefore inhibition of specific complement components, especially those involved

in the activation phase of the complement cascade (e.g. C1, C4, C2 components) is likely

19

to be challenging, since blocking one pathway may result in the activation of other

pathways that lead to terminal membrane attack complex formation [178].

Therefore, strategies that inhibit production of complement system components

may be more beneficial. Both RPE cells and macrophages are known to synthesise

complement in the retina [140, 141, 144, 181] and drug treatments that inhibit the

activation and production of complement by these cells may hold therapeutic potential in

slowing the progression of AMD. Novel therapeutic strategies such as microRNAs

(miRNAs), known as ‘master gene regulators’, are being explored as therapeutic molecules

for retinal degenerations, and have been employed experimentally to reduce the expression

of inflammatory genes [182]. Chemokine inhibitors have also been used to regulate the

activation and recruitment of macrophages in experimental models of retinal detachment,

diabetic retinopathy, retinitis pigmentosa, and in a model of atrophic AMD primarily

concerning inhibition of the CCL2-CCR2 axis [89, 183, 184]. However, the issue of

redundancy again plays a role in chemokine signalling, as the inhibition of specific

chemokines or their receptors may actually lead to an increased production of other

chemokines to compensate, of which there are over 50 chemokine ligands and associated

receptors [78, 93, 185].

1.6.2. Broad spectrum chemokine inhibition (BSCI)

Addressing the issue of redundancy, a novel broad spectrum chemokine inhibitor

(BSCI) NR58-3.14.3 has been shown to suppress the entire CCL- and CXCL-signalling

pathways. One of the first BSCIs tested was Peptide 3, which was only effective in vitro

[186]. As a result, NR-58.3.14.3 was synthesised as a cyclic 13 amino acid retroinverso

analogue of Peptide 3, which is 1000 times more potent than Peptide 3 [187]. The new

cyclic structure of the BSCI NR-58.3.14.3 does not affect its broad pan-chemokine

inhibiting ability [188]. The exact mechanism of action of BSCI is not fully understood,

20

however, it is known to act as a blocker for chemokine signalling cues so that leukocyte

recruitment is hindered [187].

NR58-3.14.3 has been promising in a number of different tissue types and disease

models, including skin inflammation [187], cerebral ischemia-reperfusion (IR) injury

[189], obliterative bronchiolitis [190], lung ischemia [191], atherosclerosis [192],

intraperitoneal adhesions [193], endometriosis [194] and pulmonary graft-versus-host

disease (GVHD) [195]. These studies have reported that treatment with NR58-3.14.3 was

able to reduce the accumulation of inflammatory cells in the tissue, and ameliorate tissue

damage. While BSCIs have proven to be effective in reducing inflammation and tissue

degeneration in these disease models, their use in the eye has not been documented.

1.7. In vivo models of retinal degeneration

1.7.1. Animal models of retinal degeneration

Models of wet AMD primarily focus on the use of experimental methods that

induce choroidal neovascularisation (CNV) in the retina (reviewed in [196]). However, to

model retinal atrophy that occurs in dry AMD, several types of rodent models exist, and

many of these models involve increases in oxidative stress and/or inflammation [196, 197].

Knockout models of chemokine genes or complement system genes have been utilised to

develop retinal degeneration in mouse models, including CX3CR1-knockout mice, where a

deficiency in the fractalkine receptor involved in the inhibition of microglial activity is

known to cause retinal pathology [198, 199]. Complement factor H (CFH)-deficient mice

also develop increased C3 deposition and abnormalities in the retina [200].

Rodent models that induce oxidative stress in the retina have been developed to

model features of dry AMD. A model involving the immunisation of mice with

21

carboxyethylpyrrole (CEP)-adducted mouse serum albumin induced retinal degeneration,

where mice developed C3 deposition in the outer retina, macrophage recruitment and

photoreceptor cell death [63, 68, 69]. Retinal photo-oxidative damage (or light damage)

models have been utilised for over 50 years [201] to induce photoreceptor degeneration in

the rodent retina (reviewed in [202, 203]). Although the effect of photo-oxidative damage

in the retina is affected by circadian rhythm and light history of the animals [204, 205],

photo-oxidative damage has been used to initiate photoreceptor death and extensive retinal

remodelling in the rodent retina [206, 207]. This occurs primarily in the superior retina

where the area centralis, an area analogous to the human macula, is located [208].

Our laboratory has demonstrated the use of photo-oxidative damage models of

retinal degeneration using both rats and mice, to investigate the immunological

mechanisms of atrophic AMD pathogenesis [209, 210]. By producing several features of

the disease in the rodent retina, we have demonstrated that oxidative damage and

photoreceptor cell death is induced during exposure to photo-oxidative damage [209, 210].

Damaging light induces ROS production and lipid peroxidation in the retina, which can

initiate photoreceptor loss and upregulate stress mechanisms. Chemokines such as CCL2

are expressed by RPE, Müller cells and activated microglia [85, 87], leading to the

migration of retinal microglia and the recruitment of blood-borne macrophages from the

retinal vasculature and underlying choroid to the damaged photoreceptors [113, 141, 209].

Additionally, these microglia and macrophages have been found to express complement

activation markers such as C3 in the outer retina [141, 211]. These inflammatory

components are associated with the progression of retinal degeneration following exposure

to photo-oxidative damage. Substantial focal lesion development occurs in the

photoreceptor layer, starting at the area centralis in the superior retina and eventually

expanding over time [209, 210], modelling a key feature of atrophic AMD.

22

1.7.2. Complement activation in animal models

Models of photo-oxidative damage show that complement activation is facilitated

by microglia and macrophages in the damaged retina, and indicate that complement

expression may be associated with further photoreceptor damage [141, 211, 212]. The

expression of retinal complement by microglia and macrophages is also observed in

models of ageing [143, 144]. However, further studies are needed to elucidate the role of

these cells in contributing to complement activation and prolonged retinal remodelling,

using a protracted time course of progressive retinal degeneration. Additionally, the

cellular contribution of complement-expressing cells in the retina is not fully understood.

RPE cells were initially reported to be major producers of complement in the retina [140,

181, 213, 214]. However, emerging evidence indicates that microglia and macrophages are

the more likely primary mediators of complement expression in the degenerating retina

[140-144]. Investigation of the contribution of these local retinal sources of complement to

retinal degeneration is necessitated.

Furthermore, the contribution of each complement pathway upon activation is not

fully understood, and it has been suggested that more than one complement pathway may

be involved in the progression of retinal degeneration [215]. The activation of the

alternative pathway is known to contribute to retinal degeneration in several animal models

[216-220]. Recently, CFH has been described to have a non-canonical role in mononuclear

phagocyte clearance in the degenerating retina, where CFH mutations may result in the

toxic accumulation of these cells, including microglia and macrophages, in the outer retina

[309]. Novel roles for the complement pathways are continuing to be uncovered, and so

further characterisation of complement activators and regulators in retinal degeneration is

necessary to fully understand how complement activation can be targeted therapeutically.

23

1.8. Summary and aims

The activation and accumulation of microglia and macrophages in the degenerating

retina are highly implicated in the progression of retinal diseases such as AMD. However,

several key questions remain unanswered, regarding their contributions to complement

activation and photoreceptor death in progressive retinal degeneration.

The overall aims of this thesis are:

1. To determine the contribution that microglia and macrophages have in propagating the

inflammatory response in retinal degeneration, which may lead to further photoreceptor

cell death and atrophic lesion development.

2. To utilise novel therapeutic strategies to inhibit the activity of these microglia and

macrophages in the degenerating retina.

Chapter 2 outlines the general methodology described throughout this thesis.

Chapter 3 characterises the role of complement activation by microglia and macrophages

in contributing to retinal degeneration in humans, rats and mice, with a particular focus on

the role of C3 in atrophic lesion development. Chapter 4 describes the therapeutic potential

of a broad spectrum chemokine inhibitor (BSCI) NR58-3.14.3 in modulating

inflammatory-mediated cell death by macrophages in retinal degeneration. Chapter 5

details the role of interleukin-1β (IL-1β) in promoting chemokine production by retinal

supporting cells in retinal degeneration, and we demonstrate the use of two inhibition

strategies to reduce IL-1β-derived macrophage recruitment. Finally, the significance of

these findings is discussed in Chapter 6.

24

2. METHODS

25

2.1. In vitro experiments

2.1.1. Cell cultures

Immortalised human cell lines for Müller cells (MIO-M1, Müller 1 Moorefields

Institute of Ophthalmology; Dr A. Limb, Institute of Ophthalmology, University College

London, UK) and RPE cells (ARPE-19, ATCC CRL-2302; American Tissue Culture

Collection, VA, USA) were cultured for experiments presented in this thesis. Cell lines

were authenticated by CellBank, Australia. Cell lines stored at -80°C were thawed and

grown in a tissue culture flask with Dulbecco's Modified Eagle Medium (DMEM, high

glucose with sodium pyruvate; Sigma-Aldrich, MO, USA) supplemented with 10% fetal

bovine serum (FBS; Thermo Fisher Scientific, MA, USA) and 3mM L-glutamine (Thermo

Fisher Scientific). Cells were incubated at 37°C in a humidified atmosphere (95% air and

5% CO2). To passage the cells every 3 to 4 days, cells were incubated with trypsin solution

(containing 2.5% trypsin (Thermo Fisher Scientific), 1% EDTA and 0.1M phosphate

buffered saline (PBS)) for 3 minutes at 37°C to detach the cells from the flask. Cells were

centrifuged then split 1:5 into a new flask and incubated at 37°C until needed for

experiments, as detailed later in this thesis.

2.2. Animal experiments

2.2.1. Animal rearing and holding

All animal experiments reported in this thesis were conducted in accordance with

the ARVO Statement for Use of Animals in Ophthalmic and Vision Research, and with

approval from the ANU Animal Experimentation Ethics Committee (Ethics ID: A2012/07,

A2014/56). Adult Sprague-Dawley (SD) rats were utilised in these experiments, which

26

were born and reared under cyclic dim light conditions (12 hours at 5 lux, 12 hours at 0

lux) in open-top cages. All rats were aged between 90-120 post-natal days at the time of

use. Additionally, adult C57BL/6J mice aged 60-80 days and age-matched homozygous

C3-knockout mice (C3-/-, 129S4-C3tm1Crr/J) were used in these experiments. Mice were

born and reared in individually ventilated cages (IVCs) in cyclic dim light conditions (12

hours at 5 lux, 12 hours at 0 lux) until needed for further experiments.

2.2.2. Intravitreal injections

Intraocular (intravitreal) injections were performed to deliver compounds of

interest (NR58-3.14.3, C3 siRNA, Il-1β siRNA) into the eye. A total volume of 3µl was

delivered via intravitreal injection into each rat eye, and a total volume of 1µl into each

mouse eye. These volumes were chosen as they minimise disturbance to the pressure of the

eye, reducing the risk of cataract formation [221]. All compounds were delivered in

ultrapure endotoxin-free 0.1M PBS (Thermo Fisher Scientific).

Prior to all injections, animals were restrained and anaesthetised using a mixture of

Ketamine (100mg/kg body weight; Troy Laboratories, NSW, Australia), an anaesthetic,

and Ilium Xylazil-20 (12mg/kg body weight; Troy Laboratories), a muscle relaxant,

delivered through an intraperitoneal injection with an insulin syringe. Each animal was

checked for signs of unconsciousness, including loss of movement (except for breathing),

and loss of the corneal and toe-pinch reflexes. A heat mat was used to maintain core body

temperature. A pupil dilator was administered to both eyes (Minims Atropine Sulphate 1%

w/v eye drops for mice, or Minims Tropicamide 0.5% w/v eye drops for rats; Bausch and

Lomb, NSW, Australia). Animals were then transferred to a surgery mat under a Zeiss

OPMI 99 examination microscope (Zeiss, West Germany), or a Leica M125 stereo

microscope (Leica Microsystems, Wetzlar, Germany), which was used to aid the

intravitreal injection process. Following dilation of the pupil, a cotton string loop was tied

27

around the eye lifting it from the socket. 10% w/v povidone-iodine antiseptic liquid

(Betadine; Faulding Pharmaceuticals, SA, Australia) was applied to each eye before

injection.

The injectable compound of interest was drawn up into a 10µl Hamilton syringe

with an attached 34G bevelled needle (World Precision Instruments, FL, USA). Using a

30G bevelled needle (Becton Dickinson, NJ, USA), a small puncture wound was made into

the eye about 1mm from the limbus. The tip of the needle was inserted in a supero-

temporal direction and then removed. The 34G needle attached to the Hamilton syringe

was inserted into the hole, and 1-3µl of solution was intravitreally injected into each eye.

Following the injection, Chlorsig antibiotic cream (Aspen Pharma, NSW, Australia) was

applied to the injection site. Eye gel (GenTeal; Novartis, NSW, Australia) was

administered to both eyes to prevent dryness, and the animal was recovered on a heat mat.

2.2.3. Photo-oxidative damage

Photo-oxidative damage (or light damage) has been used as a model to induce

retinal degeneration in rodents for over 50 years [201]. The use of two photo-oxidative

damage models have been reported throughout this thesis as previously published; a rat

model [209] and a mouse model [210]. SD rats were placed into transparent Perspex open-

top boxes and exposed to 1000 lux white light for 24 hours (COLDF2, 2x36W, IHF; Thorn

Lighting, Spennymoor, UK), with free access to food and water. Lighting levels were set to

1000 lux using a light meter device (DLM2; UEi Test Instruments, OR, USA). Following

photo-oxidative damage and post-damage live animal analysis, animals were either

euthanized for tissue collection (0 day time point) or were held under dim lighting (5 lux)

until required for tissue collection (3, 7, 14 or 56 days).

C57BL/6J and C3-/- mice were placed into Perspex boxes coated with a reflective

interior surface, and exposed to 100 Klux of natural white light-emitting diodes (LED) for

28

up to 7 days, with free access to food and water. Lighting levels were set to 100 Klux using

a light meter device (HD450; Extech MA, USA). During the course of photo-oxidative

damage, each animal was administered with pupil dilator eye drops twice daily, morning

and evening (Minims Atropine Sulphate 1% w/v eye drops; Bausch and Lomb). Following

photo-oxidative damage and post-damage live animal analysis, animals were euthanized

for tissue collection. Age-matched non-damaged animals were used in all rat and mouse

experiments as dim-reared controls.

2.2.4. Electroretinography (ERG)

Electroretinography (ERG) was used to measure mouse retinal function in response

to full-field flash stimuli under scotopic conditions in dim-reared control and photo-

oxidative damaged animals in methods previously published [210]. Mice were dark-

adapted overnight prior to the measurement of retinal recordings, and all recordings were

performed in a dark room with minimal red light sources. Animals were restrained and

intraperitoneally anaesthetised using a mixture of Ketamine (100mg/kg body weight; Troy

Laboratories) and Ilium Xylazil-20 (12mg/kg body weight; Troy Laboratories). A heat mat

was used to maintain core body temperature. A pupil dilator (Minims Atropine Sulphate

1% w/v eye drops; Bausch and Lomb) and eye gel (GenTeal; Novartis) was administered

to both eyes prior to taking retinal recordings.

The animal was setup on a homeothermic blanket to maintain body temperature at

at 37°C using a rectal probe (Harvard Apparatus, MA, USA). A cotton loop was tied

around the eye, and the head of the animal was inserted into the Ganzfeld sphere. An earth

probe was placed on the hind foot of the animal. An Ag-AgCl reference probe was placed

in the mouth of the animal (SDR Scientific, NSW, Australia) and a corneal probe was

placed on the corneal surface of the eye to be examined. Eye drops or gel was administered

to both eyes prior to commencing the recordings. A BioAmp (AD Instruments, Dunedin,

29

New Zealand) set at 2mV was used to ensure there was minimal noise in the setup. A

single-flash paradigm was used to elicit mixed (rod and cone) responses. Mice were

exposed to flash stimuli over the intensity range of -4.4-1.9 Log cd.s/m2 using an LED-

based system (FS-250A Enhanced Ganzfeld; Photometric Solutions International, VIC,

Australia). The interstimulus interval was increased from 2 seconds for the lowest

intensities to 4 minutes for the highest intensities to allow complete recovery of the b-wave

between stimuli. Following the retinal recordings, eye gel (GenTeal; Novartis) was

administered to both eyes of the animal to maintain hydration upon recovery of the animal.

Measurements of the a-wave and b-wave were performed using Lab Chart 8 (AD

Instruments). An assessment of retinal function was made by comparison of the amplitudes

of the a-wave and b-wave between experimental groups. The amplitude of the a-wave was

measured from the baseline to the trough of the a-wave (minimum value), and the

amplitude of the b-wave was measured from the trough of the a-wave to the peak of the b-

wave (maximum - minimum value). The a-wave and b-wave data were fitted with a Naka-

Rushton equation [R/Rmax = I/(I + K)] using the Solver function in Microsoft Excel 2013 to

determine Rmax (maximum amplitude) and K (semi-saturation constant) from the response

amplitude (R) and the flash intensity (I).

2.2.5. Optical Coherence Tomography (OCT)

Optical coherence tomography (OCT) is a technique used to assess morphology of

the retinal layers. Cross-sectional retinal and fundus images were undertaken in live rats

using a Spectralis HRA+OCT device (Heidelberg Engineering, Heidelberg, Germany).

Animals were anaesthetised with an intraperitoneal injection of Ketamine (100 mg/kg body

weight; Troy Laboratories) and Ilium Xylazil-20 (12 mg/kg body weight; Troy

Laboratories). A heat mat was used to maintain core body temperature. Following

anaesthesia, a pupil dilator (Minims Tropicamide 0.5% w/v eye drops; Bausch and Lomb)

30

and hypromellose 0.3% eye drops (GenTeal; Novartis) was administered to both eyes. A

rodent contact lens was placed on the eye (PMMA lenses, radius of curvature of the central

optic zone of 2.70mm and diameter of 5.20mm; Cantor + Nissel, Brackley, UK) [222].

Animals were restrained on a custom-made platform attached to the Spectralis

HRA+OCT imaging device, adapted for rat eyes according to the manufacturer’s

specifications (Heidelberg Engineering). Eyes were kept well-hydrated using the

hypromellose eye drops to maintain corneal hydration and improve OCT image quality.

Using the Heidelberg Eye Explorer software (Heidelberg Engineering) with a C-Curve

setting of 7.7mm (radius of the curvature of the anterior corneal surface), the camera was

switched on and confocal scanning laser ophthalmoscopy (cSLO) was used to take fundus

images of the retina. A custom glass 25 diopter lens optimised for rodent cSLO was fitted

to the device over the 30 degree lens (Heidelberg Engineering). The filter wheel was set to

Position A or R (acquisition mode). The camera was moved left to right to line up with the

eye, then was moved up and down until aligned with the eye. The camera was moved

slowly towards the eye until an evenly-illuminated cSLO image was displayed. The focus

was set to 0.00D prior to image acquisition. For OCT images, the camera was moved back

and the custom mouse lens was removed. The camera was slowly moved back towards the

eye using the focus knob to keep the retina in the display. Once the retina spanned the

length of the display at a minimum imaging quality of 25dB, a line scan or volume scan

was obtained with an automatic real time (ART) mean of 100 frames. Cross-sectional OCT

images were taken in 1mm increments from the optic nerve (up to 3mm superior, and 2mm

inferior to the optic nerve) to assess retinal layer thickness. Following retinal imaging, the

contact lens was removed from the eye and eye gel (GenTeal; Novartis) was administered

to both eyes of the animal to maintain hydration upon recovery.

OCT and fundus images were analysed using ImageJ software (NIH, MD, USA).

31

Cross-sectional images of the retina were analysed per millimetre in duplicate, with a

minimum of 5 measurements of individual retinal layers manually taken per cross-

sectional image. The outer nuclear layer (ONL) containing the photoreceptor cell bodies

was measured to determine photoreceptor loss in each experimental group following

photo-oxidative damage, and compared to control retinas. ONL thickness ratios were

calculated as the thickness of the ONL relative to the distance between the inner and outer

limiting membranes (ILM-OLM). Fundus images were used to detect the presence of a

retinal lesion in areas of ONL thinning, where the fundus appeared darker. Images of the

area of interest (2-3mm superior to the optic nerve) were converted to greyscale (8-bit),

and contrast and brightness were optimised using the ‘curves’ function in Photoshop CS6

using a standard approach. Images were then converted to bitmaps using controlled

parameters (99 pixels/inch, halftone screen, 53 lines/inch, 45˚, square). ImageJ was used to

measure the lesion size manually (arbitrary units).

2.2.6. Tissue collection

Following live animal experiments, rats were euthanized intraperitoneally using an

overdose of barbiturate (Lethabarb, 60mg/kg body weight; Virbac, NSW, Australia; 2%

Ilium Lignocaine-20; Troy Laboratories), and mice were euthanized using carbon dioxide

(CO2). Tissue collection commenced after confirming death, indicated by the loss of

movement, reflexes, breathing and heartbeat. To collect the retina for molecular analysis, a

corneal incision was made along the surface of one eye, and the retina was excised from

the eye and placed into 150µl RNAlater (Thermo Fisher Scientific) at 4°C to preserve the

RNA until extraction. The retinas were kept at 4°C overnight prior to their long-term

storage at -80°C until required for RNA extraction.

For histological analysis, the superior aspect of the other eye was marked with a

permanent marker pen for orientation. Using dissecting scissors and forceps (World

32

Precision Instruments), each eye was lifted from the socket, and was enucleated from the

connective tissues. The eye was injected with approximately 50µl 4% paraformaldehyde

fixative using an insulin syringe and was collected into a vial containing 4%

paraformaldehyde for 3 hours at 4°C. Following fixation, the eyes were washed 3 times

with 0.1M PBS for 5 minutes each wash. The eyes were then left in 15% sucrose solution

overnight at 4°C for cryoprotection prior to embedding the following day.

2.3. Histological and in situ molecular analysis

2.3.1. Embedding

Prior to cryosectioning the eyes for histological analysis, enucleated eyes were

embedded in Tissue-Tek Optimal Cutting Temperature Compound (Sakura Finetek USA

Inc., CA, USA). Dry ice was slowly added to acetone in a plastic container, until the

temperature of the mixture had dropped to approximately -78°C. Truncated plastic

embedding moulds (Pro Sci Tech, QLD, Australia) were filled with the Tissue-Tek

medium. Each eye was placed into an individual mould, with the marked superior aspect of

the eye facing the same direction for orientation. The mould was then lowered into the dry

ice and acetone freezing mixture and the eye was snap-frozen for approximately 2 minutes,

until the Tissue-Tek medium had frozen into a solid block with a small peak in the centre

of the block. The mould was double-wrapped in aluminium foil and transferred to -20°C

for long-term storage until cryosectioned.

2.3.2. Cryosectioning

Retinal cryosections of each eye were cut using a Leica CM 1850 cryostat (Leica

Microsystems). Cryosections were cut at 16µm for rat eyes, and 12µm for mouse eyes,

33

where each retinal section contained approximately 2 layers of photoreceptors in the outer

nuclear layer (ONL). Each eye was mounted onto the cryostat chuck using a small amount

of Tissue-Tek medium, with the superior aspect of each eye facing the same direction for

consistent sections. Para-sagittal cryosections were collected from the optic nerve (ON)

central region of the eye, where retinal damage is primarily located in the superior retina

following photo-oxidative damage [206, 209, 210]. Cryosections contained structures from

the whole eye, including the sclera, lens, retina, choroid and optic nerve. For each eye, 20-

40 sections were collected onto labelled Superfrost Ultra Plus glass slides in duplicate

(Menzel-Glaser, Braunschweig, Germany). A Leica DM 1000 light microscope (Leica

Microsystems, Wetzlar, Germany) was used to visualise the sections. Slides were oven-

dried at 37°C overnight, and were transferred to -20°C for long-term storage.

2.3.3. TUNEL assay

The terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay

is used in situ to detect cells undergoing DNA fragmentation during apoptosis, necrosis

and autolysis [223]. The terminal deoxynucleotidyl transferase (Tdt) enzyme adds

biotinylated dUTP molecules onto fragmented DNA strands. Upon secondary labelling,

cell death is visualised and can be quantified.

In retinal cryosections, photoreceptor cell death was investigated using the TUNEL

assay. Retinal cryosections containing the optic nerve were equilibrated to room

temperature, and a hydrophobic barrier was drawn around the sections on the slides with a

pap pen (Daido Sangyo, Tokyo, Japan). Slides were immersed in 70% ethanol for 10

minutes and then Milli-Q water (MQ H2O) for 10 minutes. 0.1% Triton X (Sigma Aldrich)

was added to sections for 2 minutes for permeabilisation of the membranes, before rinsing

in 0.1M PBS for 10 minutes. Slides were equilibrated in 1x Tdt buffer for 10 minutes prior

to addition of the Tdt reaction mixture.

34

The Tdt reaction mixture was prepared using 1060µl MQ H2O, 125µl 10x Tdt

buffer, 3µl biotin dUTP (Roche Diagnostics, Basel, Switzerland) and 1.5µl Tdt enzyme

(Roche Diagnostics). The mixture was added evenly across all sections, and the slides were

incubated at 37°C for 1 hour in a humid chamber. The reaction was then stopped by

immersing the slides in 2x saline-sodium citrate (SSC) buffer for 15 minutes. Slides were

blocked with 10% normal goat serum (NGS; Sigma Aldrich) for 10 minutes prior to adding

the secondary label. Streptavidin conjugated to Alexa Fluor 594 (1:500; Thermo Fisher

Scientific) was added evenly across all sections under dim conditions. The slides were

incubated at 37°C for 1 hour in a humid chamber. Following secondary labelling, slides

were rinsed twice in 0.1M PBS for 5 minutes each. For visualisation of the cellular layers,

a DNA label (Bisbenzimide or Hoechst’s stain, 1:10000; Sigma Aldrich) was added to all

sections for 2 minutes, followed by another rinse in 0.1M PBS for 5 minutes. Slides were

coverslipped with Aqua Poly/Mount (Polysciences, PA, USA) prior to visualisation. Slides

were sealed with nail varnish and were stored at 4°C.

2.3.4. Immunohistochemistry

The detection and localisation of specific proteins in situ was determined using

immunohistochemistry (IHC), with primary antibodies utilised throughout this thesis

detailed in Table 2.1. Retinal cryosections containing the optic nerve were used for

histological analysis. For comparison, a negative control slide (no primary antibody) was

included with each immunohistochemistry run. Slides were equilibrated at room

temperature and a hydrophobic barrier was drawn around the sections with a pap pen.

Slides were soaked in 70% ethanol for 10 minutes, MQ H2O for 5 minutes, and 0.1M PBS

for 5 minutes. To perform antigen retrieval, sections were incubated in Reveal-It Ag

(ImmunoSolution, QLD, Australia) at 37°C for 1 hour. Sections were blocked with 10%

normal goat serum (NGS) at room temperature for 1 hour. Modifications to the blocking

35

procedure are as follows: 3% bovine serum albumin (Roche Diagnostics) was used as the

blocking solution prior to the addition of the α-C3d antibody, while Image-iT FX Signal

Enhancer (Thermo Fisher Scientific) was used as the blocking solution for the α-C3

antibody. Primary antibodies (Table 2.1) were then added evenly to each section. Slides

were incubated at 4°C for approximately 16 hours overnight in a humid chamber.

Slides were washed 4 times, each for 5 minutes in 0.1M PBS. Secondary

antibodies, conjugated to either Alexa 594 or 488 (Thermo Fisher Scientific), were added

evenly to the sections under dim conditions. Slides were incubated at room temperature for

4 hours or at 37°C for 2 hours in a humid chamber. Following incubation with the

secondary antibody, slides were washed 4 times, each for 5 minutes in 0.1M PBS. A DNA

label (Bisbenzimide or Hoechst’s stain) was added to the sections for 2 minutes, for

visualisation of the cellular layers. Slides were rinsed in 0.1M PBS for 5 minutes before

coverslipping with Aqua Poly/Mount. Slides were sealed with nail varnish and stored at

4°C. Note: For double labelling, both primary antibodies (and both secondary antibodies)

were added simultaneously.

Table 2.1. List of primary antibodies used for immunohistochemistry

Primary Antibody Dilution Catalogue Number Company

Rabbit α-C3 1:50 AB118877 Abcam, Cambridge, UK

Goat α-C3d 1:100 AF2655 R&D Systems, MN, USA

Rabbit α-GFAP 1:500 Z0334 Dako, Glostrup, Denmark

Rabbit α-IBA1 1:500 019-19741 Wako, Osaka, Japan

Goat α-IL-1β 1:500 AF501 R&D Systems, MN, USA

Rabbit α-Rhodopsin 1:500 AB9279 Merck Millipore, MA, USA

Mouse α-Vimentin 1:100 V6630 Sigma Aldrich, MO, USA

36

2.3.5. In situ hybridisation

In situ hybridisation (ISH) is a technique utilised to visualise mRNA expression in

tissue sections, to determine the cellular source and/or expression pattern of a specific gene

of interest. A riboprobe is synthesised with the complementary sequence to the mRNA

being detected. In this thesis, C3, Ccl2 and Cxcl1 mRNA transcripts were detected in

retinal cryosections using riboprobes previously synthesised [87, 141]. C3 was cloned from

PCR products derived from human (460bp amplicon) and rat (483bp amplicon) retinal

cDNA. Ccl2 and Cxcl1 were also cloned from PCR products (550-bp and 504-bp

amplicons respectively) from rat retinal cDNA. These cloned templates were then

synthesised into digoxigenin (DIG)-labelled riboprobes. In situ hybridisation was

conducted using our established protocol [224]. All chemicals were sourced from Sigma

Aldrich, unless specified.

RNAses were cleaned from the bench and wash containers with RNAse Zap

solution (Thermo Fisher Scientific) and MQ H2O. Slides were labelled and air-dried in a

fume hood or biological cabinet for 30 minutes. A slide for addition of the ‘sense’ probe

was included in the run as a control. For the pre-treatment steps prior to hybridisation,

slides were immersed in 0.1M PBS for 5 minutes then in 10% neutral buffered formalin

(NBF) for 20 minutes. Slides were rinsed twice in 0.1M PBS for 5 minutes each, before

being treated with 20µg/ml Proteinase K in Tris-EDTA (TE) at 37°C for 7 minutes. Slides

were rinsed in 0.1M PBS for 5 minutes, and then were soaked in 10% NBF for 20 minutes.

