5896

Abstract. – OBJECTIVE: To elucidate the function of long non-coding RNA (lncRNA) SN-HG1 in acute myeloid leukemia (AML) and to ex-plore its biological mechanism.

PATIENTS AND METHODS: Expression levels of lncRNA SNHG1 and miR-488-5p in AML cell lines pAML and THP-1 were determined by quan-titative Real Time-Polymerase Chain Reaction (qRT-PCR). Proliferative potential and cell cycle progression of pAML and THP-1 cells were de-tected after SNHG1 knockdown. Potential bind-ing sites of SNHG1 and miR-488-5p were pre-dicted by bioinformatics. Through RNA Binding Protein Immunoprecipitation (RIP) assay and lu-ciferase reporter gene assay, we evaluated the binding condition between SNHG1 and miR-488-5p. MiR-488-5p expression in pAML and THP-1 cells with SNHG1 knockdown was de-tected by qRT-PCR to further verify their inter-action. Subsequently, binding sites of NUP205 and miR-488-5p were predicted. Both mRNA and protein levels of NUP205 in pAML and THP-1 cells were examined. The regulatory effects of overexpressed NUP205 on proliferative poten-tial and cell cycle progression of pAML and THP-1 cells transfected with si-SNHG1 were explored by gain-of-function experiments.

RESULTS: LncRNA SNHG1 was highly ex-pressed in pAML and THP-1 cells, while miR-488-5p was lowly expressed. SNHG1 knock-down in pAML and THP-1 cells inhibited pro-liferative ability and arrested cell cycle in G0/G1 phase. Knockdown of SNHG1 markedly up-regulated the miR-488-5p expression in pAML and THP-1 cells. Furthermore, RIP and lucifer-ase reporter gene assay confirmed the bind-ing between SNHG1 and miR-488-5p. NUP205 was highly expressed in pAML and THP-1 cells at both mRNA and protein levels. Moreover, luciferase reporter gene assay indicated that NUP205 could bind to miR-488-5p. More impor-tantly, the overexpression of NUP205 in pAML and THP-1 cells reversed the inhibitory effect of SNHG1 knockdown on proliferative ability and cell cycle progression.

CONCLUSIONS: LncRNA SNHG1 promotes the development of AML through miR-488-5p/NUP205 axis.

Key Words:AML, LncRNA SNHG1, MiR-488-5p, NUP205, Pro-

liferation.

Introduction

Acute myeloid leukemia (AML) is the most common hematological tumor. Its main features are accumulation of a large number of leukemia cells caused by maturation disorders and differ-entiation blockage of hematopoietic stem cells. These pathological changes eventually lead to hematopoietic failure and poor prognosis. Dys-regulated signaling pathways in AML often re-sult from genetic mutations or abnormalities. Searching for specific biomarkers by exploring the molecular mechanism of AML helps to pre-cisely predict and select an appropriate treatment approach for AML patients1-3.

Human Genome Sequencing found that over 90% of human genome are non-coding RNAs (ncRNAs) and fewer than 2% are protein-coding genes4. The ncRNAs family can be classified into subtypes based on molecular size, structure and function. In recent years, miRNAs and lncRNAs have been extensively studied in the field of oncol-ogy as members of ncRNAs family. MiRNAs are short, non-coding RNAs with typically 19-25 nt in length. LncRNAs are long non-coding RNAs, and usually contain more than 200 nt in length. Several studies have focused on ncRNAs-me-diated regulation of protein-coding genes. Re-searches have demonstrated that ncRNAs are

European Review for Medical and Pharmacological Sciences 2019; 23: 5896-5903

X.-L. BAO, L. ZHANG, W.-P. SONG

Department of Neonatology, Weinan Maternal and Child Health Hospital, Weinan, China

Corresponding Author: Wenping Song, BM; e-mail: songwenping12354@163.com

LncRNA SNHG1 overexpression regulates the proliferation of acute myeloid leukemia cells through miR-488-5p/NUP205 axis

LncRNA SNHG1 regulates AML

5897

capable of forming a precise interactional regula-tion network. The competitive endogenous RNA (ceRNA) theory suggests that a large number of ncRNAs may interact with miRNAs, providing a new regulatory mechanism at post-transcription-al level5,6. Abnormally expressed ncRNAs are also found in tumors, suggesting the significant roles of ncRNAs in tumor development7,8.

