JOURNAL OF VIROLOGY, Sept. 1991, p. 4591-45970022-538X/91/094591-07$02.00/0Copyright C) 1991, American Society for Microbiology

Linker Insertion Mutations in the Adenovirus Preterminal ProteinThat Affect DNA Replication Activity In Vivo and In Vitro

JEFFREY N. FREDMAN,1 STEVEN C. PETTIT,1t MARSHALL S. HORWITZ,2"3 AND JEFFREY A. ENGLER'*Department ofBiochemistry, University ofAlabama at Birmingham, Birmingham, Alabama 35294,1 and Departments of

Microbiology-Immunology2 and Cell Biology,3 Albert Einstein College of Medicine, Bronx, New York 10461

Received 4 March 1991/Accepted 24 May 1991

Eighteen linker insertion mutants with mutations in the adenovirus precursor to terminal protein (pTP),which were originally constructed and tested in virions by Freimuth and Ginsberg (Proc. Natl. Acad. Sci. USA83:7816-7820, 1986), were transferred to expression plasmids for assay of the various functions of the isolatedpTP. Function was measured by the ability of individual pTP mutant proteins to participate in the initiationof replication from an adenovirus DNA end, by their activity in assays of DNA elongation, and by theintracellular distribution of pTP demonstrated by indirect immunofluorescence. Ten of the 11 mutants thatwere active in virion formation were also functional in DNA replication reactions in extracts, while 1 hadreduced function. Four mutants with mutations that were lethal to virus production were also inactive in DNAreplication reactions. These four mutations are probably located at sites required for the function of pTP inDNA synthesis. Three pTP mutants with mutations that were lethal or partially defective with respect to virionformation were active in reactions requiring pTP for initiation and elongation in extracts. All three of thesemutant pTPs targeted normally to the nucleus, suggesting a defect after this step in replication. Since pTP hasbeen reported to bind the nuclear matrix, these pTP mutants may have mutations that define sites necessaryfor binding to this structure. Several mutants with mutations that lie outside the putative nuclear targetingregion were aberrantly localized, suggesting either that additional domains are important in nuclearlocalization or that there are alterations in protein structure that affect nuclear transport for some pTPmutants.

The intracellular replication of human adenoviruses (Ad)involves the interaction of three virus proteins, three hostfactors, and Ad DNA covalently linked at each 5' end toterminal protein (TP) (for reviews, see references 9, 14, and20). The host factors nuclear factor I and nuclear factor IIIbind to the Ad origins at either end of the 36,000-bpdouble-stranded linear DNA (13, 16, 19, 23, 27, 29). Theseproteins then interact with the complex of Ad DNA poly-merase (Ad Pol) and precursor to TP (pTP) (8, 30) in thenuclei of infected cells (7). Ad DNA-binding protein stabi-lizes denatured single-stranded regions at the origin (17). Thecomplex initiates DNA replication by forming a covalentpTP-dCMP linkage at the P-hydroxyl group of serine residue580 of pTP (15, 16, 18, 25). The 3'-OH of the dCMP is thenthe primer for elongation of Ad DNA. Nuclear factor II is a

type I topoisomerase that helps relieve torsional stressacquired in the strand displacement during the elongationstage of replication. In a late event after replication, pTPcovalently bound to the viral DNA is processed by a viralprotease to TP (4, 31).

This intracellular replication of Ad DNA can be reconsti-tuted in a series of steps in cell extracts. pTP binds to AdPol, and this is followed by binding to Ad origin DNA. Thisassociation is probably stabilized by the binding between AdPol and nuclear factor I (7).Freimuth and Ginsberg (10) constructed a series of linker

insertion mutations in the pTP gene of Ad type 5 (Ad5) toanalyze its role in intracellular replication. These mutationswere then incorporated into virus by recombination with

* Corresponding author.t Present address: Lineberger Cancer Research Center, The

University of North Carolina, Chapel Hill, NC 27599-7295.

viral DNA fragments and tested for appearance of functionalvirus. They identified three mutant phenotypes: silent,which gave normal virus yields; replication defective, whichgave reduced yields; and lethal, which failed to give anyrecombinant virus. Recently, Roovers et al. (24) used similartechniques to extend the range of pTP mutations available inviral DNA.

In this report, studies in transfected-cell extracts aredescribed to determine the molecular defects in these mutantpTP proteins. In these studies, transient expression plasmidsystems that express Ad Pol and pTP (21, 28) were used toproduce these mutant proteins for analysis in extracts. Whilemost of the results in cells and in extracts are in agreement,several of these mutations assayed in extracts appeared togive results that are at variance with the data obtained bystudying virus mutants. Some of these discrepancies point toadditional functions for either the pTP or Ad Pol that can bedetermined by further studies.