Slides were placed in 0.1M triethanolamine (TEA) containing 630µl of acetic anhydride

for 10 minutes, followed by a 0.1M PBS 5 minute wash. Slides were washed in 0.9% NaCl

for 5 minutes. A series of ethanol solutions were used to dehydrate the sections; 50%

ethanol for 1 minute, 70% ethanol for 2 minutes, 90% ethanol for 1 minute, 2 washes with

37

100% ethanol for 2 minutes. The slides were then air-dried in the fume hood or biological

cabinet for 1 hour prior to hybridisation.

The pre-hybridisation (pre-hyb) and hybridisation (hyb) mixes (prepared from

NaCl, Tris-HCl, NaH2PO4, NaEDTA, Ficoll 400, dithiothreitol, poly ribo A, yeast t-RNA,

dextran sulphate, formamide) were heated to 60°C. The pre-hyb mix was added evenly to

the sections, and a coverslip was placed on top of the sections. The slides were placed in a

hydrated fume box at 55-57°C for 3 hours. Following the pre-hybridisation step, the hyb

mix containing the antisense probe was added evenly to the slides; the sense probe was

added to the control slide, and a coverslip was placed onto the sections. The slides were

incubated in a hydrated fume box at 55-57°C for approximately 16 hours overnight.

Following hybridisation, the slides were washed in a series of saline-sodium citrate

buffers (SSC, pH 7.4). Slides were briefly dipped 2 to 3 times into 4x SSC at 60°C to

remove the coverslips. Slides were washed in 2x SSC at 60°C for 30 minutes, 1x SSC at

60°C for 30 minutes, twice in 0.1x SSC at 60°C for 30 minutes, and finally in 0.1x SSC at

room temperature for 10 minutes. To prepare the slides for antibody detection, slides were

rinsed for 1 minute in washing buffer, constituted from maleic acid, Tween-20 (Amresco,

OH, USA) and MQ H2O. Slides were then blocked with 2x blocking solution for 30

minutes (made from Blocking Reagent, maleic acid and MQ H2O). The anti-digoxigenin

(DIG) antibody (1:1000; Roche Diagnostics) was added evenly to the slides, and incubated

at room temperature for 30 minutes.

Following addition of the antibody, slides were washed 3 times in washing buffer

for 40 minutes each, and then washed in detection buffer (constituting Tris-HCl, NaCl, MQ

H2O, no Mg2+) for 5 minutes. Slides were then incubated in a NBT/BCIP colour substrate

reaction mixture in detection buffer at 4°C for 1 to 16 hours (variable) under dim

conditions until the colour reaction had fully developed with minimal background staining

38

as checked under a Leica DM 1000 light microscope (Leica Microsystems), taking care not

to overstain the slides. Slides were then rinsed in MQ H2O for 10 minutes to stop the

reaction, and then placed into 10% NBF for at least 20 minutes at 4°C. Slides were rinsed

twice in 0.1M PBS for 5 minutes. For double labelling of the sections,

immunohistochemistry was used following the protocol described above. As an alternative

to NBT/BCIP staining, HNPP/Fast-Red (Roche Diagnostics) was incubated for 1.5 hours

prior to immersion in MQ H2O to stop the reaction. Slides were coverslipped in Aqua

Poly/Mount and stored at 4°C.

2.4. Molecular analysis

2.4.1. Fluorescence-activated cell sorting (FACS)

Fluorescence-activated cell sorting (FACS) was utilised to isolate CD11b+ cells

from rat retinas, which were pooled from 2 animals (4 retinas) for each sample. Retinas

were removed from the rat eye through a corneal incision and were placed into Hank's

balanced salt solution (HBSS with 0.1% glucose, no phenol red, Ca2+ or Mg2+; Thermo

Fisher Scientific) at 4°C. Retinas were transferred onto a sterile petri dish and crosshatched

using a razor blade to fragment the retinas. A pipette tip was used to transfer the retinas to

an Eppendorf tube containing 0.5ml of chilled digestion mix, containing 2mg/ml (0.2%)

papain (Worthington Biochemicals, NJ, USA), 660 µg/ml (5.5mM) L-cysteine (Sigma

Aldrich), 10µg/ml gentamycin (Sigma Aldrich), 100U/ml DNAse I (Roche Diagnostics),

5µg/ml superoxide dismutase (SOD; Worthington Biochemicals) and 5µg/ml catalase

(Sigma Aldrich). Samples were incubated at 37°C for 7 minutes then at 8°C for 30

minutes, during which samples were gently homogenised with a pipette to dissociate the

cells in suspension.

39

Samples were centrifuged for 5 minutes at 1550 rpm at 4°C, and the supernatant

was removed. Cells were resuspended and incubated for 10 minutes in 0.5ml chilled

neutralisation mix, containing HBSS (with 0.2% glucose and 4% bovine serum albumin

(BSA; Roche Diagnostics)), 50µg/ml antipain (Roche Diagnostics), 10µg/ml gentamycin,

100U/ml DNAse I, 5µg/ml SOD and 5µg/ml catalase. Samples were centrifuged for 5

minutes at 1550 rpm at 4°C, and the supernatant was removed. Cells were resuspended in

1ml of chilled staining buffer, containing HBSS, 1mg/ml (0.1%) sodium azide (Sigma

Aldrich) and 10mg/ml (1%) BSA. Cells were divided into multiple tubes for antibody

staining as necessary (including an unstained control) and centrifuged for 5 minutes at

1200 rpm at 4°C. After the supernatant was removed, the CD11b antibody conjugated to

Alexa 647 (Biolegend, CA, USA) was diluted in chilled staining buffer, and was added to

the samples for 30 minutes at 4°C. The unstained control sample was resuspended in

staining buffer without an antibody.

Samples were centrifuged for 5 minutes at 1200 rpm at 4°C and the supernatant

was removed. The cells were resuspended and centrifuged twice in washing buffer,

containing 1mg/ml (0.1%) sodium azide, 10mg/ml (1%) BSA and 2mM EDTA. Following

the final spin down of the cells, samples were resuspended in chilled staining buffer and

were ready for analysis. CD11b-stained samples were sorted through a fluorescence

activated cell sorter at the Imaging and Cytometry Facility at JCSMR, ANU (FACSAria II;

BD Biosciences, NJ, USA). The isolated CD11b+ cells were collected in chilled staining

buffer and were kept at 4°C for immediate RNA extraction.

2.4.2. RNA extraction

Total RNA was extracted from whole rat retinas using a combination of TRIzol

(Thermo Fisher Scientific) and an RNAqueous Total RNA Isolation Kit (Thermo Fisher

Scientific). For RNA extraction from whole mouse retinas, cultured cells or FACS-isolated

40

cells, an RNAqueous Micro Total RNA Isolation Kit (Thermo Fisher Scientific) was used.

Retinas/cells were homogenised in 200µl TRIzol using a plastic pestle. Following

homogenisation, another 400µl TRIzol (660µl for the micro kit; 1ml per 50-100mg tissue)

was added to the samples, vortexed for 5 seconds and incubated at room temperature for 7

minutes. 1/5 volume of chloroform was added to the samples, which were vortexed

thoroughly for 20 seconds. Samples were centrifuged for 10 minutes at 13000g at 4°C to

separate the layers into RNA, DNA and protein phases. Following centrifugation, the top

aqueous phase containing the RNA was collected into a new sample tubes. An equal

volume of 64% ethanol was added to the RNA (half volume of 100% ethanol for the micro

kit). Samples were vortexed for 5 seconds and transferred into the appropriate filter column

for the kit, followed by centrifugation for 10 seconds at 13000g to trap the RNA in the

filter. The flowthrough was discarded.

Samples were then run through a series of wash steps to purify the RNA. 700µl of

wash solution 1 (180µl for the micro kit) was added to the columns and centrifuged for 10

seconds at 13000g. After discarding the flowthrough, 500µl of wash solution 2/3 (180µl

for the micro kit) was washed through the columns twice and centrifuged for 10 seconds at

13000g. The flowthrough was discarded, and the filter columns were air-dried in the

centrifuge for 1 minute at 13000g. The filter columns were placed in new tubes for

collection of the RNA. Pre-heated 75°C elution solution was added onto the filter (30µl for

a standard sized filter, 10µl for the small filter in the micro kit) and left for 1 minute to heat

the filter to allow the RNA to be eluted through. Columns were spun in the centrifuge for

30 seconds at 13000g. Another 20µl of heated elution solution (10µl for the micro kit)

were added to the filters for further elution of the RNA. Samples were analysed for RNA

quantity and purity using an ND-1000 spectrophotometer (Nanodrop Technologies, DE,

USA) and were stored at -80°C.

41

2.4.3. cDNA preparation

Using 500-1000ng of extracted RNA, cDNA was prepared using a Tetro cDNA

Synthesis Kit (Bioline, London, UK). A 14µl mixture of RNA, Oligo (dT) Primer

(500µg/ml), dNTPs (10mM) and RNAse-free H2O was prepared for each RNA sample in

0.2ml tubes. Using a Veriti 96-Well Thermal Cycler (Applied Biosystems, CA, USA), the

tubes were incubated for 5 minutes at 70°C then were chilled at 4°C for 5 minutes. The

reverse transcriptase master mix was prepared from 5x RT buffer (4µl per tube), RiboSafe

RNAse Inhibitor (10U/µl; 1µl per tube) and Tetro Reverse Transcriptase (200U/µl; 1µl per

tube). 6µl of master mix was added to each sample tube. For a negative control tube, no

reverse transcriptase enzyme was added. All tubes were incubated for 30 minutes at 45°C

on the thermocycler. The reaction was terminated by increasing the temperature to 80°C

for 5 minutes, and then tubes were chilled at 4°C. cDNA samples were stored at -20°C.

2.4.4. Quantitative real-time PCR

Quantitative real-time polymerase chain reaction (qPCR) was performed using

synthesised cDNA. The master mix for each cDNA sample was prepared for each gene to

be run in technical duplicate. For each reaction, 0.2-0.4µl of cDNA template (prepared

from 500-1000ng RNA) was added to RNAse-free H2O to a total volume of 4.5µl. These

master mixes were added to a 384-well plate (Applied Biosystems) for each cDNA sample.

To prepare the gene master mixes for each cDNA sample in duplicate, 2x Taqman Gene

Expression Master Mix (5µl per reaction; Thermo Fisher Scientific) was mixed with

specific Taqman hydrolysis assays (0.5µl per reaction; Thermo Fisher Scientific)

dependent on the gene of interest. Table 2.2 is a list of Taqman assays used throughout this

thesis. These master mixes were added into the 384-well plate. Plates were covered with a

MicroAmp Optical Adhesive Film (Applied Biosystems), and were run on a QuantStudio

12K Flex instrument (Applied Biosystems). The plate was incubated at 50°C for 2 minutes,

42

and then was heated to 95°C for 10 minutes for AmpliTaq Gold DNA Polymerase

activation. In the PCR stage (40 cycles), samples were heated at 95°C for 15 seconds to

denature the strands, then at 60°C for 1 minute to anneal and extend; the fluorescence in

each well was read on the instrument. The expression of all target genes was compared to

the Gapdh and Actb housekeeping genes using the comparative cycle threshold (Ct)

method (ΔΔCt). These reference genes do not change expression with retinal photo-

oxidative damage [225]. The QuantStudio software was used for qPCR analysis.

Table 2.2. Taqman hydrolysis assays used for qPCR (Thermo Fisher Scientific)

Gene Symbol Gene Name Catalogue Number Entrez Gene ID

Actb Actin, beta Mm01205647_g1 11461

C1s Complement component 1, s

subcomponent

Rn00594278_m1 192262

Mm01625167_g1 50908

C2 Complement component 2 Rn00597176_m1 24231

Mm00442726_m1 12263

C3 Complement component 3 Mm00437858_m1 12266

C4a Complement component 4A

(Rodgers blood group)

Rn00709527_m1 24233

Mm01132415_g1 625018

Casp1 Caspase 1 Rn00562724_m1 25166


Ccl2 Chemokine (C-C motif) ligand 2 Rn01456716_g1 24770

Ccl3 Chemokine (C-C motif) ligand 3 Rn00564660_m1 25542



Cfb Complement factor B Rn01526084_g1 294257

Mm00433918_g1 14962

Cfd Complement factor D (adipsin) Rn01535436_g1 54249

Cfh Complement factor H Rn00590326_m1 155012

Mm01299248_m1 12628

Cfi Complement factor I Rn00577333_m1 79126

Cntf Ciliary neurotrophic factor Mm00446373_m1 12803

43

Cxcl1 Chemokine (C-X-C) motif

ligand 1

Rn00578225_m1 81503

Cxcl10 Chemokine (C-X-C) motif

ligand 10

Rn01413889_g1 245920

Fgf2 Fibroblast growth factor 2 Mm01285715_m1 14173

Gapdh Glyceraldehyde-3-phosphate

dehydrogenase

Rn99999916_s1 24383

Mm99999915_g1 14433

Il-1β Interleukin 1β Rn00580432_m1 24494

Il-6 Interleukin 6 Rn01410330_m1 24498


Nlrp3 Nucleotide-binding domain,

leucine-rich-containing family,

pyrin domain-containing-3

Rn04244620_m1 287362

Rho Rhodopsin Mm00520345_m1 212541

Serping1 Serpin peptidase inhibitor, clade

G (C1 inhibitor), member 1

Rn01485600_m1 295703

Tnf Tumor necrosis factor α Rn00562055_m1 24835

2.4.5. Standard PCR

Standard PCR was used to detect amplification products in samples following

cDNA synthesis. Forward and reverse primers specific to genes of interest (Chapters 4-5)

were designed using the Primer3 web-based design program [226]. Oligonucleotides were

synthesised by Sigma Aldrich. The PCR reaction mixture was setup using the MyTaq

DNA Polymerase kit (Bioline). Components included cDNA template (40ng/µl), MyTaq

Reaction Buffer (5x), MyTaq Polymerase, forward and reverse primers (20µM), and

DNAse-free H2O. A negative control sample had no cDNA added to the reaction mixture.

The PCR was run via a standard amplification protocol on a Veriti 96-Well Thermal

Cycler (Applied Biosystems); an initial phase of 95°C preceded the amplification phase.

This was followed by 35 cycles of melting (95°C for 15 seconds), annealing (60°C for 15

44

seconds) and amplification (72°C for 10 seconds). To finish, samples were run at 72°C for

1 minute. Following PCR, amplification products were run on a 1% agarose gel via

electrophoresis, with Gel Red (Biotium, CA, USA) used for visualisation. Bands on the gel

were imaged using a UV light source and camera (Vilber Lourmat, Paris, France).

2.5. Imaging and statistical analysis

2.5.1. Quantification of cell counts and ONL thickness

TUNEL, IBA1 and C3 positive cells were quantified along the full length of retinal

cryosections (supero-inferior) in duplicate. Outer retinal counts (ONL-RPE) were taken for

IBA1+ and C3+ staining. To determine photoreceptor cell death, only TUNEL+ cells in the

ONL were quantified. To quantify the development of an outer retinal lesion, ONL

thickness was quantified in OCT images as described earlier. To quantify photoreceptor

loss in retinal cryosections, the number of rows of photoreceptor nuclei (visualised using a

DNA label) was quantified at the lesion site in the superior retina (approximately 2mm

superior to the optic nerve in rats, 1mm in mice). For each section, 5 measurements were

taken, and each eye was counted in duplicate.

2.5.2. Confocal imaging

Fluorescence in retinal cryosections was visualised and imaged using a laser-

scanning A1+ confocal microscope (Nikon, Tokyo, Japan). Images were acquired using the

NIS-Elements AR software (Nikon). Negative control slides were visualised and imaged

with each different immuno-label, to determine specificity of staining and the lower

threshold of fluorescence detection for comparison to positively-stained slides. All slides

were imaged using the same settings for each immuno-label for the comparison of positive

staining between experimental groups. The intensity of fluorescent staining was

45

determined using ImageJ, and images were processed and assembled into figure panels

using Photoshop CS6 software (Adobe Systems, CA, USA).

2.5.3. Statistical analysis

All graphing and statistical analysis was performed using Prism 6 (GraphPad

Software, CA, USA), using unpaired student t-tests, one-way analysis of variance

(ANOVA) or two-way ANOVA with the appropriate post-hoc tests to determine statistical

significance (P<0.05), as indicated throughout this thesis in Chapters 3-5. Graphs were

generated with mean ± SEM values.

46

3. RESULTS

Retinal macrophages synthesize C3 and activate complement in

AMD and in models of focal retinal degeneration

This chapter is presented as the following publication (* denotes equal first author):

Natoli, R.*, Fernando, N.*, Jiao, H.*, Racic, T., Madigan, M., Barnett, N.L., Chu-Tan,

J.A., Valter, K., Provis, J., Rutar, M. (2017) Retinal macrophages synthesize C3 and

activate complement in AMD and in models of focal retinal degeneration. Investigative

Ophthalmology & Visual Science. 58 (7), 2977-2990

The candidate has made a major contribution as a first author to this study (generating 75%

of rat data, 50% of mouse data and preparing the manuscript for publication).

47

3.1. Abstract

Purpose: Complement system dysregulation is strongly linked to the progression of age-

related macular degeneration (AMD). Deposition of complement including C3 within the

lesions in atrophic AMD is thought to contribute to lesion growth, although the

contribution of local cellular sources remains unclear. We investigated the role of retinal

microglia and macrophages in complement activation within atrophic lesions, in AMD and

in models of focal retinal degeneration.

Methods: Human AMD donor retinas were labelled for C3 expression via in situ

hybridisation. Rats were subject to photo-oxidative damage, and lesion expansion was

tracked over a 2-month period using Optical Coherence Tomography (OCT). Three

strategies were used to determine the contribution of local and systemic C3 in mice: total

C3 genetic ablation, local C3 inhibition using intravitreally-injected siRNA, and depletion

of serum C3 using cobra venom factor.

Results: Retinal C3 was expressed by microglia/macrophages located in the outer retina in

AMD eyes. In rodent photo-oxidative damage, C3-expressing microglia/macrophages and

complement activation were located in regions of lesion expansion in the outer retina over

2 months. Total genetic ablation of C3 ameliorated degeneration and complement

activation in retinas following damage, although systemic depletion of serum complement

had no effect. In contrast, local suppression of C3 expression using siRNA inhibited

complement activation and deposition, and reduced cell death.

Conclusions: These findings implicate C3, produced locally by retinal

microglia/macrophages, as contributing causally to retinal degeneration. Consequently, this

suggests that C3-targeted gene therapy may prove valuable in slowing the progression of

AMD.

48

3.2. Introduction

The complement system comprises a cascade of proteins that are cleaved

sequentially to initiate the destruction of a pathogen, foreign body, or cell debris [145,

146]. Prolonged cleavage of C3 may lead to membrane attack complex (MAC) assembly

and cytolysis [145, 146]. Complement activation is under tight control, including

regulation by complement factor H (CFH), a critical inhibitor. However, in

neurodegenerative diseases including age-related macular degeneration (AMD), regulation

of complement activation is compromised, contributing to disease onset and progression

(reviewed in [3, 152, 227]).

AMD affects photoreceptors and the retinal pigment epithelium (RPE) of the

macula, which mediates high acuity vision. Multiple factors contribute to AMD

pathogenesis (reviewed in [42]), however, the Y402H mutation in CFH is the most highly

associated risk factor [153, 154]. Other variants in C3, CFB, and C2 genes are associated

with AMD susceptibility (reviewed in [152]), with complement gene variants in the

population estimated to account for ~70% of the risk for developing AMD [152].

Poor understanding of the cellular events that initiate and feed complement

activation in the retina has been a significant obstacle in development of innovative

approaches in the management of AMD [3]. Immunohistochemistry analyses have

revealed that by-products of C3 catabolism are deposited in affected areas of RPE/Bruch’s

membrane, including drusen deposits, from AMD patients [62, 153, 157, 159-162]. This

deposition, however, depends upon the availability of C3 within the retinal

microenvironment, and the sources of C3 – systemic circulation or local retinal mediators –

are unclear. Whole-transcriptome analyses of AMD donor eyes show that C3 mRNA is

significantly increased in neural retina, but not in RPE/Choroid [47], suggesting that cells

in the neural retina may be critically engaged in AMD pathogenesis.

49

In this study, we seek to identify the retinal modulators of complement in AMD

and uncover their significance in the pathogenic activation of the cascade in the retina. We

identified retinal macrophages as the local producer of C3 in both early and advanced

forms of AMD. Using a model of outer-retinal degeneration and inflammation in rodents

and Optical Coherence Tomography (OCT) we show that C3-expressing macrophages are

associated with the expansion of atrophic lesions. Crucially, we demonstrate that

intravitreal delivery of small interfering RNA (siRNA) suppresses this local expression of

C3 and ameliorates retinal complement activation and degeneration; on the other hand,

inhibition of serum-derived C3 has no effect on retinal complement levels or degeneration.

Taken together, these findings inform our understanding of the role of complement in

AMD, pinpointing macrophages as the key source of C3 that drives deleterious

complement activation, and providing an indication for locally targeted gene therapy to

suppress complement activation in retinal degeneration.

3.3. Methods

3.3.1. Experimental animals

All experiments were conducted in accordance with the ARVO Statement for Use

of Animals in Ophthalmic and Vision Research. The study was approved by the Australian

National University Animal Experimentation Ethics Committee (Application ID: 2014/56).

Sprague-Dawley (SD) albino rats aged 120-150 post-natal days were used in this study.

Additionally, C57BL/6J mice and C3-knockout mice (C3-/-, 129S4-C3tm1Crr/J), both

aged 60-80 days, were obtained from the Australian Phenomics Facility. For the C3 KO

experiments, the KO mice were compared to isogenic C57BL/6J littermates. All animals

were housed and maintained under standard laboratory conditions in 12:12hrs light:dark

50

cycle of 5lux (dim-reared). Age-matched dim-reared animals with no photo-oxidative

damage were used as controls.

3.3.2. Photo-oxidative damage and tissue collection

SD rats were placed into transparent Perspex open-top boxes and exposed to

1000lux white light for 24hrs (COLDF2, 2x36W, IHF, Thorn Lighting, Spennymoor, UK),

with free access to food and water [209]. Following photo-oxidative damage (PD), animals

were euthanized with an overdose of barbiturate (60mg/kg Valabarb; Virbac, NSW,

Australia) for tissue collection (0 days) or were held for 3, 7, 14 or 56 days under dim

lighting (5lux), then euthanized.

C57BL/6J and C3-/- mice were housed in Perspex boxes coated with a reflective

interior, and exposed to 100Klux of natural white LED for 1, 3, 5 and 7 days, with free

access to food and water [228]. Each animal was administered with pupil dilator eye-drops

twice daily during PD (Atropine Sulphate 1%w/v eye-drops; Bausch and Lomb, NSW,

Australia). Following PD, electroretinography (ERG) was used to measure mouse retinal

function in response to full-field flash stimuli under scotopic conditions in dim-reared

control and 7-day damaged mice as described previously [228]. Animals were euthanized

with CO2 prior to tissue collection. Eyes were collected and processed for cryosections or

RNA extraction, as previously described in our publications [141, 228].

3.3.3. Optical Coherence Tomography (OCT)

Cross-sectional and fundus images of live rat retinas were undertaken using a

Spectralis™ HRA+OCT device (Heidelberg Engineering, Heidelberg, Germany). Animals

were anaesthetised with an intraperitoneal injection of Ketamine (100 mg/kg; Troy

Laboratories, NSW, Australia), and Xylazil (12 mg/kg; Troy Laboratories). Following

anaesthesia, a pupil dilator was administered to both eyes (Tropicamide 0.5%w/v eye-

51

drops; Bausch and Lomb). Animals were restrained on a custom-made platform attached to

the imaging device, adapted for rat eyes according to manufacturer’s specifications. To

maintain corneal hydration and improve OCT image quality to the manufacturer’s

minimum standard (25dB), hypromellose 0.3% eye-drops (GenTeal; Novartis, NSW,

Australia) were administered and a rodent contact lens was placed on the eye (PMMA

lenses, radius of curvature of the central optic zone of 2.70mm and diameter of 5.20mm;

Cantor + Nissel, Brackley, UK) [222]. Fundus and cross-sectional images were taken from

0-3mm superior to the optic nerve (ON), and 1-2mm inferior to the ON. Eye gel (GenTeal;

Novartis) was administered to both eyes for recovery.

3.3.4. Treatment of mice with cobra venom factor (CVF)

To achieve systemic complement depletion, cobra venom factor (CVF) (Quidel,

CA, USA) was dissolved in endotoxin-free PBS to a final concentration of 0.1µg/µl.

C57BL/6J mice were administered with 25µg CVF intraperitoneally prior to 7 days of

photo-oxidative damage, and on days 3 and 5 during damage to sustain complement

depletion. To confirm an inhibition of complement activity, peripheral blood was collected

at 7 days for a haemolytic assay. The serum of CVF-treated mice was extracted and

incubated with sheep red blood cells (Applied Biological Products Management, SA,

Australia) pre-sensitised with haemolysin (Sigma-Aldrich, MO, USA) as described

previously [229]. The absorbance at 540nm was read using an Infinite-200-PRO plate

spectrometer (Tecan, Mannedorf, Switzerland) and the percentage of haemolysis was

calculated, and compared to serum from PBS-injected mice as a positive control, and C3-/-

serum as a negative control.

3.3.5. Intravitreal injections of siRNA

In vivo RNA interference was performed using C3 siRNA (s63165; Thermo Fisher

Scientific, MA, USA) and negative control siRNA (12935300, Stealth RNAi Med GC;

52

Thermo Fisher Scientific), which were encapsulated using a cationic liposome-based

formulation (Invivofectamine 3.0 Reagent; Thermo Fisher Scientific) as per the

manufacturer’s instructions. To purify and increase the concentration of the siRNA

formulation to a final concentration of 0.3µg/µl in endotoxin-free PBS, the samples were

spun at 4000g through an Amicon Ultra-4 Centrifugal Filter Unit (Merck Millipore, MA,

USA). Intravitreal injections were performed as described in our previous publication [89];

1µl of the C3 siRNA or negative control siRNA formulation was injected into both eyes of

each C57BL/6J mouse on day 4 of photo-oxidative damage. Animals were recovered, and

then returned to photo-oxidative damage for the remainder of the 7-day time-course.

Mouse livers were collected 3 days after the siRNA injections for analysis of systemic C3.

3.3.6. Immunohistochemistry and quantification of ONL thickness and

microglia/macrophages in cryosections

All histological and immunofluorescent analyses utilised retinal cryosections that

were cut along the para-sagittal plane (supero-inferior), described previously [209, 210].

These sections also included optic nerve head, in order to maintain regional consistency

between replicates and groups.

To detect and localise specific proteins in the retina, immunohistochemistry was

performed using primary antibodies (Table 3.1) as described in our previous protocols with

minor modifications [87, 141]. Mouse cryosections were immunolabelled with the α-C3

antibody instead of α-C3d, as it achieved more optimal staining. Fluorescence in retinal

sections was visualised under a laser-scanning A1+ confocal microscope (Nikon, Tokyo,

Japan), and images were acquired using the NIS-Elements AR software (Nikon). Images

were processed using Photoshop CS6 software (Adobe Systems, CA, USA).

Immunolabelled IBA1+ cells in the outer retina (ONL-RPE) were counted across each

whole retinal section and then averaged for each group, consistent with our prior methods

53

[210, 228]. For quantification, only the cell bodies of the IBA1+ cells were counted so as

to prevent the occasional ambiguity of IBA1+ processes from skewing the dataset.

Table 3.1. Primary antibodies used for immunohistochemistry

Primary Antibody Dilution Catalogue Number Company

Rabbit α-IBA1 1:500 019-19741 Wako, Osaka, Japan

Goat α-C3d 1:100 AF2655 R&D Systems, MN, USA

Rabbit α-C3 1:50 AB118877 Abcam, Cambridge, UK

Rabbit α-Rhodopsin 1:500 AB9279 Merck Millipore, MA, USA

Rabbit α-GFAP 1:500 Z0334 Dako, Glostrup, Denmark

To assess ONL thinning on cryosections following photo-oxidative damage, the

section were stained with Toluidine Blue and then quantified in accordance with our

previous methodology [228]. Briefly, number of rows of photoreceptor nuclei were

quantified within the lesion of the superior retina (1-2mm superior to the optic nerve in

mice), and counts were subsequently averaged for each experimental group.

3.3.7. In situ hybridisation on human and rat retinas

To localise C3 mRNA transcripts in retinal cryosections, C3 was cloned from PCR

products derived from human (460bp amplicon) and rat (483bp amplicon) retinal cDNA.

These cloned templates were then synthesised into a digoxigenin (DIG)-labelled riboprobe

that was specific to human or rat C3 mRNA, according to our published methodology

[141].

In situ hybridisation was performed on cryosections from either human AMD

donor tissue or rat retinas subjected to photo-oxidative damage. AMD tissues had been

extensively categorised and processed for cryosectioning in an earlier investigation [230].

In brief, human eyes were collected with informed consent through the Lions NSW Eye

Bank, Sydney, Australia, with ethical approval from the Human Research Ethics

54

Committee of the University of Sydney and The Australian National University. Grading

for the eyes ranged from normal to early- or late-AMD, and which was assigned by a team

of experienced graders according to published pathological criteria [231].

In situ hybridisation was conducted using our established protocol [224]. Both rat

and human C3 riboprobes were hybridised overnight at 57˚C and then washed in saline

sodium citrate (pH 7.4) at 60˚C. The bound probe was visualised with nitro blue

tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP), and sections were

double-labelled using IBA1 immunohistochemistry.

3.3.8. Quantitative real-time polymerase chain reaction (qPCR)

RNA extraction and purification was performed on retinas using a combination of

TRIzol reagent (Thermo Fisher Scientific) and an RNAqueous Total RNA Isolation Kit

(Thermo Fisher Scientific) as described in our previous publication [232]. cDNA was

prepared from 500ng of each RNA sample using a Tetro cDNA Synthesis Kit (Bioline

Reagents, London, UK) according to the manufacturer’s protocol.

Gene expression changes were measured via qPCR using Taqman hydrolysis

probes (Table 3.2) and Taqman Gene Expression Master Mix (Thermo Fisher Scientific).

Each qPCR was run using a QuantStudio 12K Flex instrument (Applied Biosystems) at the

Biomolecular Resource Facility (JCSMR, ANU). Analysis was performed using the

comparative cycle threshold method (ΔΔCt) which was normalised to the expression of

Gapdh and Actb reference genes, as established previously [141, 144].