LncRNA SNHG1 locates at 11p12.3 with 1134 bp in length. Its intron contains 8 nucleolar small RNA host genes (SNORD22 and SNORD25-31)9. SNHG1 is abnormally highly expressed in lung cancer, liver cancer, and neuroblastoma tissues, showing a negative correlation with disease prog-nosis. SNHG1 can target on several anti-tumor miRNAs, such as miR-338, miR-195, miR-101-3p. SNHG1 promotes the occurrence and progression of esophageal cancer, hepatocellular carcinoma, and non-small cell lung cancer9-11. SNHG1 serves as an oncogene in these tumors. In this work, we studied the role of lncRNA SNHG1 in AML and explored its underlying mechanism.

Patients and Methods

Isolation of Primary AML Cells5-10 mL of peripheral blood was collected from

AML patients after they signed the informed con-sent for voluntarily participating in this study. Peripheral blood was treated with EDTA2 anti-coagulant. Mononuclear cells were separated by Ficoll separation solution, and washed twice with phosphate-buffered saline (PBS). Through mag-netic bead sorting method (Miltenyi Biotec Gm-bH, Bergisch Gladbach, Germany), CD3+ cells were removed. The signed written informed con-sents were obtained from all participants before the study. This investigation has been approved by the Ethics Committee of Weinan Maternal and Child Health Hospital.

Cell Culture and Transfection pAML and THP-1 cells were cultured in

high-glucose Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Rockville, MD, USA) contain-ing 10% fetal bovine serum (FBS; Gibco, Rock-ville, MD, USA) at 37°C under 5% CO2. Medium was changed once other day. Cells in logarithmic growth phase were seeded in 6-well plates at 1×106 cells/mL one day prior to transfection. Un-til 50-60% of confluence, cells were transfected with 50 nmol/L si-SNHG1-1, si-SNHG1-2, si-SN-HG1-3, miR-488-5p inhibitor or NUP205 over-

expression plasmid using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Medium was replaced 6 h later. At 48 h, transfected cells were harvested for the following experiments.

RNA Extraction and Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR)

Cellular RNA was extracted according to the instructions of TRIzol (Invitrogen, Carlsbad, CA, USA). RNA samples with the concentration of 100-500 ng/μL and 1.9-2.1 of A260/280 nm were considered as qualified and preserved at -20°C. RNA was reversely transcribed into complemen-tary deoxyribose nucleic acid (cDNA) according to the instructions of the reverse transcription kit. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was utilized as the internal reference for SNHG1 and NUP205, whereas U6 was the internal reference for miR-488-5p. Relative levels of SNHG1, NUP205, and miR-488-5p were deter-mined using the SYBR Green method. Three rep-licate wells were set in each sample to ensure that the Ct difference in three replicates of each sample was lower than 0.5. QRT-PCR conditions were: Pre-denaturation at 95°C for 5 min; 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s, for a total of 35 cycles. Expression level was calculated by 2-ΔΔCt method. The primer sequences were as follows: LncRNA SNHG1, F: CAGAACCCAAACTCAG-GCAC, R: GAAGAGCAAGGCCCTGAATG; NUP205, F: GAAACTTCTGGACATTGAAG-GA, R: TGAGGATGGAACTAGGGGAAG; GAPDH, F: CGCTCTCTGCTCCTCCTGTTC, R: ATCCGTTGACTCCGACCTTCAC; MiR-488-5p, F: ACACTCCAGCTGGGTAGCAGCA-CATCATGG, R: TGGTGTCGTGGAGTCG; U6, F: GCTTCGGCAGCACATATACTAAAAT, R: CGCTTCAGAATTTGCGTGTCAT.