MATERIALS AND METHODS

DNA manipulations. Plasmid DNAs in Escherichia coliDH-1 were isolated by the alkaline lysis method (1) andbanded twice in CsCl-ethidium bromide density equilibriumgradients. Plasmid p439-pTP was constructed by digestingmutant AdS plasmid pPF439 (10) with NheI and Asp 718.The DNA fragment containing the pTP main open readingframe (ORF) (Ad5 nucleotides 10809 to 8533) was isolated,8-bp BamHI linkers were added, and the resulting BamHI-cleaved segment was ligated to BglII-digested pJj-pol (28).This procedure, which resulted in the substitution of themain Ad Pol ORF in pJ1-pol with the pTP ORF, was for ease

of cloning. This plasmid was then digested with BglII, and a

DNA fragment missing the middle two-thirds of pTP was

4591

Vol. 65, No. 9

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 04

Jan

uary

202

2 by

31.

208.

233.

75.

4592 FREDMAN ET AL.

isolated and self-ligated, resulting in 100-pTP (Fig. 1). Mu-tant AdS plasmids pPF 229, pPF 231 to pPF 234, pPF 297,pPF 339, pPF 340, pPF 343, pPF 344, pPF 346 to pPF 348,pPF 388, pPF 391, pPF 393, pPF 394, pPF 397, and pPF 439to pPF 441 (generously provided by H. S. Ginsberg) (10)were digested with BglII, and the DNA segment containingthe middle two-thirds ofpTP was isolated. This segment wasthen ligated into BglII-digested 100-pTP, resulting in theinsertion of the various mutations. Orientation and insertionof mutations was verified by restriction mapping (25). Se-quencing was done with the following five oligonucleotides:

1597 5' CTCCCAGTTTTTCAA 3'1598 5' TCTTCCAACTGCGCC 3'1599 5' TGTCAAAACGAAGCC 3'1600 5' TGTTGGAAGATCTCG 3'2415 5' CGAGATCTTCCAACATAAGGCG 3'

Cells and replication components. The CMT-4 (11) monkeykidney cell line into which the plasmid DNAs were trans-fected has the simian virus 40 large tumor antigen geneincorporated into its genome under control of the metal-lothionein promoter. CMT-4 cells were transfected as de-scribed previously (5) and then induced 24 h posttransfectionwith 100 FM ZnCl2 and 1 FM CdCl2. At 48 h posttransfec-tion, cells were washed twice with Tris-buffered saline (pH7.2), scraped off the plates, and collected by centrifugation.Crude cytoplasmic extracts were prepared by Dounce ho-mogenization as previously described (3), and protein yieldswere determined by a colorimetric assay in accordance withthe instructions of the manufacturer (Pierce Chemical Co.,Rockford, Ill.). Relative quantitation of pTP on immunoblotswas determined as previously described (22), using a poly-clonal anti-pTP peptide antibody against the carboxyl termi-nus of pTP as the primary antibody. In all assays, theamounts of CMT-4 cytoplasmic extracts used were calcu-lated to add to each reaction mixture the same amount ofpTP as determined by quantitative immunoblot analysis.

In vitro replication assays for initiation and elongation ofAdDNA. Assays for the formation of the pTP-dCMP initiationcomplex were performed at 30°C, as previously described(22). Initiation was measured by formation of 32P-labeledpTP-dCMP complexes after incubation with [_-32P]dCTP (15,Ci, 400 Ci/mmol). Labeled initiation complexes were im-munoprecipitated and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (21). Quan-titative densitometric analysis was performed on anUltroscan XL laser densitometer (LKB Instruments, Inc.,Rockville, Md.). The assay for elongation of pTP-dCMPinitiation complexes used the end-fragment, origin-specificassay previously described (9, 12, 28). SmaI-digested Ad35DNA-TP complex was preferentially labeled in the SmaI Band SmaI G fragments by [at-32P]dTTP in a reaction requir-ing Ad Pol (derived from extracts of transfected CMT-4cells), pTP, Ad DNA-binding protein, and uninfected HeLacell nuclear extract. Following pronase treatment to removeterminal proteins, the DNA was analyzed by electrophoresisand the resulting autoradiogram was quantitated on anUltroscan XL laser densitometer. Densitometry values forthe SmaI G fragment corrected for the nonspecific radioac-tivity incorporated into the SmaI F fragment were expressedas percentages of the wild-type reaction to obtain the relativeactivities of the pTP mutant polypeptides. Because of non-specific (probably repair) reactions incorporating morecounts into the large fragments, the SmaI B fragment wasnot used for calculating the replication reaction. All activi-

ties were normalized for the amount of specific pTP proteindetermined by quantitative immunoblot analysis.

