Pf

ADL

a

ARRAA

KIPAM

1

zobmpimmmstmaaeias

S

h0

Molecular & Biochemical Parasitology 213 (2017) 16–21

Contents lists available at ScienceDirect

Molecular & Biochemical Parasitology

almitoylation of Plasmodium alveolins promotes cytoskeletalunction

nnie Z. Tremp 1, Fatimah S. Al-Khattaf 1,2, Johannes T. Dessens ∗

epartment of Pathogen Molecular Biology, Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street,ondon WC1E 7HT, UK

r t i c l e i n f o

rticle history:eceived 11 November 2016eceived in revised form 8 February 2017ccepted 15 February 2017vailable online 20 February 2017

a b s t r a c t

S-palmitoylation is a post-translational lipid modification that is widespread among Plasmodium proteinsand essential for parasite development. Little is known about the contribution of palmitoylation to thefunction of individual parasite molecules and structures. Alveolins are major components of the subpel-licular network (SPN), a cortical cytoskeleton primarily involved in providing mechanical strength to the

eywords:ntermediate filamentlasmodium bergheicyl-biotin exchangeotility

cell. We show here that the alveolin IMC1c is palmitoylated on a conserved cysteine motif, and that non-palmitoylated IMC1c displays normal expression, stability and trafficking. However, mutant parasitesexhibit reduced osmotic stress resistance and tensile strength. These findings support the hypothesisthat alveolin palmitoylation enhances cytoskeletal function by strengthening the connection betweenthe SPN and the adjoining inner membrane complex via lipid anchoring.

© 2017 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY license

. Introduction

Three invasive life stages: the ookinete, sporozoite and mero-oite, feature among the many different developmental formsf the malaria parasite. These so-called ‘zoites’ are characterisedy having specialised secretory organelles (e.g. rhoptries andicronemes) as well as a specialised cortical structure termed the

ellicle, both of which are adaptations required for their motile andnvasive properties. A double membrane structure termed the inner

embrane complex (IMC) situated directly underneath the plasmaembrane defines the pellicle [1–3]. In addition, a network of inter-ediate filaments termed the subpellicular network (SPN), which

upports the pellicle membranes and provides mechanical strengtho the cell [4], is located on the cytoplasmic face of the IMC. The

ain components of the SPN include a family of proteins termedlveolins [4,5]. In the genus Plasmodium, 13 conserved and synteniclveolin family members have been identified that are differentiallyxpressed among the three zoites stages [6,7]. It has been shown

n the rodent malaria species Plasmodium berghei that disruption oflveolins is accompanied by reduced tensile strength of the zoitetages in which they are expressed [5,7–10]. Plasmodium alveolins

∗ Corresponding author.E-mail address: Johannes.Dessens@lshtm.ac.uk (J.T. Dessens).

1 These authors contributed equally.2 Current address: Department of Infection Control, College of Medicine, King

aud University, Riyadh, Saudi Arabia.

ttp://dx.doi.org/10.1016/j.molbiopara.2017.02.003166-6851/© 2017 The Author(s). Published by Elsevier B.V. This is an open access article

(http://creativecommons.org/licenses/by/4.0/).

have also been shown to have roles in parasite morphogenesis andgliding motility [5,8–10]. Alveolins are characterised by the pres-ence of one or more highly conserved domains composed of tandemrepeat sequences [6,11,12]. In addition to these conserved ‘alveolindomains’, a subset of the alveolins also possess conserved cysteinemotifs close to their amino- or carboxy-terminus, which are pre-dicted to act as substrates for post-translational S-palmitoylation[13,14].

S-palmitoylation is a post-translational thioester linkage of the16-carbon fatty acid palmitate to cysteine residues [15], a reactionthat is catalysed by palmitoyl-S-acyl-transferases (PATs). PATs areidentifiable from having a Asp-His-His-Cys (DHHC) motif withina cysteine-rich domain, and at least 12 distinct putative PAT-encoding genes have been identified in Plasmodium spp. [16].Localisation studies indicate that the subcellular distribution ofmany PATs is restricted to distinct compartments including endo-plasmic reticulum, IMC and rhoptries [16]. S-palmitoylation inPlasmodium affects over 400 proteins and is essential for devel-opment of liver, blood and mosquito stages of the parasite [17–20].However, little is known about the specific contributions of thislipid modification to the function of individual parasite proteins.Furthermore, most palmitoylation sites are poorly predictable.This study was aimed at investigating the potential contribu-tion of palmitoylation to the function of the alveolin IMC1c in

P. berghei (PbIMC1c; PBANKA 120200). PbIMC1c and its Plasmod-ium orthologues have a single conserved cysteine motif at theircarboxy-terminus that is predicted to act as a palmitoylation site

under the CC BY license (http://creativecommons.org/licenses/by/4.0/).