Cell Proliferation Assay Cells after transfection for 48 hours were sus-

pended in 2 mL of complete medium. Cells were seeded in 96-well plates at a density of 5,000 cells per well, with 5 replicate wells in each group. 10 μL of cell counting kit-8 (CCK-8) reagent (Dojin-do Laboratories, Kumamoto, Japan) was added at 0, 1 d, 2 d, and 3 d, respectively. About 1 h later, the absorbance at 450 nm was recorded and pro-liferative rate was calculated.

Cell Cycle Determination

Cells transfected for 48 h were fixed in 75% ice ethanol at -20°C overnight. The fixed cells

X.-L. Bao, L. Zhang, W.-P. Song

5898

were centrifuged, and the precipitate was washed twice with 1 mL of pre-cooled phosphate buffer. The resuspended cells were then incubated with 150 μL of RNase A and digested in 37°C water bath for 30 min, followed by incubation with 100 μL of Propidium Iodide (PI) in ice water bath for 30 min in the dark. Cell cycle progression was finally determined using flow cytometry and an-alyzed using Fow Jo analysis software.

Western Blot Total protein was extracted using the cell ly-

sate for determining protein expression. After the total protein was quantified by bicinchoninic acid (BCA; Pierce, Rockford, IL, USA), the sample was separated by 10% Sodium Dodecyl Sul-phate-Polyacrylamide Gel Electrophoresis (SDS-PAGE). The transferred polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA, USA) was blocked with 5% skim milk. Mem-branes were then incubated with the primary antibody and corresponding secondary antibody. Band exposure was developed by enhanced che-miluminescence (ECL) assay.

RNA Binding Protein Immunoprecipitation

The RIP assay was performed according to the procedure of the RNA-Binding Protein Im-munoprecipitation Kit (Millipore, Billerica, MA, USA). After cell lysis, 100 μL of the cell extract was incubated with RIP buffer containing mag-netic beads of AGO2 antibody (Abcam, Cam-bridge, MA, USA) or IgG antibody (Millipore, Billerica, MA, USA) at 4°C for 6 h. After eluting the magnetic beads, the complex was incubated in 0.1% SDS/0.5 mg/mL proteinase K at 55°C for 30 min in order to remove proteins. RNA was quantified using NanoDrop (Thermo Scientific, Waltham, MA, USA) and purified using a bioana-lyzer (Agilent, Santa Clara, CA, USA). QRT-PCR was performed after isolation and purification of immunoprecipitated RNA.

Dual-Luciferase Reporter Gene AssayPotential target sites of miR-488-5p were

predicted by Targetscan, miRanda, and Pictar. Wild-type or mutant-type sequences of SNHG1 3’UTR and NUP205 3’UTR were inserted into the pGL3 promoter vector, respectively. Cells were co-transfected with miR-488-5p mimic or negative control and wild-type or mutant-type sequences. At 48 hours, luciferase activity was

determined using the dual-luciferase reporter as-say kit (Promega, Madison, WI, USA). The ex-periment was repeated for three times.

Statistical AnalysisData analysis was performed using Statistical

Product and Service Solutions (SPSS) 22.0 (IBM, Armonk, NY, USA). The Student’s t-test was used for analyzing the measurement data. All measurement data were expressed as mean±SD (Standard Deviation). The difference was statisti-cally significant at p<0.05.

Results

LncRNA SNHG1 Remained a High Expression in AML cells

QRT-PCR was used to detect the expressions of SNHG1 and miR-488-5p in pAML and THP-1 cells. The results indicated that SNHG1 was highly expressed in pAML and THP-1 cells (Fig-ure 1A), while miR-488-5p was lowly expressed (Figure 1B). To further elucidate the potential mechanism of SNHG1 in regulating AML de-velopment, three SNHG1 interference sequenc-es (si-SNHG1-1, si-SNHG1-2, si-SNHG1-3) were constructed. As qRT-PCR data revealed, all three interference sequences could markedly downreg-ulated SNHG1 expression in leukemia cells (Fig-ure 1C, 1D). Among them, si-SNHG1-3 exerted the most efficient transfection efficacy and was utilized for the following experiments. Transfec-tion of si-SNHG1 remarkably inhibited viabilities of pAML and THP-1 cells as CCK-8 assay in-dicated (Figure 1E and 1F). Moreover, the flow cytometry data suggested a shortened S phase and arrested G0/G1 phase in leukemia cells with SNHG1 knockdown (Figure 1G and 1H).