Indirect immunofluorescence microscopy. CMT-4 cellswere plated on a glass coverslip in a 35-mm plate. They weretransfected and induced as described above. At 48 h post-transfection, cells were fixed with 3% paraformaldehyde inphosphate-buffered saline. Tris-buffered saline-1% TritonX-100 was used to permeabilize the cell membrane beforeincubation with the polyclonal anti-pTP peptide antibody.Fluorescein isothiocyanate-conjugated goat anti-rabbit im-munoglobulin G (Jackson Immunoresearch, West Grove,Pa.) was used as the secondary antibody. The assay forSV40 T-antigen localization controls utilized a monoclonalanti-T antigen antibody (Oncogene Sciences, Manhasset,N.Y.) and biotinylated secondary goat anti-mouse immuno-globulin G (Jackson Immunoresearch) followed by strept-avidin-Texas red (GIBCO-BRL). The cells were photo-graphed on a Nikon photomicroscope at a magnification ofx40 with Kodak Gold 400 film.

RESULTS

Transient expression of pTP in CMT-4 cells. Mutant AdDNA fragments were cloned into 100-pTP downstream ofthe Ad major late promoter and HindlIl J fragment (Fig. 1).CMT-4 cells were transfected for 48 h with the variousmutant plasmid constructs and then scraped off the plates.Crude cytoplasmic extracts were prepared, and total proteinyields were determined. The cytoplasmic extracts were runon quantitative immunoblots and then subjected to densito-metry to determine relative levels of pTP expression amongvarious mutants (Fig. 2). The relative levels of expressionamong the mutants varied substantially; some mutants neverexpressed stable protein, despite correct sequence. Theobserved differences in protein amount are probably due todifferences in protein stability, as was found for similarplasmids expressing Ad Pol (6).

Activity of linker insertion mutants for initiation and elon-gation of Ad DNA replication. The wild type and all mutantswere assayed for initiation on Ad DNA measured by pTP-dCMP formation, as shown in Fig. 3 for selected mutants.The same extracts were assayed in the end-fragment reac-tion (Fig. 4), which measures the elongation of Ad DNA forany mutant that could initiate. Although the total proteinpresent in each reaction mixture was varied to allow theaddition of equal quantities of pTP, the amount of productformed was linearly related only to the amount of pTP, asdetermined in control experiments with wild-type extracts(unpublished data). The results of the initiation and elonga-tion assays for all the mutants are summarized in Table 1 andare compared with the activity of each mutant when incor-porated into virions.

(i) Silent mutations. Eleven of 18 linker insertion mutantstested were characterized as silent by Freimuth and Gins-berg (10) (Table 1). Nine of these mutants showed approxi-mately wild-type levels of activity in initiation and elonga-tion assays in extracts, while two of the silent mutantsshowed reduced levels of activity. Mutant p343-pTP resultedin substantially reduced levels of function but appeared tohave wild-type expression levels on immunoblots, indicatingthat the defect was not in the expression or stability of thepTP. Mutant p441-pTP was almost totally inactive, althoughit was also expressed at wild-type levels.

(ii) Replication-defective mutations. Two of the linker in-sertion mutants were characterized as replication defective(partial activity) by Freimuth and Ginsberg (10) (Table 1).

J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 04

Jan

uary

202

2 by

31.

208.

233.

75.

LINKER INSERTION MUTATIONS IN pTP 4593

A MLPE 1IHDF=ZL

MLP H H Bgl N Bg IIIWZVAZ DHFR P/A

41.8 38.1

ULL.D H H B III

41.8 38.1

MLP

L -LVAITPH H

-418 3.41.8 38.i-I

Bgl iI Bg III

P/AFR Linker InsertionMutations

0

0W 0~~~~~~~~~1 a,4-

n

u~~~~~~~~~~~~~~~~~~~~~~~~~~(D o H

X: u Z G m

co r rIco cn 'vcI N CX en x

cs r, 1- c 0C o c* uxa) v (o 1 If CD(814 VO cl) Vh en v m d )v V Cn1-v as V Nv n en rme1 N N m VP S N v cn c1 sP en t NC

14 a, A4 04 14 44 1404 04 Al a,14141i 1 1i

P.P. I'll Al XP. Q. X.PI a,Pd X.04P

°t49IP 99 9 99 P99 t PIOOH

co X3 t 0 or, Go u 4 o o414 r, 11 m WDD O mn sP ah cm n s t v0 srer U1) WI Ln Ln %0