hemical Parasitology 213 (2017) 16–21 17

[piwS[

2

2

taw(2pmwrwbutwwr

2

wC(l1ttsdtPc

2

bsw1aaSelPama−aHi0

Fig. 1. Generation and genetic analyses of mCherry-tagged PbIMC1c parasite lines.A: Schematic diagram of the unmodified (parental) and modified (IMC1c/mCherry)imc1c alleles. The imc1c gene is indicated with coding sequence (wide grey bars) and5′ and 3′ untranslated regions (UTRs, narrow grey bars). Also indicated is the relativepositions of the terminal cysteine motif (asterisk), the mCherry module (mCh); thehDHFR selectable marker gene cassette (hdhfr); the XhoI site corresponding to thecysteine motif mutation in IMC1c/mCherry-Mutant 1; and primers used for diag-nostic PCR amplification (P1-P4). B: Amino acid sequences of the carboxy-terminalsequences of PbIMC1c in parasite lines IMC1c/mCherry-WT and IMC1c/mCherry-Mutant 1. The conserved cysteines are marked in bold. C: PCR with primers P3and P4 across the 5′ integration site diagnostic for the presence of the mCherry-tagged pbimc1c alleles (top panel), and PCR with primers P1 and P2 diagnostic forthe presence/absence of the unmodified pbimc1c allele (bottom panel), carried outon genomic DNA from clonal populations of parasite line IMC1c/mCherry-Mutant

A.Z. Tremp et al. / Molecular & Bioc

13]. In Plasmodium falciparum, the protein was detected in thealmitoylated proteome of asexual blood stages [20] indicating that

t is indeed palmitoylated. PbIMC1c is expressed in all three zoiteshere it displays a cortical localisation consistent with that of the

PN, and is essential for asexual blood stage parasite development21].

. Materials and methods

.1. Animal use

All laboratory animal work was subject to ethical review byhe London School of Hygiene and Tropical Medicine, and waspproved by the United Kingdom Home Office. Animal experimentsere carried out in accordance with the United Kingdom Animals

Scientific Procedures) Act 1986 implementing European Directive010/63 for the protection of animals used for experimental pur-oses. Experiments were conducted in 6–8 weeks old female CD1ice, specific pathogen free and maintained in filter cages. Animalelfare was assessed daily and animals were humanely killed upon

eaching experimental or humane endpoints. Mice were infectedith parasites by intraperitoneal injection, or by infected mosquito

ite on anaesthetised animals. Parasitemia was monitored reg-larly by collecting of a small drop of blood from a superficialail vein. Drugs were administered by intraperitoneal injection orhere possible were supplied in drinking water. Parasitised bloodas harvested by cardiac bleed under general anaesthesia without

ecovery.

.2. Generation of transgenic parasite lines

Plasmid pLP-IMC1c/mCherry [21] was PCR-amplifiedith primers IMC1C-mut1-F (CTCGAGACAGGTA-

ATGGAGAAGCTTAGGGGCCCTC) and IMC1C-Mut1-RCCATGTACCTGTCTCGAGTCCAACTGGTTTAGCTTCTTCA) and circu-arised by in-fusion to give plasmid pLP-IMC1c/mCherry-Mutant. The site-directed mutagenesis was designed to substitute thehree conserved cysteine residues at the carboxy terminus, and athe same time to introduce a diagnostic XhoI restriction site at theite of the mutation (Fig. 1AB). The resulting targeting vector wasigested with KpnI and SacII to remove the plasmid backbone prioro transfection of purified P. berghei schizonts as described [21].yrimethamine-resistant parasites were selected and dilutionloned to give parasite line IMC1c/mCherry-Mutant 1.

.3. Palmitoylation assay

Infected blood was harvested and parasites purified by redlood cell lysis, followed by three washes in phosphate bufferedaline (PBS, pH 7.4) to remove cellular debris. Parasite pelletsere dissolved in lysis buffer (50 mM Tris–HCl pH 7.2, 1% SDS,× protease inhibitor cocktail (PI, Sigma), 5 mM EDTA, 1 mM TCEP)nd then treated with 40 mM N-ethylmaleimide (NEM) overnightt 4 ◦C with nutation to block free cysteines. The following dayDS, TCEP and NEM were removed from the samples by bufferxchange on Zeba spin desalting columns (Thermo Scientific) equi-ibrated with hydroxylamine (HAM) buffer (1× PBS pH7.4, 1×I, 5 mM EDTA). Each sample was divided into two equal partsnd to each was added an equal volume of HAM buffer supple-ented with 2 mM EZ-link HPDP-biotin (Thermo Fisher Scientific)

nd either 100 mM HAM (labelled +HAM) or no HAM (labelledHAM). Samples were incubated 2 h at room temperature to

llow palmitate-biotin exchange, after which HAM and unboundPDP-biotin were removed by buffer exchange on Zeba spin desalt-

ng columns equilibrated with HAM buffer supplemented with.1% Triton X-100. Streptavidin-agarose suspension (Sigma) was