LncRNA SNHG1 Sponged miR-488-5pThe potential binding site for SNHG1 and miR-

488-5p was predicted through bioinformatics (Figure 2A). MiR-488-5p mimic and miR-488-5p inhibitor were constructed, and their transfection efficacies in pRML and THP-1 cells were ver-ified (Figure 2B and 2C). After knockdown of SNHG1, the expression of miR-488-5p increased in pAML and THP-1 cells, suggesting a negative correlation between them (Figure 2D and 2E). Subsequently, RIP results suggested a potential binding relationship between SNHG1 and miR-

LncRNA SNHG1 regulates AML

5899

488-5p (Figure 2F). Dual-luciferase reporter gene assay showed that overexpression of miR-488-5p markedly reduced the fluorescence intensity of SNHG1-WT group, whereas SNHG1-MUT group was not affected (Figure 2G and 2H). These re-sults confirmed that SNHG1 downregulated the miR-488-5p expression by sponging it in pAML and THP-1 cells.

NUP205 Was the Potential Target Gene of MiR-488-5p

The potential binding site for NUP205 and miR-488-5p was predicted through bioinformat-ics as well (Figure 3A). Both qRT-PCR and West-

ern blot data revealed an increased expression of NUP205 in pAML and THP-1 cells (Figure 3B and 3C). Subsequently, dual-luciferase report-er gene assay showed that the overexpression of miR-488-5p markedly reduced the fluores-cence intensity of NUP205-WT group, whereas NUP205-MUT group was not affected (Figure 3D and 3E). The above indicated that NUP205 was the potential target gene of miR-488-5p.

SNHG1 Promoted the Development of AML Through MiR-488-5p/NUP205 Axis

To verify whether SNHG1 regulated the bi-ological behaviors of leukemia cells through

Figure 1. LncRNA SNHG1 remained a high expression in AML cells. A, SNHG1 was highly expressed in pAML and THP-1 cells. B, MiR-488-5p was lowly expressed in pAML and THP-1 cells. C, Transfection efficacy of si-SNHG1-1, si-SNHG1-2, and si-SNHG1-3 in pAML cells. D, Transfection efficacy of si-SNHG1-1, si-SNHG1-2, and si-SNHG1-3 in THP-1 cells. E, CCK-8 assay showed that transfection of si-SNHG1 remarkably inhibited viability of pAML cells. F, CCK-8 assay showed that transfection of si-SNHG1 remarkably inhibited viability of THP-1 cells. G, Transfection of si-SNHG1 remarkably arrested cell cycle progression of pAML cells. H, Transfection of si-SNHG1 remarkably arrested cell cycle progression of THP-1 cells. **p<0.01, ***p<0.001.

X.-L. Bao, L. Zhang, W.-P. Song

5900

miR-488-5p/NUP205 axis, gain-of-function ex-periments were conducted by co-transfection of si-SNHG1 and NUP205 overexpression plasmid. The inhibitory effect of SNHG1 knockdown on viabilities of pAML and THP-1 cells was re-versed by NUP205 overexpression (Figure 4A and 4B). Similarly, leukemia cells co-transfect-ed with si-SNHG1 and NUP205 overexpression plasmid showed higher cell proportion in S phase and lower proportion in G0/G1 phase than those

only transfected with si-SNHG1 (Figure 4C and 4D). We may conclude that SNHG1 regulated cel-lular behaviors of AML through NUP205.