Table 3.2. Taqman hydrolysis probes used for qPCR

Gene Symbol Gene Name Catalogue Number Entrez Gene ID


dehydrogenase

Rn99999916_s1 24383

Mm99999915_g1 14433

Actb Actin, beta Mm01205647_g1 11461

55

C1s Complement component 1, s

subcomponent

Rn00594278_m1 192262

Mm01625167_g1 50908

C2 Complement component 2 Rn00597176_m1 24231

Mm00442726_m1 12263

C3 Complement component 3 Mm00437858_m1 12266

C4a Complement component 4A

(Rodgers blood group)

Rn00709527_m1 24233

Mm01132415_g1 625018

Cfb Complement factor B Rn01526084_g1 294257

Mm00433918_g1 14962

Cfd Complement factor D (adipsin) Rn01535436_g1 54249

Cfh Complement factor H Rn00590326_m1 155012

Mm01299248_m1 12628

Cfi Complement factor I Rn00577333_m1 79126

Serping1 Serpin peptidase inhibitor, clade

G (C1 inhibitor), member 1

Rn01485600_m1 295703

Cntf Ciliary neurotrophic factor Mm00446373_m1 12803

Fgf2 Fibroblast growth factor 2 Mm01285715_m1 14173

Rho Rhodopsin Mm00520345_m1 212541

3.3.9. OCT and fundus images

OCT and fundus images were analysed using ImageJ software (NIH, MD, USA).

Retinal thickness, and ONL depth were measured in 5 OCT transects (superior and inferior

to the optic nerve) spaced at 1mm intervals, with 5 points sampled across each image. ONL

thickness ratios were calculated as the ONL thickness relative to the distance between the

outer and inner limiting membranes. To detect fundus lesions, images of the area of interest

(2-3mm superior to the optic nerve) were converted to grayscale, and contrast was

optimised using the ‘curves’ function in Photoshop CS6 using a standard approach. Images

were then converted to bitmaps using controlled parameters. ImageJ was used to measure

the lesion size manually (arbitrary units).

56

3.3.10. Statistics


Software, CA, USA). Significant trends in time-course datasets were ascertained using the

one-way or two-way analysis of variance (ANOVA) to determine statistical significance

(P<0.05); Sidak’s or Tukey’s post-hoc tests were applied where multiple statistical

comparisons were desired, while Fisher’s uncorrected Least Significant Difference (LSD)

was used for instances of single comparisons. Student’s t-test was utilised for other single

comparisons, where noted.

3.4. Results

3.4.1. Localisation of C3 mRNA in human donor retinas: A role for macrophages

We investigated the localisation of C3 mRNA in normal aged human donor retinas

and age-matched AMD-affected retinas using in situ hybridisation (Figure 3.1). We

detected minimal C3 mRNA expression in normal retinas, and little-to-none within RPE

cells or choroid (Figure 3.1A). However, in early AMD retinas, C3-expressing cells were

detected in the nerve fibre layer (NFL), superficial retinal vasculature, and subretinal space

in regions adjacent to RPE disturbance (Figure 3.1B-D). We detected numerous C3-

expressing cells in regions of advanced scarring (Figure 3.1E-F), at lesion edges (Figure

1G-I), and near the optic nerve head (Figure 3.1J). In contrast, barely any labelling was

detected in the choroid of these lesioned areas (Figure 3.1E). Counter immunolabelling

indicated that most of the C3-expressing cells were immunopositive for the

macrophage/microglia marker IBA1 (Figure 3.1K-N).

57

Figure 3.1. C3 expression in human AMD retinas. A: No C3-expressing cells were

detected in the normal retina. B-D: Subretinal C3-expressing cells were present in early

AMD retinas exhibiting RPE disturbance. C3 mRNA expression was detected near the

inner retinal vasculature. E-J: In late AMD retinas, C3-expressing cells were detected

58

within the lesion (E-F), at the lesion edges (G-I), and at the optic nerve head (J). K-N:

These C3-expressing cells were identified as IBA1+ microglia/macrophages.

Representative images derived from N=2-3 per group. GCL, ganglion cell layer; INL,

inner nuclear layer; ONL, outer nuclear layer; NFL, nerve fibre layer; OS, outer segments;

V, vasculature. Scale bars represent 100µm in A,B,E,G,H,J; 50µm in K; 10µm in

C,D,F,I,M.

59

3.4.2. Complement activation and macrophage recruitment within rat retinal lesions

Progression of lesion expansion in rat retinas following photo-oxidative damage

was tracked in vivo using Optical Coherence Tomography (OCT) at 0, 3, 7, 14, and 56

days (Figure 3.2). Measurements of outer nuclear layer (ONL) thickness were taken from

cross-sectional images along 3 horizontal transects in the superior retina (Figure 3.2A), and

2 in the inferior retina. Graphical representation of those measurements showed a gradual

ONL thinning in the superior retina between 0 and 56 days, which was most prominent at

2-3mm superior to the optic nerve head (Figure 3.2B). The data show a significant lesion

detectable by 7 days (P<0.05, Figure 3.2B, D), which continued to develop further over the

time-course. The thinnest ONL was detected in the 2-3mm transect at 56 days (P<0.05,

Figure 3.2B, F). A retinal lesion (2-3mm superior to the optic nerve) was detected in

fundus images from 3 days onwards (Figure 3.2G-M). The lesion size steadily increased

from 3 to 14 days, and doubled from 14 to 56 days (P<0.05, Figure 3.2G-M).

Expression of a suite of complement components (C1s, C2, C3 and C4a) and

regulators (Cfb, Cfd, Serping1, Cfh, Cfi) was analysed across the time-course in whole rat

retinas (Figure 3.3). All complement genes showed a significant trend in upregulation

across the time-course (P<0.05), with C1s, C3 and C4a remaining significantly increased

at 56 days post-damage compared to dim-reared controls (P<0.05, Figure 3.3B). While the

complement regulators Cfb Cfd, Serping1, Cfh and Cfi were all highly up-regulated early

in the time-course (0-7 days, Figure 3.3C), none were found to show any significant

change by 56 days, compared to controls (Figure 3.3D, P>0.05).

Following photo-oxidative damage, there was an incursion of IBA1+ microglia and

macrophages into the ONL and subretinal space (Figure 3.4). This persisted within the

lesion up to 56 days (Figure 3.4A). Counts of IBA1+ cells in the ONL and subretinal space

showed a ~7-fold increase between 0 and 7 days (Figure 3.4A, C), which decreased to

60

Figure 3.2. Outer nuclear layer (ONL) thickness ratio changes following photo-oxidative

damage (PD) in rats. A: The regions of the superior retina imaged using OCT were from

the optic nerve (ON) to 1mm, 1-2mm, and 2-3mm above the optic nerve. B: The ONL

thickness ratio from ON-1mm (superior) and ON-2mm (inferior) showed minimal change

over the time-course. The trend indicates a decrease in ONL thickness at 1-3mm superior

61

from 0 days onwards (P<0.05). A significant decrease in ONL thickness was observed at 2-

3mm (superior) up to 56 days (P<0.05). C-F: Representative OCT images of the control

(C), in comparison to days 7-56 (D-F) at 2-3mm (superior) illustrate substantial ONL

thinning over the time-course. G: The area (arbitrary units) of the retinal lesion as observed

on fundus images from days 3-56 was quantified using bitmap analysis of the lesion area in

ImageJ. A gradual increase in lesion size over time was observed, which was significant

from 14 to 56 days (P<0.05). H-M: Representative lesion area fundus images from 2-3mm

superior to the optic nerve (dashed box in A). No lesion was detected in control (H) and 0

day (I) images. A retinal lesion was observed in fundus images from 3 days (J), which

gradually increased in size at 7 days (K), 14 days (L) and 56 days (M). Statistical analysis

was determined using one-way ANOVA with Tukey’s post-hoc test (P<0.05). GCL,

ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; IS/OS, inner and

outer segments; S, superior; I, inferior. N=4 animals per group.

62

Figure 3.3. Complement gene expression in rat retinas following photo-oxidative damage

(PD). All genes investigated were upregulated until 56 days post-damage compared to dim-

reared controls. A: Complement components C1s, C2 and C4a reached peak expression at

3 days. Expression of C3 was highest at 0-7 days. B: C1s, C3 and C4a were still

significantly increased at 56 days compared to controls (P<0.05). C: Expression of the

complement regulator gene Cfb was highest at 0 days, whereas Cfd expression peaked at 3

days. Serping1, Cfh, Cfi expression all peaked at 3 days. D: Serping1, Cfh, Cfi, Cfb, and

Cfd showed no statistically significant change after 56 days post-exposure (P>0.05). The

trend in expression was determined using one-way ANOVA (A,C, P<0.05), and Student’s

t-tests was used to compare controls and 56 days (B-D). N=4 animals per group.

63

Figure 3.4. Infiltration of IBA1+ microglia/macrophages into the outer rat retina following

photo-oxidative damage (PD). A: In dim-reared controls, there were no IBA1+ cells in the

outer retina (ONL-RPE). Upon damage, an increase in IBA1+ cell numbers in the outer

retina reached a peak at 7 days, and remained significantly increased at 56 days (P<0.05).

B: IBA1+ cells were detected only in the inner retinas of controls. C: IBA1+ cell numbers

in the outer retina and subretinal space peaked at 7 days at the lesion edge. D-E: At 56

days, there were significant numbers of IBA1+ cells in the outer retina at the lesion edges,

even though very few photoreceptor cell nuclei remained. Statistical significance was

determined using a one-way ANOVA. INL, inner nuclear layer; ONL, outer nuclear layer.

N=4 animals per group. Scale bars represent 50µm.

64

approximately half the number by 14 days, but remained significantly higher than control

animals in the outer retina at 56 days (P<0.05, Figure 3.4A, D-E).

In situ hybridisation (ISH) to localise expression of C3 mRNA at 7, 14 and 56 days

post-exposure was consistent with previous findings in this model at 7 days [141], showing

C3 mRNA localisation in the neural retina and subretinal space (Figure 3.5A-F). We

detected accumulations of C3-expressing macrophages predominantly clustered amongst

the remnants of the ONL and at the lesion edges, and near the inner retinal vasculature up

to 56 days (Figure 3.5A-F). Co-localisation with IBA1+ immunolabelling (Figure 3.5G-I)

suggests the identity of these C3-expressing cells as macrophages. We did not observe C3

expression by other cell types in retina, including RPE cells, consistent with our previous

reports [141, 144].

We used immunoreactivity for C3d, a by-product of C3 cleavage and an indication

of complement activation, to visualise the distribution of C3 following photo-oxidative

damage (Figure 3.5J-V). C3d labelling was absent in dim-reared controls (Figure 3.5J).

However, C3d immunoreactive deposits were prominent at 7 and 14 days post-damage in

the ONL, amongst the photoreceptor segments and in the subretinal space, particularly at

the lesion edges (Figure 3.5K, L). These features persisted up to 56 days (Figure 3.5M-P).

Double immunolabelling for IBA1 and C3d showed a close association of macrophages

with C3d deposits situated within the lesion (Figure 3.5Q-V).

3.4.3. Suppression of local C3 inhibits retinal atrophy - mouse studies

To better understand the role of locally-expressed C3 in complement deposition in

the subretinal space, and its role in retinal atrophy, we used three different strategies to

inhibit C3 in a model of retinal degeneration [228]: C3 knockout (C3-/-), local inhibition of

C3 using siRNA, and systemic C3 depletion using Cobra Venom Factor (CVF).

65

Figure 3.5. Infiltration of C3-expressing cells and C3d protein deposition in the outer rat

retina following photo-oxidative damage (PD). A: There was no outer-retinal C3

expression in dim-reared controls. B-D: At 7 days post-damage, C3-expressing cells were

detected within the lesion and at the lesion edges in the outer retina (B-C), as well as near

66

the inner retinal vasculature (D). E: C3-expressing cells were present in the outer retina at

14 days. F: At 56 days, C3-expressing cells were still present at the lesion edges. G-I:

These C3-expressing cells were identified as IBA1+ microglia/macrophages. J: Low levels

of C3d were detected in the inner retinal vessels of controls. K: At 7 days post-damage,

C3d deposition was evident throughout the outer retina (ONL and subretinal space) at the

lesion edges. L: C3d labelling peaked at 14 days, with large amounts of protein deposition

detected at the lesion edges. M-P: At 56 days, there was still C3d labelling present within

the lesion (M-N) and at the lesion edges (O-P). Q-U: At 14 days (Q) and 56 days (R-U),

there was some co-localisation of the C3d protein with IBA1+ microglia/macrophages at

the lesion edges. V: The negative control (no primary antibodies) showed only background

staining, with some visible autofluorescence of debris near the outer retina. Representative

images derived from N=4 animals per group. INL, inner nuclear layer; ONL, outer nuclear

layer; RPE, retinal pigment epithelium; C, choroid; IPL, inner plexiform layer. Scale bars

represent 50µm in A-M,O,Q-R,V; 10µm in N,P,S-U.

67

3.4.4. C3 knockouts

Previous reports indicate that complete ablation of C3 reduces the ERG function

and outer-retinal integrity in 12-month old animals [233]. For this reason we carried out

experiments on P60-80 mice, in which no functional or histological deviations were

observed [233, 234]. Dim-reared C3-/- animals were assessed for any functional or

histopathological changes compared to wild types (Wt). These comparisons showed no

reduction in ERG amplitudes, changes in rhodopsin (Rhod) expression, or up-regulation of

the stress/neuroprotective factors GFAP, Fgf-2, or Cntf (Supplementary Figure 3.1).

C3 gene expression and immunoreactivity for C3 were confirmed as absent in C3-/-

animals and in dim-reared Wt mice (Figure 3.6A-B). Increased C3 expression in Wt retinas

was evident after 1 day of photo-oxidative damage and was up-regulated across the

exposure time-course, with peak expression on day 5 (P<0.05, Figure 3.6A).

Immunoreactivity for C3 deposits in the ONL and subretinal space of Wt retinas was

evident at 5 and 7 days (Figure 3.6C-E), and absent in C3-/- retinas over the same period

(Figure 3.6F). Over the time-course of photo-oxidative damage, the ONL was better

preserved in C3-/- mice compared to Wt (Figure 3.6G-M); at 7 days ONL thickness was

significantly greater in the C3-/- mice compared to Wt (P<0.05, Figure 3.6G, J, M).

The a-wave and b-wave responses of the ERG reflects the differences in retinal

morphology of Wt and C3-/- animals described above, where the ERG a-wave and b-wave

intensity response characteristics between groups was significantly different (P<0.05,

Figure 3.6N-O). C3-/- mice had higher a- and b-wave responses compared to Wt mice

(Figure 3.6N-O); this difference was most pronounced at the highest flash intensity

(P<0.05, Figure 3.6P).

68

Figure 3.6. C3 expression in C57BL/6J wild-type (Wt) and C3-/- mouse retinas. A: C3 gene

expression following photo-oxidative damage (PD) increased to a peak at 5 days (P<0.05

compared to control, N=8 animals). B-F: C3 protein deposition was evident at 5 and 7 days

69

in Wt retinas (C-D). C3 detection was absent in C3-/- retinas at 7 days (F), which was

comparable to Wt controls (B). G: ONL thinning was significant in Wt retinas compared to

C3-/- retinas at 7 days (P<0.05, N=6 animals). H-M: Toluidine blue staining of Wt and C3-/-

retinas show no ONL disturbance in the controls (H,K), and progressive thinning at 5 days

(I,L) and 7 days (J,M), with C3-/- retinas having a thicker ONL than Wt retinas (at the site

of the retinal lesion, 1-2mm superior to the optic nerve). N-P: C3-/- retinas at 7 days

demonstrated a significantly higher a-wave (N) and b-wave (O) compared to Wt retinas

(P<0.05, N=10 animals), which was most pronounced at 1.9 Log cd.s/m2 (P, P<0.05, N=10

animals). Statistical significance was determined using one-way (A) or two-way ANOVA

(G, Sidak’s post-hoc test; P, uncorrected Fisher’s LSD for the 1.9 Log cd.s/m2 comparison).

GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; RPE, retinal

pigment epithelium. Scale bars represent 50µm.

70

3.4.5. Local C3 inhibition using siRNA

C3 siRNA significantly reduced C3 gene expression in retinas at 7 days photo-

oxidative damage (p<0.05, Figure 3.7A). Lower levels of C3 protein deposits were

observed in C3 siRNA-injected retinas compared with those injected with negative control

siRNA (Figure 3.7B-C). In contrast, liver expression of C3 was not affected by intravitreal

injection of C3 siRNA, indicating that siRNA injected into the eye was largely localised

there (Figure 3.7D).

Quantitative analysis of retinas post-damage showed that the photoreceptor

population was protected against cell death in C3 siRNA-injected retinas compared with

negative control siRNA (Figure 3.7E). Comparison of retinal thickness shows that the

ONL is significantly thicker (P<0.05) in C3 siRNA-injected animals compared with

negative control siRNA (Figure 3.7E). Furthermore, ERG analyses showed that the mean

a-wave and b-wave amplitudes of the ERG were significantly greater in C3 siRNA-treated

animals compared to negative siRNA controls, which was most pronounced at the highest

flash intensity (P<0.05, Figure 3.7H). The ERG a-wave and b-wave intensity response

characteristics between groups was significant (p<0.05, Figure 3.7F-G).

3.4.6. Systemic C3 depletion using Cobra Venom Factor

To understand the possible role of serum complement components in the retina, we

systemically depleted serum complement activity in Wt mice, using cobra venom factor

(CVF). A haemolysis assay using serum from C3-/- animals, and animals injected with

CVF or PBS, indicated that at 7 days damage, serum complement activity was depleted by

CVF to a comparable level to C3-/- mouse serum, but not in PBS-injected animals,

indicating that systemic complement was inhibited by CVF (P<0.05, Figure 3.8A).

72

Figure 3.7. Inhibition of retinal C3 expression using C3 siRNA and 7 days of photo-

oxidative damage (PD). A: Retinal C3 gene expression was significantly decreased

following an intravitreal injection of C3 siRNA compared to the negative siRNA controls

(P<0.05, N=11 animals). B-C: There was a reduction in C3 protein deposition in the C3

siRNA-injected retinas compared to negative siRNA controls. D: Liver C3 gene expression

was not affected at 3 days after the C3 siRNA intravitreal injection (N=3 animals). E:

There was a significant reduction in photoreceptor loss in C3 siRNA-injected retinas

compared to negative siRNA controls (P<0.05, N=13 animals). F-H: C3 siRNA retinas

displayed a larger a-wave (F) and b-wave (G) compared to negative siRNA controls, which

was most pronounced at 1.9 Log cd.s/m2 (H), indicating a significantly improved retinal

function (P<0.05, N=4 animals). Statistical significance was determined by an unpaired

student t-test (A,D,E) or a two-way ANOVA (F-G, uncorrected Fisher’s LSD for the 1.9

Log cd.s/m2 comparison). INL, inner nuclear layer; ONL, outer nuclear layer; RPE, retinal

pigment epithelium. Scale bars represent 50µm.

74

Figure 3.8. Depletion of systemic complement using cobra venom factor (CVF) at 7 days

of photo-oxidative damage (PD). A: Complement activity in the serum was inhibited in

CVF-injected animals compared to PBS controls as determined in a haemolytic assay using

sheep red blood cells (SRBC), where complement inhibition in CVF-injected animals was

comparable to C3-/- animals (N=4 animals). B: Retinal expression of complement genes

(C3, C1s, C2, C4a, Cfb, Cfh) were not significantly affected by CVF depletion of systemic

complement (N=9 animals). C-D: There was no difference in C3 protein deposition

between CVF and PBS-injected animals. E: No difference in ONL thickness was observed

between CVF and PBS-injected animals (N=6 animals). F-H: Depletion of systemic

complement did not decrease retinal function, as there was no significant difference in the

a-wave (F) or b-wave (G) between CVF and PBS groups (N=5 animals). Statistical

significance was determined by an unpaired student t-test (A,B,E) or a two-way ANOVA

(F-G, uncorrected Fisher’s LSD for the 1.9 Log cd.s/m2 comparison). ONL, outer nuclear

layer; RPE, retinal pigment epithelium. Scale bars represent 50µm.

75

To understand the impact of CVF on complement gene expression in the retina we

compared levels of C3, C1s, C2, C4a, Cfb, and Cfh at 7 days in animals injected with CVF,

with PBS-injected controls. The elimination of systemic complement by CVF did not

significantly alter the retinal expression of those complement components or regulatory

genes (Figure 3.8B). In addition, no difference was observed in retinal C3 deposition

between CVF- and PBS-injected animals at 7 days (Figure 3.8C-D).

Analysis of retinal morphology showed that depletion of systemic complement

does not protect against retinal degeneration. No difference in ONL thickness in CVF-

injected mice compared with PBS-injected mice was observed (Figure 3.8E). Similarly,

there were no significant differences in mean a-wave or b-wave amplitudes in CVF- and

PBS-injected animals after 7 days damage, and no significant difference in the ERG

intensity response characteristics between groups (Figure 3.8F-H).

76

Supplementary Figure 3.1. Characterisation of dim-reared C57BL/6J wild-type (Wt) and

C3-/- mouse retinas. A: When assessing retinal function, there was no change in the a-wave

between Wt and C3-/- groups. B-C: There was no significant difference in the b-wave

77

across the varying flash intensities (B) except at 1.9 Log cd.s/m2, where a significant

difference was detected (C, P<0.05, N=4-5 animals). D-G: Rhodopsin labelling in the outer

segments (OS) was similar in the Wt and C3-/- retinas (D-F, N=5 animals), and there was no

change in Rhod gene expression between both groups (G, N=3 animals). H-J: GFAP

expression in the Müller cells was not significantly different in Wt and C3-/- retinas,

however, was slightly higher in the Wt (N=5 animals). K: There was no significant change

in the expression of neuroprotective genes (Cntf, Fgf2) between Wt and C3-/- retinas (N=4

animals). Statistical significance was determined by an unpaired student t-test (F-G,J-K) or

a two-way ANOVA (A-B, uncorrected Fisher’s LSD for the 1.9 Log cd.s/m2 comparison).

GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer.

78

3.5. Discussion

This is the first study to demonstrate the key importance of locally expressed

sources of complement in driving complement-induced retinal atrophy. First, we show that

C3 expression by macrophages in the human retina is closely linked to retinal atrophy in

AMD. Second, we demonstrate in vivo the emergence and progression of a focal atrophic

lesion in the rat retina over a period of 56 days, and the modulation of expression of a

range of complement-related genes, including the persistent elevation of C3 and its

expression by macrophages over the time-course. Third, using C3-/- mice, knockdown and

depletion strategies we demonstrate conclusively that C3 expressed in the retina, but not

serum C3, plays a decisive role in complement propagation in retinal degeneration. Taken

together, these results suggest that a therapeutic approach targeting C3 could slow the

progression of many neurodegenerative diseases including AMD.

3.5.1. Role of complement in onset of retinal atrophy

Complement dysregulation has been highly implicated in the progression of AMD

[152]. Consistent with other similar findings that complement over-activation contributes

to retinal degenerations [68, 69, 196, 200, 217, 219], our previous studies show an up-

regulation of complement genes C1s, C2, C3 and C4a in retinal degenerations [141, 144,

211, 228]. This study extends those collective findings showing that C1s, C2, C3 and C4a

are up-regulated during progressive lesion expansion, and that accumulation of C3-

expressing macrophages at the lesion edges is a constant feature of lesion progression. This

complement gene expression profile is consistent with a broad scope of literature, which

has genetically and histologically linked focal retinal atrophy, including AMD

pathogenesis, to irregularities in the complement system [47, 62, 153, 157, 158, 160-162].

In particular, sustained up-regulation of C1s, C3 and C4a demonstrated in this study, is

consistent with findings from systems-level analysis of AMD neural retinas [47].

79

C3 propagation is strongly implicated in AMD through the association of the

Y402H variant of CFH [153, 154]. We pursued the effects of disrupting local and systemic

C3 using a triad of C3 inhibition strategies. The results show that the retina is protected

from atrophy in both ablation and local knockdown of C3, but not from systemic CVF

depletion of C3. This demonstrates that only locally expressed C3 – not serum C3 – is

linked to retinal atrophy in this study. Serum complement components are constitutively

produced and replenished by the liver [235], and it has been reported that C3 levels are

elevated in the peripheral blood of AMD patients [236]. Because complement components

from serum would not be able to cross the intact blood-retinal barrier (BRB) due to their

large size, it is unlikely that they could participate in the onset of retinal atrophy. However,

as retinal atrophy progresses and there is breakdown of the outer BRB, there are no barriers

to the permeation of serum constituents and this could contribute to further progression of

atrophy.

3.5.2. Local C3-expressing macrophages as a therapeutic target for reducing retinal

atrophy

Macrophage infiltration of the subretinal space is a feature of AMD histopathology

[4, 92, 135], including at the lesion edges in geographic atrophy [135], and their

pathogenic involvement in the disease is well-supported through findings in both laser-

induced neovascularization [237, 238] and photo-oxidative damage [92, 228, 239] models,

where their presence is associated with photoreceptor loss. In the present study we show

that C3 is upregulated only by retinal and subretinal macrophages, and not by RPE cells in

AMD-affected retinas. Areas of lesion development in our experimental model of retinal

degeneration are associated with complement activation and deposition by microglia and

macrophages, where photoreceptor cell death may occur through membrane attack

complex formation. Our current and previous findings [141, 144] are consistent with a

80

transcriptome-wide analysis, combining over 60 donor samples covering all forms of

AMD, which demonstrated C3 upregulation in neural retina, but not RPE/choroid [47].

Despite this we do not suggest that the RPE/choroid interface plays no role in

modulating complement, as these tissues are known to express a range of other

complement constituents, and the membrane attack complex is abundant in the

choriocapillaris in early AMD [164]. RPE cells have been reported in some studies as a

local source of C3 in mouse retina in homeostasis or resulting from retinal degenerations

[140, 181, 214]. These studies relied upon PCR of combined extracts of RPE/Choroid, or

used cultured RPE. However, no study has confirmed that RPE expresses complement

genes in the retinal environment in situ.

We surmise that complement activation and deposition in the outer retina is

dependent on the summative effects of a range of mediators and regulators, and that

accumulation of subretinal macrophages is a key component from the perspective of C3

synthesis and deposition. We identify retinal C3-expressing macrophages as a novel

therapeutic target for mitigating the damaging effects of complement in retinal atrophy,

and highlight a potential role for C3-targeted gene therapies.

An outstanding question is whether the C3-expressing macrophages associated with

retinal atrophy derive from the pool of resident microglia, or recruited bone-marrow

monocytes, or both. O’Koren and colleagues have shown, using genetic lineage tracing,

that subretinal macrophages are predominantly resident microglia [120]. On the other

hand, their localisation of some C3-expressing macrophages adjacent to the superficial

retinal vasculature and optic nerve suggest recruitment pattern of bone-marrow derived

macrophages [185], suggesting that the C3-expressing population may also comprise non-

resident macrophages.

81

3.5.3. Conclusions

Through combined observations in human donor tissue and models of retinal

degeneration, our study illustrates a novel role of macrophages in priming the pathogenic

activation of complement via their secretion of C3. We emphasise that this key

contribution of subretinal macrophages does not preclude important roles for the

RPE/choroid interface itself in influencing complement activation. However, our findings

do reveal that the orchestration of complement-mediated pathology in AMD involves more

elements than surmised previously [152], of which subretinal macrophages are a pivotal

element. In demonstrating the efficacy of intravitreal C3 siRNA in mediating complement-

induced in retinal atrophy while also negating a contribution of systemic C3, we provide

vital proof-of-principle support for locally administered gene therapy to target

complement-induced retinal atrophy. This work lays a foundation for testing advanced

gene-editing approaches, such as CRISPR/Cas9 technology, with the potential to

revolutionise the therapeutic landscape for complement-mediated retinal degenerations

including AMD.

82

4. RESULTS

The broad spectrum chemokine inhibitor NR58-3.14.3

modulates macrophage-mediated inflammation in the diseased

retina


Fernando, N.*, Natoli, R.*, Valter, K., Provis, J., Rutar, M. (2016) The broad spectrum

chemokine inhibitor NR58-3.14.3 modulates macrophage-mediated inflammation in the

diseased retina. Journal of Neuroinflammation. 13:41


of all data and preparing the manuscript for publication).

83

4.1. Abstract

Background: The activity of macrophages is implicated in the progression of retinal

pathologies such as atrophic age-related macular degeneration (AMD), where they

accumulate amongst the photoreceptor layer and subretinal space. This process is aided by

the local expression of chemokines, which furnish these cells with directional cues that

augment their migration to areas of retinal injury. While these qualities make chemokines a

potential therapeutic target in curtailing damaging retinal inflammation, their wide variety

and signalling redundancy pose challenges in broadly modulating their activity. Here, we

examine the efficacy of the broad spectrum chemokine inhibitor NR58-3.14.3 – a

suppressor of Ccl- and Cxcl- chemokine pathways – in suppressing macrophage activity

and photoreceptor death, using a light-induced model of outer-retinal atrophy and

inflammation.

Methods: Photo-oxidative damage was induced in SD rats via exposure to 1000lx of light

for 24hrs, after which animals were euthanized at 0 or 7 day post-exposure time points.

Prior to damage, NR58-3.14.3 was injected intravitreally. Retinas were harvested and

evaluated for the effect of NR58-3.14.3 on subretinal macrophage accumulation and

cytokine expression profile, as well as photoreceptor degeneration.

Results: We report that intravitreal administration of NR58-3.14.3 reduces the

accumulation of macrophages in the outer retina following exposure to light damage, at

both 0 and 7 days post-exposure time-points. Injection of NR58-3.14.3 also reduced the

up-regulation of inflammatory markers including of Il6, Ccl3 and Ccl4 in infiltrating

macrophages, which are promoters of their pathogenic activity in the retina. Finally,

NR58-3.14.3 injected retinas displayed markedly reduced photoreceptor death following

light damage, at both 0 and 7 days post-exposure.

84

Conclusions: Our findings indicate that NR58-3.14.3 is effective in inhibiting subretinal

macrophage accumulation in light-induced retinal degeneration, and illustrate the potential

of broad spectrum chemokine inhibitors as novel therapeutic agents in thwarting retinal

inflammation. Although broad spectrum chemokine inhibitors may not be appropriate for

all retinal inflammatory conditions, our results suggest that they may be beneficial for

retinal dystrophies in which chemokine expression and subretinal macrophage

accumulation are implicated, such as advanced AMD.