FIG. 1. (A) Plasmid for the transient expression of wild-type and mutant pTPs in CMT-4 cells. Ad DNA segments in the hatched regionbetween BglII sites designate the fragments shuttled from mutant plasmids pPF 229 to pPF 441 into 100-pTP. The control plasmid, p91023,which lacks any pTP sequences, is also shown. p91023, the original plasmid used in these constructions, includes the Ad major late promoter(MLP), the spliced tripartite leader (TPL), the VA genes (VA), the SV40 enhancer and origin of replication (ORI), the poly(A) signal (P/A),and the dihydrofolate reductase (DHFR) gene. These elements enhance plasmid copy number, transcription, and specificity of translation ofthe recombinant message to increase protein yield in transient assays. (B) Location of mutants along the pTP ORF. The positions of importantfunctional regions on the pTP molecule are shown by large arrows pointing down to the stippled rectangle. Mutants designated pPF andlocated above the stippled rectangle are those originally constructed by Freimuth and Ginsberg (10). These mutants were cloned into theexpression system described in panel A. Mutants located below the stippled rectangle are those reported by Roovers et al. (24). The solidtriangle represents a ts mutation, the open circles represent silent mutations, the stippled circle represents a replication-defective mutant, andthe filled-in circles represent lethal mutations.

Both of these mutants, which caused 10-fold or greaterreductions in virus titers, displayed wild-type levels of pTPactivity in the initiation and elongation assays in extracts.

(iii) Lethal mutations. Eight of the linker insertion mutantswere identified as lethal for the production of virus (Table 1)(10). Three of the lethal mutants, p391-pTP, p439-pTP, andp348-pTP, produced insufficient protein to quantitate andtest in replication assays. Four of the lethal mutants gave noactivity in either the initiation or elongation assay. One ofthe lethal mutants, p344-pTP, gave levels of activity in theinitiation and elongation assays approximating those ob-served for wild-type protein.Nuclear localization of pTP molecules encoded by viral

mutants. Wild-type pTP expressed transiently in CMT-4cells localized to the nucleus of transfected cells (Fig. 5A).Mock-transfected cells showed no pTP (Fig. 5B). Many ofthe tested linker insertion mutations, whether they were

silent or lethal, produced normal nuclear targeting patterns(Fig. 5C and D). Several of the linker insertion mutations,however, resulted in aberrant localization patterns, even

though the mutation was not located in the putative nucleartargeting sequence ofpTP (24). The mutant p394-pTP, which

was inactive either in virions or in initiation and elongationreactions, showed a punctate distribution mostly in thecytoplasm at all three temperatures tested (51 of 52 of cellstransfected at 32°C, 43 of 44 at 37°C, and 172 of 172 at 39°C;Fig. 5E and G). Another mutant, p423-pTP, which was

previously shown to have a mutation in the amino terminusand to be temperature sensitive, was inappropriately local-ized at the permissive temperature in 45 of 107 cells (42% ofthose counted). At the intermediate temperature of 37°C,p423-pTP was aberrantly localized in 68 of 95 cells counted(72% abnormal). At the nonpermissive temperature of 39°C,there were 137 of 142 cells with aberrant localization ofp423-pTP (96% abnormal). The aberrant localization ofp423-pTP consisted of punctate accumulations in the cyto-plasm; however, some apparently normal nuclear transportwas observed even at elevated temperatures (Fig. SF and H).These results indicate that the aberrant nuclear localizationof pTP is related to some permutation of the protein otherthan the nuclear targeting sequence previously defined (34).The cell nuclei in these transfections, however, do notappear to be organized differently from those of wild-type

p91 023

p439-pTP

100-pTP

VOL. 65, 1991

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 04

Jan

uary

202

2 by

31.

208.

233.

75.

4594 FREDMAN ET AL. J ro~

0' 0' 040 10 0D

a4 a, a4E-4 E- E4 Fe-

a. Oa a.

I. 1 I1 I1

0' 0't

a04

E4 FE-

en a0aN c e

,1p~4 1P0OINMW"'M 4- 80 kcd

FIG. 2. Immunoblot of cytoplasmic pTP extracts. CMT-4 cells

were transfected with CaPO4-precipitated plasmids carrying various

pTP mutants. At 48 h posttransfection, crude cytoplasmic extracts

were made. Twenty micrograms of each extract was separated by

SDS-PAGE, blotted onto nitrocellulose, and probed with polyclonal

anti-pTP peptide antibody. Bands corresponding to expressed pTP

are indicated by the arrow. These immunoblots were analyzed by

quantitative densitometry to determine the amount of pTP in each

extract relative to the amount of wild-type pTP. Wild-type pTP

(J-pTP) samples of 0, 4, 8, 12, and 16 p.g were adjusted with p91023

extract to give 20 p.g of total protein per lane. Twenty micrograms of

p388-pTP, p389-pTP, and p393-pTP was loaded in each lane. kd,

kilodaltons.

pTP, as shown by the normal nuclear localization of SV40 T

antigen in the identical cells (Fig. 51 and J).