Discussion

AML is a type of hematopoietic malignant tu-mor caused by differentiation blockage, apoptotic disorder, and malignant proliferation of hemato-

Figure 2. LncRNA SNHG1 sponged miR-488-5p. A, The potential binding site for SNHG1 and miR-488-5p. B, Transfection efficacy of miR-488-5p mimic and miR-488-5p inhibitor in pAML cells. C, Transfection efficacy of miR-488-5p mimic and miR-488-5p inhibitor in THP-1 cells. D, Transfection of si-SNHG1 upregulated the mRNA level of miR-488-5p in pAML cells. E, Transfection of si-SNHG1 upregulated the mRNA level of miR-488-5p in THP-1 cells. F, RIP results suggested a potential binding relationship between SNHG1 and miR-488-5p. G, Dual-luciferase reporter gene assay showed that overexpression of miR-488-5p markedly reduced the fluorescence intensity of SNHG1-WT group in pAML cells, whereas SNHG1-MUT group was not affected. H, Dual-luciferase reporter gene assay showed that the overexpression of miR-488-5p markedly reduced the fluorescence intensity of SNHG1-WT group in THP-1 cells, whereas SNHG1-MUT group was not affected. **p<0.01, ***p<0.001.

LncRNA SNHG1 regulates AML

5901

poietic stem cells and progenitor cells. Massive accumulation and infiltration of dysfunctional hematopoietic stem cells and progenitor cells to other normal tissues and organs finally lead to hematopoietic dysfunction. Common symptoms of AML include anemia, hemorrhage, bone pain, infection, fever, etc.12. The incidence of AML in adults with 13-39 years old remains high, ac-counting for 50-70% of all types of leukemia13. Disease condition of leukemia is critical and its prognosis is poor due to high recurrent rate.

Many studies have shown that lncRNA SN-HG1 is associated with tumors. SNHG1 in lung squamous cell carcinoma can regulate ZEB1 by inhibiting the activity of Tap6314. SNHG1 pro-motes the proliferation and invasion of liver cancer cells by inhibiting miR-195, thereby promoting the occurrence and development of liver cancer11. In osteosarcoma, SNHG1 regulates WNT2B expres-sion by absorbing miR-577 through Wnt/β-catenin pathway15. Jiandong et al16 showed a negative cor-relation between SNHG1 and the tumor suppressor miR-326 in osteosarcoma. SNHG1 promotes the growth, invasion, and migration of osteosarcoma

cells by upregulating the oncogenic factor NOB1 through targeting miR-326. Yan et al10 investigated the role of SNHG1 in the progression of esoph-ageal squamous cell carcinoma as a ceRNA in lncRNA-SNHG1/CST3 axis. It is reported that the function of SNHG1 in neuroblastoma can be driv-en by the N-Myc gene and regulated by MYCN amplification. The expression of SNHG1 is posi-tively correlated with the expression of MYCN no matter in MYCN-amplified or MYCN non-ampli-fied neuroblastoma17.

There is a positive correlation between miR-488 and miR-488-5p in the blood. In a cohort with 330 breast cancer patients who underwent surgery18, the high expression of circulating pre-miR-488-5p is a poor independent prognostic factor for relapse-free survival. Fujitomo et al19 have shown that NUP205 is highly expressed in lung cancer cells, which is consistent with the expression trend of TMEM209. TMEM209 exerts a crucial role in the growth of lung can-cer cells, which regulates nuclear transport of c-Myc through interacting with NUP20519. NUP205 is part of NPC in Xenopus and it

Figure 3. NUP205 was the potential target gene of miR-488-5p. A, The potential binding site for NUP205 and miR-488-5p. B, NUP205 was highly expressed in pAML and THP-1 cells at mRNA level. C, NUP205 was highly expressed in pAML and THP-1 cells at protein level. D, Dual-luciferase reporter gene assay showed that the overexpression of miR-488-5p markedly reduced the fluorescence intensity of NUP205-WT group in pAML cells, whereas NUP205-MUT group was not affected. E, Dual-luciferase reporter gene assay showed that overexpression of miR-488-5p markedly reduced the fluorescence intensity of NUP205-WT group in THP-1 cells, whereas NUP205-MUT group was not affected. ***p<0.001.