4.2. Background

Age-related macular degeneration (AMD) is the leading cause of irreversible

blindness among those aged over 65 in industrialised nations [34]. It is a progressive

retinopathy that affects the photoreceptor population, retinal pigment epithelium (RPE) and

Bruch’s membrane, and the choroid at various stages of the disease. The advanced stages

of AMD are classified into two forms. Exudative ‘wet’ AMD, induced by sudden choroidal

neovascularisation (CNV), and geographic atrophy (GA) marked by a progressive

expanding lesion of the RPE, photoreceptors, and choriocapillaris. While AMD has a

complex aetiology involving multiple lifestyle and genetic risk factors, the significance of

immunological processes has emerged slowly [4, 71-74, 240]. The relatively recent

confirmation in genome wide association studies (GWAS) of the importance of the

complement system and macrophages has placed inflammation among the forefront of

factors influencing both the onset and progression of AMD [152, 241].

The accumulation and activation of macrophages within the retinal tissues is a

prominent feature of most retinopathies, and is well documented in all forms of AMD.

Microglial cells are the resident macrophages of the retina that are derived from embryonic

85

yolk sac progenitors during development [119, 242], while non-resident bone marrow-

derived macrophages may be recruited into the retina from the vasculature in pathology [5,

120]. In AMD lesions, macrophages form large aggregations in the photoreceptor layer,

subretinal space, and RPE [71, 72, 74, 92, 134, 135, 243], which are typically free of these

leukocytes in healthy individuals [244]. Despite having some beneficial properties [131],

excessive accumulation of these cells is implicated in degeneration in animal models of

AMD, retinal detachment [245], diabetic retinopathy [183, 246, 247], and glaucoma [248,

249].

Chemokines are key regulators of macrophage activation and accumulation in

AMD [250, 251], as well as degenerations associated with retinal detachment [245] and

diabetic retinopathy [183]. The chemokine family comprises more than 50 molecules and

associated receptors that activate and recruit leukocytes to sites of damage. Transcriptome-

wide analysis of AMD donor retinas reports that the leukocyte chemoattractants Ccl2,

Cxcl1, Cxcl10, Cxcl11 are up-regulated in all forms of the disease [47]. Moreover,

intraocular Ccl2 protein levels are increased in patients with CNV or GA [92, 252, 253],

and infiltrating microglia/monocytes in retinas with GA express the cognate Ccl2 receptor,

Ccr2 [92]. Chemokines signalling is implicated in exacerbating the accumulation of

macrophages and photoreceptor death in a range of animal models that demonstrate some

features in common with AMD, including laser-induced-CNV [3], photo-oxidative stress

[89, 91, 92], Abca4−/−Rdh8−/− mice [93], and carboxyethylpyrrole (CEP)-immunized mice

[254].

While these findings underscore the importance of chemokines in shaping

inflammation in the retina, therapeutic blockade of individual chemokine ligands/receptors

may have limited efficacy due to chemokine receptor redundancy, and the tendency toward

compensatory increases in expression of other chemokine family members [93, 185].

86

Broad spectrum chemokine inhibitors (BSCIs) are a class of chemokine modulators with

the ability to inhibit signal transduction of a broad swathe of chemokine receptors [187].

Among these, NR58-3.14.3 is a robust cyclic peptide that specifically inhibits chemokine-

mediated migration of macrophages by blocking the signalling of Ccl- and Cxcl- pathways

[187]. NR58-3.14.3 has been shown to effectively inhibit macrophage accumulation and

ameliorate pathology in lung ischemia [191], obliterative bronchiolitis [190], skin

inflammation [187], and atherosclerotic plaques [192].

To our knowledge there are no studies which have explored the potential of BSCIs

in retinal degeneration models. Here, we investigate the effect of NR58-3.14.3 in

modulation of the accumulation of macrophages in the outer retina, using a light-induced

model of oxidative stress and retinal inflammation. While acute exposure to light damage

does not induce some of the classical features of AMD (including drusen and CNV) it

induces focal and progressive atrophy of the outer retina and models very effectively the

accumulation of subretinal macrophages and up-regulation of chemokines Ccl2, Cxcl1,

Cxcl10, and Cxcl11 [87]. Furthermore, we have shown that the degenerative changes

associated with light damage closely mimic naturally occurring degenerative changes in

the aging rat retina [144].

In the current study, we show that intravitreal delivery of NR58-3.14.3 is safely

tolerated in experimental animals, is long-lasting in the retinal environment, suppresses

macrophage accumulation in the outer retina, and reduces retinal pathology following light

damage. Additionally, we demonstrate that NR58-3.14.3 reduces the expression of pro-

inflammatory factors Il6, Ccl3 and Ccl4 by macrophages, which are implicated in

promoting their deleterious activity in retinal dystrophy. These data provide proof-of-

principle support of the value of BSCIs in thwarting deleterious macrophage activity in

retinal degeneration.

87

4.3. Methods

4.3.1. Animal handling and rearing

All experiments were in accordance with the ARVO Statement for Use of Animals

in Ophthalmic and Vision Research, and with approval from the ANU Animal

Experimentation Ethics Committee (Ethics ID: A2014/56). Adult Sprague-Dawley (SD)

rats were utilised in all experiments, which were born and reared under dim light

conditions (5 lux) and aged between 90-120 post-natal days at the time of use.

4.3.2. Preparation of NR58-3.14.3 and intravitreal injections

Animals were anaesthetised with an intraperitoneal injection of Ketamine

(100mg/kg; Troy Laboratories, NSW, Australia) and Xylazil (12mg/kg; Troy Laboratories,

NSW, Australia). Intravitreal injections of consisting of 3µL were conducted as described

previously [89]; this route was preferred over systemic administration as it minimizes the

potential for off-target effects which may confound the data. The 3µL injection volume

was chosen as offers good reproducibility, minimal disturbance in vitreal volume, and

negligible cataract formation [221]. The broad spectrum chemokine inhibitor (BSCI)

NR58-3.14.3 (Auspep, VIC, Australia) was reconstituted in endotoxin-free 0.1M PBS to a

final concentration of 66.7µg/µl. In the treatment group, 3µl of NR58-3.14.3 in PBS was

intravitreally injected into both eyes of each animal, so that 200µg of NR58-3.14.3 was

delivered to each eye. The control group received an injection of 3µl PBS vehicle in each

eye. Following intravitreal injections the animals were monitored closely throughout the

time course of experiments. As expected, no incidences of cataract formation or other

abnormalities were observed.

88

4.3.3. Light damage

Immediately after administering intravitreal injections, animals were exposed to

1000 lux light for a period of 24 hours, as described previously [209]. During light

damage, animals were placed into transparent Perspex open-top cages under a light source

(COLDF2, 2x36W, IHF, Thorn Lighting, Australia) with access to food and water ad

libitum. After light damage, animals were either euthanized for tissue collection (0 day

time point) or were placed into recovery under dim light conditions (5 lux) for 7 days.

4.3.4. Retinal localisation of injected NR58-3.14.3 via fluorescein

The fluorescein-labelled NR58-3.14.3 was prepared using an NHS-Fluorescein

Antibody Labelling Kit (Pierce, Thermo Fisher Scientific, MA, USA), applied according to

the manufacturer’s protocol. In brief, the NR58-3.14.3 was reconstituted in endotoxin-free

PBS to a concentration of 1mg/ml. The NR58-3.14.3 was then incubated with the NHS-

Fluorescein for 1 hour at room temperature, before being purified through a column to

remove excess dye from the final product. The fluorescein-NR58-3.14.3 was stored at 4°C.

Using the intravitreal procedure described earlier, each animal was injected with 3µl

fluorescein-NR58-3.14.3 in one eye only; the contralateral eye was used as either a

fluorescein-only injected control, or a non-injected control. Following the injection,

animals were placed under dim-light conditions to recover. Both eyes of each animal were

collected for cryosectioning at several times after the injection (20 minutes, 3 hours, 24

hours and 7 days). The levels of fluorescein-NR58-3.14.3 in injected retinas were

measured on cryosections. The fluorescence was visualised with a laser-scanning A1+

confocal microscope (Nikon, Tokyo, Japan), and images were acquired at consistent

regions using the NIS-Elements AR software (Nikon, Tokyo, Japan). From these images

fluorescence intensity was quantified with ImageJ software (NIH, MD, USA), using

integrated density for a fixed area.

89

4.3.5. Tissue collection and processing of whole retinas

Animals were euthanized using an overdose of barbiturate, which was administered

via intraperitoneal injection (Valabarb; Virbac, NSW, Australia). The left eye from each

animal was marked for orientation then enucleated for cryosectioning, while the retina from

the right eye was excised through a corneal incision for RNA extraction. Both

cryosectioning and RNA extraction of the excised retinas were performed according to our

previous methodology [141].

4.3.6. Fluorescence-activated cell sorting (FACS) of retinal macrophages

Rats in each treatment group were euthanized immediately after light damage (0

days) using barbiturate overdose as previously described. Retinas from both eyes were

promptly removed through a corneal incision. Retinas from each animal were pooled and

immediately placed in chilled Hank's balanced salt solution (HBSS), and then subjected to

light mechanical separation using a razor blade. Samples were transferred into a 0.2%

papain digestion cocktail as described in our previous protocol [87], with minor

modifications. Samples were incubated at 37°C for 7 minutes then 8°C for 30 minutes.

After neutralisation and resuspension, the resulting homogenate was incubated in staining

buffer containing a CD11b antibody conjugated to Alexa 647 (Biolegend, San Diego, CA)

for 30 minutes at 4°C, then washed in HBSS and resuspended in staining buffer. The

resultant CD11b-stained samples were run through a fluorescence-activated cell sorter

(FACS) (BD FACSAria II; BD Biosciences, Franklin Lakes, NJ). The isolated CD11b+

macrophages were collected in staining buffer and kept chilled on ice until RNA extraction

could be commenced. RNA extraction was conducted via a protocol we have previously

established [87]. Isolated total RNA was analysed for quantity and purity with a ND-1000

spectrophotometer (Nanodrop Technologies, Wilmington, DE).

90

4.3.7. TUNEL assay and quantification of photoreceptor survival

To quantify levels of photoreceptor cell death in the retina, retinal cryosections

were stained for apoptosis using a terminal deoxynucleotidyl transferase dUTP nick end

labelling (TUNEL) kit (Roche Diagnostics, NSW, Australia) as previously described [255,

256]. TUNEL+ cells in the ONL were counted throughout the full length of each retinal

section along the para-sagittal plane (supero-inferior), and also included the optic nerve for

consistency. These counts were subsequently averaged for each experimental group. To

quantify photoreceptor survival, sections were stained with bisbenzimide (Sigma-Aldrich

Co., MO, USA), and the number of rows of photoreceptor cell bodies in the ONL were

counted. Five counts were made for each retinal section, and then were averaged for each

experimental group.

4.3.8. Immunohistochemistry

Cryosections were used for immunohistochemical analysis, using antibodies

against IBA1 (1:500, Wako, Osaka, Japan) and GFAP (1:500, Dako, Agilent Technologies,

CA, USA) as described in our previous study, with minor modifications [87, 209].

Fluorescence in retinal sections was captured with a laser-scanning A1+ confocal

microscope (Nikon, Tokyo, Japan). Images panels were analysed and assembled using

ImageJ (NIH, MD, USA) and Photoshop CS6 software (Adobe Systems, CA, USA).

4.3.9. Quantification of microglia/macrophages

Macrophages counts were performed on sections immunolabelled with the IBA1

marker, a label for retinal microglia and macrophages. Counts of IBA1+ cells were carried

out along the full-length of retinal sections cut in the para-sagittal plane (supero-inferior)

within the vertical meridian, and each section also included the optic nerve to ensure

consistency. Counts were made of all IBA1+ cells throughout the retina, which were split

91

into two groups: the inner retina (ILM-OPL), and the outer retina (ONL-RPE) where

activated macrophages are known to aggregate during retinal degeneration [131, 245, 257].

4.3.10. Polymerase chain reaction (PCR)

cDNA was prepared from 1µg of RNA of each sample using a Tetro cDNA

Synthesis Kit (Bioline Reagents, London, UK). The quantitative real-time PCRs (qPCRs)

were conducted using Taqman hydrolysis probes (Table 4.1) and Taqman Gene Expression

Master Mix (Applied Biosystems, Life Technologies, CA, USA). These were applied

following the manufacturer’s instructions, and run on a QuantStudio Flex 12K instrument

(Applied Biosystems), at the Biomolecular Resource Facility, JCSMR, ANU. Data analysis

was performed using Expression Suite v1.0.3 software (Life Technologies, CA, USA); the

fold change was determined for each gene and sample using the comparative cycle

threshold (Ct) method (ΔΔCt). All data was normalised to the GAPDH reference gene,

which does not change in expression over the course of retinal light damage [141, 217,

225]. ACTB was utilised as an additional reference gene in qPCRs involving the CD11b+

isolates.


Gene Symbol Gene Name Catalog Number Entrez Gene ID

Ccl2 Chemokine (C-C motif) ligand 2 Rn01456716_g1 24770




IL-6 Interleukin 6 Rn01410330_m1 24498

IL-1B Interleukin 1β Rn00580432_m1 24494

TNF Tumor necrosis factor α Rn00562055_m1 24835

IL-12B Interleukin 12β Rn00575112_m1 64546

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

Rn99999916_s1 24383

ACTB Actin, beta Rn00667869_m1 81822

92

Standard PCR was performed on RNA samples purified from FACS-isolated

CD11b+ microglia/macrophages, using primers specific to chemokine receptor genes

(Ccr1, Ccr2, Ccr5, Cxcr3) which are detailed in our previous investigation [87]. First-strand

cDNA synthesis was performed from 50 ng of RNA using the Tetro cDNA Synthesis Kit

(Bioline), and standard PCR was then performed using MyTaq DNA polymerase (Bioline);

negative controls had cDNA omitted from the reaction cocktail. The presence of PCR

product and specificity of the reaction were assessed by gel electrophoresis.


Ccl3 was cloned from a 540bp PCR product using cDNA prepared from rat retinas

(as described in the qPCR section), and which was synthesised into a digoxigenin (DIG)-

labelled riboprobe according to our previous publication [87]. The In situ hybridisation was

performed using our established protocol [224]; the Ccl3 riboprobe was hybridised on

retinal cryosections overnight at 55°C, and then washed in decreasing concentrations of

saline sodium citrate (pH 7.4) at 60°C. The bound probe was visualised with either

NBT/BCIP, or HNPP/Fast-Red (Roche).

4.3.12. Statistical analysis


Software, CA, USA). A two-way ANOVA with Tukey’s multiple comparison post-test, or

an unpaired student t-test was utilised to determine the statistical outcome; a P-value of

<0.05 was considered statistically significant.

93

4.4. Results

4.4.1. Stability and localisation of NR58-3.14.3 in injected retinas

Localisation and persistence of NR58-3.14.3 within the retina was determined by

intravitreal injections of fluorescein-conjugated NR58-3.14.3 (Figure 4.1). At 20 minutes

post-injection, levels of fluorescence increased dramatically in retinas injected with NR58-

3.14.3-fluorescein, compared to fluorescein-only and non-injected controls (P<0.05, Figure

4.1A). Fluorescence levels were maintained at 3 hours post-injection, though were reduced

by approximately a third after 24hrs – this was not significant however compared to the 20

minutes post-injection group (P>0.05). After 7 days, fluorescence was still present in

NR58-3.14.3-fluorescein injected retinas at levels significantly higher than the fluorescein-

only and non-injected control groups (P<0.05).

At 20 minutes-post injection, NR58-3.14.3-fluorescein was distributed throughout

the retina, spanning the ganglion cell layer (GCL) to the RPE (Figure 4.1B). This

distribution was mostly unchanged after 3hrs, although fluorescence appeared more

concentrated within the GCL, nerve fibre layer (NFL), inner nuclear layer (INL), and RPE

(Figure 4.1C, arrows). After 24hrs incubation, fluorescence was localised in intense

clusters encompassing the NFL, retinal vasculature, and RPE (Figure 4.1D, arrows). This

localisation was maintained at 7 days post injection (Figure 4.1E, arrows), while

fluorescein-only controls showed little fluorescence at all (Figure 4.1F).

4.4.2. Tolerance of NR58-3.14.3 within the retinal environment

NR58-3.14.3 was initially injected into dim-reared retinas to determine whether it

induced any change in photoreceptor death, retinal stress, or macrophages alone (Figure

4.2). At 24hrs following intravitreal injection with NR58-3.14.3 analyses showed no

significant change in the number of TUNEL+ photoreceptors (P>0.05, Figure 4.2A) or in

94

Figure 4.1. Stability and localisation of intravitreally injected NR58-3.14.3. A: Levels of

fluorescence readily increased in retinas injected with fluorescein-conjugated NR58-3.14.3

after only 20 minutes, and remained highly elevated after 3hrs. Fluorescence was

significantly lower at 7 days post-injection (P<0.05), but was still far higher than

fluorescein-only and non-injected controls (P<0.05). B: NR58-3.14.3-fluorescein (green,

arrow) was present throughout the retina at 20 minutes post-injection. C: Fluorescence

95

remained consistent in retinas after 3hrs, though was more concentrated within the GCL,

NFL, INL, and RPE (arrows). D-E: After 24hrs and 7 days post-injection, fluorescence for

NR58-3.14.3-fluorescein was markedly reduced, but still readily apparent around the NFL,

retinal vasculature, and RPE (arrows). F: Retinas injected with fluorescein-only showed

only very faint background fluorescence in comparison to NR58-3.14.3-fluorescein

injected animals (E). GCL, ganglion cell layer; INL, inner nuclear layer; NFL, nerve fibre

layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium. Scale bars represent

100µm. NR58-3.14.3-fluorescein n=3, fluorescein-only n=3, non-injected n=3.

96

Figure 4.2. Tolerance of NR58-3.14.3 within the retinal environment in relation to stress

and macrophage recruitment. A: Injection of dim-reared controls with NR58-3.14.3 did not

yield any change in TUNEL+ photoreceptors after 24hrs incubation, compared to non-

injected controls (P>0.05). B: NR58-3.14.3 alone did not induce any recruitment of IBA1+

macrophages to the outer retina after 24hrs incubation in dim-reared animals, and there

was also no change in the inner retinal population (P>0.05). C-D: The integrity of the ONL

was unchanged in animals injected with NR58-3.14.3, compared to non-injected controls.

E-F: The morphology of IBA1+ macrophages/microglia (green) was unaltered in NR58-

3.14.3 treated retinas, and the ONL was devoid of any of these cells (arrows) in both

groups. G-H: Immunoreactivity for stress marker GFAP was restricted to the GCL in both

NR58-3.14.3 and non-injected groups (arrows), consistent with a normal physiological

state. GCL, ganglion cell layer; IHC, immunohistochemistry; INL, inner nuclear layer;

NFL, nerve fibre layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium. Scale

bars represent 100µm. NR58-3.14.3 n=3, non-injected n=3.

97

integrity of the retinal layers (Figure 4.2C-D), compared to control retinas; both parameters

were consistent with our previous measurements in control SD retinas [209]. General

retinal stress was assessed via immunohistochemistry for GFAP (Figure 4.2G-H), an

accepted indicator of retinal pathology [10]. Immunoreactivity for GFAP was confined to

the GCL (arrows) in both NR58-3.14.3- and PBS-injected retinas, consistent with a normal

physiological retinal state [10, 209, 258]. Finally, there was no change in the distribution of

IBA1+ microglia/macrophages in NR58-3.14.3-injected retinas compared to PBS-injected

controls (P>0.05, Figure 4.2B, E-F). The outer nuclear layer (ONL) and subretinal space

was devoid of macrophages in both groups (Figure 4.2E-F, arrows), while resident

microglia/macrophages in the inner retina showed no change in number or morphology.

4.4.3. Effect of NR58-3.14.3 on macrophage accumulation following light damage

The accumulation of macrophages within the outer retina (including the

photoreceptor layer and subretinal space) following NR58-3.14.3 injection was assessed

using IBA1 immunoreactivity (Figure 4.3) to identify microglia/macrophages [259, 260].

Immediately following light damage (0 days recovery), we observed a substantial incursion

of IBA1+ cells into the outer retina of PBS-injected controls (Figure 4.3A, C-D arrows). In

animals injected with NR58-3.14.3, this accumulation was substantially less per retinal

section (~70% reduction after NR58-3.14.3, P<0.05, Figure 4.3A, E).

In PBS-injected animals 7 days post-light damage, the number of IBA1+ cells

increased significantly throughout the retina, particularly in the subretinal space (Figure

4.3A) where accumulations of swollen, amoeboid-like macrophages were observed

amongst the degenerating photoreceptor segments (Figure 4.3F-G arrows). In animals

injected with NR58-3.14.3 however, the number of IBA1+ cells infiltrating the outer retina

was significantly less than in PBS controls (~60% reduction after NR58-3.14.3, P<0.05,

Figure 4.3A), and virtually no macrophages were detected in the subretinal space (Figure

98

Figure 4.3. Macrophage/microglia recruitment to the outer retina following injection of

NR58-3.14.3 and light damage. A-B: At 0 days post-LD, there was a substantial incursion

of IBA1+ cells and their ramified processes into the outer retina of PBS-injected controls,

which was substantially lower in animals injected with NR58-3.14.3 (P<0.05). During the

chronic phase of degeneration at 7 days post-LD, the number of IBA1+ cells was further

increased in the outer retina, although animals injected with NR58-3.14.3 had far fewer

IBA1+ cells than in PBS controls (P<0.05). For the inner retinal counts of IBA1+

macrophages/microglia, there was no change at either 0 or 7 days recovery for both

treatment groups (P >0.05). C-E: IBA1+ cells invaded ONL with their extended processes

99

in PBS-injected animals at 0 days (C-D, arrows), which was not apparent in the NR58-

3.14.3 group (E). F-H: Accumulations subretinal IBA1+ macrophages were observed in

PBS-injected animals at 7 days (F-G, arrows), while the subretinal space was nearly devoid

of these cells in NR injected retinas. GCL, ganglion cell layer; IHC,

Immunohistochemistry; INL, inner nuclear layer; NFL, nerve fibre layer; ONL, outer

nuclear layer; RPE, retinal pigment epithelium. C,E,F,H scale bars represent 100µm, D,G

are 25µm. N=11 per group at 0 and 7 days.

100

4.3H). Conversely, the numbers of IBA1+ cells in the inner retina was similar in NR58-

3.14.3- and PBS-injected animals at both 0 and 7 days recovery (P>0.05, Figure 4.3B).

4.4.4. Change in photoreceptor integrity following NR58-3.14.3 injection and light

damage

The effect of NR58-3.14.3 administration on photoreceptor cell death following

light-induced damage was investigated using the TUNEL assay (Figure 4.4). Exposure to

bright continuous light induced an increase in the number of TUNEL+ photoreceptors in

both PBS- and NR58-3.14.3-injected groups (Figure 4.4A). However, the number of

TUNEL+ cells in animals injected with NR58-3.14.3 was approximately half that in the

PBS-injected control animals at 0 days recovery (P<0.05, Figure 4.4A-C). The effect of

NR58-3.14.3 was even more pronounced during the chronic phase of degeneration at 7

days recovery, wherein the number of TUNEL+ photoreceptors was 4 times lower in

NR58-3.14.3-injected animals compared with the PBS-controls (P<0.05, Figure 4.4A, D-

E). In addition, the cumulative effect of NR58-3.14.3 on the number of surviving

photoreceptors following light damage was determined via measurements of ONL

thickness. There was no change in the number of photoreceptor rows at 0 days recovery

compared to PBS controls (P>0.05, Figure 4.4F). At 7 days recovery however, there was in

increased number of photoreceptor rows in NR58-3.14.3 retinas compared to PBS controls

(P<0.05, Figure 4.4F-H).

4.4.5. Cytokine and chemokine expression following NR58-3.14.3 injection and light

damage

The expression of chemokines (Ccl2, Ccl3, Ccl4, Ccl7) and cytokines (Il6, Il1b,

TNFa, Il12) was assessed using qPCR to determine the effect of NR58-3.14.3 on

chemokine signalling (Figure 4.5). These were selected based on their up-regulation in our

microarray analysis conducted previously using the light damage model [87]. Expression

101

Figure 4.4. Change in photoreceptor integrity following injection of NR58-3.14.3 and light

damage. A: At 0 days post-LD, animals injected with NR58-3.14.3 had approximately half

the number of TUNEL+ cells per retina compared to PBS-injected controls (P<0.05). After

7 days post-LD, where chronic retinal degeneration is most apparent, the number of

TUNEL+ photoreceptors was roughly 3 times lower in animals injected with NR58-3.14.3

than in the PBS-controls (P<0.05). B-E: Representative TUNEL images showcase the

reduction in TUNEL+ photoreceptors in NR58-3.14.3 injected retinas at both 0 (C) and 7

(E) days post-LD, compared to PBS controls (B,D). F: At 0 days post-LD, there was no

102

change in the number of rows of photoreceptor nuclei in NR58-3.14.3 injected retinas

compared to PBS controls (P>0.05). However, at 7 days post-LD, animals injected with

NR58-3.14.3 had a larger number of remaining photoreceptor rows than PBS controls

(P<0.05). G-H: Representative ONL images demonstrate this reduction of photoreceptor

loss in NR58-3.14.3 injected retinas compared to PBS controls at 7 days post-LD. INL,

inner nuclear layer; ONL, outer nuclear layer. B-E scale bars represent 100µm, G-J are

50µm. N=10-11 per group at 0 days, N=12 per group at 7 days.

103

Figure 4.5. Expression of chemokines (A, C) and cytokines (B, D) in whole retinas

following injection of NR58-3.14.3 and light damage. A-B: All genes assessed exhibited

significant up-regulation at 0 days post-LD in both treatment groups. However, Ccl3, Ccl4,

and Il6 had significantly lower expression (P<0.05) in retinas injected with NR58-3.14.3

compared to PBS-controls. C-D: By 7 days post-LD, up-regulation of all genes assessed

was only 10-20% of that observed at 0 days, with no difference between NR58-3.14.3 and

PBS injected groups (P>0.05). 0 days N=11-12 per group, 7 days N=5 per group.

104

levels of all genes were substantially upregulated immediately after bright light exposure

(0 days) in both PBS- and NR58-3.14.3-injected animals (Figure 4.5A-B). However,

expression levels of Ccl3, Ccl4, and Il6 were significantly less in NR58-3.14.3-injected

compared to PBS-injected animals (Figure 4.5A-B; P<0.05). At 7 days post-light damage,

expression levels of all cytokines/chemokines assessed had dropped by approximately 80-

90% (Figure 4.5C-D), and there was no difference between expression levels in the two

treatment groups (P>0.05).

4.4.6. Change in expression of inflammatory factors by macrophages following

NR58-3.14.3 injection and light damage

Microglia/macrophages were FACS-sorted from retinal suspensions for each

treatment group on the basis of CD11b immunoreactivity (Figure 4.6A), which co-localises

with IBA1 [261-263]. CD11b was preferred over IBA1 as a microglia/macrophage marker

in this instance, because the intracellular staining required for IBA1 would prevent any

downstream RNA analysis following FACS. We first sought to confirm whether the

CD11b+ microglia/macrophages expressed Ccl- and Cxcl- chemokine receptors which

correspond to the ligands up-regulated following light damage [87], as well as in AMD

[47]. Using standard PCR (Figure 4.6B), CD11b+ microglia/macrophages from both

treatment groups were found to express Ccr1, Ccr3, Ccr5, and Cxcr3 receptors.

To further explore the role of microglia/macrophages in retinal inflammation we

compared the expression of Ccl3, Ccl4, and Il6 in isolated CD11b+ microglia/macrophages

from NR58-3.14.3-injected and PBS-injected groups using qPCR. These were chosen due

to their differential expression in the whole-retina samples (shown in Figure 4.5) and the

implicit roles of these genes in promoting pathogenic macrophage activity [93, 239]. After

light damage, expression of Ccl3, Ccl4, and Il6 were significantly decreased in CD11b+

cells from NR58-3.14.3-injected retinas, compared to PBS control retinas (P<0.05,

105

Figure 4.6. Effect of NR58-3.14.3 on the pathogenic phenotype of the retinal macrophage

population following light damage. A: Representative FACS plots, with gating strategies

for the isolation of CD11b+ microglia/macrophages. Gating methodology was applied

equally for all samples. B: Representative images of PCR products via electrophoresis for

chemokine receptors Ccr1, Ccr2, Ccr5, Cxcr3, in samples of CD11b-sorted cells. Receptor

expression was observed in both NR58-3.14.3 and PBS CD11b isolates. C: Following

exposure to LD, expression of Ccl3, Ccl4, and Il6 were all decreased in CD11b+

microglia/macrophages isolated from NR58-3.14.3–injected retinas, compared to those

from PBS injected retinas (P<0.05). N=5 per group at 0 days.

106

Figure 4.6C). In situ hybridisation for Ccl3 mRNA showed clusters of ramified microglia

in the outer retina of PBS controls (Figure 4.7A-B arrows) following light damage, which

were also immunoreactive for IBA1 (Figure 4.7E-F arrows). Ccl3-expressing macrophages

were far less numerous in retinas from NR58-3.14.3-injected animals (Figure 4.7C-D

arrows).

107

Figure 4.7. In situ hybridisation for Ccl3 mRNA following NR58-3.14.3 injections and

light damage. A-B: At 0 days LD recovery in PBS-injected retinas, there was staining for

Ccl3 mRNA (purple) in among clusters of irregularly shaped nuclei traversing the ONL

(arrows). C-D: Retinas injected NR58-3.14.3, conversely, displayed very few Ccl3-

expressing nuclei. E-F: Ccl3-expressing nuclei (red, arrow) were correlated with

immunofluorescence for IBA1+ macrophages/microglia (green, arrow). IHC,

immunohistochemistry; ISH, in situ hybridisation; ONL, outer nuclear layer; OS, outer

segments. Scale bars represent 50µm.

108

4.5. Discussion

The findings of the current study demonstrate the efficiency of the broad spectrum

chemokine inhibitor NR58-3.14.3 in modulating the pathogenic activity of

macrophages/microglia and ameliorating photoreceptor death, in a model of photo-

oxidative damage and outer retinal inflammation. First, our data demonstrate that the

intravitreal delivery of NR58-3.14.3 is tolerated within the retinal environment, and its

persistence in the retina provides for a generous window of activity. Second, we show that

injection of NR58-3.14.3 suppresses the chronic accumulation of macrophages/microglia

within the photoreceptor layer and subretinal space following damage. Third, NR58-

3.14.3-treated macrophages demonstrated reduced pathogenic activation, indicated by

decreased expression of Ccl3, Ccl4, and Il6. Finally, we show that photoreceptor

degeneration is reduced across the time course of damage in retinas injected with NR58-

3.14.3, which is accompanied by an increase in photoreceptor survival at the site of focal

and progressive atrophy.