1 (lane 1), IMC1c/mCherry-WT (lane 2) and parental parasites (lane 3). D: XhoIrestriction enzyme digestion of the PCR amplicon from C, diagnostic for the pres-ence/absence of the carboxy-terminal cysteine motif mutation.

added and the mixture incubated for 1 h at room temperaturewith nutation to allow binding to and subsequent pulldown ofthe biotinylated protein fraction. Agarose beads were collectedby centrifugation, twice washed with HAM buffer plus 1% Tri-ton X-100, and finally resuspended in an equal volume of 2x SDSpolyacrylamide gel electrophoresis sample buffer supplementedwith 1% �-mercaptoethanol to release biotinylated protein fromthe streptavidin-agarose beads. Samples were heated at 70 ◦C for10 min prior to fractionation through NuPage 4–12% Bis-Tris pre-cast gels (Invitrogen).

2.4. Ookinete size measurements (footprint method)

We recently developed the footprint method for sporozoites toenable a quantitative determination of sporozoite size indepen-dent of cell shape that is easy to standardise [13]. This method wasadapted here for ookinetes. Briefly, thin films of purified, cultured

ookinetes were made on glass microscope slides and air dried. Aftermethanol fixation, Giemsa-stained images of cells were capturedby microscopy on Zeiss LSM510 inverted laser scanning confocalmicroscope. Subsequently, using Zeiss LSM image browser soft-

1 hemic

wta

2

0bcciOiwvas

3

3d

I(ocrt(ssGTci(prwaPGGfc

ndmICsitpbtectoM

8 A.Z. Tremp et al. / Molecular & Bioc

are the circumference of individual ookinetes was measured, andhe surface area occupied (i.e. the footprint) calculated. Statisticalnalysis was carried out using two-tailed t-test.

.5. Hypo-osmotic shock and cell viability assay

Ookinetes in PBS were subjected to hypo-osmotic shock of.5 × PBS by adding an equal volume of water, or of 0.4 × PBSy adding 1.5 volumes of water. After 5 min, normal osmoticonditions were restored by adding an appropriate amount of con-entrated PBS. Cell viability was scored by fluorescence microscopyn the presence of 0.5% propidium iodide and 1% Hoechst 33258.okinetes whose nucleus stained positive for both propidium

odide and Hoechst were scored as non-viable, whereas ookineteshose nucleus only stained positive for Hoechst were scored as

iable. At least one hundred ookinetes were scored per treatment,nd all values were normalised for cell death before hypo-osmotichock.

. Results

.1. The cysteine motif of IMC1c is dispensable for parasiteevelopment

Parasite line IMC1c/mCherry-WT, which expresses full-lengthMC1c fused to a carboxy-terminal red fluorescent proteinmCherry variant), was generated by double crossover homol-gous recombination (Fig. 1A). To study the function of thearboxy-terminal cysteine motif of PbIMC1c and its predictedole as a palmitoylation site, a specific mutation substitutinghe three cysteines was introduced by site-directed mutagenesisFig. 1B). The mutation introduced a diagnostic XhoI restrictionite at the same time. Diagnostic PCR across the 5′-integrationite with primers IMC1c-long5′UTR-F (P3) (GGCTCTCAAATTCTTG-AAG) and pDNR-mCherry-R (P4) (AACGGGATCTTCTAGTTACTTG-ACAGCTCGTCCATGC) gave rise to a 4.5 kb product, as was thease for the corresponding IMC1c/mCherry-WT line, demonstrat-ng correct integration of the modified allele into the imc1c locusFig. 1C, top panel). Moreover, the PCR product amplified fromarasite line IMC1c/mCherry-Mutant 1 possessed the unique XhoIecognition sequence confirming that the cysteine motif mutationas indeed present (Fig. 1D). The absence of the wildtype imc1c

llele in the transgenic parasite lines was confirmed by diagnosticCR with primers pDNR-IMC1c-F (P1) (ACGAAGTTATCAGTCGACG-TACCAAGTGCATTTAGTATGTTGTGGC) and IMC1c-3′R (P2) (TTA-AGCCGATTTTATCTTGTTACAC), amplifying an expected 2.3 kb

ragment from unmodified parental parasites, but not from thelonal transgenic IMC1c/mCherry lines (Fig. 1C, bottom panel).