X.-L. Bao, L. Zhang, W.-P. Song

5902

helps to maintain the integrity of NPC through interacting with NUP93 and NUP5320. It has been reported22 that NUP93 and NUP53 can interact with NUP205 and maintain the stability of NUP205 in HeLa cells21. NUP93 is able to preferentially interact with the phosphorylated and activated forms of MAD (human SMAD1 homolog) in Drosophila and directly involved in the nuclear import of MAD.

In this research, we first examined the ex-pressions of lncRNA SNHG1 and miR-488-5p in pAML and THP-1 cells. LncRNA SNHG1 was highly expressed, whereas miR-488-5p was

lowly expressed in leukemia cells. Subsequent-ly, the regulatory effects of SNHG1 on the proliferation of pAML and THP-1 cells were investigated. Cell cycle progression was arrested in G0/G1 phase, and proliferative potential of leukemia cells was inhibited by SNHG1 knock-down. Dual-luciferase reporter gene assay and RIP assay both confirmed the binding between SNHG1 and miR-488-5p, suggesting that SN-HG1 sponged miR-488-5p in pAML and THP-1 cells. NUP205 was highly expressed in pAML and THP-1 cells at both mRNA and protein ex-pressions. Besides, dual-luciferase reporter gene

Figure 4. SNHG1 promoted the development of AML through miR-488-5p/NUP205 axis. A, The inhibitory effect of SNHG1 knockdown on viability of pAML cells was reversed by NUP205 overexpression. B, The inhibitory effect of SNHG1 knockdown on viability of THP-1 cells was reversed by NUP205 overexpression. C, The inhibitory effect of SNHG1 knockdown on cell cycle progression of pAML cells was reversed by NUP205 overexpression. D, The inhibitory effect of SNHG1 knockdown on cell cycle progression of THP-1 cells was reversed by NUP205 overexpression. **p<0.01, ***p<0.001.

LncRNA SNHG1 regulates AML

5903

assay showed that NUP205 bound to miR-488-5p, suggesting that NUP205 was a potential tar-get gene of miR-488-5p. Finally, gain-of-func-tion experiments proved that overexpression of NUP205 in pAML and THP-1 cells reversed the inhibitory effect of SNHG1 knockdown on cell proliferation and cell cycle progression.

Conclusions

We showed that lncRNA SNHG1 is highly expressed in pAML and THP-1 cells. SNHG1 promotes the development of AML through miR-488-5p/NUP205 axis.

Conflict of InterestThe Authors declare that they have no conflict of interests.

References

1) Grimwade d, mrozek k. Diagnostic and prognostic value of cytogenetics in acute myeloid leukemia. Hematol Oncol Clin North Am 2011; 25: 1135-1161.

2) Patel JP, levine rl. How do novel molecular genet-ic markers influence treatment decisions in acute myeloid leukemia? Hematology Am Soc Hematol Educ Program 2012; 2012: 28-34.

3) Scholl c, Gilliland dG, FrohlinG S. Deregulation of signaling pathways in acute myeloid leukemia. Semin Oncol 2008; 35: 336-345.

4) donG X, chen k, cuevaS-diaz dr, You Y, Sloan Sa, zhanG Y, zonG S, cao Q, BarreS Ba, wu JQ. Comprehensive identification of long non-cod-ing RNAs in purified cell types from the brain re-veals functional LncRNA in OPC fate determina-tion. PLoS Genet 2015; 11: e1005669.

5) Salmena l, PoliSeno l, taY Y, katS l, PandolFi PP. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 2011; 146: 353-358.

6) thomSon dw, dinGer me. Endogenous microR-NA sponges: evidence and controversy. Nat Rev Genet 2016; 17: 272-283.

7) karreth Fa, PandolFi PP. ceRNA cross-talk in can-cer: when ce-bling rivalries go awry. Cancer Dis-cov 2013; 3: 1113-1121.