DISCUSSION

This report describes linker insertion mutants with muta-

tions within the pTP ORF which were inserted into a

transient expression system and assayed for their ability to

direct protein transport to the nucleus, to form the initiation

complex, and to elongate Ad DNA in extracts containing the

other replication proteins. Previous results (10) with these

mutations in virions identified several segments of pTP that

seemed tolerant of the linker insertions with respect to

production of viable virus, while other regions of the proteinwere more sensitive to insertion. Roovers et al. (24) recently

produced additional viruses containing linker scanning mu-

tants of pTP using different linkers in both sites already

targeted by Freimuth and Ginsberg (10) and in additional

untargeted sites. Although the data from both of these

awAl en E-4 E-4 E-E-4 CV a. a.

.-4 en r-

c I IVP.

A

DAE-4 F-

aw

B

A"" -4-- 80 kcd ;mom, ~

Panel A Panel B Panel C

FIG. 4. Ad-specific replication with expressed wild-type (wt) and

mutant pTPs with transfected CMT-4 cytoplasmic extracts. All

assays contained SinaI-digested Ad35 DNA-TP complex. Restric-

tion fragments SmnaI-B and Smal-G contain the replication origins

and are preferentially labeled by [a-`2P]dTTP in the reaction that

also includes Ad Pol, Ad DNA-binding protein, and the various

pTPs. The reaction mixtures contained densitometrically quanti-tated equivalent amounts of pTP. After incubation at 370C for 1 h,

reactions were halted by adding SDS and pronase. The reaction

products were separated by electrophoresis on a 0.7% agarose gel

and autoradiographed. pTP activity was calculated by quantitativedensitometric analysis of the Sinal G bands on the autoradiogram as

described in Materials and Methods. p91023 is a mock extract.

studies are nearly identical, there is a substantial difference

between Roovers' and colleagues' in378, which is lethal, and

Freimuth's and Ginsberg's pPF 440, which is a silent insert

at the same restriction site. Our data on pPF 440 assayed in

initiation and elongation reactions in extracts support the

observation that this insertion is silent.

Aberrant targeting was demonstrated by three mutants,

p234-pTP, p394-pTP, and p423-pTP, following transfections

of CMT-4 cells with plasmids expressing these proteins. Two

of these mutants also failed to show activity in the replica-tion assays in extracts. Since none of these mutants are

located in the putative nuclear targeting signal (34), results

may indicate that other sites are important in nuclear trans-

port or that global folding abnormalities in the proteinstructure preclude recognition of the nuclear targeting sig-nal. The third aberrantly targeted mutant, ts423 (p423-pTP),retains some activity at both permissive and nonpermissive

temperatures. Previous studies on it and on other amino-

terminal mutants have demonstrated the necessity of the

IIad E-4 E-

en

c

4*- 80 kd ..I... 4*- 80 kcd

Panel A Panel B Panel C

FIG. 3. Initiation of Ad DNA replication with pTP expressed from wild-type (wt) and mutant plasmid constructs. Performance of the

initiation reaction used different amounts of total protein so that each reaction mixture included equivalent amounts of pTP as determined byquantitative densitometric analysis. After a 1-h incubation at 30'C, the reaction was terminated and pTP-[31P]dCMP initiation complexes were

immunoprecipitated with polyclonal anti-pTP peptide antibody before PAGE. The relative activity of each pTP (80 kDa) was quantitated by

densitometry of the autoradiogram. p91023 is a mock extract.

t4o, 4-*-G

J. VIROL.

p p

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 04

Jan

uary

202

2 by

31.

208.

233.

75.

LINKER INSERTION MUTATIONS IN pTP 4595

TABLE 1. pTP linker insertion mutants

Relative activityaMutant Sequence Initiation Elongation Virion

(30°C) (370C) phenotype

J-pTP

Mutants for which infection and trans-fection results agree

423b

347d

388e

234d

232e

297e

346e

393d

23ld

440d

397e

339e

343d

394d

229d

Mutants for which infection and trans-fection results are discordant

340e

233d

344d

441d

Mutants that failed to produce protein

391

439

348

100 100 Wild type

12.D C A R L P G G Q S V P T M.

69.A P G A P A D R S A T L R W.

69.A P G A P A D P R G S A T L.

126.N W S V M A D R S A N C T Y.

189.G R H L R R I D P P N S A A.

189.G R H L R R I P G D P P N S.

235.E A W G M A D R S A D R L R.

317G G G V P G P T Q Q L L R C.

360.P R E N G G S I R R A V T E.

378.I E R F V R I D P D R L P V.

404.E E E G E A D R S A P V A F.

416.I E E E E A R A P V A F E R.

416I E E E E A D R S A P V A F.

478.L R R W V M S R D F F V A E.

544.F S Q L M A D R S A R I S N.

156.T Q V Q Q A R A I L A E R V.

156.T Q V Q Q A D R S A I L A E.

404.E E E G E A D R S A L M E E.

439.L L E E E F G S I R T V S A.