Parasite lines IMC1c/mCherry-WT and Mutant 1 developedormally in the mouse and when examined by UV microscopyisplayed red fluorescence in the asexual blood stages andacrogametocytes similar to that reported for parasite line

MC1c/GFP that expresses GFP-tagged IMC1c [21] (data not shown).onsistent with this observation, western blot analysis of bloodtage parasites of both parasite lines using anti-mCherry antibod-es revealed a strong band of approximately 60 kDa, correspondingo the IMC1c::mCherry fusion proteins (Fig. 2A). In the mosquito,arasite line IMC1c/mCherry-Mutant 1 developed normally andased on visual assessment was indistinguishable from its wild-ype counterpart in terms of ookinete and sporozoite shape, IMC1cxpression level and distribution (Fig. 2B). Fluorescence was con-

entrated at the cortex of the zoites consistent with a localisation inhe SPN (Fig. 2B). Both parasite lines formed comparable numbersf oocysts (mean ± sem 30 ± 13 for IMC1c/Mcherry-WT; 31 ± 9 forutant 1; P = 0.97; n = 20) and were readily transmitted to naive

al Parasitology 213 (2017) 16–21

mice by sporozoite-infected mosquito bite. These results demon-strate that the carboxy-terminal cysteine motif of PbIMC1c isdispensable for parasite development in the mouse and mosquito.

3.2. IMC1c is palmitoylated on its carboxy-terminal cysteinemotif

Palmitoylation of IMC1c was assessed biochemically using amodification of the acyl-biotin exchange method [22]. Westernanalysis using anti-mCherry antibodies detected IMC1c::mCherrysignal in the HAM-treated IMC1c/mCherry-WT sample that wasmarkedly stronger than in the HAM-negative control relative topre-pulldown signals (Fig. 2C). In the absence of HAM, palmitate-biotin exchange does not occur, and thus the increased signalin the HAM-positive sample indicates that PbIMC1c is palmitoy-lated (the signal in the HAM-negative sample is likely the resultof some incomplete blocking of free cysteine residues by the ear-lier NEM treatment). In the IMC1c/mCherry-Mutant 1 samples,IMC1c::mCherry signals were barely detectable in either −HAMand +HAM treatments (Fig. 2C). Collectively, these results providebiochemical evidence that PbIMC1c is palmitoylated on its carboxy-terminal cysteine motif.

3.3. Palmitoylation of IMC1c enhances cytoskeletal function

Although parasite development of Mutant 1 in host and vec-tor was indistinguishable from that of its wildtype counterpart,the demonstrated involvement of alveolins in motility and ten-sile strength provision prompted us to test whether a phenotypemight be associated with any of these properties. This was carriedout with cultured ookinetes, which are easily accessible and forwhich reliable motility and tensile strength assays exist [8,9,23].No detectable differences in parasite locomotion were observed:ookinete motility through Matrigel was comparable between thetwo parasite lines (mean ± sem 31.7 ± 3.3 �m per 10 min for WT;33.8 ± 1.6 �m for Mutant 1; n = 20; t-test P = 0.68). Moreover,ookinetes from both lines displayed a meandering movement typ-ical of helical gliding as described [10].

To assess ookinete tensile strength, cells were subjected tohypo-osmotic conditions, which forces the cells to draw in waterand swell. The ability to withstand hypo-osmotic shock is routinelyused as a relative measure of tensile strength [24], based on thefact that cells with reduced tensile strength swell more leading toincreased cell death. Under normal osmotic conditions (1.0 × PBS),the mean size of ookinetes as determined by our footprint assaywas indistinguishable between IMC1c/mCherry-WT and Mutant1 parasites (mean ± sem 28.7 ± 0.63 �m2 for IMC1c/Mcherry-WT;29.1 ± 0.55 �m2 for Mutant 1; n = 30; P = 0.67), confirming ourobservations of live cells (Fig. 2B). Ookinete size increased signifi-cantly (P < 0.0001) upon hypo-osmotic exposure (0.5 × PBS) in bothparasite lines (mean ± sem 34.6 ± 0.56 �m2 for IMC1c/Mcherry-WT; 36.3 ± 0.61 �m2 for Mutant 1; n = 30), reflecting the uptakeof water by the cells (Fig. 3A). Compared to the control par-asite, Mutant 1 ookinetes displayed a greater and statisticallysignificant size increase (P < 0.05) under these hypo-osmotic con-ditions, pointing to a reduction in their tensile strength. Indeed,this notion was supported by measurements of ookinete viabil-ity after hypo-osmotic shock: Exposure of cultured ookinetes for5 min to 0.5 × PBS caused 22% cell death in the control parasiteline IMC1c/mCherry-WT, which increased to approximately 31%in parasite line IMC1c/mCherry-Mutant 1 (Fig. 3B). More strin-gent hypo-osmotic shock (5 min exposure to 0.4 × PBS) resulted

in higher, approximately 55% cell death in control parasites thatincreased to approximately 67% in Mutant 1 parasites (Fig. 3B).When expressed as a percentage of the control parasite values,Mutant 1 displayed on average 27% higher sensitivity in response

