M B G 8 6 8 0Rui Pires Martins PhD Candidate, CMMG

computer applications in molecular genetics

before we start…

• changes to .login file?

• created two directories in genetics• “traces”• “class” (or something??)

• transferred a copy of files to “class”• by wsFTP or through Windows

Mgb8680 | DNA sequencing

• DNA sequencing• chromatogram/trace data• chromas v.1.45• staden suite

• preGAP4• GAP4• trev• spin

Mgb8680 | DNA sequencing

outline

Mgb8680 | DNA sequencing

DNA sequencing jargon

• read a DNA sequence

• trace a chromatographic representation of DNA sequencing data

• contiguous sequence several reads with common spans joined together

• consensus the resulting sequence from several contigs that overlap

• template “sense” strand

• complement “anti-sense” strand

5’ ATTGGAGATCCGACTAATCCA 3’3’ TAACCTCTAGGCTGATTAGGT 5’

Mgb8680 | DNA sequencing

DNA sequencing

AGTCTCAG

Mgb8680 | DNA sequencing

fluorescent DNA sequencing

• each nucleotide is colour coded• “good” sequence reads have well-defined peaks

Mgb8680 | DNA sequencing

sequence traces

Mgb8680 | DNA sequencing

sequence traces

• “bad” sequence isn’t so pretty and requires some practise to learn to “call”

• if two peaks overlap, largest peaks “wins”, unless the peak encompasses more than one residue

• “bad” sequence REQUIRES CONFIRMATION

A A T T A T G T A A A T T

Mgb8680 | DNA sequencing

Chromas v.1.45• basic chromatogram/trace reading/viewing

programme for ab1 and scf files• freeware, works in Windows environments• some limited editing capabilities

• examples: forward.ab1 & reverse.ab1• Compare to forward.seq and reverse.seq

Mgb8680 | DNA sequencing

Staden Suite

Mgb8680 | DNA sequencing

Staden suite• very comprehensive suite of programmes for

sequence analysis, manipulation and assembly• (was?) free to academics• preGAP4 processes/manipulates raw data prior

to assembly• GAP4 (genome assembly) assembles/

manipulates processed reads into contigs; analyzes sequence integrity; organizes sequencing projects

• trev trace viewing programme; can be used along GAP or on its own.

Mgb8680 | DNA sequencing

Staden suite• examples: lb3.ab1, lb4.ab1, ub3l.ab1,

ub3lup.ab1, ub4.ab1, ubml.ab1, ubmup.ab1• vector file: pBSK+antisense5to3

• you will learn to read these files into preGAP4; process them; then assemble the files into a contig using GAP4.

• trev will be used to edit the sequence reads• you will also learn to produce a finished

sequence file that could be submitted to GenBank

Mgb8680 | DNA sequencing

assignment1. Finish the assembly of the 7 files into as long a contig as you can generate. Be

sure to edit any sequence ambiguities as you go. Submit a final text file (fastA format) with this sequence.

2. Repeat the assembly. Only this time, shotgun all 7 files at once. What happened? Are there any advantages to the manual process? (HINT: you’ll have to create a new database in Staden to do this)

3. Use one of the trace readers/editors to edit the following residues from reverse.ab1

270 280 290 300

GCCCCTACACTCGNNNGCCTGCCCGCCTCTCAA4. Assemble the forward.ab1 and reverse.ab1 files into a staden reads database.

What is different this time (i.e. do you notice any annotations or tagged regions in the contigs; and if so what?) What advantages can you see to tagging these regions before you try to assemble them?

email answers as text to rui@wayne.edu by Sunday night

help/questions can also be directed to rui@wayne.edu or through

MSN messenger (mutatethis@hotmail.com)