NR58-3.14.3 is thought to exert its inhibitory effect on Ccl- and Cxcl- families

though disruption of intracellular signal transduction, which effectively renders leukocytes

blind to directional cues provided by Ccl- and Cxcl- ligands [195, 264]. This broad

suppression is desirable, as the blockade of singular chemokine ligands, such as Ccl2, can

induce compensatory increases in the expression other chemokines which exacerbate

retinal inflammation and degeneration [93, 185]. Up-regulation of Ccl2, Cxcl1, Cxcl10,

Cxcl11 are present in all forms of AMD [47], and the Ccl2/Ccr2 axis is implicated in the

pathogenic accumulation of macrophages to the outer retina in models that feature aspects

of either CNV or geographic atrophy, such as light damage [3, 89, 91-93, 254]. Increases

in ocular Ccl- and Cxcl- chemokines are also found in individuals affected by retinal

detachment [265, 266], uveitis [267], glaucoma [268], diabetic retinopathy, and retinitis

109

pigmentosa [269], while blockade of Ccl2 signalling has proven beneficial in thwarting

macrophage aggregation and cell death in experimental retinal detachment [245], diabetic

retinopathy [183], and retinitis pigmentosa [184]. While the light damage paradigm does

not model features of CNV or degenerations such as retinal detachment, our findings

allude to the potential of BSCIs in targeting a broad swathe of chemokine activity across a

spectrum of retinal degenerations.

To our knowledge, this is the first study to examine the potential of BSCIs as a

potential therapeutic agent in retinal disease. The findings from our study are consistent

with previous investigations using NR58-3.14.3 in inflammatory models ranging from

atherosclerotic plaques to obliterative bronchiolitis, wherein an inhibition of macrophage

accumulation and amelioration of tissue damage were observed [189, 190, 192, 194, 195].

Our data own show that intravitreal NR58-3.14.3 reduces the accumulation of

macrophages within the outer retina, including ONL and subretinal space. The proportion

of these subretinal macrophages that are either resident microglia or recruited bone-

marrow derived monocytes is unclear, although the effect of intravitreal NR58-3.14.3 on

these subpopulations is beyond the scope of this study. Nevertheless, we speculate that

intravitreal NR58-3.14.3 could impact the infiltration of both subpopulations to the

subretinal space, despite the local nature its administration. This is suggested by the

localisation fluorescein-NR58-3.14.3 within the retinal vasculature, where blood borne

monocytes are known to recruit into the retina following light-induced injury [185].

Additionally, as NR58-3.14.3 penetrates through to all layers of the retina, it may act on

RPE and Müller cells, which are both known to secrete Ccl- and Cxcl- chemokines to

recruit leukocytes to the site of injury [85, 87].

Our data indicate that NR58-3.14.3 modulates the transcriptional phenotype of

macrophages following light damage. The expression of Ccl3, Ccl4, and Il6 were all down-

110

regulated in macrophages exposed to NR58-3.14.3, and is consistent with the down

regulation of Il6 observed in experimental obliterative bronchiolitis following

administration of NR58-3.14.3 [190]. Ccl3, Ccl4, and Il6 are markers of M1 polarisation,

which is typically associated with deleterious pro-inflammatory responses [113]. Although

macrophage polarisation is considered a simplification of extremes which form part of a

phenotypic spectrum, the suppression of these genes within the macrophage population in

NR58-3.14.3 injected retinas do point toward a lower inflammatory state among these cells

as a result. How NR58-3.14.3 elicits this transcriptional change is unclear, though we

speculate it may occur via its inhibition of macrophage chemotaxis to the outer retina,

wherein emergent photoreceptor death may stimulate up-regulation of cytokines such as

Ccl3, Ccl4, and Il6. This is supported by our in situ hybridisation data, wherein Ccl4

mRNA is expressed only in macrophages that have migrated to the outer retina.

Several lines of evidence suggest that Ccl3, Ccl4, and Il6 are important mediators

of pathogenic activity by macrophages in retinal degeneration, which may account for the

neuroprotective action of NR58-3.14.3. Increased levels of Il6 are associated with the

incidence and progression of AMD, and the cytokine is considered a potential therapeutic

target [46, 96, 270]. A pathogenic role of Il6 is more recently highlighted by Levy and

colleagues, who show that accumulation of the AMD biomarker apolipoprotein E (APOE)

in subretinal macrophages up-regulates their expression of Il6, which in turn promotes

their increased survival and induction of retinal pathology in light-damaged Cx3cr1−/−

mice [239]. Additionally, a deleterious role of Il6 has been characterised in experimental

ocular toxoplasmosis via antibody neutralisation, which considerably improved retinal

morphology compared to controls [97].

Ccl3 is implicated in animal models of AMD/Stargardt disease

(Abca4−/−Rdh8−/−), retinitis pigmentosa (Mertk−/−) [93], and oxygen induced

111

retinopathy [94]. Ccl3 was expressed by macrophages/microglia as shown by Kohno and

colleagues – consistent with our current investigation – and its ablation reduced the extent

of photoreceptor degeneration in both aged Abca4−/−Rdh8−/− mice and young Mertk−/−

mice [93]. In experimental oxygen induced retinopathy, mice were treated with the

combination therapy of Ccl3 and Ccl2 neutralising antibodies, rather than a singular

therapy. Regardless the neovascular pathology was reduced by 30% in these animals [94].

The precise role of Ccl4 in retinal degeneration has yet to be examined, although protein

levels are increased in the aqueous humour of AMD patients [271], and its expression is

up-regulated concomitantly with emergence of retinal degeneration in experimental light

damage [87], diabetic retinopathy, and Abca4−/−Rdh8−/− and Mertk−/− mice [93].

Moreover, ablation of Ccl3 induced compensatory increases in Ccl4 expression in light-

damaged Abca4−/−Rdh8−/− mice, which was postulated to contribute to the increased

pathology observed in this paradigm (rather than the age paradigm where there was

protection).

We speculate that NR58-3.14.3 may also confer retinal protection by inhibiting

other macrophage processes, such as aberrant phagocytosis. This phenomenon has been

recently demonstrated in the rd10 model of retinitis pigmentosa, in which infiltrating

microglial cells were found to exacerbate cell death by phagocytosing non-apoptotic

photoreceptors [116]. In suppressing the infiltration of macrophages within the outer

retina, NR58-3.14.3 may also reduce the erratic phagocytosis of photoreceptors by

activated macrophages. This may be a contributing factor to the increases in ONL

thickness in NR58-3.14.3-injected retinas, however, additional investigations including

longer-term and functional studies are required to firmly establish this in the future.

112

4.5.1. Conclusion

Our findings showcase the efficacy of BSCIs such as NR58-3.14.3 in modulating

macrophage/microglia responses in retinal degeneration. NR58-3.14.3 ameliorated the

chronic aggregation of subretinal macrophages in light-induced subretinal inflammation,

and suppressed their potentiation of Il6, Ccl3 and Ccl4 signalling. As with all current

models, light damage does not encompass every aspect of AMD pathology; nevertheless

our findings have implications for the treatment of inflammation in the disease.

Chemokines are associated with the aggregation of subretinal macrophages in AMD, while

expression of Il6, Ccl3 and Ccl4 are implicated in augmenting their survival and

pathogenicity within the subretinal space. Together, these experiments offer proof-of-

principle for the potential of BSCIs as therapeutic agents in targeting subretinal

inflammation in diseases such as AMD.

113

5. RESULTS

Microglia-derived IL-1β promotes chemokine expression by

Müller cells and RPE in focal retinal degeneration


Natoli, R.*, Fernando, N.*, Madigan, M., Chu-Tan, J.A., Valter, K., Provis, J., Rutar, M.

(2017) Microglia-derived IL-1β promotes chemokine expression by Müller cells and RPE

in focal retinal degeneration. Molecular Neurodegeneration. 12:31


of all data and preparing the manuscript for publication).

114

5.1. Abstract

Background: Chemokine signalling is required for the homing of leukocytes during

retinal inflammation, and is associated with pathogenesis of diseases such as age-related

macular degeneration (AMD). Here, we explore the role of interleukin-1β (IL-1β) in

modulating AMD-associated chemokines Ccl2, Cxcl1, and Cxcl10 during photo-oxidative

retinal damage, and the effect on both the accumulation of outer-retinal macrophages, and

death of photoreceptors.

Methods: Inhibition of retinal IL-1β expression was performed using either siRNA or

antibody neutralisation, which was intravitreally injected in SD rats prior to photo-

oxidative damage. Changes in the expression and localisation of Il-1β, Ccl2, Cxcl1 and

Cxcl10 genes were assessed using qPCR and in situ hybridisation, while the recruitment of

retinal macrophages was detected using immunohistochemistry for IBA1. Levels of

photoreceptor cell death were determined using TUNEL.

Results: Photo-oxidative damage elevated the expression of Il-1β and inflammasome-

related genes, and IL-1β protein was detected in microglia infiltrating the outer retina. This

was associated with increased expression of Ccl2, Cxcl1, and Cxcl10. Intravitreal IL-1β

inhibitors suppressed chemokine expression following damage and reduced macrophage

accumulation and photoreceptor death. Moreover, in Müller and RPE cell cultures, and in

vivo, Ccl2, Cxcl1 and Cxcl10 were variously upregulated when stimulated with IL-1β, with

increased macrophage accumulation detected in vivo.

Conclusions: IL-1β is produced by retinal microglia and macrophages and promotes

chemokine expression by Müller cells and RPE in retinal degeneration. Targeting IL-1β

may prove efficacious in broadly suppressing chemokine-mediated inflammation in retinal

dystrophies such as AMD.

115

5.2. Background

Inflammation plays a key role in the pathogenesis of age-related macular

degeneration (AMD), which is the leading cause of blindness in the ageing population of

the Western world [34]. One of the characteristics of atrophic or ‘dry’ AMD, is the

accumulation of microglia/macrophages in the outer retina and subretinal space [4, 71-74].

Homing of leukocytes, such as macrophages, to sites of neuronal damage is orchestrated in

part by the co-ordinated expression of chemokines (reviewed in [272]). The chemokine

family consists of numerous ligands and receptors belonging to particular subclasses (such

as Ccl- and Cxcl-), which act as guidance cues for leukocytes during homeostasis and

injury [78]. Chemokine expression is prominent in many retinal degenerations, including

AMD, wherein the up-regulation of genes encoding potent ligands such as Ccl2 and

Cxcl10 is a characteristic of the disease [47]. The Ccl2-Ccr2 signalling axis has been well-

studied in relation to retinal disease, and genetic ablation or pharmacological inhibition of

the ligand or receptor reduces pathology in laser-induced neovascularisation and photo-

oxidative damage models [84, 92, 238].

Our previous work has shown that RPE and Müller cells are the mediators of

chemokine responses, and up-regulate the expression of Ccl2, Cxcl1 and Cxcl10 in

response to damage [87]. Furthermore, pharmacological suppression of the Ccl- and Cxcl-

signalling axes ameliorates subretinal macrophage infiltration and photoreceptor/RPE

degeneration [228]. However, the factor/s that stimulate expression of these chemokines

during retinal inflammation remain unclear. Recent in vitro studies indicate that cytokines

such as Il-6 and Ccl2 may be stimulated in RPE or Müller cells when co-cultured with

lipopolysaccharide (LPS)-stimulated microglia [86, 88], suggesting that similar

interactions may promote chemokine expression by Müller cells and RPE during retinal

degeneration.

116

IL-1β is a pro-inflammatory cytokine whose maturation and secretion into the

extracellular environment is mediated by assembly of the NLRP3 inflammasome

(reviewed in [98-100]), and is associated with the progression of retinal pathologies

including neovascular and atrophic AMD [111, 112]. Several studies have also indicated

that IL-1β is secreted by microglia in photo-oxidative damage [113, 114], as well as in

models of neovascular AMD [115], retinitis pigmentosa [116], and retinal detachment

[117]. In this study, we tested the hypothesis that IL-1β promotes the up-regulation of

chemokines in Müller cells and RPE, increasing outer-retinal macrophage accumulation

and photoreceptor death, using a model of focal retinal degeneration. In this model, several

inflammatory features observed in atrophic AMD are produced, including the expression

of chemokines such as Ccl2, macrophage accumulation and outer retinal lesion

development [85, 141, 209]. We find that inhibiting IL-1β, either via antibody

neutralisation or targeted small interfering RNA (siRNA), suppresses the expression of

RPE- and Müller cell-associated chemokines Ccl2, Cxcl1, and Cxcl10, reduces

accumulation of macrophages in the outer retina, and mitigates photoreceptor death. We

also find that IL-1β protein directly stimulates retinal chemokine up-regulation in vivo, and

in cultured RPE and Müller cells. Targeting IL-1β as a therapeutic approach to reduce

chemokine synthesis in the damaged retina may be beneficial in slowing the progression of

retinal degenerations.

5.3. Methods

5.3.1. Animals and photo-oxidative damage

All experiments were conducted in accordance with the ARVO Statement for Use

of Animals in Ophthalmic and Vision Research, and had approval from the Australian

117

National University (ANU) Animal Experimentation Ethics Committee (Ethics ID:

A2014/56). Adult Sprague-Dawley (SD) albino rats aged 90-120 days were used for all

experiments. Animals were born and reared under dim light conditions (5 lux) prior to

photo-oxidative damage. For the photo-oxidative damage paradigm, animals were placed

into transparent Perspex open-top cages under a light source (COLD F2, 2x36W, IHF,

Thorn Lighting, Australia) at 1000 lux for either 3, 6, 12, 17, or 24 hours (hrs), with access

to food and water ad libitum. Following light exposure, animals were immediately

euthanized using an overdose of barbiturate via an intraperitoneal injection (Valabarb;

Virbac, NSW, Australia). For each animal, eyes were processed for either cryosectioning

or RNA extraction, according to protocols detailed in our previous publications [141].

5.3.2. Intravitreal injections

Intravitreal injections were performed as described in detail previously [273],

wherein animals were anaesthetised using an intraperitoneal injection of ketamine

(100mg/kg; Troy Laboratories, NSW, Australia) and xylazil (12mg/kg; Troy Laboratories).

Injections consisted of either siRNA- or antibody-based IL-1β inhibitors, or IL-1β protein.

A neutralising antibody to IL-1β (Cat# AF-501-NA, R&D Systems, Minneapolis,

MN) was administered intravitreally to rats immediately prior to photo-oxidative damage.

A 3µL solution containing either anti-IL-1β or an isotype control antibody was injected

into individual animals, which equated to a delivery of 0.6µg of antibody per eye. After

intravitreal injections, the animals were immediately transferred to individual cages

designed to allow light to enter unimpeded. Animals were exposed to photo-oxidative

damage for 24hrs, during which corneal hydration was maintained though application of a

synthetic tear gel (GenTeal Gel; Novartis, NSW, Australia) until the animals awoke.

RNA-interference (RNAi) was conducted using Il-1β-specific siRNA (Cat#

s127941; Thermo Fisher Scientific, Waltham, MA, USA), while a scrambled negative

118

siRNA (Cat# 12935300, Stealth RNAi Med GC; Thermo Fisher Scientific) served as a

control, which were encapsulated using a cationic liposome-based formulation

(Invivofectamine 3.0 Reagent; Thermo Fisher Scientific) according to the manufacturer’s

instructions. To purify and concentrate the siRNA formulation, the samples were

centrifuged at 4000g through an Amicon Ultra-4 Centrifugal Filter Unit (Merck Millipore,

MA, USA). The final concentration of the encapsulated siRNA formulation was 1µg/µl in

endotoxin-free 0.1M PBS. For injection, animals were anaesthetised in the same fashion as

the antibody neutralisation series. 3µl of either Il-1β or negative siRNA was then

intravitreally delivered to both eyes of each animal, which equated to a final dosage of 3µg

siRNA per eye. Animals were then exposed to 24hrs photo-oxidative damage under the

same parameters as the antibody neutralisation cohort.

IL-1β protein was administered to rats following the same intravitreal methodology

as described in the inhibition experiments. Recombinant IL-1β protein (Cat# AF-501-RL-

010, R&D Systems) was injected at final concentration of 10ng per eye, as established in a

previous study [274]; injections with only the PBS vehicle served as controls. Animals

were euthanized at 3, 6, or 12 days post-injection, with eyes then processed as described in

the previous section.

5.3.3. RPE and Müller cell cultures

Immortalised human cell lines MIO-M1 (Müller 1 Moorefields Institute of

Ophthalmology; Dr A. Limb, Institute of Ophthalmology, University College London) and

ARPE-19 (ATCC CRL-2302, American Tissue Culture Collection, Manassas, VA) were

used to study responses to IL-1β stimulation. Cell lines were authenticated by CellBank,

Australia. The cells were grown in Dulbecco's Modified Eagle Medium (DMEM; Life

Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS; Life

Technologies) and 3mM L-glutamine (Life Technologies), in a humidified atmosphere

119

consisting of 95% air and 5% CO2 at 37°C. The cells were passaged by trypsinization

every 3 to 4 days.

The MIO-M1 and ARPE-19 lines were incubated in IL-1β protein to assess its

effect on their expression of chemokines. Cells were first seeded to a density of 1 × 105

cells on 24-well plates and left to recover for at least 48hrs. 24hrs prior to experimentation,

the cells were placed in serum-deficient DMEM containing 1% FBS. IL-1β protein (Cat#

201-LB, R&D Systems) was then added to the culture medium at a concentrations of

10ng/mL, as per previous literature [275, 276], and then incubated for 12hrs. The cells

were then harvested for either RNA extraction and PCR, or an MTT assay to verify cell

viability. RNA was extracted from each sample well using a retinal RNA extraction

protocol that we have established previously [85], with slight modifications for cell culture.

The MTT assay was performed with a kit supplied by Roche (Cell Proliferation Kit I,

Roche Applied Science, Penzberg, Germany) following the supplied instructions.

Following IL-1β stimulation, MTT reagent was added to the sample wells and left to

incubate for 4hrs, after which a solution of 0.04M HCl in isopropanol was then added to

each well to dissolve the resulting formazan crystals. The absorbance for each sample was

then read at 570nm on a TECAN Infinite 200 PRO (TECAN Seestrasse, Männedorf,

Switzerland), and quantified as a percentage relative to unstimulated culture samples.

5.3.4. TUNEL and immunohistochemistry

Retinal cryosections were stained for apoptotic cells using a terminal

deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) kit (Roche Applied

Science) and following our previous methodology [255, 256]. To quantify photoreceptor

cell death, TUNEL+ cells in the ONL were counted throughout the full length of each

section cut in the parasagittal plane (supero-inferior). For each animal, technical duplicates

were counted, and these counts were averaged for each experimental group.

120

Immunohistochemistry was performed on retinal cryosections according to

previously described protocols, with minor modifications [87]. A list of primary antibodies

used is provided in Table 5.1. Fluorescence in sections was captured using a laser-scanning

A1+ confocal microscope (Nikon, Tokyo, Japan). Images were processed using Photoshop

CS6 software (Adobe Systems, CA, USA). Immunolabelled IBA1+

microglia/macrophages were quantified across the full length of each section in the

parasagittal plane (supero-inferior). The number of IBA1+ microglia/macrophages in the

outer retina was quantified by counting the IBA1+ cells in the ONL and subretinal space.

Table 5.1. Primary antibodies used for immunohistochemistry

Primary Antibody Dilution Source

Rabbit α-IBA1 (ionized binding

calcium adaptor molecule 1)

1:500 #019-19741, Wako Pure Chemical

Industries, Osaka, Japan

Goat α-IL-1β 1:500 #AF501, R&D Systems, Minneapolis, MN,

USA

Mouse α-Vimentin 1:100 #V6630, Sigma-Aldrich, St. Louis, MO,

USA

5.3.5. Polymerase chain reaction (PCR)

In preparation for quantitative real-time PCR (qPCR) and standard PCR, the RNA

from retina or cell culture samples was synthesised into cDNA using a Tetro first-strand

cDNA Synthesis Kit (Bioline Reagents, London, UK), as described in our previous

investigation [87].

qPCR was performed on cDNA samples using Taqman hydrolysis probes (Table

5.2; Thermo Fisher Scientific), which were applied according to the manufacturer’s

instructions with the Taqman Gene Expression Master Mix system (Thermo Fisher

Scientific). The qPCR reactions were run on a QuantStudio Flex 12K instrument (Thermo

121

Fisher Scientific). The resultant data were analysed according to the comparative cycle

threshold (Ct) method (ΔΔCt), which was normalised to the expression of both Gapdh and

Actb reference genes, as established in our previous analyses [85, 144].


Gene

Symbol

Gene Name Catalog Number Entrez

Gene ID

Actb Actin, beta Rn00667869_m1 81822



Ccl2 Chemokine (C-C) motif ligand 2 Rn01456716_g1 24770

Cxcl1 Chemokine (C-X-C) motif ligand 1 Rn00578225_m1 81503

Cxcl10 Chemokine (C-X-C) motif ligand 10 Rn01413889_g1 245920


dehydrogenase

Rn99999916_s1 24383


Nlrp3 Nucleotide-binding domain, leucine-rich-

containing family, pyrin domain-

containing-3

Rn04244620_m1 287362

Standard PCR was conducted from cDNA synthesised from cells cultures or retinal

homogenates, using primers specific to Il-1β receptor-related genes in human: Il-1r1 (F: 5’

ATCGTGATGAATGTGGCTGA 3’; R: 5’ TCTCATTAGCTGGGCTCACA 3’), Il-1rap

(F: 5’ CGTTTCATCTCACCAGGACTC 3’; R: 5’ CCAAACCTCATTGCGAGAAT 3’),

or rat: Il-1r1 (F: 5’ ACATTCGCAGCTGTCCTCTT 3’; R: 5’

TGTGCTCTTCAGCCACATTC 3’), Il-1rap (F: 5’ TCATACCGCCAAGGTACACA 3’;

R: 5’ GGGCTCAGGACAACAATCAT 3’). The primers designed using the Primer3 web-

based design program [226]; both transverse an intron splice site to avoid genomic

amplification. The PCR was performed using MyTaq DNA Polymerase (Bioline) as per

122

the manufacturer’s instructions, and the presence and specificity of the PCR product were

inferred by gel electrophoresis.


Ccl2 and Cxcl1 were cloned from PCR products (550-bp and 504-bp amplicons

respectively) using cDNA synthesised from retinal RNA (as described above).

Digoxigenin (DIG)-labelled riboprobes were then prepared as described in our previous

publication [87]. In situ hybridisation on retinal cryosections was carried out according to

our established methodology [224]; briefly, each riboprobe was hybridised to sections

overnight at 55˚C, then was washed in decreasing concentrations of saline sodium citrate

(pH 7.4) at 60˚C. The bound probe was visualised with either NBT/BCIP or HNPP/Fast-

Red (Roche Applied Science).

5.3.7. Quantitative and statistical analysis

Graphing and statistical analysis for this study was performed using Prism 7

(GraphPad Software, CA, USA). Statistical analysis was conducted using a Students t-test

for instances of single comparisons. For assessing trends or multiple comparisons over

protracted time-courses, a Kruskal–Wallis one-way analysis of variance (ANOVA) with

Dunn’s multiple comparison post-test was applied, as per our previous investigation [87].

A P value of < 0.05 was considered statistically significant.

123

5.4. Results

5.4.1. Expression of retinal IL-1β in relation to chemokine up-regulation and

macrophage infiltration following photo-oxidative damage

Retinal expression of Il-1β and genes associated with inflammasome assembly and

activation (Casp1, Casp8, and Nlrp3) were assessed by qPCR following 24hrs photo-

oxidative damage (Figure 5.1A). Il-1β was dramatically up-regulated after 24hrs photo-

oxidative damage, consistent with our prior reports [87], and in concert with expression of

Casp1, Casp8, and Nlrp3 (P<0.05, Figure 5.1A). Immunoreactivity for IL-1β was not

detected in dim-reared control retinas, but after photo-oxidative damage IL-1β

immunoreactivity was evident on some ramified IBA1+ microglia/macrophages in the

ONL and subretinal space (Figure 5.1B-C, yellow). IBA1+ cells located in the choroid did

not exhibit IL-1β immunoreactivity (Figure 5.1C).

Comparison of Il-1β expression with changes in retinal Ccl2, Cxcl1 and Cxcl10

(Figure 5.1D) shows a correlation between Il-1β and chemokine expression. Over the 24hr

time-course of photo-oxidative damage (3, 6, 12, 17, and 24hrs), Il-1β expression was

markedly upregulated after 6hrs, and increasing Il-1β expression was associated with an

upregulation of Ccl2, Cxcl1, and Cxcl10, with all markers reaching peak expression at

24hrs (P<0.05; one-way ANOVA). Consistent with previous reports [85, 141] we also

observed incursions of IBA1+ macrophages into the ONL and subretinal space by 24hrs of

photo-oxidative damage (P<0.05, Figure 5.1E-G).

5.4.2. Effect of IL-1β suppression on photoreceptor death, macrophage

accumulation, and chemokine expression

Inhibition of IL-1β and its effect on photo-oxidative retinal damage was ascertained using

both siRNA and antibody neutralisation approaches (Figures 5.2 and 5.3). Intravitreal

124

Figure 5.1. Temporal relation of IL-1β to chemokine expression and macrophage

infiltration following photo-oxidative damage (PD). A: After 24hrs of light exposure, a

number of inflammasome activation markers were significantly upregulated (Casp1,

Casp8, Nlrp3, P<0.05), in addition to Il-1β (P<0.05). B-C: Representative images show

125

immunoreactivity for IL-1β (red) in the outer retina following 24hrs of photo-oxidative

damage, particularly in the ONL, subretinal space and RPE (B; arrows), and which co-

localised to IBA1+ microglia (green) (C; arrows). D: Up-regulation of IL-1β was

documented over a 24hr time-course of photo-oxidative damage (P<0.05), which was

found to align closely with up-regulation of Ccl2, Cxcl1 and Cxcl10 over the same period

(P<0.05). E: A large increase in the number of IBA1-immunoreactive macrophages was

quantified within the outer retina (ONL and subretinal space) following photo-oxidative

damage (P<0.05) compared to dim-reared controls. F-G: Representative images showcase

the infiltration of IBA1-immunolabelled macrophages (green) within the ONL and

subretinal space (arrows) in retinal sections following photo-oxidative damage (G), in

contrast to the absence of these cell in sections from dim-reared retinas (F). C, choroid;

INL, inner nuclear layer; ONL, outer nuclear layer; OS, outer segments. N=4-6 per group.

Asterisks denote a significant change, where P<0.05. Scale bars equate to 50µm.

126

injection of the Il-1β-specific siRNA induced a 1.8 fold reduction in the expression of

retinal Il-1β at 24hrs photo-oxidative damage, compared to negative control siRNA

(P<0.05, Figure 5.2A). Animals injected with Il-1β siRNA had ~60% fewer TUNEL+

photoreceptors 24hrs post-exposure to photo-oxidative damage compared to controls

(P<0.05, Figure 5.2B). In experiments where IL-1β was neutralised using the antibody,

injected intravitreally prior to photo-oxidative damage, there was an 80% reduction in the

number of TUNEL+ photoreceptors in the retina, compared to those injected with an

isotype antibody control (P<0.05, Figure 5.2C-E). Counts of IBA1+ macrophages confirm

that inhibition of IL-1β with either siRNA or neutralising antibody reduces the number of

IBA1+ macrophages in the outer retina (ONL and subretinal space), compared with the

respective controls (P<0.05, Figure 5.2F-H).

We then sought to determine the effect of IL-1β suppression on the retinal

expression of chemokines Ccl2, Cxcl1, and Cxcl10 (Figure 5.3A). In both modes of IL-1β

inhibition, there was a significant reduction in the expression of Ccl2 and Cxcl1 compared

to controls (P<0.05, Figure 5.3A). While Il-1β-specific siRNA did not modify expression

of Cxcl10, antibody neutralisation of IL-1β was effective in reducing Cxcl10 expression

(P<0.05). By use of in situ hybridisation, we also confirmed that Ccl2 mRNA was present

in vimentin-immunoreactive Müller cell processes after 24hrs photo-oxidative damage

(Figure 5.3D-E; arrows), and that Ccl2 mRNA labelling was reduced in IL-1β-inhibited

retinas compared to controls (Figure 5.3B-C; arrows). Ccl2 mRNA was not detected in

RPE cells (Figure 5.3B-C), consistent with our previous findings [85, 87]. We detected

Cxcl1 mRNA labelling in the INL (Figure 5.3F; arrows) and RPE layer (Figure 5.3H;

arrows) after photo-oxidative damage, which was reduced in retinas where IL-1β had been

inhibited via neutralising antibody (Figure 5.3G, I). INL staining for Cxcl1 mRNA

correlated with vimentin-immunoreactive Müller cells (Figure 5.3J-K; arrows), consistent

with our previous report [87].

127

Figure 5.2. Effect of IL-1β inhibition on photoreceptor apoptosis and macrophage

infiltration following photo-oxidative damage (PD). A: A significant knockdown of Il-1β

expression in the retina was achieved in retinas injected with an Il-1β-specific siRNA,

compared to the negative control siRNA group (P<0.05). B: The number of TUNEL+ cells

in the ONL was reduced in Il-1β siRNA-injected retinas after photo-oxidative damage,

compared to controls (P<0.05) C: A reduction in the number of TUNEL+ cells in the ONL

was also documented in animals that had been intravitreally injected with an IL-1β

128

neutralising antibody prior to photo-oxidative damage, in comparison to an isotype control

antibody (P<0.05). D-E: Representative images showcase a decrease in TUNEL+ profiles

(red) in retinal section from the IL-1β neutralisation group (E), compared to a section from

the isotype control group (D). F: The infiltration of IBA1-immunolabelled macrophages

into the outer retina (ONL and subretinal space) following photo-oxidative damage was

significantly decreased in animals injected with either Il-1β-specific siRNA or an IL-1β-

specific neutralising antibody, compared to their respective controls (P<0.05). G-H:

Representative images of IBA1-immunolabelled macrophages demonstrate the reduction in

IBA1+ cells in the outer retina in the IL-1β antibody neutralisation retinas compared to

controls (green). INL, inner nuclear layer; ONL, outer nuclear layer. N=4-5 per group.