A.Z. Tremp et al. / Molecular & Biochemical Parasitology 213 (2017) 16–21 19

Fig. 2. Phenotypic analyses of mCherry-tagged PbIMC1c parasite lines. A: Western blot using anti-mCherry antibodies of blood stage parasites from parasite lineIMC1c/mCherry-WT (WT) and IMC1c/mCherry-Mutant 1 (M1). Positions of molecular weight markers (PageRulerTM Prestained Protein Ladder +) are shown on the righthand side. B: Confocal fluorescence and brightfield images of ookinetes (top), sporulating oocysts (middle) and sporozoites (bottom) of parasite lines IMC1a/mCherry-WTa -sectio fter acb

tfrs

4

(tfikt

nd Mutant 1. White square marks an area of the oocyst showing transversally crossf blood stage parasite lysates of parasite lines IMC1c/mCherry-WT and Mutant 1 aefore and after pull-down with streptavidin-agarose beads.

o hypo-osmotic shock (Fig. 3C). These statistically significant dif-erences in sensitivity were consistent across clones and biologicaleplicates, indicating that Mutant 1 ookinetes possess reduced ten-ile strength as a consequence of lacking IMC1c palmitoylation.

. Discussion

Cells possess broadly three types of cytoskeletal filaments:i) microfilaments, composed predominantly of actin; (ii) micro-

ubules, composed mainly of tubulin, and (iii) intermediatelaments (IFs). While metazoan proteins that form IFs (e.g. lamin,eratin, desmin) are structurally diverse, they share certain archi-ectural features, the most important among these being a helical

oned sporozoites (inset), clearly showing the cortical fluorescence. C: Western blotyl-biotin exchange in the absence (−HAM) or presence (+HAM) of hydroxylamine,

rod domain that is able to supercoil with the same domain inanother IF molecule to form a coiled-coil structure. Formation ofthe coiled-coil dimer is fundamental to the filamentous features ofthese molecules. The coiled-coiling properties of the helical domainare conferred at the primary structure level by heptad repeats:tandem repeats of seven amino acids in a specific arrangement,although variations on this theme are common. While cytoskele-tal IFs in metazoans, particularly in vertebrates, have long beenstudied, their existence in protists is not widely recognised. It isbecoming increasingly evident, however, that protists may pos-

sess novel types of IF proteins [25,26], with the caveat that directexperimental evidence for their IF-like properties is not currentlyavailable. Alveolins are an example of such novel putative IF pro-

20 A.Z. Tremp et al. / Molecular & Biochemical Parasitology 213 (2017) 16–21

Fig. 3. Sensitivity to hypo-osmotic shock of parasite lines IMC1c/mCherry-WT and IMC1c/mCherry-Mutant 1. A: Images of Giemsa-stained ookinetes in normal (1.0 × PBS)and hypo-osmotic (0.5 × PBS) conditions, showing swelling of the cells due to water uptake. B: Percentage ookinete survival after 5 min exposure to hypo-osmotic shock.A ormalised for cell death before hypo-osmotic shock. C: Bar chart of ookinete viabilitya site (IMC1c/mCherry-WT) value. Error bars represent standard error of the mean (n = 2).S

tpp

tTrIfdpwbtssatapttIttwmi[rripIoipaito[tTr

ab

Fig. 4. Model of alveolin synthesis, recruitment and assembly into the subpellicularnetwork of a Plasmodium zoite to form a functional cytoskeleton. Depicted is a sec-tion of a cell showing plasma membrane (dark blue) and cytoplasm (yellow). Thekey steps indicated are: (1) Synthesis of alveolin proteins (grey) in the cytoplasm.(2) Targeting of the alveolins to the inner membrane complex (light blue) via thealveolin domain, and assembly into intermediate filaments. (3) Addition of palmi-toyl lipid (red) to the alveolin by IMC-resident palmitoyl-acyl-transferase (green)and membrane anchoring. (4) Interaction with other alveolins (black) in response

t least one hundred ookinetes were scored per treatment, and all values were nfter hypo-osmotic shock (0.4 × PBS) expressed as a percentage of the control paratatistically significant differences (P < 0.05, t-test) are indicated (*).

eins, and this study sheds further light on their function, inarticular with regards to the contribution of post-translationalalmitoylation.

