Molecular Approaches to Nutrition

Molecular Biology 2

Principles and Methods

Dr. Janice Drew

Principles and Methods Purification and handling of DNA/RNA

Gel Electrophoresis

Nucleic Acid Hybridisation

Cutting and rejoining DNA

Methods of introducing DNA into cells

PCR

DNA sequencing

Sequence interpretation

Handling of DNA/RNA

DNases and RNases

Glass and plasticware

Solutions

Extraction of DNA/RNA

DNA extraction Alkaline lysis Neutralisation Precipitation of proteins and cell debris Precipitation or elution using spin column

RNA extraction Lysis incorporating instantaneous inactivation of RNases Separation of contaminating DNA Precipitation or elution using spin column

Quantitation and analysis of DNA/RNA

Spectrometric determination at 260nm

Gel Electrophoresis

Agilent technology

Gel Electrophoresis Nucleic acids are negatively charged

PO4- groups

Electrophoresis resolves by size

Agarose is the usual gel matrix

Ethidium bromide/SYBR green ‘stains’ DNA & RNA Fluorescent colour under UV illumination

Agarose Gel Preparation

Agarose : fine white powder; polysaccharide (galactose polymer) isolated from seaweed.

1% (w/v) dissolves in Tris-acetate buffer at ~60 °C and the solution sets at ~30 °C

Agarose Gel Image

Largest (1,500bp)

Smallest (100bp)

Markers (DNA Ladder)Known Sizes

_

+

Agilent Technology

Electropherogram showing Agilent analysis of total RNA

18S

28S

Times (seconds)

Fluo

resc

ence

Hybridisation - Identification of DNA/RNA

Agarose gel electrophoresis separates nucleic acids on the basis of size - does not identify DNA/RNA fragments

Nucleic acid probes are used to identify specific DNA/RNA sequences in a gel

Probe is a known nucleic acid sequence Relies on the principle of base pairing -

complementary DNA/RNA sequences stick (hybridise) together

Hybridisation - Identification of DNA/RNA

Many molecular biology procedures to identify specific DNA/RNA sequences use this principle -

Southern (DNA) or Northern (RNA) blotting

In situ hybridisation

Microarrays

Antisense technologies

Probe Production Synthesise a known fragment

OR Purify a known fragment of DNA

Restriction enzyme digestion

Heat denature to give single strands

Add primers, DNA polymerase and radioactive/colour labelled nucleotides Make a radioactive/ colour labelled complementary

strand

Denature to give single strands

HYBRIDISATION OVEN

Incubate filter and probe in hybridisation buffer

TREAT and BLOT GEL

Transfer to nylon membrane

nylon membrane and transferred DNA

Southern/Northern Blotting

and

Hybridisation

Restriction Endonucleases

Restriction endonucleases cut DNA Present in bacteria Cut at sequence specific sites

Usually 4 or 6 base pairs long

Bacteria use them to destroy ‘foreign’ DNA Bacteria protect their own DNA against self-cutting by

special methylation of their DNA

Restriction enzymes can be purified and are used in genetic engineering studies

Restriction Endonucleases Example Restriction enzymes

EcoR I (E. coli Restriction Endonuclease I) Stu I (Streptomyces tubercidicus I)

GAATTCCTTAAG

5’

5’

3’

3’

Sticky Ended Blunt Ended

AGGCCTTCCGGA

5’

5’

3’

3’

EcoR I Stu IPalindromicAxis of rotational symmetry

Molecular Scissors and Glue

There are 100’s of restriction enzymes, each one with a different recognition site These enzymes are ‘molecular scissors’ and can be used

to specifically cut long DNA strands into smaller pieces

The T4 virus, which infects E. coli, has an enzyme, T4 DNA ligase, which can form a phosphodiester bonds between DNA molecules Purified T4 DNA ligase can be used as ‘molecular glue’ to

join pieces of DNA. This enzyme is widely used for DNA cloning

Ligation of DNA

EcoR IOH 3’ 5’ PO4

Circular DNA

T4 DNA ligase catalyses the formation of phosphodiester bonds

PO4 5’ 3’OH

T4 DNA Ligase

T4 DNA Ligase

Stu I

EcoR I

GCTTAA

AATTC G

Methods of introducing DNA into cells

Plasmids

Viruses

DNA and RNA viruses

Phage vectors

Cloning DNA into Plasmids

Bacteria have a circular DNA genome5 to 10 million base pairs (bp) in size

Many bacteria also contain plasmids Small circular DNA molecules, ~3,000 to 50,000 bp Note: The bacterial genome is not a plasmid

Plasmids contain ‘extra’ genes which are often vital for the survival of the bacteriumNutrient metabolism, antibiotic resistance

Plasmids can be used as vectors in which foreign DNA can be ligated (cloned)

A General Laboratory Plasmid

Multiple Cloning Site

A foreign gene can be ligated into a plasmid, and the genetically engineered plasmid introduced into E. coli.