Asterisks denote a significant change, where P<0.05. Scale bars equate to 25µm.

129

Figure 5.3. Effect of IL-1β inhibition on chemokine expression following photo-oxidative

damage (PD). A: In animals that were intravitreally injected with Il-1β-specific siRNA,

there was significantly lower expression of Ccl2 and Cxcl1 compared to control siRNA

after photo-oxidative damage (P<0.05). In the group injected with IL-1β neutralising

antibody however, the expression of Ccl2, Cxcl1 and Cxcl10 were all significantly down-

130

regulated in comparison to the isotype control group (P<0.05). B-K: In situ hybridisation

was used to examine the localisation of Ccl2 and Cxcl1 mRNA transcripts following IL-1β

inhibition and photo-oxidative damage, as shown in representative images. Staining for

Ccl2 mRNA (purple/red) was decreased in IL-1β antibody-injected retinas compared to

control IgG retinas (B-C; arrows), and was co-localised to vimentin–immunoreactive

Müller cells (green) (D-E; arrows). Staining for Cxcl1 mRNA was observed within INL (F-

G) and RPE layers (H-I), which was decreased in the IL-1β neutralising antibody group.

The INL staining correlated with Müller cell processes that were immunolabelled with

vimentin (J-K). INL, inner nuclear layer; ONL, outer nuclear layer; OS, outer segments.

N=5 per group. Asterisks denote a significant change, where P<0.05.

131

5.4.3. Effect of IL-1β stimulation on chemokine expression in Müller and RPE cell

cultures

The capacity for IL-1β to stimulate chemokine up-regulation in Müller cells and

RPE cells was assessed in MIO-M1 and ARPE-19 cell cultures, respectively (Figure 5.4).

Both cultures were incubated with 10ng/mL IL-1β protein for 12hrs, at which point we

observed dramatic increases in the expression of Ccl2, Cxcl1 and Cxcl10 in MIO-M1 cells

compared to unstimulated control wells (P<0.05, Figure 5.4A). To discount the possibility

that the IL-1β-induced up-regulation of chemokines was a result of cell stress/death, we

conducted an MTT assay on the cultures after IL-1β stimulation (Figure 5.4B). We

determined that both cultures exhibited no reduction in viability as a result of IL-1β

stimulation compared to controls (P>0.05). We also found that both MIO-M1 and ARPE-

19 cells express Il-1r1 and Il-1rap receptor genes necessary for IL-1β signal transduction

(Figure 5.4C-D).

5.4.4. Changes in chemokine expression and macrophage infiltration following

intravitreal delivery of IL-1β protein

Finally, we investigated the effect of IL-1β protein administered intravitreally on

the expression of chemokines and the accumulation of macrophages over a 24hr period

(Figure 5.5). The data show a broad up-regulation of retinal Ccl2, Cxcl1, and Cxcl10

(Figure 5.5A), up to 24hrs post-injection compared to PBS-injected controls. This was

particularly evident for Cxcl1, which by 6 hrs-post-injection increased ~22 fold (P<0.05),

although was somewhat reduced by 12 and 24hrs. The localisation and number of IBA1+

macrophages at 24hrs after the injection of IL-1β protein (Figure 5.5B-F) demonstrated a

significant increase in the total number of retinal macrophages present compared to the

PBS-control group (P<0.05; Figure 5.5B). IBA1+ cells were observed predominantly in

the GCL and optic nerve head (Figure 5.5E-F; arrows), and comprised a population with a

132

Figure 5.4. Chemokine expression in RPE and Müller cell cultures stimulated with IL-1β.

A: MIO-M1 and ARPE-19 cells were incubated with IL-1β protein for 12hrs, after which

MIO-M1 cultures were found to up-regulate expression of Ccl2, Cxcl1 and Cxcl10

(P<0.05), while ARPE-19 cells had significantly increased expression of Cxcl1 and Cxcl10

(P<0.05), compared to unstimulated controls. B: MTT assays were conducted on MIO-M1

and ARPE-19 cultures, which showed no difference in cell viability between IL-1β and

control groups. C-D: Representative images of Il-1r1 and Il-rap PCR products indicate

that MIO-M1 and ARPE-19 express the receptor genes necessary for Il-1β signal

transduction. N=5 per group. Asterisks denote a significant change, where P<0.05.

133

Figure 5.5. Change in retinal chemokine expression and macrophage infiltration in retinas

following intravitreal injection of IL-1β protein. A: Injection of IL-1β protein increased the

expression of Ccl2, Cxcl1 and Cxcl10 in retinas over a time-course of 6, 12, and 24hrs

post-injection, compared to PBS-injected controls (P<0.05). B: There was a significant

increase in the number of IBA1+ cells throughout retinal sections in the IL-1β group at

134

24hrs post-injection, compared to the PBS control group (P<0.05). C-F: Representative

images of IBA1-immunolabelled retinal sections show increased clusters of IBA1+

macrophages amongst the GCL and optic nerve head of the IL-1β-injected group (E-F;

arrows) compared to PBS controls (C-D). G-H: Representative images show positive

expression of PCR products for Il-1r1 and Il-rap in control rat retinas. GCL, ganglion cell

layer; INL, inner nuclear layer; ONL, outer nuclear layer. N=3-6 per group. Asterisks

denote a significant change, where P<0.05. Scale bars equate to 50µm.

135

rounded (activated) rather than ramified (resting) morphology. PCR conducted on isolates

of control rat retinal tissue confirmed the presence of Il-1r1 and Il-1rap genes (Figure

5.5G-H).

5.5. Discussion

These findings describe for the first time a key role for IL-1β in mediating the

accumulation of outer-retinal macrophages by modulating the expression of chemokines by

Müller cells and RPE. First, we demonstrate that Il-1β is up-regulated in concert with the

Müller and RPE cell-expressed chemokines (Ccl2, Cxcl1 and Cxcl10), and with the influx

of macrophages into the outer retina following photo-oxidative damage. Second, we

showed that therapeutic suppression of retinal IL-1β using either siRNA or antibody

neutralisation curtails chemokine expression, accumulation of outer-retinal macrophages

and photoreceptor degeneration. Finally, we show that Müller and RPE cell cultures up-

regulate Ccl2 (Müller cells only), Cxcl1 and Cxcl10 in response to IL-1β stimulation, and

that intravitreal delivery of IL-1β induces up-regulation of these same chemokines in the

retina, coinciding with increases in the population of retinal macrophages. The data from

this study supports the use of IL-1β inhibition strategies as a therapeutic approach to

reduce chemokine synthesis, and subsequent macrophage accumulation and photoreceptor

death in retinal degenerations.

Previous studies using injections of recombinant IL-1ra, an endogenous antagonist

for IL-1r1, have suggested a role for IL-1β in propagating retinal degeneration, using

models of photo-oxidative damage in Cx3cr1-deficient mice [114, 277], laser-induced

CNV [115], and retinitis pigmentosa [116]. However, a short-coming of that approach is

that IL-1ra does not suppress IL-1β signalling specifically, as the inflammatory cytokine

136

IL-1α also competes for binding and is equally as effective in activating Il-1r1 as IL-1β

[98, 278, 279]. In this study, we have used Il-1β-specific siRNA, as well as IL-1β antibody

inhibition methodologies to target IL-1β directly, circumventing any possibility of off-

target inhibition of IL-1α-mediated signalling. Our data clearly show that decreased IL-1β

correlates with decreased chemokine production by RPE and Müller cells, reduced

macrophage recruitment and increased photoreceptor survivability. Excluding the effect of

IL-1α signalling is an important consideration, as IL-1α released from dying cells promotes

sterile inflammation and leukocyte recruitment [279, 280], and ablation of IL-1α alleviates

inflammation in myocardial infarction [281]. Moreover, our previous microarray analysis

(gene expression omnibus GSE22818) indicates that IL-1α is up-regulated following

photo-oxidative damage [141].

Our previous investigations have indicated that RPE and Müller cells are

potentiators of Ccl- and Cxcl- expression during photo-oxidative damage [85-87]. Several

of these chemokines, including CCL2, CXCL1 and CXCL10 are involved in leukocyte

recruitment in CNS diseases and in retinal degeneration [84, 85, 87, 272]. The significance

of the expression of such chemokines is underscored by our finding that the broad

spectrum chemokine inhibitor NR58-3.14.3 – a suppressor of Ccl- and Cxcl- signalling –

ameliorates macrophage recruitment and photoreceptor degeneration resulting from photo-

oxidative damage [228]. The involvement of IL-1β signalling in chemokine expression

shown in the current study is consistent with its known influence outside the retina,

including its ability to induce CCL2 in pancreatic β-cells [282, 283], and spur up-

regulation of CXCL1 in intestinal tissue during infection with Clostridium difficile [284].

Precisely how IL-1β induces the up-regulation of chemokines in RPE and Müller cells is

uncertain, though it has been demonstrated in pancreatic β-cells that IL-1β signalling

mediates nuclear localisation of the transcription factor NF-κB, which then promote the

expression of chemokines such as CCL2 [285].

137

While the data generated in these investigations was generally consistent between

the IL-1β inhibition strategies employed, it is noted that expression of Cxcl10 was not

inhibited by Il-1β siRNA, in contrast to the findings using antibody neutralisation. This

difference may be due to delayed efficacy of the siRNA resulting from the time required

for adequate transfection and mRNA suppression. Consistent with this idea, comparison of

the data indicate that the neutralising antibody had a more potent effect on Ccl2 and Cxcl1

expression compared with siRNA. However, given the reduction in macrophage infiltration

identified in both treatment groups (siRNA and antibody), despite the discordant

suppression of Cxcl10, it is possible that Cxcl10 does not play a crucial role in macrophage

recruitment in the retina compared to Ccl2 and Cxcl1. While indeed plausible, other studies

have shown that CXCL10 specifically elicits macrophage recruitment in experimental

nonalcoholic steatohepatitis [286], and is also implicated in macrophage infiltration in

kidney during puromycin aminonucleoside nephrosis [287].

Though our investigation focused on the effect of IL-1β on expression of

RPE/Müller cell-associated chemokines and macrophage recruitment, the potential

contribution of other leukocyte populations should not be overlooked. Peripheral

neutrophils and T-cells, as well as macrophages, express the receptors for CXCL1 and

CXCL10 [288-291]. These leukocyte populations are poorly characterised in sterile retinal

inflammation, although are understood to comprise a small proportion amongst the

predominantly macrophage-led response in AMD and models such as photo-oxidative

damage [3, 170]. Nonetheless, the contribution of these cell types to pathology in sterile

retinal inflammation is unclear, and identifies neutrophils and T-cells as candidates for

investigation in future studies.

138

5.5.1. Conclusions

Our study identifies a key role for IL-1β in orchestrating the infiltration of

macrophages to the outer retina, by inducing the up-regulation of chemokines in RPE and

Müller cells following retinal damage. Moreover, we confirm the potential of specific IL-

1β inhibitors in dampening inflammation and ameliorating photoreceptor degeneration.

Consequently, their application may have value in the treatment of retinal dystrophies in

which chemokine expression and subretinal macrophage accumulation are implicated, such

as AMD.

139

6. SUMMARY

140

These studies collectively build upon previous findings in our research group that

C3 is expressed by macrophages in models of retinal degeneration and ageing [141, 144]

as well as the finding that Ccl2 siRNA reduces macrophage recruitment in the retina [89].

This thesis presents data which strongly indicates that retinal microglia and macrophages

contribute to photoreceptor degeneration, and have a sustained effect on atrophic lesion

development in the degenerating retina. This supports the use of therapeutic molecules to

target inflammatory activation by retinal microglia and macrophages, as a strategy for

slowing the progression of retinal degenerative diseases.

The work described in this thesis provides a deeper understanding of how microglia

and macrophages propagate the inflammatory response in retinal degeneration. First, it is

demonstrated that microglia and macrophages play a critical role in activating complement,

leading to increased photoreceptor loss and further accumulation of inflammatory cells in

the damaged retina [292]. It is shown, in both human atrophic age-related macular

degeneration (AMD) and in rodent photo-oxidative damage, that complement component 3

(C3), a central component of the complement system, is synthesised and deposited in the

photoreceptor layer by retinal microglia and macrophages. Using intravitreally-delivered

C3 siRNA to inhibit retinal sources of C3, it is demonstrated that locally-derived C3, not

systemic C3, contributes to the onset of retinal degeneration implicating complement-

expressing retinal microglia and macrophages in prolonged disease progression.

The findings from Chapter 3 using C3 siRNA demonstrates a potential role for

gene therapies to knockdown the expression of specific inflammatory genes, particularly

C3. The strong association between polymorphisms in complement genes, and the

prevalence of AMD gives further weight to the potential use of gene therapies to combat

retinal diseases. Using locally-delivered C3 siRNA via lipid-based transfection, we

demonstrated that C3 expression in the retina was knocked down efficiently. However, the

141

delivery of siRNA to the retina may only be for a short duration, as other research from our

group suggests it may be cleared within 3-4 days of delivery. Gene therapies that exert a

prolonged effect within the retina are therefore warranted, such as the use of vectors

including AAV2, which have proven useful in the treatment of Leber Congenital

Amaurosis (RPE65 mutation) [310]. The use of clustered, regularly interspaced, short

palindromic repeat (CRISPR)/Cas9 technology (reviewed in [293]) would allow sustained

C3 knockout to occur within the retina, and has been performed in several models of

retinal disease [294-296]. Most recently, one group demonstrated the use of Vegfa Cas9

ribonucleoproteins (RNPs) in a choroidal neovascularisation (CNV) model of wet AMD to

reduce Vegfa-associated retinal damage [297, 298]. Alternatively, conditional ablation of

C3 from retinal microglia using Cre-loxP could be useful in further determining the

contribution of the local microglia/macrophages to complement activation in retinal

degeneration. Utilisation of these technologies may lead to valuable insights into the

reduction of deleterious complement gene activation in AMD.

Second, the work highlights the therapeutic potential of broad spectrum chemokine

inhibition as a strategy to prevent retinal degeneration [228]. It was demonstrated that an

intravitreal injection of NR58-3.14.3 reduced the recruitment of microglia and

macrophages into the outer retina, and ameliorated photoreceptor cell death in rodent

photo-oxidative damage. This indicates its potential for the treatment of retinal

degenerations such as atrophic AMD, where chemokine secretion and macrophage

recruitment to the outer retina are key features of disease progression. This study also

shows that targeting chemokine production to inhibit macrophage recruitment and activity

may be an optimal therapeutic strategy for slowing the progression of retinal degeneration.

Third, it has been shown that the pro-inflammatory cytokine interleukin-1β (IL-1β)

plays a key role in contributing to retinal degeneration in rodent photo-oxidative damage

142

[299]. This study shows that retinal microglia and macrophages are the primary expressers

of IL-1β, promoting the expression of chemokines by Müller cells and RPE, leading to the

further recruitment of macrophages to the degenerating retina. This study also

demonstrates the value of targeting cell signalling mechanisms upstream of complement,

further highlighting the key roles of microglia and macrophages in retinal degeneration.

Here we demonstrate that Il-1β knockdown is also an effective method for reducing

chemokine-mediated macrophage recruitment in the retina. However, the inflammasome

signalling pathway is largely responsible for Il-1β production, which is primarily expressed

by macrophage cells [100]. The role of the NLRP3 inflammasome has been controversial

in the literature, with research suggesting that blocking NLRP3 inflammasome activation is

beneficial in dry AMD [103], but detrimental in wet AMD [106]. Current work in our

research group is being undertaken to understand the role of the NLRP3 inflammasome in

the photo-oxidative damage model. Additionally, as we have shown that gene therapies to

target Il-1β and inflammasome activation may be useful, our research group is focused on

the use of microRNAs (miRNAs), ‘master gene regulators’ [300], to regulate inflammation

in retinal degeneration [301]. By identifying miRNAs that may regulate Il-1β and

inflammasome signalling [302-305] in the retina, this may lead to the development of

novel gene therapies to target macrophage-derived inflammation in retinal degeneration.

The next critical question, beyond the scope of the studies reported here is do

retinal microglia and blood-borne macrophages contribute similarly to the progression of

retinal degeneration? A limitation of the studies presented in this thesis is that thus far it

has not been possible to differentiate these two cell populations. However, two recent

advances now make this distinction possible. First, studies indicate that a TMEM119

antibody is able to differentiate resident microglia from blood-borne macrophages in the

brain, using flow cytometry and immunohistochemistry [306-308]. Second, a fate mapping

143

technique to endogenously label the two cell types with fluorescent reporters can

distinguish cells as either resident or recruited, using tamoxifen-inducible Cre

recombinases [120], and suggests that these populations are phenotypically distinguishable

by a specific set of markers. Characterising the inflammatory profiles of these two separate

populations will assist in understanding how microglia and macrophages each contribute to

pro-inflammatory cytokine production, complement activation and photoreceptor cell

death. This will allow for further development of therapeutic interventions for retinal

diseases including AMD.

The photo-oxidative damage model recapitulates many features of atrophic AMD,

including oxidative stress, pro-inflammatory cytokine production, the recruitment of

microglia and macrophages, the synthesis of complement system components and the

progression of an expanding photoreceptor lesion. However, further investigation to

identify the translational potential of the therapeutic molecules described in this thesis is

warranted, using additional models that reproduce other features of AMD not modelled in

photo-oxidative damage including the CEP model [63, 68, 69] and the laser-induced CNV

model [196, 197]. Additionally, a model of early AMD, such as ageing, could be used to

further investigate the thickening of Bruch’s membrane, drusen and RPE disruption.

This thesis provides further understanding of the role of microglia and

macrophages in amplifying the inflammatory response and their contribution to the

progression of retinal degeneration. It also demonstrates that the inhibition of factors that

drive the recruitment of these cells into the degenerating retina reduces their accumulation

and ameliorates photoreceptor damage. Further studies that delineate resident microglia

and blood-borne macrophages to elucidate their individual contributions will be valuable in

developing more effective therapeutic strategies to manage photoreceptor loss in AMD.

144

7. REFERENCES

145

7.1. Complete Reference List

1. Access Economics (2010) The global economic cost of visual impairment. AMD Alliance International. 26-27.

2. BrightFocus Foundation. Age-related macular degeneration: Facts and figures. 2016.

3. Ambati, J., Atkinson, J.P., and Gelfand, B.D. (2013) Immunology of age-related macular degeneration. Nature Reviews Immunology. 13, 438-451.

4. Penfold, P.L., Madigan, M.C., Gillies, M.C., and Provis, J.M. (2001) Immunological and aetiological aspects of macular degeneration. Progress in Retinal and Eye Research. 20, 385-414.

5. Karlstetter, M., Scholz, R., Rutar, M., Wong, W.T., Provis, J.M., and Langmann, T. (2015) Retinal microglia: Just bystander or target for therapy? Progress in Retinal and Eye Research. 45, 30-57.

6. Kolb, H., Gross anatomy of the eye., in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City UT.

7. Bear, M., Connors, B., and Paradiso, M., Neuroscience: Exploring the brain. 1996, USA: Williams & Wilkins.

8. Kolb, H., Simple anatomy of the retina., in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City UT.

9. Newman, E. and Reichenbach, A. (1996) The Müller cell: A functional element of the retina. Trends in Neurosciences. 19, 307-312.

10. Bringmann, A., Pannicke, T., Grosche, J., Francke, M., Wiedemann, P., Skatchkov, S.N., et al. (2006) Müller cells in the healthy and diseased retina. Progress in Retinal and Eye Research. 25, 397-424.

11. Reichenbach, A. and Bringmann, A. (2013) New functions of Müller cells. Glia. 61, 651-678.

12. Goldman, D. (2014) Muller glial cell reprogramming and retina regeneration. Nature Reviews Neuroscience. 15, 431-442.

13. Franze, K., Grosche, J., Skatchkov, S.N., Schinkinger, S., Foja, C., Schild, D., et al. (2007) Müller cells are living optical fibers in the vertebrate retina. Proceedings of the National Academy of Sciences. 104, 8287-8292.

14. Bringmann, A., Iandiev, I., Pannicke, T., Wurm, A., Hollborn, M., Wiedemann, P., et al. (2009) Cellular signaling and factors involved in Müller cell gliosis: Neuroprotective and detrimental effects. Progress in Retinal and Eye Research. 28, 423-451.

146

15. Vecino, E., Rodriguez, F.D., Ruzafa, N., Pereiro, X., and Sharma, S.C. (2016) Glia–neuron interactions in the mammalian retina. Progress in Retinal and Eye Research. 51, 1-40.

16. Fischer, A.J. and Reh, T.A. (2001) Müller glia are a potential source of neural regeneration in the postnatal chicken retina. Nature Neuroscience. 4, 247-252.

17. Ooto, S., Akagi, T., Kageyama, R., Akita, J., Mandai, M., Honda, Y., et al. (2004) Potential for neural regeneration after neurotoxic injury in the adult mammalian retina. Proceedings of the National Academy of Sciences. 101, 13654-13659.

18. Karl, M.O., Hayes, S., Nelson, B.R., Tan, K., Buckingham, B., and Reh, T.A. (2008) Stimulation of neural regeneration in the mouse retina. Proceedings of the National Academy of Sciences. 105, 19508-19513.

19. Takeda, M., Takamiya, A., Jiao, J.-w., Cho, K.-S., Trevino, S.G., Matsuda, T., et al. (2008) α-aminoadipate induces progenitor cell properties of Müller glia in adult mice. Investigative Ophthalmology & Visual Science. 49, 1142-1150.

20. Cunha-Vaz, J., Bernardes, R., and Lobo, C. (2010) Blood-retinal barrier. European Journal of Ophthalmology. 21, 3-9.

21. Campbell, M. and Humphries, P., The blood-retina barrier., in Biology and Regulation of Blood-Tissue Barriers, C.Y. Cheng, Editor. 2013, Springer New York: New York, NY. p. 70-84.

22. Strauss, O. (2005) The retinal pigment epithelium in visual function. Physiological Reviews. 85, 845-881.

23. Kolb, H., Photoreceptors., in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City UT.

24. Molday, R.S. and Moritz, O.L. (2015) Photoreceptors at a glance. Journal of Cell Science. 128, 4039-4045.

25. Provis, J.M., Penfold, P.L., Cornish, E.E., Sandercoe, T.M., and Madigan, M.C. (2005) Anatomy and development of the macula: Specialisation and the vulnerability to macular degeneration. Clinical and Experimental Optometry. 88, 269-281.

26. Xu, H., Chen, M., and Forrester, J.V. (2009) Para-inflammation in the aging retina. Progress in Retinal and Eye Research. 28, 348-368.

27. Medzhitov, R. (2008) Origin and physiological roles of inflammation. Nature. 454, 428-435.

28. Harman, D. (1981) The aging process. Proceedings of the National Academy of Sciences. 78, 7124-7128.

29. Mateos, M.V., Tenconi, P.E., Giusto, N.M., and Salvador, G.A. (2015) Inflammation and oxidative stress in retinal diseases: The role of intracellular signaling in the retinal pigment epithelium. International Journal of Ophthalmology and Clinical Research. 2, 3.

147

30. Nita, M. and Grzybowski, A. (2016) The role of the reactive oxygen species and oxidative stress in the pathomechanism of the age-related ocular diseases and other pathologies of the anterior and posterior eye segments in adults. Oxidative Medicine and Cellular Longevity. 2016, 3164734.

31. Perez, V.L. and Caspi, R.R. (2015) Immune mechanisms in inflammatory and degenerative eye disease. Trends in Immunology. 36, 354-363.

32. Wong, W.L., Su, X., Li, X., Cheung, C.M.G., Klein, R., Cheng, C.-Y., et al. (2014) Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: A systematic review and meta-analysis. The Lancet Global Health. 2, e106-116.

33. Gass, J.D. (1972) Drusen and disciform macular detachment and degeneration. Transactions of the American Ophthalmological Society. 70, 409-436.

34. Ambati, J., Ambati, B.K., Yoo, S.H., Ianchulev, S., and Adamis, A.P. (2003) Age-related macular degeneration: Etiology, pathogenesis, and therapeutic strategies. Survey of Ophthalmology. 48, 257-293.

35. Sarks, S.H., Arnold, J.J., Killingsworth, M.C., and Sarks, J.P. (1999) Early drusen formation in the normal and aging eye and their relation to age related maculopathy: A clinicopathological study. British Journal of Ophthalmology. 83, 358-368.

36. Sarks, S., Cherepanoff, S., Killingsworth, M., and Sarks, J. (2007) Relationship of basal laminar deposit and membranous debris to the clinical presentation of early age-related macular degeneration. Investigative Ophthalmology & Visual Science. 48, 968-977.

37. Nowak, J.Z. (2006) Age-related macular degeneration (AMD): Pathogenesis and therapy. Pharmacological Reports. 58, 353-363.

38. Sarks, J.P., Sarks, S.H., and Killingsworth, M.C. (1994) Evolution of soft drusen in age-related macular degeneration. Eye (London, England). 8, 269-283.

39. Ramrattan, R.S., Van der Schaft, T.L., Mooy, C.M., De Bruijn, W.C., Mulder, P.G.H., and De Jong, P.T.V.M. (1994) Morphometric analysis of Bruch's membrane, the choriocapillaris, and the choroid in aging. Investigative Ophthalmology & Visual Science. 35, 2857-2864.

40. McLeod, D.S., Taomoto, M., Otsuji, T., Green, W.R., Sunness, J.S., and Lutty, G.A. (2002) Quantifying changes in RPE and choroidal vasculature in eyes with age-related macular degeneration. Investigative Ophthalmology & Visual Science. 43, 1986-1993.

41. Sunness, J.S., Rubin, G.S., Applegate, C.A., Bressler, N.M., Marsh, M.J., Hawkins, B.S., et al. (1997) Visual function abnormalities and prognosis in eyes with age-related geographic atrophy of the macula and good visual acuity. Ophthalmology. 104, 1677-1691.

148

42. Klein, R., Peto, T., Bird, A., and Vannewkirk, M.R. (2004) The epidemiology of age-related macular degeneration. American Journal of Ophthalmology. 137, 486-495.

43. Klein, R., Klein, B.E.K., Tomany, S.C., Meuer, S.M., and Huang, G.H. (2002) Ten-year incidence and progression of age-related maculopathy: The Beaver Dam eye study. Ophthalmology. 109, 1767-1779.

44. Mitchell, P., Wang, J.J., Foran, S., and Smith, W. (2002) Five-year incidence of age-related maculopathy lesions: The Blue Mountains Eye Study. Ophthalmology. 109, 1092-1097.

45. Smith, W., Assink, J., Klein, R., Mitchell, P., Klaver, C.C.W., Klein, B.E.K., et al. (2001) Risk factors for age-related macular degeneration: Pooled findings from three continents. Ophthalmology. 108, 697-704.

46. Klein, R., Myers, C.E., Cruickshanks, K.J., Gangnon, R.E., Danforth, L.G., Sivakumaran, T.A., et al. (2014) Markers of inflammation, oxidative stress, and endothelial dysfunction and the 20-year cumulative incidence of early age-related macular degeneration: The beaver dam eye study. JAMA Ophthalmology. 132, 446-455.

47. Newman, A.M., Gallo, N.B., Hancox, L.S., Miller, N.J., Radeke, C.M., Maloney, M.A., et al. (2012) Systems-level analysis of age-related macular degeneration reveals global biomarkers and phenotype-specific functional networks. Genome Medicine. 4, 1-18.

48. Thakkinstian, A., Han, P., McEvoy, M., Smith, W., Hoh, J., Magnusson, K., et al. (2006) Systematic review and meta-analysis of the association between complementary factor H Y402H polymorphisms and age-related macular degeneration. Human Molecular Genetics. 15, 2784-2790.

49. Gurne, D.H., Tso, M.O.M., Edward, D.P., and Ripps, H. (1991) Antiretinal antibodies in serum of patients with age-related macular degeneration. Ophthalmology. 98, 602-607.

50. Patel, N., Ohbayashi, M., Nugent, A.K., Ramchand, K., Toda, M., Chau, K.Y., et al. (2005) Circulating anti-retinal antibodies as immune markers in age-related macular degeneration. Immunology. 115, 422-430.

51. De Jong, P.T.V.M. (2006) Age-related macular degeneration. New England Journal of Medicine. 355, 1474-1485.

52. Salomon, R.G., Hong, L., and Hollyfield, J.G. (2011) Discovery of carboxyethylpyrroles (CEPs): Critical insights into AMD, autism, cancer, and wound healing from basic research on the chemistry of oxidized phospholipids. Chemical Research in Toxicology. 24, 1803-1816.

53. Klein, R., Klein, B.E.K., and Moss, S.E. (1998) Relation of smoking to the incidence of age-related maculopathy: The Beaver Dam eye study. American Journal of Epidemiology. 147, 103-110.

149

54. Mitchell, P., Jin Wang, J., Smith, W., and Leeder, S.R. (2002) Smoking and the 5-year incidence of age-related maculopathy: The Blue Mountains Eye Study. Archives of Ophthalmology. 120, 1357-1363.

55. Vingerling, J.R., Hofman, A., Grobbee, D.E., and De Jong, P.T.V.M. (1996) Age-related macular degeneration and smoking: The Rotterdam study. Archives of Ophthalmology. 114, 1193-1196.

56. Delcourt, C., Diaz, J.L., Ponton-Sanchez, A., and Papoz, L. (1998) Smoking and age-related macular degeneration: The POLA study. Archives of Ophthalmology. 116, 1031-1035.

57. Sperduto, R.D. and Hiller, R. (1986) Systemic hypertension and age-related maculopathy in the Framingham Study. Archives of Ophthalmology. 104, 216-219.

58. Hyman, L., Schachat, A.P., He, Q., and Leske, M.C. (2000) Hypertension, cardiovascular disease, and age-related macular degeneration. Archives of Ophthalmology. 118, 351-358.

59. Cruickshanks, K.J., Klein, R., and Klein, B.E.K. (1993) Sunlight and age-related macular degeneration: The Beaver Dam eye study. Archives of Ophthalmology. 111, 514-518.

60. Kennedy, C.J., Rakoczy, P.E., and Constable, I.J. (1995) Lipofuscin of the retinal pigment epithelium: A review. Eye. 9, 763-771.

61. Dorey, C.K., Wu, G., Ebenstein, D., Garsd, A., and Weiter, J.J. (1989) Cell loss in the aging retina: Relationship to lipofuscin accumulation and macular degeneration. Investigative Ophthalmology & Visual Science. 30, 1691-1699.