The results of this study confirm that the carboxy-terminal cys-eine motif of the alveolin IMC1c acts as a palmitoylation site.hey also highlight the fact that palmitoylation of IMC1c is notequired for protein stability, or for recruitment to the SPN andMC targeting (Fig. 2B). PbIMC1c contains no other predicted sitesor post-translational lipidation, indicating that its core alveolinomain is solely sufficient for IMC targeting. This contrasts withalmitoylation of the IMC sub-compartment proteins (ISPs), whichas shown to be necessary for correct IMC targeting of ISPs in

oth Toxoplasma gondii and P. falciparum [27,28]. In sharp con-rast to IMC1c, mutation of equivalent cysteine motifs in theporozoite-expressed alveolin IMC1a in P. berghei were recentlyhown to have a marked adverse effect on the protein’s stabilitynd, consequently, on parasite fitness [13]. What might explainhese differences? Using quantitative mass spectrometry, Jonesnd colleagues showed that palmitoylation of IMC1c in P. falci-arum blood stage parasites is highly sensitive to the presence ofhe palmitoylation inhibitor 2-bromopalmitate (2-BMP) [20]. Givenhat absence of palmitoylation does not result in degradation ofMC1c, as shown in this study, its sensitivity to 2-BMP could pointo a dynamic palmitoylation status involving cycles of palmitoyla-ion and depalmitoylation. Another explanation is that the inhibitoras present before IMC1c was palmitoylated. Given that PATs areembrane-spanning enzymes and alveolins reside in the SPN, it

s likely that alveolins are palmitoylated by IMC-resident PATs19,28]. Accordingly, palmitoylation would not occur until after SPNecruitment/IMC targeting of the alveolin. Contrary to IMC1a that isecruited to the SPN concomitant with pellicle formation [5], IMC1cs recruited late to the SPN after pellicle formation and zoite mor-hogenesis has happened [21]. By implication, palmitoylation of

MC1c in the blood stages would not take place until completionf cytokinesis in the schizonts, which could explain why 2-BMP

s so effective at blocking this step. In either scenario (extensivealmitoyl cycling or delayed palmitoylation), IMC1c would spend

considerable part of its lifetime in a non-palmitoylated state andt makes sense therefore that it should be stable in the absence ofhis lipid modification. Conversely, the markedly reduced stabilityf IMC1a in response to losing cysteine motifs/palmitoylation sites13] could be interpreted as the alveolin requiring a stable palmi-oylation status and being palmitoylated soon after its synthesis.he presence and importance of palmitoyl cycling in Plasmodium

emains to be determined.

We did not detect a phenotype of Mutant 1 parasites associ-ted with motility. The SPN supports gliding motility most likelyy tethering molecular motor components situated on the other

to palmitoylation. (For interpretation of the references to colour in this figure legend,the reader is referred to the web version of the article.)

side of the IMC via the GAPM proteins, a family of multi-pass mem-brane proteins that reside in the IMC and that interact with bothalveolins and molecular motor proteins [29]. The lack of a motil-ity phenotype combined with the apparent normal localisation ofIMC1c in Mutant 1 (Fig. 2B) suggests that connecting the glideo-some with the cytoskeleton can still take place efficiently in theabsence of IMC1c palmitoylation, although it cannot be ruled outthat a reduction in motility may have been too small to detect usingour assay. The absence of IMC1c palmitoylation in Mutant 1 alsodid not discernibly affect zoite shape. There are two likely reasonsfor this: First, zoite morphogenesis is concurrent with pellicle for-mation, and because IMC1c is recruited to the SPN after pellicleformation [21], IMC1c is unlikely to influence this process. Sec-ond, tensile strength reduction does not automatically affect zoitemorphogenesis, because these two processes are uncoupled [23].

Our findings did, however, reveal a role of IMC1c palmitoylationin mechanical strength (Fig. 3). Our data support the model thatthe SPN acts as an internal cytoskeletal basket that provides tensilestrength to the cell, and indicate that this function is enhanced bylipid anchoring the SPN into the IMC through alveolin palmitoy-lation (Fig. 4). A tight association of the SPN with the IMC coulddirectly enhance the tensile strength of the SPN, or alternativelyalveolin palmitoylation and membrane association could promoteinteractions with other alveolins and SPN components. This, in turn,could lead to increased SPN rigidity. In this context it is important

to note that palmitoylation is known to enhance protein interac-tions [15]. Cell rigidity of the ookinete is likely to be importantwhen it escapes the blood meal in the midgut lumen and crosses

hemic

tbildm

iafettswvwpobshsp

A

aeFb

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

Parasitol. 91 (1999) 362–366.[31] Y.S. Han, J. Thompson, F.C. Kafatos, C. Barillas-Mury, Molecular interactions

between Anopheles stephensi midgut cells and Plasmodium berghei: the time

A.Z. Tremp et al. / Molecular & Bioc

he peritrophic matrix and midgut epithelium, a process that haseen described to cause major cell constrictions [30,31]. Accord-

ngly, weakened ookinetes with reduced tensile strength could beess effective at these invasive processes, or more prone to damageuring it. The same could apply to sporozoites when they invadeosquito or human tissues.

