lsm1102_tutorial questions on dna replication

2
Tutorial questions on DNA replication 1. If a strain of bacteria was making too much DnaA protein, how would you expect this to affect its ability to regulate DNA replication? With regard to the number of chromosomes per cell, how might this strain differ from a normal bacterial strain? 2. To synthesize DNA in vitro, single-stranded DNA can be used as a template. You need to add DNA polymerase, dNTPs (deoxynucleotides), and a primer in order to synthesize a complementary strand of DNA. The primer can be a short sequence of DNA or RNA. The primer must be complimentary to the template DNA. Let’s suppose a single-stranded DNA molecule is 46 nucleotide long and has the following sequence: GCCCCGGTACCCCGTAATATACGGGACTAGGCCGGAGGTCCGGGCG The template DNA is mixed with a primer with the sequence 5’-cgcccggacc-3’, DNA polymerase and dNTPs. In this case, a double stranded DNA molecule is made. Q1. Which is the 5’ end? Q2. What is the sequence of the complimentary strand? Q3. If 5’-gccccggtac-3’ is used as the primer, can this primer be used to replicate this single-stranded DNA? Q4. If 5’-cgccccctgg-3’ is used as the primer, can this primer be used to replicate this single-stranded DNA? 3. If telomerase activity is disrupted in a cell, what do you expect?

Upload: givena2ndchance

Post on 06-Mar-2015

46 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: LSM1102_Tutorial Questions on DNA Replication

Tutorial questions on DNA replication 1. If a strain of bacteria was making too much DnaA protein, how would you expect this to affect its ability to regulate DNA replication? With regard to the number of chromosomes per cell, how might this strain differ from a normal bacterial strain? 2. To synthesize DNA in vitro, single-stranded DNA can be used as a template. You need to add DNA polymerase, dNTPs (deoxynucleotides), and a primer in order to synthesize a complementary strand of DNA. The primer can be a short sequence of DNA or RNA. The primer must be complimentary to the template DNA. Let’s suppose a single-stranded DNA molecule is 46 nucleotide long and has the following sequence: GCCCCGGTACCCCGTAATATACGGGACTAGGCCGGAGGTCCGGGCG The template DNA is mixed with a primer with the sequence 5’-cgcccggacc-3’, DNA polymerase and dNTPs. In this case, a double stranded DNA molecule is made. Q1. Which is the 5’ end? Q2. What is the sequence of the complimentary strand? Q3. If 5’-gccccggtac-3’ is used as the primer, can this primer be used to replicate this single-stranded DNA? Q4. If 5’-cgccccctgg-3’ is used as the primer, can this primer be used to replicate this single-stranded DNA? 3. If telomerase activity is disrupted in a cell, what do you expect?

Page 2: LSM1102_Tutorial Questions on DNA Replication

4. If the below DNA molecule is replicated in a solution of 32P-labeled CTP, will both daughter molecules be radioactive? 5’-GGGGGGGG-3’ 3’-CCCCCCCC-5’ What about the below DNA molecule?

5’-GGGCGGGG-3’ 3’-CCCGCCCC-5’ 5. RNA viruses such as SARS and HIV viruses have been causing a lot of problems for human being. One reason is that the drugs developed previously are not always effective against the current viruses. Please explain why.