Upload File

m huch et al. nature 000 , 1-4 (2013) doi:10.1038/nature11826

  • Home
  • Documents
  • M Huch et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11826
1
M Huch et al. Nature 000, 1-4 (2013) doi:10.1038/nature11826 Liver damage induces Lgr51 + bipotential liver progenitors.

Upload: zahi

Post on 18-Jan-2016

26 views

Category:

Documents


4 download

Report

Tags:

DESCRIPTION

Liver damage induces Lgr51 + bipotential liver progenitors. M Huch et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11826. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: M Huch et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11826

M Huch et al. Nature 000, 1-4 (2013) doi:10.1038/nature11826

Liver damage induces Lgr51+ bipotential liver progenitors.

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

GI Motility online (May 2006) | doi:10.1038/gimo48

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

DOI: 10.1038/ncomms1280 molecular dynamics of single

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

GI Motility online (May 2006) | doi:10.1038/gimo6

GI Motility online (May 2006) | doi:10.1038/gimo12

DOI: 10.1038/NPHYS3211 Supplementary Information for

doi:10.1038/nature12886 Neanderthal from the Altai

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature Biotechnology: doi:10.1038/nbt

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

17 September 2009 doi:10.1038/nature08355 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo31

Published in Nature Materials (2016) doi:10.1038/nmat4569

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

GI Motility online (May 2006) | doi:10.1038/gimo46

doi:10.1038/nature05202 LETTERS

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112