Repeated failure to disrupt pbimc1c indicates that this alveolins essential for blood stage parasite development [21]. The lack of

strong phenotype for its cysteine mutant reported here there-ore implies that palmitoylation of this alveolin only marginallynhances protein function and contributes only a small fitness gaino the parasite. This suggests that the essential nature of palmi-oylation at a cellular level could be the result of accumulativemall fitness gains at a molecular level, which are relatively minorhen considered individually. With regards to tensile strength pro-

ision, the SPN contains multiple alveolins besides IMC1c, some ofhich may equally be palmitoylated [6,13]. While the removal of

almitoylation from one alveolin may have only a modest impactn SPN function, when palmitoylation of multiple alveolins werelocked the effect is likely to be more profound. This notion is con-istent with observations that parasite lines in which specific PATsave been disrupted, thus affecting palmitoylation of many sub-trate proteins at the same time, in many cases result in severehenotypes [17–19].

cknowledgements

This work was supported by the Wellcome Trust, Grants 076648nd 088449; the United Kingdom Biotechnology and Biological Sci-nces Research Council, Grant BB/M001598; and a Studentship toSA-K from the Cultural Bureau of the Royal Embassy of Saudi Ara-ia in London.

eferences

[1] L.H. Bannister, J.M. Hopkins, R.E. Fowler, S. Krishna, G.H. Mitchell, A briefillustrated guide to the ultrastructure of Plasmodium falciparum asexual bloodstages, Parasitol. Today 16 (2000) 427–433.

[2] N.S. Morrissette, L.D. Sibley, Cytoskeleton of apicomplexan parasites,Microbiol. Mol. Biol. Rev. 66 (2002) 21–38.

[3] J.M. Santos, M. Lebrun, W. Daher, D. Soldati, J.F. Dubremetz, Apicomplexancytoskeleton and motors: key regulators in morphogenesis, cell division,transport and motility, Int. J. Parasitol. 39 (2009) 153–162.

[4] T. Mann, C. Beckers, Characterization of the subpellicular network, afilamentous membrane skeletal component in the parasite Toxoplasma gondii,Mol. Biochem. Parasitol. 115 (2001) 257–268.

[5] E.I. Khater, R.E. Sinden, J.T. Dessens, A malaria membrane skeletal protein isessential for normal morphogenesis, motility, and infectivity of sporozoites, J.Cell Biol. 167 (2004) 425–432.

[6] F.S. Al-Khattaf, A.Z. Tremp, J.T. Dessens, Plasmodium alveolins possess distinctbut structurally and functionally related multi-repeat domains, Parasitol. Res.115 (2015) 631–639.

[7] I. Kaneko, S. Iwanaga, T. Kato, I. Kobayashi, M. Yuda, Genome-wideidentification of the target genes of AP2-O, a Plasmodium AP2-familytranscription factor, PLoS Pathog. 11 (2015) e1004905.

[8] A.Z. Tremp, E.I. Khater, J.T. Dessens, IMC1b is a putative membrane skeleton

protein involved in cell shape, mechanical strength, motility, and infectivityof malaria ookinetes, J. Biol. Chem. 283 (2008) 27604–27611.

[9] A.Z. Tremp, J.T. Dessens, Malaria IMC1 membrane skeleton proteins operateautonomously and participate in motility independently of cell shape, J. Biol.Chem. 286 (2011) 5383–5391.

al Parasitology 213 (2017) 16–21 21

10] K. Volkmann, C. Pfander, C. Burstroem, M. Ahras, D. Goulding, J.C. Rayner,et al., The alveolin IMC1h is required for normal ookinete and sporozoitemotility behaviour and host colonisation in Plasmodium berghei, PLoS ONE 7(2012) e41409.

11] S.B. Gould, W.H. Tham, A.F. Cowman, G.I. McFadden, R.F. Waller, Alveolins, anew family of cortical proteins that define the protist infrakingdom Alveolata,Mol. Biol. Evol. 25 (2008) 1219–1230.

12] H. El-Haddad, J.M. Przyborski, L.G. Kraft, G.I. McFadden, R.F. Waller, S.B. Gould,Characterization of TtALV2, an essential charged repeat motif protein of theTetrahymena thermophila membrane skeleton, Eukaryot. Cell 12 (2013)932–940.