8) TaY Y, rinn J, PandolFi PP. The multilayered com-plexity of ceRNA crosstalk and competition. Na-ture 2014; 505: 344-352.

9) cui Y, zhanG F, zhu c, GenG l, tian t, liu h. Upreg-ulated lncRNA SNHG1 contributes to progression of non-small cell lung cancer through inhibition of miR-101-3p and activation of Wnt/beta-caten-in signaling pathway. Oncotarget 2017; 8: 17785-17794.

10) Yan Y, Fan Q, wanG l, zhou Y, li J, zhou k. Ln-cRNA Snhg1, a non-degradable sponge for miR-338, promotes expression of proto-oncogene CST3 in primary esophageal cancer cells. Onco-target 2017; 8: 35750-35760.

11) zhanG h, zhou d, YinG m, chen m, chen P, chen z, zhanG F. Expression of long non-coding RNA (ln-cRNA) small nucleolar RNA host gene 1 (SNHG1) exacerbates hepatocellular carcinoma through suppressing miR-195. Med Sci Monit 2016; 22: 4820-4829.

12) ma l, kuai wX, Sun Xz, lu Xc, Yuan YF. Long non-coding RNA LINC00265 predicts the prognosis of acute myeloid leukemia patients and functions as a promoter by activating PI3K-AKT pathway. Eur Rev Med Pharmacol Sci 2018; 22: 7867-7876.

13) Ferrara F, SchiFFer ca. Acute myeloid leukaemia in adults. Lancet 2013; 381: 484-495.

14) zhanG hY, YanG w, zhenG FS, wanG YB, lu JB. Long non-coding RNA SNHG1 regulates zinc fin-ger E-box binding homeobox 1 expression by in-teracting with TAp63 and promotes cell metasta-sis and invasion in Lung squamous cell carcino-ma. Biomed Pharmacother 2017; 90: 650-658.

15) JianG z, JianG c, FanG J. Up-regulated lnc-SN-HG1 contributes to osteosarcoma progression through sequestration of miR-577 and activation of WNT2B/Wnt/beta-catenin pathway. Biochem Biophys Res Commun 2018; 495: 238-245.

16) wanG J, cao l, wu J, wanG Q. Long non-cod-ing RNA SNHG1 regulates NOB1 expression by sponging miR-326 and promotes tumorigenesis in osteosarcoma. Int J Oncol 2018; 52: 77-88.

17) Sahu d, hSu cl, lin cc, YanG tw, hSu wm, ho SY, Juan hF, huanG hc. Co-expression analysis iden-tifies long noncoding RNA SNHG1 as a novel pre-dictor for event-free survival in neuroblastoma. Oncotarget 2016; 7: 58022-58037.

18) maSuda t, Shinden Y, noda m, ueo h, hu Q, YoShi-kawa Y, tSuruda Y, kuroda Y, ito S, eGuchi h, ohno S, mimori k. Circulating pre-microRNA-488 in pe-ripheral blood is a potential biomarker for predict-ing recurrence in breast cancer. Anticancer Res 2018; 38: 4515-4523.

19) FuJitomo t, daiGo Y, matSuda k, ueda k, nakamu-ra Y. Critical function for nuclear envelope protein TMEM209 in human pulmonary carcinogenesis. Cancer Res 2012; 72: 4110-4118.

20) Grandi P, danG t, Pane n, Shevchenko a, mann m, ForBeS d, hurt e. Nup93, a vertebrate homologue of yeast Nic96p, forms a complex with a novel 205-kDa protein and is required for correct nu-clear pore assembly. Mol Biol Cell 1997; 8: 2017-2038.

21) hawrYluk-Gara la, ShiBuYa ek, wozniak rw. Verte-brate Nup53 interacts with the nuclear lamina and is required for the assembly of a Nup93-contain-ing complex. Mol Biol Cell 2005; 16: 2382-2394.

22) chen X, Xu l. Specific nucleoporin requirement for Smad nuclear translocation. Mol Cell Biol 2010; 30: 4022-4034.