88.F L V G Y Y Y L V R T C N D.

252M V L L S G S I R T I R R L.

535.W N E G G G S I R L N A F S. . .

26 9 tsc

90 61 Silentc

142 122 Silentc

0 7 Lethalcf

93 47 Silent',f

71 61 Silentcf

5 0 Lethalcf

65 132 Silentcf

81 65 Silentc

79 153 Silentc g

128 93 Silentch

69 27 Silentc"f

42 22 Silentcf

0 0 Lethalc

0 0 Lethalc

72 43 Replication defectivec

90 182 Replication defectivec

85 65 Lethalc

3 3 Silentc

ND' ND Lethalci

ND ND Lethalc

ND ND Lethalc

a Calculated relative activities of various pTP mutants. The activities were compared with that of the wild type (J-pTP) by the densitometric tracings ofautoradiographs of initiation and elongation assays.

b This mutant was previously described by Pettit et al. (21). Data shown are derived at a nonpermissive temperature of 38°C.C Data from Freimuth and Ginsberg (10).dAverage of two independent determinations.e Average of three independent determinations.f Similar mutants from Roovers et al. (24) produced similar results.g One mutant with a mutation at the same site but with a different amino acid insert was a lethal mutant (24).h Eight-amino-acid deletion at this linker insertion site.ND, not determined.Single-amino-acid substitution at this site, tyrosine for glutamine.

VOL. 65, 1991

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 04

Jan

uary

202

2 by

31.

208.

233.

75.

4596 FREDMAN ET AL.

amino terminus for pTP to function in Ad DNA replication(22). Recent data on the +29 terminal protein's N terminuswere consistent with Ad pTP data, suggesting that DNAreplication activity was sensitive to N-terminal deletions (32,33). A previous study noted that preincubation at the non-permissive temperature was necessary for the temperature-sensitive (ts) phenotype to be evident (22). The indirectimmunofluorescence result for ts mutant p423-pTP suggeststhat its temperature sensitivity is due to incorrect proteinfolding that may obscure the nuclear targeting signal at thenonpermissive temperature.

Several of the linker insertion mutants had phenotypes atvariance with those expected from the results of Freimuthand Ginsberg (10), who used the infectious virion assays.Both mutants p343-pTP and p441-pTP were able to makevirus intracellularly and were appropriately localized intothe nucleus but gave substantial reductions in the initiationand elongation assays in extracts. While the activities formutant p343-pTP of 22 and 42% of wild type (Table 1) maybe sufficient to produce wild-type amounts of virion, mutantp441-pTP appears completely inactive in the assays in ex-tracts. The results suggest that some intracellular event suchas interaction with nuclear matrix proteins or other factorsabsent from the extract studies compensates for the p441-pTP mutation. Alternatively, if the virus yield was normalbut temporally delayed, the phenotype may be totally defec-tive in extracts. Additional data to reconcile this discrepancyare not currently available.

Several of these mutants, p441-pTP, p423-pTP, and p437-pTP, have been shown to have a fivefold-reduced ability,relative to wild-type pTP, to bind to nuclear matrix (26).However, each has a different phenotype when tested in theDNA replication reactions in extracts: p441-pTP (this report)is inactive, p423-pTP is ts (22), and p437-pTP is active (22).For p437-pTP, this observation suggests that the normalfunctioning of the protein in extracts is a result of themutation exclusively affecting a domain of the protein in-volved in nuclear matrix associations, which would onlyaffect function during intracellular virion replication. Amongthe lethal or replication-defective mutants in virion forma-tion, p344-pTP, p340-pTP, and p233-pTP produce activeDNA replication extracts. While these mutants have notbeen tested for their ability to bind the nuclear matrix, thedata on nuclear targeting show that each of these three pTPsenters the nucleus. Thus, the best candidates for mutantswith mutations affecting nuclear matrix binding but notaffecting DNA synthesis or nuclear transport would bep340-pTP, p233-pTP, and p344-pTP.

FIG. 5. Nuclear localization of AdS wild-type, mock-trans-fected, and mutant pTPs. Indirect immunofluorescence of CMT-4cells transfected with various pTPs was determined 48 h posttrans-fection by using polyclonal antipeptide antibodies against the Cterminus of pTP (A to H) and monoclonal antibodies against SV40large T antigen (I and J). (A) Wild-type pTP (37°C); this panel showstwo overlapping, brightly stained nuclei (the results of wild-typepTP transfections at 39°C are identical to those at 37°C). (B) p91023(37°C); this panel shows the low level of background fluorescence.(C) p388-pTP (37°C); this panel shows one large, brightly stainednucleus abutting a second, smaller, brightly stained nucleus. (D)p346-pTP (37°C); this panel shows two overlapping, brightly stainednuclei. (E) p394-pTP (32°C); this panel shows two nuclei, one withbright punctate dots throughout the nucleus, and another withpunctate dots clumped in the middle of the nucleus. (F) p423-pTP