62. Crabb, J.W., Miyagi, M., Gu, X., Shadrach, K., West, K.A., Sakaguchi, H., et al. (2002) Drusen proteome analysis: An approach to the etiology of age-related macular degeneration. Proceedings of the National Academy of Sciences. 99, 14682-14687.

63. Hollyfield, J.G., Perez, V.L., and Salomon, R.G. (2010) A hapten generated from an oxidation fragment of docosahexaenoic acid is sufficient to initiate age-related macular degeneration. Molecular Neurobiology. 41, 290-298.

64. Gu, X., Meer, S.G., Miyagi, M., Rayborn, M.E., Hollyfield, J.G., Crabb, J.W., et al. (2003) Carboxyethylpyrrole protein adducts and autoantibodies, biomarkers for age-related macular degeneration. Journal of Biological Chemistry. 278, 42027-42035.

65. Gu, J., Pauer, G.J.T., Yue, X., Narendra, U., Sturgill, G.M., Bena, J., et al. (2009) Assessing susceptibility to age-related macular degeneration with proteomic and genomic biomarkers. Molecular and Cellular Proteomics. 8, 1338-1349.

66. Schutt, F., Bergmann, M., Holz, F.G., and Kopitz, J. (2003) Proteins modified by malondialdehyde, 4-hydroxynonenal, or advanced glycation end products in lipofuscin of human retinal pigment epithelium. Investigative Ophthalmology & Visual Science. 44, 3663-3668.

150

67. Weismann, D., Hartvigsen, K., Lauer, N., Bennett, K.L., Scholl, H.P.N., Issa, P.C., et al. (2011) Complement factor H binds malondialdehyde epitopes and protects from oxidative stress. Nature. 478, 76-81.

68. Hollyfield, J.G., Bonilha, V.L., Rayborn, M.E., Yang, X., Shadrach, K.G., Lu, L., et al. (2008) Oxidative damage-induced inflammation initiates age-related macular degeneration. Nature Medicine. 14, 194-198.

69. Hollyfield, J.G. (2010) Age-related macular degeneration: The molecular link between oxidative damage, tissue-specific inflammation and outer retinal disease. Investigative Ophthalmology & Visual Science. 51, 1276-1281.

70. Perez, V.L., Saeed, A.M., Tan, Y., Urbieta, M., and Cruz-Guilloty, F. (2013) The eye: A window to the soul of the immune system. Journal of Autoimmunity. 45, 7-14.

71. Penfold, P., Killingsworth, M., and Sarks, S. (1984) An ultrastructural study of the role of leucocytes and fibroblasts in the breakdown of Bruch's membrane. Australian Journal of Ophthalmology. 12, 23-31.

72. Penfold, P.L., Killingsworth, M.C., and Sarks, S.H. (1985) Senile macular degeneration: The involvement of immunocompetent cells. Graefe's Archive for Clinical and Experimental Ophthalmology. 223, 69-76.

73. Penfold, P.L., Killingsworth, M.C., and Sarks, S.H. (1986) Senile macular degeneration: The involvement of giant cells in atrophy of the retinal pigment epithelium. Investigative Ophthalmology & Visual Science. 27, 364-371.

74. Penfold, P.L., Provis, J.M., and Billson, F.A. (1987) Age-related macular degeneration: Ultrastructural studies of the relationship of leucocytes to angiogenesis. Graefe's Archive for Clinical and Experimental Ophthalmology. 225, 70-76.

75. Killingsworth, M.C., Sarks, J.P., and Sarks, S.H. (1990) Macrophages related to Bruch's membrane in age-related macular degeneration. Eye (London, England). 4, 613-621.

76. Streilein, J.W. (2003) Ocular immune privilege: The eye takes a dim but practical view of immunity and inflammation. Journal of Leukocyte Biology. 74, 179-185.

77. Caspi, R.R. (2006) Ocular autoimmunity: The price of privilege? Immunological Reviews. 213, 23-35.

78. Borish, L.C. and Steinke, J.W. (2003) 2. Cytokines and chemokines. Journal of Allergy and Clinical Immunology. 111, S460-475.

79. Cavaillon, J.-M. (2001) Pro-versus anti-inflammatory cytokines: Myth or reality. Cellular And Molecular Biology-Paris-Wegmann-. 47, 695-702.

80. Groves, D.T. and Jiang, Y. (1995) Chemokines, a family of chemotactic cytokines. Critical Reviews in Oral Biology & Medicine. 6, 109-118.

81. Rossi, D. and Zlotnik, A. (2000) The biology of chemokines and their receptors. Annual Review of Immunology. 18, 217-242.

151

82. Bajetto, A., Bonavia, R., Barbero, S., Florio, T., and Schettini, G. (2001) Chemokines and their receptors in the central nervous system. Frontiers in Neuroendocrinology. 22, 147-184.

83. Zlotnik, A. and Yoshie, O. (2000) Chemokines: A new classification system and their role in immunity. Immunity. 12, 121-127.

84. Rutar, M. and Provis, M.J., Role of chemokines in shaping macrophage activity in AMD., in Retinal Degenerative Diseases: Mechanisms and Experimental Therapy, C. Bowes Rickman, et al., Editors. 2016, Springer International Publishing: Cham. p. 11-16.

85. Rutar, M., Natoli, R., Valter, K., and Provis, J.M. (2011) Early focal expression of the chemokine Ccl2 by Muller cells during exposure to damage-inducing bright continuous light. Investigative Ophthalmology & Visual Science. 52, 2379-2388.

86. Wang, M., Ma, W., Zhao, L., Fariss, R.N., and Wong, W.T. (2011) Adaptive Müller cell responses to microglial activation mediate neuroprotection and coordinate inflammation in the retina. Journal of Neuroinflammation. 8, 1-19.

87. Rutar, M., Natoli, R., Chia, R., Valter, K., and Provis, J. (2015) Chemokine-mediated inflammation in the degenerating retina is coordinated by Muller cells, activated microglia, and retinal pigment epithelium. Journal of Neuroinflammation. 12, 8.

88. Ma, W., Zhao, L., Fontainhas, A.M., Fariss, R.N., and Wong, W.T. (2009) Microglia in the mouse retina alter the structure and function of retinal pigmented epithelial cells: A potential cellular interaction relevant to AMD. PLoS ONE. 4, e7945.

89. Rutar, M., Natoli, R., and Provis, J.M. (2012) Small interfering RNA-mediated suppression of Ccl2 in Müller cells attenuates microglial recruitment and photoreceptor death following retinal degeneration. Journal of Neuroinflammation. 9, 221.

90. Grunin, M., Burstyn-Cohen, T., Hagbi-Levi, S., Peled, A., and Chowers, I. (2012) Chemokine receptor expression in peripheral blood monocytes from patients with neovascular age-related macular degeneration. Investigative Ophthalmology & Visual Science. 53, 5292-5300.

91. Suzuki, M., Tsujikawa, M., Itabe, H., Du, Z.-J., Xie, P., Matsumura, N., et al. (2012) Chronic photo-oxidative stress and subsequent MCP-1 activation as causative factors for age-related macular degeneration. Journal of Cell Science. 125, 2407-2415.

92. Sennlaub, F., Auvynet, C., Calippe, B., Lavalette, S., Poupel, L., Hu, S.J., et al. (2013) CCR2+ monocytes infiltrate atrophic lesions in age-related macular disease and mediate photoreceptor degeneration in experimental subretinal inflammation in Cx3cr1 deficient mice. EMBO Molecular Medicine. 5, 1775-1793.

93. Kohno, H., Maeda, T., Perusek, L., Pearlman, E., and Maeda, A. (2014) CCL3 production by microglial cells modulates disease severity in murine models of retinal degeneration. The Journal of Immunology. 192, 3816-3827.

152

94. Yoshida, S., Yoshida, A., Ishibashi, T., Elner, S.G., and Elner, V.M. (2003) Role of MCP-1 and MIP-1α in retinal neovascularization during postischemic inflammation in a mouse model of retinal neovascularization. Journal of Leukocyte Biology. 73, 137-144.

95. Ishikawa, K., Yoshida, S., Nakao, S., Sassa, Y., Asato, R., Kohno, R., et al. (2012) Bone marrow-derived monocyte lineage cells recruited by MIP-1β promote physiological revascularization in mouse model of oxygen-induced retinopathy. Laboratory Investigation. 92, 91-101.

96. Seddon, J.M., George, S., Rosner, B., and Rifai, N. (2005) Progression of age-related macular degeneration: Prospective assessment of C-reactive protein, interleukin 6, and other cardiovascular biomarkers. Archives of Ophthalmology. 123, 774-782.

97. Rochet, É., Brunet, J., Sabou, M., Marcellin, L., Bourcier, T., Candolfi, E., et al. (2015) Interleukin-6-driven inflammatory response induces retinal pathology in a model of ocular toxoplasmosis reactivation. Infection and Immunity. 83, 2109-2117.

98. Dinarello, C. (1996) Biologic basis for interleukin-1 in disease. Blood. 87, 2095-2147.

99. Dinarello, C.A. (2011) Interleukin-1 in the pathogenesis and treatment of inflammatory diseases. Blood. 117, 3720-3732.

100. Schroder, K. and Tschopp, J. (2010) The inflammasomes. Cell. 140, 821-832.

101. Guo, H., Callaway, J.B., and Ting, J.P.Y. (2015) Inflammasomes: Mechanism of action, role in disease, and therapeutics. Nature Medicine. 21, 677-687.

102. Gao, J., Liu, R.T., Cao, S., Cui, J.Z., Wang, A., To, E., et al. (2015) NLRP3 inflammasome: Activation and regulation in age-related macular degeneration. Mediators of Inflammation. 2015, 690243.

103. Tarallo, V., Hirano, Y., Gelfand, Bradley D., Dridi, S., Kerur, N., Kim, Y., et al. (2012) DICER1 loss and Alu RNA induce age-related macular degeneration via the NLRP3 inflammasome and MyD88. Cell. 149, 847-859.

104. Ijima, R., Kaneko, H., Ye, F., Nagasaka, Y., Takayama, K., Kataoka, K., et al. (2014) Interleukin-18 induces retinal pigment epithelium degeneration in mice. Investigative Ophthalmology & Visual Science. 55, 6673-6678.

105. Tseng, W.A., Thein, T., Kinnunen, K., Lashkari, K., Gregory, M.S., D'Amore, P.A., et al. (2013) NLRP3 inflammasome activation in retinal pigment epithelial cells by lysosomal destabilization: Implications for age-related macular degeneration. Investigative Ophthalmology & Visual Science. 54, 110-120.

106. Doyle, S.L., Campbell, M., Ozaki, E., Salomon, R.G., Mori, A., Kenna, P.F., et al. (2012) NLRP3 has a protective role in age-related macular degeneration through the induction of IL-18 by drusen components. Nature Medicine. 18, 791-798.

107. Doyle, S.L., Ozaki, E., Brennan, K., Humphries, M.M., Mulfaul, K., Keaney, J., et al. (2014) IL-18 attenuates experimental choroidal neovascularization as a potential

153

therapy for wet age-related macular degeneration. Science Translational Medicine. 6, 230ra44.

108. Doyle, S.L., López, F.J., Celkova, L., Brennan, K., Mulfaul, K., Ozaki, E., et al. (2015) IL-18 immunotherapy for neovascular AMD: Tolerability and efficacy in nonhuman primates. Investigative Ophthalmology & Visual Science. 56, 5424-5430.

109. Celkova, L., Doyle, S.L., and Campbell, M. (2015) NLRP3 inflammasome and pathobiology in AMD. Journal of Clinical Medicine. 4, 172-192.

110. Shaftel, S.S., Griffin, W.S.T., and O'Banion, M.K. (2008) The role of interleukin-1 in neuroinflammation and Alzheimer disease: An evolving perspective. Journal of Neuroinflammation. 5, 1-12.

111. Oh, H., Takagi, H., Takagi, C., Suzuma, K., Otani, A., Ishida, K., et al. (1999) The potential angiogenic role of macrophages in the formation of choroidal neovascular membranes. Investigative Ophthalmology & Visual Science. 40, 1891-1898.

112. Zhao, M., Bai, Y., Xie, W., Shi, X., Li, F., Yang, F., et al. (2015) Interleukin-1β level is increased in vitreous of patients with neovascular age-related macular degeneration (nAMD) and polypoidal choroidal vasculopathy (PCV). PLoS ONE. 10, e0125150.

113. Jiao, H., Natoli, R., Valter, K., Provis, J.M., and Rutar, M. (2015) Spatiotemporal cadence of macrophage polarisation in a model of light-induced retinal degeneration. PLoS ONE. 10, e0143952.

114. Hu, S.J., Calippe, B., Lavalette, S., Roubeix, C., Montassar, F., Housset, M., et al. (2015) Upregulation of P2RX7 in Cx3cr1-deficient mononuclear phagocytes leads to increased interleukin-1β secretion and photoreceptor neurodegeneration. The Journal of Neuroscience. 35, 6987-6996.

115. Lavalette, S., Raoul, W., Houssier, M., Camelo, S., Levy, O., Calippe, B., et al. (2011) Interleukin-1β inhibition prevents choroidal neovascularization and does not exacerbate photoreceptor degeneration. The American Journal of Pathology. 178, 2416-2423.

116. Zhao, L., Zabel, M.K., Wang, X., Ma, W., Shah, P., Fariss, R.N., et al. (2015) Microglial phagocytosis of living photoreceptors contributes to inherited retinal degeneration. EMBO Molecular Medicine. 7, 1179-1197.

117. Kataoka, K., Matsumoto, H., Kaneko, H., Notomi, S., Takeuchi, K., Sweigard, J.H., et al. (2015) Macrophage- and RIP3-dependent inflammasome activation exacerbates retinal detachment-induced photoreceptor cell death. Cell Death & Disease. 6, e1731.

118. Hanisch, U.-K. and Kettenmann, H. (2007) Microglia: Active sensor and versatile effector cells in the normal and pathologic brain. Nature Neuroscience. 10, 1387-1394.

154

119. Ginhoux, F., Greter, M., Leboeuf, M., Nandi, S., See, P., Gokhan, S., et al. (2010) Fate mapping analysis reveals that adult microglia derive from primitive macrophages. Science. 330, 841-845.

120. O’Koren, E., Mathew, R., and Saban, D. (2016) Fate mapping reveals that microglia and recruited monocyte-derived macrophages are definitively distinguishable by phenotype in the retina. Scientific Reports. 6, 20636.

121. Nimmerjahn, A., Kirchhoff, F., and Helmchen, F. (2005) Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science. 308, 1314-1318.

122. Davalos, D., Grutzendler, J., Yang, G., Kim, J.V., Zuo, Y., Jung, S., et al. (2005) ATP mediates rapid microglial response to local brain injury in vivo. Nature Neuroscience. 8, 752-758.

123. Sierra, A., Encinas, J.M., Deudero, J.J.P., Chancey, J.H., Enikolopov, G., Overstreet-Wadiche, L.S., et al. (2010) Microglia shape adult hippocampal neurogenesis through apoptosis-coupled phagocytosis. Cell Stem Cell. 7, 483-495.

124. Ueno, M., Fujita, Y., Tanaka, T., Nakamura, Y., Kikuta, J., Ishii, M., et al. (2013) Layer V cortical neurons require microglial support for survival during postnatal development. Nature Neuroscience. 16, 543-551.

125. Schafer, Dorothy P., Lehrman, Emily K., Kautzman, Amanda G., Koyama, R., Mardinly, Alan R., Yamasaki, R., et al. (2012) Microglia sculpt postnatal neural circuits in an activity and complement-dependent manner. Neuron. 74, 691-705.

126. Wang, X., Zhao, L., Zhang, J., Fariss, R.N., Ma, W., Kretschmer, F., et al. (2016) Requirement for microglia for the maintenance of synaptic function and integrity in the mature retina. The Journal of Neuroscience. 36, 2827-2842.

127. Broderick, C., Hoek, R.M., Forrester, J.V., Liversidge, J., Sedgwick, J.D., and Dick, A.D. (2002) Constitutive retinal CD200 expression regulates resident microglia and activation state of inflammatory cells during experimental autoimmune uveoretinitis. The American Journal of Pathology. 161, 1669-1677.

128. Dick, A.D., Carter, D., Robertson, M., Broderick, C., Hughes, E., Forrester, J.V., et al. (2003) Control of myeloid activity during retinal inflammation. Journal of Leukocyte Biology. 74, 161-166.

129. Cardona, A.E., Pioro, E.P., Sasse, M.E., Kostenko, V., Cardona, S.M., Dijkstra, I.M., et al. (2006) Control of microglial neurotoxicity by the fractalkine receptor. Nature Neuroscience. 9, 917-924.

130. Cardona, S.M., Mendiola, A.S., Yang, Y.-C., Adkins, S.L., Torres, V., and Cardona, A.E. (2015) Disruption of fractalkine signaling leads to microglial activation and neuronal damage in the diabetic retina. ASN Neuro. 7.

131. Langmann, T. (2007) Microglia activation in retinal degeneration. Journal of Leukocyte Biology. 81, 1345-1351.

155

132. Damani, M.R., Zhao, L., Fontainhas, A.M., Amaral, J., Fariss, R.N., and Wong, W.T. (2011) Age-related alterations in the dynamic behavior of microglia. Aging Cell. 10, 263-276.

133. Xu, H., Chen, M., Manivannan, A., Lois, N., and Forrester, J.V. (2008) Age-dependent accumulation of lipofuscin in perivascular and subretinal microglia in experimental mice. Aging Cell. 7, 58-68.

134. Gupta, N., Brown, K.E., and Milam, A.H. (2003) Activated microglia in human retinitis pigmentosa, late-onset retinal degeneration, and age-related macular degeneration. Experimental Eye Research. 76, 463-471.

135. Cherepanoff, S., McMenamin, P., Gillies, M.C., Kettle, E., and Sarks, S.H. (2010) Bruch's membrane and choroidal macrophages in early and advanced age-related macular degeneration. British Journal of Ophthalmology. 94, 918-925.

136. Neufeld, A.H. (1999) Microglia in the optic nerve head and the region of parapapillary chorioretinal atrophy in glaucoma. Archives of Ophthalmology. 117, 1050-1056.

137. Yuan, L. and Neufeld, A.H. (2001) Activated microglia in the human glaucomatous optic nerve head. Journal of Neuroscience Research. 64, 523-532.

138. Zeng, H., Green, W., and Tso, M.M. (2008) Microglial activation in human diabetic retinopathy. Archives of Ophthalmology. 126, 227-232.

139. Roque, R.S., Rosales, A.A., Jingjing, L., Agarwal, N., and Al-Ubaidi, M.R. (1999) Retina-derived microglial cells induce photoreceptor cell death in vitro. Brain Research. 836, 110-119.

140. Luo, C., Chen, M., and Xu, H. (2011) Complement gene expression and regulation in mouse retina and retinal pigment epithelium/choroid. Molecular Vision. 17, 1588-1597.

141. Rutar, M., Natoli, R., Kozulin, P., Valter, K., Gatenby, P., and Provis, J.M. (2011) Analysis of complement expression in light-induced retinal degeneration: Synthesis and deposition of C3 by microglia/macrophages is associated with focal photoreceptor degeneration. Investigative Ophthalmology & Visual Science. 52, 5347-5358.

142. Rutar, M., Natoli, R., Provis, J., and Valter, K. (2012) Complement activation in retinal degeneration. Advances in Experimental Medicine and Biology. 723, 31-36.

143. Ma, W., Cojocaru, R., Gotoh, N., Gieser, L., Villasmil, R., Cogliati, T., et al. (2013) Gene expression changes in aging retinal microglia: Relationship to microglial support functions and regulation of activation. Neurobiology of Aging. 34, 2310-2321.

144. Rutar, M., Valter, K., Natoli, R., and Provis, J.M. (2014) Synthesis and propagation of complement C3 by microglia/monocytes in the aging retina. PLoS ONE. 9, e93343.

145. Walport, M.J. (2001) Complement: First of two parts. New England Journal of Medicine. 344, 1058-1066.

156

146. Walport, M.J. (2001) Complement: Second of two parts. New England Journal of Medicine. 344, 1140-1144.

147. Dunkelberger, J.R. and Song, W.-C. (2009) Complement and its role in innate and adaptive immune responses. Cell Research. 20, 34-50.

148. Zhu, Y., Thangamani, S., Ho, B., and Ding, J.L. (2005) The ancient origin of the complement system. The EMBO Journal. 24, 382-394.

149. Murphy, K., Travers, P., Walport, M., Janeway's Immunobiology, 7th edition. 2008, New York: Garland Science.

150. Zhao, T., Gao, J., Van, J., To, E., Wang, A., Cao, S., et al. (2015) Age-related increases in amyloid beta and membrane attack complex: Evidence of inflammasome activation in the rodent eye. Journal of Neuroinflammation. 12, 121.

151. Khandhadia, S., Cipriani, V., Yates, J.R.W., and Lotery, A.J. (2012) Age-related macular degeneration and the complement system. Immunobiology. 217, 127-146.

152. Anderson, D.H., Radeke, M.J., Gallo, N.B., Chapin, E.A., Johnson, P.T., Curletti, C.R., et al. (2010) The pivotal role of the complement system in aging and age-related macular degeneration: Hypothesis re-visited. Progress in Retinal and Eye Research. 29, 95-112.

153. Hageman, G.S., Anderson, D.H., Johnson, L.V., Hancox, L.S., Taiber, A.J., Hardisty, L.I., et al. (2005) A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proceedings of the National Academy of Sciences. 102, 7227-7232.

154. Klein, R.J., Zeiss, C., Chew, E.Y., Tsai, J.-Y., Sackler, R.S., Haynes, C., et al. (2005) Complement factor H polymorphism in age-related macular degeneration. Science. 308, 385-389.

155. Edwards, A.O., Ritter, R., Abel, K.J., Manning, A., Panhuysen, C., and Farrer, L.A. (2005) Complement factor H polymorphism and age-related macular degeneration. Science. 308, 421-424.

156. Haines, J.L., Hauser, M.A., Schmidt, S., Scott, W.K., Olson, L.M., Gallins, P., et al. (2005) Complement factor H variant increases the risk of age-related macular degeneration. Science. 308, 419-421.

157. Gold, B., Merriam, J.E., Zernant, J., Hancox, L.S., Taiber, A.J., Gehrs, K., et al. (2006) Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration. Nature Genetics. 38, 458-462.

158. Yates, J.R.W., Sepp, T., Matharu, B.K., Khan, J.C., Thurlby, D.A., Shahid, H., et al. (2007) Complement C3 variant and the risk of age-related macular degeneration. New England Journal of Medicine. 357, 553-561.

159. Mullins, R.F., Russell, S.R., Anderson, D.H., and Hageman, G.S. (2000) Drusen associated with aging and age-related macular degeneration contain proteins common to extracellular deposits associated with atherosclerosis, elastosis, amyloidosis, and dense deposit disease. The FASEB Journal. 14, 835-846.

157

160. Johnson, L.V., Leitner, W.P., Staples, M.K., and Anderson, D.H. (2001) Complement activation and inflammatory processes in drusen formation and age related macular degeneration. Experimental Eye Research. 73, 887-896.

161. Hageman, G.S., Luthert, P.J., Victor Chong, N.H., Johnson, L.V., Anderson, D.H., and Mullins, R.F. (2001) An integrated hypothesis that considers drusen as biomarkers of immune-mediated processes at the RPE-Bruch's membrane interface in aging and age-related macular degeneration. Progress in Retinal and Eye Research. 20, 705-732.

162. Anderson, D.H., Mullins, R.F., Hageman, G.S., and Johnson, L.V. (2002) A role for local inflammation in the formation of drusen in the aging eye. American Journal of Ophthalmology. 134, 411-431.

163. Mullins, R.F., Schoo, D.P., Sohn, E.H., Flamme-Wiese, M.J., Workamelahu, G., Johnston, R.M., et al. (2014) The membrane attack complex in aging human choriocapillaris: Relationship to macular degeneration and choroidal thinning. The American Journal of Pathology. 184, 3142-3153.

164. Whitmore, S.S., Sohn, E.H., Chirco, K.R., Drack, A.V., Stone, E.M., Tucker, B.A., et al. (2015) Complement activation and choriocapillaris loss in early AMD: Implications for pathophysiology and therapy. Progress in Retinal and Eye Research. 45, 1-29.

165. Chirco, K.R., Tucker, B.A., Stone, E.M., and Mullins, R.F. (2016) Selective accumulation of the complement membrane attack complex in aging choriocapillaris. Experimental Eye Research. 146, 393-397.

166. Toapanta, F.R. and Ross, T.M. (2006) Complement-mediated activation of the adaptive immune responses: Role of C3d in linking the innate and adaptive immunity. Immunologic Research. 36, 197-210.

167. Pepys, M.B. (1972) Role of complement in induction of the allergic response. Nature: New Biology. 237, 157-159.

168. Pepys, M.B. (1974) Role of complement in induction of antibody production in vivo. The Journal of Experimental Medicine. 140, 126-145.

169. Carroll, M.C., The role of complement in B cell activation and tolerance., in Advances in Immunology, J.D. Frank, Editor. 1999, Academic Press. p. 61-88.

170. Camelo, S., Calippe, B., Lavalette, S., Dominguez, E., Hur, J., Devevre, E., et al. (2015) Thinning of the RPE and choroid associated with T lymphocyte recruitment in aged and light-challenged mice. Molecular Vision. 21, 1051-1059.

171. Zhou, J., He, S., Zhang, N., Spee, C., Zhou, P., Ryan, S.J., et al. (2010) Neutrophils compromise retinal pigment epithelial barrier integrity. Journal of Biomedicine and Biotechnology. 2010, 289360.

172. Coughlin, B., Schnabolk, G., Joseph, K., Raikwar, H., Kunchithapautham, K., Johnson, K., et al. (2016) Connecting the innate and adaptive immune responses in mouse choroidal neovascularization via the anaphylatoxin C5a and γδT-cells. Scientific Reports. 6, 23794.

158

173. Liu, B., Wei, L., Meyerle, C., Tuo, J., Sen, H.N., Li, Z., et al. (2011) Complement component C5a promotes expression of IL-22 and IL-17 from human T cells and its implication in age-related macular degeneration. Journal of Translational Medicine. 9, 1-12.

174. Zhao, Z., Xu, P., Jie, Z., Zuo, Y., Yu, B., Soong, L., et al. (2014) γδ T cells as a major source of IL-17 production during age-dependent RPE degeneration. Investigative Ophthalmology & Visual Science. 55, 6580-6589.

175. Hasegawa, E., Sonoda, K.-H., Shichita, T., Morita, R., Sekiya, T., Kimura, A., et al. (2013) IL-23–independent induction of IL-17 from γδT cells and innate lymphoid cells promotes experimental intraocular neovascularization. The Journal of Immunology. 190, 1778-1787.

176. Rosenfeld, P.J., Brown, D.M., Heier, J.S., Boyer, D.S., Kaiser, P.K., Chung, C.Y., et al. (2006) Ranibizumab for neovascular age-related macular degeneration. New England Journal of Medicine. 355, 1419-1431.

177. Heier, J.S., Brown, D.M., Chong, V., Korobelnik, J.-F., Kaiser, P.K., Nguyen, Q.D., et al. (2012) Intravitreal Aflibercept (VEGF Trap-Eye) in wet age-related macular degeneration. Ophthalmology. 119, 2537-2548.

178. Xu, H. and Chen, M. (2016) Targeting the complement system for the management of retinal inflammatory and degenerative diseases. European Journal of Pharmacology. 787, 94-104.

179. de Amorim Garcia Filho, C.A., Yehoshua, Z., Gregori, G., Nunes, R.P., Penha, F.M., Moshfeghi, A.A., et al. (2014) Change in drusen volume as a novel clinical trial endpoint for the study of complement inhibition in age-related macular degeneration. Ophthalmic Surgery, Lasers and Imaging Retina. 45, 18-31.

180. Yehoshua, Z., Alexandre de Amorim Garcia Filho, C., Nunes, R.P., Gregori, G., Penha, F.M., Moshfeghi, A.A., et al. (2014) Systemic complement inhibition with eculizumab for geographic atrophy in age-related macular degeneration: The COMPLETE study. Ophthalmology. 121, 693-701.

181. Luo, C., Zhao, J., Madden, A., Chen, M., and Xu, H. (2013) Complement expression in retinal pigment epithelial cells is modulated by activated macrophages. Experimental Eye Research. 112, 93-101.

182. Wang, S., Koster, K.M., He, Y., and Zhou, Q. (2012) miRNAs as potential therapeutic targets for age-related macular degeneration. Future Medicinal Chemistry. 4, 277-287.

183. Rangasamy, S., McGuire, P.G., Franco Nitta, C., Monickaraj, F., Oruganti, S.R., and Das, A. (2014) Chemokine mediated monocyte trafficking into the retina: Role of inflammation in alteration of the blood-retinal barrier in diabetic retinopathy. PLoS ONE. 9, e108508.

184. Guo, C., Otani, A., Oishi, A., Kojima, H., Makiyama, Y., Nakagawa, S., et al. (2012) Knockout of ccr2 alleviates photoreceptor cell death in a model of retinitis pigmentosa. Experimental Eye Research. 104, 39-47.

159

185. Joly, S., Francke, M., Ulbricht, E., Beck, S., Seeliger, M., Hirrlinger, P., et al. (2009) Cooperative phagocytes: Resident microglia and bone marrow immigrants remove dead photoreceptors in retinal lesions. The American Journal of Pathology. 174, 2310-2323.

186. Reckless, J. and Grainger, D. (1999) Identification of oligopeptide sequences which inhibit migration induced by a wide range of chemokines. Biochemical Journal. 340, 803-811.

187. Reckless, J., Tatalick, L.M., and Grainger, D.J. (2001) The pan-chemokine inhibitor NR58-3.14.3 abolishes tumour necrosis factor-α accumulation and leucocyte recruitment induced by lipopolysaccharide in vivo. Immunology. 103, 244-254.

188. Wilbert, S.M., Engrissei, G., Yau, E.K., Grainger, D.J., Tatalick, L., and Axworthy, D.B. (2000) Quantitative analysis of a synthetic peptide, NR58-3.14.3, in serum by LC-MS with inclusion of a diastereomer as internal standard. Analytical Biochemistry. 278, 14-21.

189. Beech, J.S., Reckless, J., Mosedale, D.E., Grainger, D.J., Williams, S.C.R., and Menon, D.K. (2001) Neuroprotection in ischemia-reperfusion injury: An antiinflammatory approach using a novel broad-spectrum chemokine inhibitor. Journal of Cerebral Blood Flow & Metabolism. 21, 683-689.