13] F.S. Al-Khattaf, A.Z. Tremp, A. El-Houderi, J.T. Dessens, The Plasmodiumalveolin IMC1a is stabilised by its terminal cysteine motifs and facilitatessporozoite morphogenesis and infectivity in a dose-dependent manner, Mol.Biochem. Parasitol. 211 (2017) 48–56.

14] B.R. Anderson-White, F.D. Ivey, K. Cheng, T. Szatanek, A. Lorestani, C.J.Beckers, et al., A family of intermediate filament-like proteins is sequentiallyassembled into the cytoskeleton of Toxoplasma gondii, Cell. Microbiol. 13(2011) 18–31.

15] M.E. Linder, R.J. Deschenes, Palmitoylation: policing protein stability andtraffic, Nat. Rev. Mol. Cell Biol. 8 (2007) 74–84.

16] K. Frenal, C.L. Tay, C. Mueller, E.S. Bushell, Y. Jia, A. Graindorge, et al., Globalanalysis of apicomplexan protein S-acyl transferases reveals an enzymeessential for invasion, Traffic 14 (2013) 895–911.

17] J.M. Santos, J. Kehrer, B. Franke-Fayard, F. Frischknecht, C.J. Janse, G.R. Mair,The Plasmodium palmitoyl-S-acyl-transferase DHHC2 is essential for ookinetemorphogenesis and malaria transmission, Sci. Rep. 5 (2015) 16034.

18] J.M. Santos, N. Duarte, J. Kehrer, J. Ramesar, M.C. Avramut, A.J. Koster, et al.,Maternally supplied S-acyl-transferase is required for crystalloid organelleformation and transmission of the malaria parasite, Proc. Natl. Acad. Sci.U.S.A. 113 (2016) 7183–7188.

19] C.S. Hopp, A.E. Balaban, E. Bushell, O. Billker, J.C. Rayner, P. Sinnis, Palmitoyltransferases have critical roles in the development of mosquito and liverstages of Plasmodium, Cell. Microbiol. 18 (2016) 1625–1641.

20] M.L. Jones, M.O. Collins, D. Goulding, J.S. Choudhary, J.C. Rayner, Analysis ofprotein palmitoylation reveals a pervasive role in Plasmodium developmentand pathogenesis, Cell Host Microbe 12 (2012) 246–258.

21] A.Z. Tremp, F.S. Al-Khattaf, J.T. Dessens, Distinct temporal recruitment ofPlasmodium alveolins to the subpellicular network, Parasitol. Res. 113 (2014)4177–4188.

22] J. Wan, A.F. Roth, A.O. Bailey, N.G. Davis, Palmitoylated proteins: purificationand identification, Nat. Protoc. 2 (2007) 1573–1584.

23] A.Z. Tremp, V. Carter, S. Saeed, J.T. Dessens, Morphogenesis of Plasmodiumzoites is uncoupled from tensile strength, Mol. Microbiol. 89 (2013) 552–564.

24] A. Menke, H. Jockusch, Decreased osmotic stability of dystrophin-less musclecells from the mdx mouse, Nature 349 (1991) 69–71.

25] L. Koreny, M.C. Field, Ancient eukaryotic origin and evolutionary plasticity ofnuclear lamina, Genome Biol. Evol. 8 (2016) 2663–2671.

26] H. Preisner, E.L. Karin, G. Poschmann, K. Stuhler, T. Pupko, S.B. Gould, Thecytoskeleton of parabasalian parasites comprises proteins that shareproperties common to intermediate filament proteins, Protist 167 (2016)526–543.

27] J.R. Beck, I.A. Rodriguez-Fernandez, J. Cruz de Leon, M.H. Huynh, V.B.Carruthers, N.S. Morrissette, et al., A novel family of Toxoplasma IMC proteinsdisplays a hierarchical organization and functions in coordinating parasitedivision, PLoS Pathog. 6 (2010) e1001094.

28] J. Wetzel, S. Herrmann, L.S. Swapna, D. Prusty, A.T. John Peter, M. Kono, et al.,The role of palmitoylation for protein recruitment to the inner membranecomplex of the malaria parasite, J. Biol. Chem. 290 (2015) 1712–1728.

29] H.E. Bullen, C.J. Tonkin, R.A. O’Donnell, W.H. Tham, A.T. Papenfuss, S. Gould,et al., A novel family of Apicomplexan glideosome-associated proteins withan inner membrane-anchoring role, J. Biol. Chem. 284 (2009) 25353–25363.

30] K.D. Vernick, H. Fujioka, M. Aikawa, Plasmodium gallinaceum: a novelmorphology of malaria ookinetes in the midgut of the mosquito vector, Exp.

bomb theory of ookinete invasion of mosquitoes, EMBO J. 19 (2000)6030–6040.