(32°C); this panel shows one brightly stained nucleus. (G) p394-pTP(39°C); this panel shows punctate cytoplasmic dots surrounding asingle nucleus, and the field shown is identical to that in panel I. (H)p423-pTP (37°C); this panel shows a bright punctate spot outside thenucleus with diffuse punctate spots throughout the cytoplasm, andthe field shown is identical to that in panel J. (I) p394-pTP (39°C);this panel, utilizing monoclonal antibodies against SV40 T antigen,is identical to the field shown in panel G and shows the nucleus ofthe punctate cell seen in panel G as a brightly staining fluorescencein the center, with other stained nuclei above and below it that didnot express pTP. (J) p423-pTP (37°C); this panel, also stained withantibody to SV40 T antigen, is identical to the field shown in panelH and shows seven brightly staining nuclei, with the nucleus nearestthe center being the same one that is visible in panel H. Initiationand elongation reactions for p423-pTP have been previously re-ported for this N-terminal ts mutant (22).

A

C

c

E

G

B

D

F

H

J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 04

Jan

uary

202

2 by

31.

208.

233.

75.

LINKER INSERTION MUTATIONS IN pTP 4597

These pTP mutants help identify regions in the moleculethat may form patches which serve the several functions thatrequire pTP for viral growth. These functions include DNAPol binding, initiation and elongation of DNA, nuclearmatrix interaction (2), and proteolytic cleavage before viralpackaging. Further studies may allow more precise identifi-cation of sites in pTP that interact with the components ofthe nuclear matrix.

ACKNOWLEDGMENTS

We thank H. S. Ginsberg for the generous gift of the plasmidsused in this study. We also thank Darin Steele and Carl Abraham foradvice and expert technical assistance.

This work was supported by Public Health Service grants A120408(to J.A.E.) and CA11512 and P30-CA13330 (to M.S.H.) from theNational Institutes of Health (NIH). J.N.F. is a predoctoral traineesupported by NIH predoctoral CMB training grant T32GM08111.Costs for DNA synthesis were supported in part by grant CA13148to the UAB Comprehensive Cancer Center.

REFERENCES

1. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extractionprocedure for screening recombinant plasmid DNA. NucleicAcids Res. 7:1513-1523.

2. Bodnar, J. W., P. I. Hanson, M. Polvino-Bodnar, W. Zempsky,and D. C. Ward. 1989. The terminal regions of adenovirus andminute virus of mice are preferentially associated with thenuclear matrix in infected cells. J. Virol. 63:4344 4353.

3. Challberg, M. D., and T. J. Kelly. 1979. Adenovirus DNAreplication in vitro. Proc. Natl. Acad. Sci. USA 76:655-659.

4. Challberg, M. D., and T. J. Kelly, Jr. 1981. Processing of theadenoviral terminal protein. J. Virol. 38:272-277.

5. Chen, C., and H. Okayama. 1987. High-efficiency transforma-tion of mammalian cells by plasmid DNA. Mol. Cell. Biol.7:2745-2752.

6. Chen, M. 1990. Ph.D. thesis. Albert Einstein College of Medi-cine, Bronx, N.Y.

7. Chen, M., N. Mermod, and M. S. Horwitz. 1990. Protein-proteininteractions between adenovirus DNA polymerase and nuclearfactor I mediate formation of the DNA replication preinitiationcomplexes. J. Biol. Chem. 215:18634-18642.

8. Enomoto, T., J. H. Lichy, J. E. Ikeda, and J. Hurwitz. 1981.Adenovirus DNA replication in vitro: purification of the termi-nal protein in a functional form. Proc. Natl. Acad. Sci. USA78:6779-6783.

9. Freifeld, B. R., J. H. Lichy, J. Field, R. M. Gronostajski, R. A.Guggenheimer, M. D. Krevolin, K. Nagata, J. Hurwitz, andM. S. Horwitz. 1984. The in vitro replication of adenovirusDNA. Curr. Top. Microbiol. Immunol. 110:221-255.

10. Freinuth, P. I., and H. S. Ginsberg. 1986. Codon insertionmutants of the adenovirus terminal protein. Proc. Natl. Acad.Sci. USA 83:7816-7820.

11. Gerard, R. D., and Y. Gluzman. 1985. New host cell system forregulated simian virus 40 DNA replication. Mol. Cell. Biol.5:3231-3240.

12. Horwitz, M. S., and H. Ariga. 1981. Multiple rounds of adeno-virus DNA synthesis in vitro. Proc. Natl. Acad. Sci. USA78:1476-1480.