190. Naidu, B.V., Farivar, A.S., Krishnadasan, B., Woolley, S.M., Grainger, D.J., Verrier, E.D., et al. (2003) Broad-spectrum chemokine inhibition ameliorates experimental obliterative bronchiolitis. The Annals of Thoracic Surgery. 75, 1118-1122.

191. Naidu, B.V., Farivar, A.S., Woolley, S.M., Grainger, D., Verrier, E.D., and Mulligan, M.S. (2004) Novel broad-spectrum chemokine inhibitor protects against lung ischemia-reperfusion injury. The Journal of Heart and Lung Transplantation. 23, 128-134.

192. Reckless, J., Tatalick, L., Wilbert, S., McKilligin, E., and Grainger, D.J. (2005) Broad-spectrum chemokine inhibition reduces vascular macrophage accumulation and collagenolysis consistent with plaque stabilization in mice. Journal of Vascular Research. 42, 492-502.

193. Berkkanoglu, M., Zhang, L., Ulukus, M., Cakmak, H., Kayisli, U.A., Kursun, S., et al. (2005) Inhibition of chemokines prevents intraperitoneal adhesions in mice. Human Reproduction. 20, 3047-3052.

194. Kayisli, U.A., Berkkanoglu, M., Lufang Zhang, Kizilay, G., and Arici, A. (2007) The broad-spectrum chemokine inhibitor NR58-3.14.3 suppresses the implantation and survival of human endometrial implants in the nude mice endometriosis model. Reproductive Sciences. 14, 825-835.

195. Miklos, S., Mueller, G., Chang, Y., Bouazzaoui, A., Spacenko, E., Schubert, T.O., et al. (2009) Preventive usage of broad spectrum chemokine inhibitor NR58-3.14.3 reduces the severity of pulmonary and hepatic graft-versus-host disease. International Journal of Hematology. 89, 383-397.

160

196. Pennesi, M.E., Neuringer, M., and Courtney, R.J. (2012) Animal models of age related macular degeneration. Molecular Aspects of Medicine. 33, 487-509.

197. Fletcher, E.L., Jobling, A.I., Greferath, U., Mills, S.A., Waugh, M., Ho, T., et al. (2014) Studying age-related macular degeneration using animal models. Optometry and Vision Science. 91, 878-886.

198. Combadière, C., Potteaux, S., Gao, J.-L., Esposito, B., Casanova, S., Lee, E.J., et al. (2003) Decreased atherosclerotic lesion formation in CX3CR1/apolipoprotein E double knockout mice. Circulation. 107, 1009-1016.

199. Combadière, C., Feumi, C., Raoul, W., Keller, N., Rodéro, M., Pézard, A., et al. (2007) CX3CR1-dependent subretinal microglia cell accumulation is associated with cardinal features of age-related macular degeneration. The Journal of Clinical Investigation. 117, 2920-2928.

200. Coffey, P.J., Gias, C., McDermott, C.J., Lundh, P., Pickering, M.C., Sethi, C., et al. (2007) Complement factor H deficiency in aged mice causes retinal abnormalities and visual dysfunction. Proceedings of the National Academy of Sciences. 104, 16651-16656.

201. Noell, W., Walker, V., Kang, B., and Berman, S. (1966) Retinal damage by light in rats. Investigative Ophthalmology & Visual Science. 5, 450-473.

202. Organisciak, D.T. and Vaughan, D.K. (2010) Retinal light damage: Mechanisms and protection. Progress in Retinal and Eye Research. 29, 113-134.

203. Grimm, C. and Remé, C.E., Light damage as a model of retinal degeneration., in Retinal Degeneration. 2013, Springer. p. 87-97.

204. Organisciak, D.T., Darrow, R.M., Barsalou, L., Kutty, R.K., and Wiggert, B. (2000) Circadian-dependent retinal light damage in rats. Investigative Ophthalmology & Visual Science. 41, 3694-3701.

205. Organisciak, D.T., Darrow, R.M., Barsalou, L., Darrow, R.A., Kutty, R.K., Kutty, G., et al. (1998) Light history and age-related changes in retinal light damage. Investigative Ophthalmology & Visual Science. 39, 1107-1116.

206. Tanito, M., Kaidzu, S., Ohira, A., and Anderson, R.E. (2008) Topography of retinal damage in light-exposed albino rats. Experimental Eye Research. 87, 292-295.

207. Marc, R.E., Jones, B.W., Watt, C.B., Vazquez-Chona, F., Vaughan, D.K., and Organisciak, D.T. (2008) Extreme retinal remodeling triggered by light damage: Implications for age related macular degeneration. Molecular Vision. 14, 782-806.

208. Fukuda, Y. (1977) A three-group classification of rat retinal ganglion cells: Histological and physiological studies. Brain Research. 119, 327-344.

209. Rutar, M., Provis, J.M., and Valter, K. (2010) Brief exposure to damaging light causes focal recruitment of macrophages, and long-term destabilization of photoreceptors in the albino rat retina. Current Eye Research. 35, 631-643.

161

210. Natoli, R., Jiao, H., Barnett, N.L., Fernando, N., Valter, K., Provis, J.M., et al. (2016) A model of progressive photo-oxidative degeneration and inflammation in the pigmented C57BL/6J mouse retina. Experimental Eye Research. 147, 114-127.

211. Rutar, M., Natoli, R., Albarracin, R., Valter, K., and Provis, J. (2012) 670-nm light treatment reduces complement propagation following retinal degeneration. Journal of Neuroinflammation. 9, 1-10.

212. Zhang, C., Shen, J., Lam, T., Zeng, H., Chiang, S., Yang, F., et al. (2005) Activation of microglia and chemokines in light-induced retinal degeneration. Molecular Vision. 11, 887-895.

213. Lau, L.-I., Chiou, S.-H., Liu, C.J.-L., Yen, M.-Y., and Wei, Y.-H. (2011) The effect of photo-oxidative stress and inflammatory cytokine on complement factor H expression in retinal pigment epithelial cells. Investigative Ophthalmology & Visual Science. 52, 6832-6841.

214. Hadziahmetovic, M., Kumar, U., Song, Y., Grieco, S., Song, D., Li, Y., et al. (2012) Microarray analysis of murine retinal light damage reveals changes in iron regulatory, complement, and antioxidant genes in the neurosensory retina and isolated RPE. Investigative Ophthalmology & Visual Science. 53, 5231-5241.

215. Rohrer, B., Coughlin, B., Kunchithapautham, K., Long, Q., Tomlinson, S., Takahashi, K., et al. (2011) The alternative pathway is required, but not alone sufficient, for retinal pathology in mouse laser-induced choroidal neovascularization. Molecular Immunology. 48, e1-8.

216. Bora, N.S., Kaliappan, S., Jha, P., Xu, Q., Sohn, J.-H., Dhaulakhandi, D.B., et al. (2006) Complement activation via alternative pathway is critical in the development of laser-induced choroidal neovascularization: Role of factor B and factor H. The Journal of Immunology. 177, 1872-1878.

217. Rohrer, B., Guo, Y., Kunchithapautham, K., and Gilkeson, G.S. (2007) Eliminating complement factor D reduces photoreceptor susceptibility to light-induced damage. Investigative Ophthalmology & Visual Science. 48, 5282-5289.

218. Chen, M., Muckersie, E., Luo, C., Forrester, J.V., and Xu, H. (2010) Inhibition of the alternative pathway of complement activation reduces inflammation in experimental autoimmune uveoretinitis. European Journal of Immunology. 40, 2870-2881.

219. Sweigard, J.H., Matsumoto, H., Smith, K.E., Kim, L.A., Paschalis, E.I., Okonuki, Y., et al. (2015) Inhibition of the alternative complement pathway preserves photoreceptors after retinal injury. Science Translational Medicine. 7, 297ra116.

220. Pujol-Lereis, M.L., Schäfer, N., Kuhn, B.L., Rohrer, B., and Pauly, D., Interrelation between oxidative stress and complement activation in models of age-related macular degeneration., in Retinal Degenerative Diseases: Mechanisms and Experimental Therapy, C. Bowes Rickman, et al., Editors. 2016, Springer International Publishing: Cham. p. 87-93.

162

221. Dureau, P., Bonnel, S., Menasche, M., Dufier, J.L., and Abitbol, M. (2001) Quantitative analysis of intravitreal injections in the rat. Current Eye Research. 22, 74-77.

222. Liu, X., Wang, C.-H., Dai, C., Camesa, A., Zhang, H.F., and Jiao, S. (2013) Effect of contact lens on optical coherence tomography imaging of rodent retina. Current Eye Research. 38, 1235-1240.

223. Kraupp, B.G., Ruttkay-Nedecky, B., Koudelka, H., Bukowska, K., Bursch, W., and Schulte-Hermann, R. (1995) In situ detection of fragmented DNA (TUNEL assay) fails to discriminate among apoptosis, necrosis, and autolytic cell death: A cautionary note. Hepatology. 21, 1465-1468.

224. Cornish, E.E., Madigan, M.C., Natoli, R., Hales, A., Hendrickson, A.E., and Provis, J.M. (2005) Gradients of cone differentiation and FGF expression during development of the foveal depression in macaque retina. Visual Neuroscience. 22, 447-459.

225. Chen, L., Wu, W., Dentchev, T., Zeng, Y., Wang, J., Tsui, I., et al. (2004) Light damage induced changes in mouse retinal gene expression. Experimental Eye Research. 79, 239-247.

226. Rozen, S. and Skaletsky, H. (2000) Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology. 132, 365-386.

227. Bonifati, D.M. and Kishore, U. (2007) Role of complement in neurodegeneration and neuroinflammation. Molecular Immunology. 44, 999-1010.

228. Fernando, N., Natoli, R., Valter, K., Provis, J., and Rutar, M. (2016) The broad-spectrum chemokine inhibitor NR58-3.14.3 modulates macrophage-mediated inflammation in the diseased retina. Journal of Neuroinflammation. 13, 47.

229. Costabile, M. (2010) Measuring the 50% haemolytic complement (CH50) activity of serum. Journal of Visualised Experiments. 37, e1923.

230. Shelley, E.J., Madigan, M.C., Natoli, R., Penfold, P.L., and Provis, J.M. (2009) Cone degeneration in ageing and age-related macular degeneration. Archives of Ophthalmology. 127, 483-492.

231. Curcio, C.A., Medeiros, N.E., and Millican, C.L. (1998) The Alabama age-related macular degeneration grading system for donor eyes. Investigative Ophthalmology & Visual Science. 39, 1085-1096.

232. Natoli, R., Provis, J., Valter, K., and Stone, J. (2008) Gene regulation induced in the C57BL/6J mouse retina by hyperoxia: A temporal microarray study. Molecular Vision. 14, 1983-1994.

233. Yu, M., Zou, W., Peachey, N.S., McIntyre, T.M., and Liu, J. (2012) A novel role of complement in retinal degeneration. Investigative Ophthalmology & Visual Science. 53, 7684-7692.

234. Hoh Kam, J., Lenassi, E., Malik, T.H., Pickering, M.C., and Jeffery, G. (2013) Complement component C3 plays a critical role in protecting the aging retina in a

163

murine model of age-related macular degeneration. The American Journal of Pathology. 183, 480-492.

235. Alper, C.A., Johnson, A.M., Birtch, A.G., and Moore, F.D. (1969) Human C'3: Evidence for the liver as the primary site of synthesis. Science. 163, 286-288.

236. Sivaprasad, S., Adewoyin, T., Bailey, T.A., Dandekar, S.S., Jenkins, S., Webster, A.R., et al. (2007) Estimation of systemic complement C3 activity in age-related macular degeneration. Archives of Ophthalmology. 125, 515-519.

237. Tsutsumi, C., Sonoda, K.H., Egashira, K., Qiao, H., Hisatomi, T., Nakao, S., et al. (2003) The critical role of ocular-infiltrating macrophages in the development of choroidal neovascularization. Journal of Leukocyte Biology. 74, 25-32.

238. Luhmann, U.F., Robbie, S., Munro, P.M., Barker, S.E., Duran, Y., Luong, V., et al. (2009) The drusenlike phenotype in aging Ccl2-knockout mice is caused by an accelerated accumulation of swollen autofluorescent subretinal macrophages. Investigative Ophthalmology & Visual Science. 50, 5934-5943.

239. Levy, O., Calippe, B., Lavalette, S., Hu, S.J., Raoul, W., Dominguez, E., et al. (2015) Apolipoprotein E promotes subretinal mononuclear phagocyte survival and chronic inflammation in age-related macular degeneration. EMBO Molecular Medicine. 7, 211-226.

240. Penfold, P.L., Provis, J.M., Furby, J.H., Gatenby, P.A., and Billson, F.A. (1990) Autoantibodies to retinal astrocytes associated with age-related macular degeneration. Graefe's Archive for Clinical and Experimental Ophthalmology. 228, 270-274.

241. Donoso, L.A., Kim, D., Frost, A., Callahan, A., and Hageman, G. (2006) The role of inflammation in the pathogenesis of age-related macular degeneration. Survey of Ophthalmology. 51, 137-152.

242. Ginhoux, F., Lim, S., Hoeffel, G., Low, D., and Huber, T. (2013) Origin and differentiation of microglia. Frontiers in Cellular Neuroscience. 7, 45.

243. Dickson, D.W. (1986) Multinucleated giant cells in acquired immunodeficiency syndrome encephalopathy. Origin from endogenous microglia? The Archives of Pathology & Laboratory Medicine. 110, 967-968.

244. Provis, J.M., Penfold, P.L., Edwards, A.J., and van Driel, D. (1995) Human retinal microglia: Expression of immune markers and relationship to the glia limitans. Glia. 14, 243-256.

245. Nakazawa, T., Hisatomi, T., Nakazawa, C., Noda, K., Maruyama, K., She, H., et al. (2007) Monocyte chemoattractant protein 1 mediates retinal detachment-induced photoreceptor apoptosis. Proceedings of the National Academy of Sciences. 104, 2425-2430.

246. Ibrahim, A.S., El-Shishtawy, M.M., Pena, A., Jr., and Liou, G.I. (2010) Genistein attenuates retinal inflammation associated with diabetes by targeting of microglial activation. Molecular Vision. 16, 2033-2042.

164

247. Krady, J.K., Basu, A., Allen, C.M., Xu, Y., LaNoue, K.F., Gardner, T.W., et al. (2005) Minocycline reduces proinflammatory cytokine expression, microglial activation, and caspase-3 activation in a rodent model of diabetic retinopathy. Diabetes. 54, 1559-65.

248. Bosco, A., Inman, D.M., Steele, M.R., Wu, G., Soto, I., Marsh-Armstrong, N., et al. (2008) Reduced retina microglial activation and improved optic nerve integrity with minocycline treatment in the DBA/2J mouse model of glaucoma. Investigative Ophthalmology & Visual Science. 49, 1437-1446.

249. Neufeld, A.H. (2004) Pharmacologic neuroprotection with an inhibitor of nitric oxide synthase for the treatment of glaucoma. Brain Research Bulletin. 62, 455-459.

250. Patel, M. and Chan, C.C. (2008) Immunopathological aspects of age-related macular degeneration. Seminars in Immunopathology. 30, 97-110.

251. Nagineni, C.N., Kommineni, V.K., Ganjbaksh, N., Nagineni, K.K., Hooks, J.J., and Detrick, B. (2015) Inflammatory cytokines induce expression of chemokines by human retinal cells: Role in chemokine receptor mediated age-related macular degeneration. Aging and Disease. 6, 444-455.

252. Jonas, J.B., Tao, Y., Neumaier, M., and Findeisen, P. (2010) Monocyte chemoattractant protein 1, intercellular adhesion molecule 1, and vascular cell adhesion molecule 1 in exudative age-related macular degeneration. Archives of Ophthalmology. 128, 1281-1286.

253. Kramer, M., Hasanreisoglu, M., Feldman, A., Siegel, R.A., Sonis, P., Maharshak, I., et al. (2012) Monocyte chemoattractant protein-1 in the aqueous humor of patients with age-related macular degeneration. Clinical & Experimental Ophthalmology. 40, 617-625.

254. Cruz-Guilloty, F., Saeed, A.M., Echegaray, J.J., Duffort, S., Ballmick, A., Tan, Y., et al. (2013) Infiltration of proinflammatory M1 macrophages into the outer retina precedes damage in a mouse model of age-related macular degeneration. International Journal of Inflammation. 2013, 503725.

255. Maslim, J., Valter, K., Egensperger, R., Holländer, H., and Stone, J. (1997) Tissue oxygen during a critical developmental period controls the death and survival of photoreceptors. Investigative Ophthalmology & Visual Science. 38, 1667-1677.

256. Natoli, R., Zhu, Y., Valter, K., Bisti, S., Eells, J., and Stone, J. (2010) Gene and noncoding RNA regulation underlying photoreceptor protection: Microarray study of dietary antioxidant saffron and photobiomodulation in rat retina. Molecular Vision. 16, 1801-1822.

257. Ng, T.F. and Streilein, J.W. (2001) Light-induced migration of retinal microglia into the subretinal space. Investigative Ophthalmology & Visual Science. 42, 3301-3310.

258. Wu, K.H.C., Madigan, M.C., Billson, F., and Penfold, P.L. (2003) Differential expression of GFAP in early v late AMD: A quantitative analysis. British Journal of Ophthalmology. 87, 1159-1166.

165

259. Chen, L., Yang, P., and Kijlsta, A. (2002) Distribution, markers, and functions of retinal microglia. Ocular Immunology and Inflammation. 10, 27-39.

260. Davoust, N., Vuaillat, C., Androdias, G., and Nataf, S. (2008) From bone marrow to microglia: Barriers and avenues. Trends in Immunology. 29, 227-234.

261. Wohl, S.G., Schmeer, C.W., Friese, T., Witte, O.W., and Isenmann, S. (2011) In situ dividing and phagocytosing retinal microglia express nestin, vimentin, and NG2 in vivo. PLoS ONE. 6, e22408.

262. Zhou, W., Ke, S.Q., Huang, Z., Flavahan, W., Fang, X., Paul, J., et al. (2015) Periostin secreted by glioblastoma stem cells recruits M2 tumour-associated macrophages and promotes malignant growth. Nature Cell Biology. 17, 170-182.

263. Kettenmann, H., Hanisch, U.K., Noda, M., and Verkhratsky, A. (2011) Physiology of microglia. Physiological Reviews. 91, 461-553.

264. Grainger, D.J. and Reckless, J. (2003) Broad-spectrum chemokine inhibitors (BSCIs) and their anti-inflammatory effects in vivo. Biochemical Pharmacology. 65, 1027-1034.

265. Kunikata, H., Yasuda, M., Aizawa, N., Tanaka, Y., Abe, T., and Nakazawa, T. (2013) Intraocular concentrations of cytokines and chemokines in rhegmatogenous retinal detachment and the effect of intravitreal triamcinolone acetonide. American Journal of Ophthalmology. 155, 1028-1037.

266. Dai, Y., Wu, Z., Sheng, H., Zhang, Z., Yu, M., and Zhang, Q. (2015) Identification of inflammatory mediators in patients with rhegmatogenous retinal detachment associated with choroidal detachment. Molecular Vision. 21, 417-427.

267. Curnow, S.J. and Murray, P.I. (2006) Inflammatory mediators of uveitis: Cytokines and chemokines. Current Opinion in Ophthalmology. 17, 532-537.

268. Gao, X., Huang, W., Zhang, X., Du, S., Wang, J., Wang, W., et al. (2015) Chemokine (C-C motif) ligand 2 and chemokine (C-C motif) ligand 7 in angle-closure glaucoma. Acta Ophthalmologica. 94, e220-4.

269. Yoshida, N., Ikeda, Y., Notomi, S., Ishikawa, K., Murakami, Y., Hisatomi, T., et al. (2013) Clinical evidence of sustained chronic inflammatory reaction in retinitis pigmentosa. Ophthalmology. 120, 100-105.

270. Klein, R., Knudtson, M.D., Klein, B.E., Wong, T.Y., Cotch, M.F., Liu, K., et al. (2008) Inflammation, complement factor H, and age-related macular degeneration: The multi-ethnic study of atherosclerosis. Ophthalmology. 115, 1742-1749.

271. Agawa, T., Usui, Y., Wakabayashi, Y., Okunuki, Y., Juan, M., Umazume, K., et al. (2014) Profile of intraocular immune mediators in patients with age-related macular degeneration and the effect of intravitreal bevacizumab injection. Retina. 34, 1811-1818.

272. Ransohoff, R.M. (2009) Chemokines and chemokine receptors: Standing at the crossroads of immunobiology and neurobiology. Immunity. 31, 711-721.

166

273. Gao, H., Pennesi, M., Shah, K., Qiao, X., Hariprasad, S.M., Mieler, W.F., et al. (2003) Safety of intravitreal voriconazole: Electroretinographic and histopathologic studies. Transactions of the American Ophthalmological Society. 101, 183-189.

274. Bamforth, S.D., Lightman, S.L., and Greenwood, J. (1997) Ultrastructural analysis of interleukin-1 beta-induced leukocyte recruitment to the rat retina. Investigative Ophthalmology & Visual Science. 38, 25-35.

275. Liu, X., Ye, F., Xiong, H., Hu, D.N., Limb, G.A., Xie, T., et al. (2015) IL-1beta induces IL-6 production in retinal Muller cells predominantly through the activation of p38 MAPK/NF-kappaB signaling pathway. Experimental Cell Research. 331, 223-231.

276. Udono, T., Takahashi, K., Nakayama, M., Murakami, O., Durlu, Y.K., Tamai, M., et al. (2000) Adrenomedullin in cultured human retinal pigment epithelial cells. Investigative Ophthalmology & Visual Science. 41, 1962-1970.

277. Eandi, C.M., Charles Messance, H., Augustin, S., Dominguez, E., Lavalette, S., Forster, V., et al. (2016) Subretinal mononuclear phagocytes induce cone segment loss via IL-1beta. Elife. 5, e16490.

278. McIntyre, K.W., Stepan, G.J., Kolinsky, K.D., Benjamin, W.R., Plocinski, J.M., Kaffka, K.L., et al. (1991) Inhibition of interleukin 1 (IL-1) binding and bioactivity in vitro and modulation of acute inflammation in vivo by IL-1 receptor antagonist and anti-IL-1 receptor monoclonal antibody. The Journal of Experimental Medicine. 173, 931-939.

279. Di Paolo, N.C. and Shayakhmetov, D.M. (2016) Interleukin 1alpha and the inflammatory process. Nature Immunology. 17, 906-913.

280. Rider, P., Carmi, Y., Guttman, O., Braiman, A., Cohen, I., Voronov, E., et al. (2011) IL-1alpha and IL-1beta recruit different myeloid cells and promote different stages of sterile inflammation. The Journal of Immunology. 187, 4835-4843.

281. Lugrin, J., Parapanov, R., Rosenblatt-Velin, N., Rignault-Clerc, S., Feihl, F., Waeber, B., et al. (2015) Cutting edge: IL-1alpha is a crucial danger signal triggering acute myocardial inflammation during myocardial infarction. The Journal of Immunology. 194, 499-503.

282. Burke, S.J., Goff, M.R., Updegraff, B.L., Lu, D., Brown, P.L., Minkin, S.C., Jr., et al. (2012) Regulation of the CCL2 gene in pancreatic beta-cells by IL-1beta and glucocorticoids: role of MKP-1. PLoS ONE. 7, e46986.

283. Kutlu, B., Darville, M.I., Cardozo, A.K., and Eizirik, D.L. (2003) Molecular regulation of monocyte chemoattractant protein-1 expression in pancreatic beta-cells. Diabetes. 52, 348-355.

284. Hasegawa, M., Kamada, N., Jiao, Y., Liu, M.Z., Nunez, G., and Inohara, N. (2012) Protective role of commensals against Clostridium difficile infection via an IL-1beta-mediated positive-feedback loop. The Journal of Immunology. 189, 3085-3091.

167

285. Burke, S.J., Stadler, K., Lu, D., Gleason, E., Han, A., Donohoe, D.R., et al. (2015) IL-1beta reciprocally regulates chemokine and insulin secretion in pancreatic beta-cells via NF-kappaB. The American Journal of Physiology - Endocrinology and Metabolism. 309, e715-726.

286. Tomita, K., Freeman, B.L., Bronk, S.F., LeBrasseur, N.K., White, T.A., Hirsova, P., et al. (2016) CXCL10-mediates macrophage, but not other innate immune cells-associated inflammation in murine nonalcoholic steatohepatitis. Scientific Reports. 6, 28786.

287. Petrovic-Djergovic, D., Popovic, M., Chittiprol, S., Cortado, H., Ransom, R.F., and Partida-Sanchez, S. (2015) CXCL10 induces the recruitment of monocyte-derived macrophages into kidney, which aggravate puromycin aminonucleoside nephrosis. Clinical & Experimental Ophthalmology. 180, 305-315.

288. Lei, Z.B., Zhang, Z., Jing, Q., Qin, Y.W., Pei, G., Cao, B.Z., et al. (2002) OxLDL upregulates CXCR2 expression in monocytes via scavenger receptors and activation of p38 mitogen-activated protein kinase. Cardiovascular Research. 53, 524-532.

289. Henke, P.K., Varga, A., De, S., Deatrick, C.B., Eliason, J., Arenberg, D.A., et al. (2004) Deep vein thrombosis resolution is modulated by monocyte CXCR2-mediated activity in a mouse model. Arteriosclerosis, Thrombosis, and Vascular Biology. 24, 1130-1137.

290. Kolaczkowska, E. and Kubes, P. (2013) Neutrophil recruitment and function in health and inflammation. Nature Reviews Immunology. 13, 159-175.

291. Dufour, J.H., Dziejman, M., Liu, M.T., Leung, J.H., Lane, T.E., and Luster, A.D. (2002) IFN-gamma-inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking. The Journal of Immunology. 168, 3195-3204.

292. Natoli, R., Fernando, N., Jiao, H., Racic, T., Madigan, M., Barnett, N.L., et al. (2017) Retinal macrophages synthesize C3 and activate complement in AMD and in models of focal retinal degeneration. Investigative Ophthalmology & Visual Science. 58, 2977-2990.

293. Sander, J.D. and Joung, J.K. (2014) CRISPR-Cas systems for editing, regulating and targeting genomes. Nature Biotechnology. 32, 347-355.

294. Bakondi, B., Lv, W., Lu, B., Jones, M.K., Tsai, Y., Kim, K.J., et al. (2016) In vivo CRISPR/Cas9 gene editing corrects retinal dystrophy in the S334ter-3 rat model of autosomal dominant retinitis pigmentosa. Molecular Therapy. 24, 556-563.

295. Bassuk, A.G., Zheng, A., Li, Y., Tsang, S.H., and Mahajan, V.B. (2016) Precision medicine: Genetic repair of retinitis pigmentosa in patient-derived stem cells. Scientific Reports. 6, 19969.

296. Hung, S.S., Chrysostomou, V., Li, A.F., Lim, J.K., Wang, J.-H., Tu, L., et al. (2016) CRISPR/Cas-mediated gene editing of retinal cells in vivo. Investigative Ophthalmology & Visual Science. 57, 3470-3476.

168

297. Kim, S., Kim, D., Cho, S.W., Kim, J., and Kim, J.-S. (2014) Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, 1012-1019.

298. Kim, K., Park, S.W., Kim, J.H., Lee, S.H., Kim, D., Koo, T., et al. (2017) Genome surgery using Cas9 ribonucleoproteins for the treatment of age-related macular degeneration. Genome Research. 27, 419-426.

299. Natoli, R., Fernando, N., Madigan, M., Chu-Tan, J.A., Valter, K., Provis, J., et al. (2017) Microglia-derived IL-1β promotes chemokine expression by Müller cells and RPE in focal retinal degeneration. Molecular Neurodegeneration. 12, 31.

300. Bartel, D.P. (2009) MicroRNA target recognition and regulatory functions. Cell. 136, 215-233.

301. Saxena, K., Rutar, M.V., Provis, J.M., and Natoli, R.C. (2015) Identification of miRNAs in a model of retinal degenerations. Investigative Ophthalmology & Visual Science. 56, 1820-1829.

302. Bauernfeind, F., Rieger, A., Schildberg, F.A., Knolle, P.A., Schmid-Burgk, J.L., and Hornung, V. (2012) NLRP3 inflammasome activity is negatively controlled by miR-223. The Journal of Immunology. 189, 4175-4181.

303. Yang, Z., Zhong, L., Xian, R., and Yuan, B. (2015) MicroRNA-223 regulates inflammation and brain injury via feedback to NLRP3 inflammasome after intracerebral hemorrhage. Molecular Immunology. 65, 267-276.

304. Zhou, Y., Lu, M., Du, R.-H., Qiao, C., Jiang, C.-Y., Zhang, K.-Z., et al. (2016) MicroRNA-7 targets Nod-like receptor protein 3 inflammasome to modulate neuroinflammation in the pathogenesis of Parkinson’s disease. Molecular Neurodegeneration. 11, 28.

305. Qazi, O., Parthasarathy, P.T., Lockey, R., and Kolliputi, N. (2013) Can microRNAs keep inflammasomes in check? Frontiers in Genetics. 4, 30.

306. Bennett, M.L., Bennett, F.C., Liddelow, S.A., Ajami, B., Zamanian, J.L., Fernhoff, N.B., et al. (2016) New tools for studying microglia in the mouse and human CNS. Proceedings of the National Academy of Sciences. 113, e1738-1746.

307. Satoh, J.-i., Kino, Y., Asahina, N., Takitani, M., Miyoshi, J., Ishida, T., et al. (2016) TMEM119 marks a subset of microglia in the human brain. Neuropathology. 36, 39-49.

308. Segal, B.M. and Giger, R.J. (2016) Stable biomarker for plastic microglia. Proceedings of the National Academy of Sciences. 113, 3130-3132.

309. Calippe, B., Augustin, S., Beguier, F., Charles-Messance, H., Poupel, L., Conart, J., et al. (2017) Complement factor H inhibits CD47-mediated resolution of inflammation. Immunity. 46, 261-272.

310. Hauswirth, W.W., Aleman, T.S., Kaushal, S., Cideciyan, A.V., Schwartz, S.B., Wang, L., et al. (2008) Treatment of Leber Congenital Amaurosis due to RPE65 mutations by ocular subretinal injection of adeno-associated virus gene vector: Short-term results of a Phase I trial. Human Gene Therapy. 19, 979-990.

macrophages, cytokines and complement as therapeutic ...... · ii . candidate statement . this...

Documents