Cloning DNA into a Plasmid

Both plasmid and foreign DNA have sticky EcoR I ends

Insertion into E. coli

(transformation)

Agar plates contain antibiotic.

Grow at 37 °C

Place 1 colony in liquid media + antibiotic. Grow at 37 °C

Purify Plasmid DNA (Billions of copies)

DNA and Retroviruses can serve as vehicles for the introduction of new

DNA into a cell

DNA / RNA viruses as ‘vehicles’DNA / RNA viruses as ‘vehicles’

Chromosomal DNAViral DNA

Integration into genome

gene x

Gene Therapy and Transgenics

Polymerase Chain Reaction (PCR)

PCR generates multiple copies of DNA Heat resistant DNA polymerase used to copy a

section of DNA e.g Taq

Very efficient copying Billions of copies from a single ‘template’ DNA

Small volume / quick analysis

Polymerase Chain Reaction (PCR)Entire reaction performed in single tube

10 to 50 μl volume

Reaction contains Template DNA, heat resistant DNA polymerase, a pair

of specific DNA primers (in excess over the template), nucleotide bases, appropriate reaction buffer

Reaction is repeatedly cycled through 3 temperatures (x30) 95 °C (makes DNA single stranded) ~55 - 60 °C (primers anneal to template DNA) 72 °C DNA polymerase copies DNA, starting from the

primers

A Thermocycler

This thermocycler can accept 1500 reactions at a time, and complete them in 2 to 4 hours.

AGCTAGCATGTTGCGCGTATCATGTACAGTGCATACGTCCCCTTAGCT| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | || | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |TCGATCGTACAACGCGCATAGTACATGTCACGTATGCAGGGGAATCGA

5’

3’ 5’

3’

AGCTAGCATGTTGCGCGTATCATGTACAGTGCATACGTCCCCTTAGCT| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |

5’ 3’

| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |TCGATCGTACAACGCGCATAGTACATGTCACGTATGCAGGGGAATCGA

3’ 5’

3’ 5’

AGCTAGCATGTTGCGCGTATCATGTACAGTGCATACGTCCCCTTAGCT| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | GTATG

5’ 3’

GTTGC | | | | || | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |TCGATCGTACAACGCGCATAGTACATGTCACGTATGCAGGGGAATCGA

3’

5’ 3’

5’

Heat 95° C(Denatures)

Add Specific PrimersCool to 55° C Cool. This allows specific

‘primers’ to anneal as shown

Principal of PCR

DNA (Double Stranded)

Heat Denature (Becomes Single Stranded)

Heat to 72 °C. Heat resistant DNA polymerase extends new

DNA from the primers

Heat to 72 °C

DNA Sequencing A specific primer binds to denatured DNA

Heat resistant DNA polymerase extends a new strand from this primer

Complementary nucleotides are added as appropriate

In the reaction are small quantities of coloured dideoxynucleotides Colours: ddTTP ddGTP ddATP ddCTP These prevent further additions (terminators)

Dideoxynucleotides

ddNTPs have no 3’ OH, so when added they cannot form thephosphodiester bond required to add the next nucleotide

DNA Sequencing ReactionThe reaction is boiled to make all the DNA single stranded and then the reaction is resolved on a long polyacrylamide or capillary gel in a DNA sequencer

Electropherogram of sequencing gel

Decoding DNA sequence data

Genotyping

Genotyping includes a variety of techniques that are used to identify the

primary localization and mapping of genes implicated in human diseases.

• Polymorphisms (different forms of a gene) may be present in coding and non-coding regions of a gene.

• Polymorphisms may influence gene regulation in response to nutrients

Primer Extension TheorySNP Analysis - primer extension theory

SNP Analysis