13. Jones, K. A., J. T. Kadonaga, P. J. Rosenfeld, T. J. KeDly, and R.Tjian. 1987. A cellular DNA-binding protein that activateseukaryotic transcription and DNA replication. Cell 48:79-89.

14. Kelly, T. J. 1984. Adenovirus DNA replication, p. 271-308. InH. S. Ginsberg (ed.), The adenoviruses. Plenum Press, NewYork.

15. Kenny, M. K., L. A. Balogh, and J. A. Hurwitz. 1988. Initiationof adenovirus DNA replication. I. Mechanism of action of a host

protein required for replication of adenovirus DNA templatesdevoid of the terminal protein. J. Biol. Chem. 263:9800-9808.

16. Kenny, M. K., and J. Hurwitz. 1988. Initiation of adenovirusDNA replication. II. Structural requirements using syntheticoligonucleotide adenovirus templates. J. Biol. Chem. 263:9809-9817.

17. Kiessig, D. F., S. A. Rice, V. Cleghon, D. E. Brough, J. F.Williams, and K. Voelkerding. 1986. Studies on the adenovirusDNA-binding protein. Cancer Cells 4:485-496.

18. Lichy, J. H., J. Field, M. S. Horwitz, and J. Hurwitz. 1982.Separation of the adenovirus terminal protein precursor from itsassociated DNA polymerase: role of both proteins in the initi-ation of adenovirus DNA replication. Proc. Natl. Acad. Sci.USA 79:5225-5229.

19. O'Neill, E. A., and T. J. Kelly. 1988. Purification and charac-terization of nuclear factor III (origin recognition protein C), asequence-specific DNA binding protein required for efficientinitiation of adenovirus DNA replication. J. Biol. Chem. 263:931-937.

20. Petterson, U., and R. J. Roberts. 1986. Adenovirus gene expres-sion and replication: a historical review. Cancer Cells 4:37-57.

21. Pettit, S. C., M. S. Horwitz, and J. A. Engler. 1988. Adenoviruspreterminal protein synthesized in COS cells from cloned DNAis active in DNA replication in vitro. J. Virol. 62:496-500.

22. Pettit, S. C., M. S. Horwitz, and J. A. Engler. 1989. Mutants ofthe precursor to the terminal protein of adenovirus serotypes 2and 5. J. Virol. 63:5244-5250.

23. PruiJn, G. J. M., R. T. van Miltenburg, J. A. J. Claessens, andP. C. van der Vliet. 1986. Interaction between the octamer-binding protein nuclear factor III and the adenovirus origin ofDNA replication. J. Virol. 62:3092-3102.

24. Roovers, D. J., P. F. Overman, X. Chen, and J. S. Sussenbach.1991. Linker mutation scanning of the genes encoding theadenovirus type 5 terminal protein precursor and DNA poly-merase. Virology 180:273-284.

25. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

26. Schaack, J., W. Y. Ho, P. Freimuth, and T. Shenk. 1990.Adenovirus terminal protein mediates nuclear matrix associa-tion and efficient transcription of adenovirus DNA. Genes Dev.4:1197-1208.

27. Shu, L., J. S. Hong, Y. F. Wei, and J. A. Engler. 1986.Nucleotide sequence of the genes encoded in early region 2B ofhuman adenovirus serotype 2. Gene 46:187-195.

28. Shu, L., M. S. Horwitz, and J. A. Engler. 1987. Expression ofenzymatically active adenovirus DNA polymerase from clonedDNA requires sequences upstream of the main open readingframe. Virology 161:520-526.

29. Shu, L., S. C. Pettit, and J. A. Engler. 1988. The precisestructure and coding capacity of mRNAs from early region 2Bof human adenovirus serotype 2. Virology 165:348-356.

30. Stillman, B. W., J. B. Lewis, L. T. Chow, M. B. Mathews, andJ. E. Smart. 1981. Identification of the gene and mRNA for theadenovirus terminal protein precursor. Cell 23:497-508.

31. Tremblay, M. L., C. V. Dery, B. G. Talbot, and J. Weber. 1983.In vitro cleavage specificity of the adenovirus type 2 proteinase.Biochim. Biophys. Acta 743:239-245.

32. Zaballos, A., J. M. Lazaro, E. Mendez, R. P. Mellado, and M.Salas. 1989. Effects of internal deletions on the priming activityof the phage +29 terminal protein. Gene 83:187-195.

33. Zaballos, A., and M. Salas. 1990. Functional domains in thebacteriophage +29 terminal protein for interaction with the +29DNA polymerase and DNA. Nucleic Acids Res. 17:10353-10366.

34. Zhao, L. J., and R. Padmanabhan. 1988. Nuclear transport ofadenovirus DNA polymerase is facilitated by interaction withpreterminal protein. Cell 55:1005-1015.

VOL. 65, 1991

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 04

Jan

uary

202

2 by

31.

208.

233.

75.