lincrna-ror and mir-145 regulate invasion in triple ...m2rtta (addgene 20342) at the 1:8 ratio....

Genomics

lincRNA-RoR and miR-145 Regulate Invasion inTriple-NegativeBreast Cancer via TargetingARF6Gabriel Eades, Benjamin Wolfson, Yongshu Zhang, Qinglin Li, Yuan Yao, and Qun Zhou

Abstract

Triple-negative (ER�, HER2�, PR�) breast cancer (TNBC) is anaggressive disease with a poor prognosis with no available molec-ularly targeted therapy. Silencing of microRNA-145 (miR-145)may be a defining marker of TNBC based on molecular profilingand deep sequencing. Therefore, the molecular mechanismbehind miR-145 downregulation in TNBC was examined. Over-expression of the long intergenic noncoding RNA regulator ofreprogramming, lincRNA-RoR, functions as a competitive endog-enous RNA sponge in TNBC. Interestingly, lincRNA-RoR is dra-matically upregulated in TNBC and in metastatic disease andknockdown restoresmiR-145 expression. Previous reports suggestthat miR-145 has growth-suppressive activity in some breastcancers; however, these data in TNBC indicate that miR-145 doesnot affect proliferation or apoptosis but instead, miR-145 regu-

lates tumor cell invasion. Investigation of miR-145-regulatedpathways involved in tumor invasion revealed a novel target, thesmall GTPase ADP-ribosylation factor 6 (Arf6). Subsequent anal-ysis demonstrated that ARF6, a known regulator of breast tumorcell invasion, is dramatically upregulated in TNBC and in breasttumor metastasis. Mechanistically, ARF6 regulates E-cadherinlocalization and affects cell–cell adhesion. These results reveala lincRNA-RoR/miR-145/ARF6 pathway that regulates invasion inTNBCs.

Implications: The lincRNA-RoR/miR-145/ARF6 pathway iscritical to TNBC metastasis and could serve as biomarkers ortherapeutic targets for improving survival. Mol Cancer Res; 13(2);330–8. �2014 AACR.

IntroductionBreast cancer is the second leading cause of cancer-related deaths

among women (1). Obstacles to improving clinical outcomesinclude better understanding of disease recurrence, overcomingdrug resistance, and preventing metastasis. Improvements inbreast cancer clinical treatment have come from rationallydesigned molecularly targeted therapeutics. For patients withestrogen receptor (ER)–positive disease, antiestrogen treatments,including selective ER modulators and aromatase inhibitors, havebeen a major success story. Furthermore, treatment of HER2/neu-overexpressing breast cancers with the recombinant humanizedanti-HER2 monoclonal antibody trastuzumab has dramaticallyimproved prognosis for these patients. For patients with triple-negative breast cancer (TNBC), those lacking ER, PR, and HER2expression, there are currently no available molecularly targetedtherapeutics (2). TNBC accounts for around 20% of cases of breastcancer in the United Stated where it is frequently observedin younger women and African American women (3). TNBCis frequently aggressive and fast growing but it does respondto chemotherapy. Nevertheless, understanding the molecular

mechanisms driving TNBC will allow rational target selectionand new drug development.

Dysregulation of microRNAs (miR) is emerging as a majorcontributor to tumorigenesis in breast cancers. In a recent study,Volinia and colleagues (4) examined breast tumor deepsequencing data in an attempt to identify miRs linked withbreast tumor invasiveness. When comparing miR dsyregulationin different molecular subtypes, they found that miR-145 wasamong themost significantly repressedmiRs in TNBC.miR-145 isa reported growth suppressor downregulated in many cancer,including lung (5), prostate (6), breast (7), colon (8), and bladdercancers (9).

Recently, a role for miR-145 in the regulation of embryonicstem cell (ESC) renewal was reported (10). Levels of miR-145 inESCs remain low, whereas upon forced differentiation, miR-145levels increase dramatically and levels of pluripotency factorsOCT4, SOX2, and KLF4 decrease. OCT4, SOX2, and KLF4 wereall confirmed to be direct targets of miR-145 in ES cells andembryoid bodies. In addition to regulating ESC renewal,miR-145has also been shown to be a regulator of adult stem cell renewal.miR-145 was found to regulate mesenchymal stem celldifferentiation by targeting SOX9 (11), a master regulator ofchondrocyte maturation that has also been implicated as animportant regulator of the mammary stem cell state (12).

Long noncoding RNAs (lncRNA) are noncoding RNAmolecules greater than 200 nucleotides in size that are oftencritical regulators of gene expression. A majority of lncRNAs areintergenic [long intergenic ncRNA (lincRNA); ref. 13]. They aretranscribed by RNA pol II, polyadenylated, spliced, and 50 capped(14). LncRNAs are functionally diverse and can act as guides,tethers, decoys, and scaffolds (15). A new function of lncRNA hasalso been proposed, that of competitive endogenous RNA(ceRNA) for miRs or naturally occurring miR sponges. Such

Greenebaum Cancer Center, Department of Biochemistry and Molec-ular Biology, University of Maryland School of Medicine, Baltimore,Maryland.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Corresponding Author: Qun Zhou, Department of Biochemistry and MolecularBiology, University of Maryland School of Medicine, 108 North Greene Street,Baltimore MD 21201. Phone: 410-706-1615; Fax: 410-706-8297; E-mail:[email protected]

doi: 10.1158/1541-7786.MCR-14-0251

�2014 American Association for Cancer Research.

MolecularCancerResearch

Mol Cancer Res; 13(2) February 2015330

on May 14, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst September 24, 2014; DOI: 10.1158/1541-7786.MCR-14-0251

http://mcr.aacrjournals.org/

ceRNA networks have been identified as key regulators of muscledifferentiation (16) and in the PTEN tumor-suppressor pathway(17).

Recently, lncRNAs were implicated in stem cell pluripotency.Loewer and colleagues (18) identified lincRNA-RoR (regulatorof reprogramming) as a major regulator of pluripotencyby examining lncRNA expression, following fibroblastreprogramming into induced pluripotent stem cells (iPSC).lincRNA-RoR was dramatically upregulated in pluripotent cells.Furthermore, they found that lincRNA-RoR was essential for iPSCderivation. Wang and colleagues (19) also examined the role oflincRNA-RoR in ESCs and found that lincRNA-RoR is essentialfor ESC pluripotency. Furthermore, they found that lincRNA-RoR functions as ceRNA for miR-145, thereby protecting corepluripotency factors from miR-mediated silencing. This groupfound that this interaction led to loss of mature miR-145expression. Using RNA immunoprecipitation experiments theyvalidated the interaction of miR-145 with lincRNA-RoR, whichthey found could be disrupted bymutating bases in the target sitesfor miR-145 seed pairing.

ARF proteins (ARF1-6) are small GTPases that regulatemembrane protein trafficking and endocytosis (20). ARF6was previously implicated in tumor cell invasion in breast(21), brain (22), and skin (23, 24) cancer. In breast cancer,ARF6 was found to be essential for tumor cell–invasivephenotype (21). Hyperactivation of ARF6 was able toimpart metastatic characteristics to nonmetastatic breastcancer cells. It was hypothesized that ARF6 may function byinhibiting cell–cell adhesion or regulating formation ofinvadopodia. This group found that protein, but not mRNAlevels of ARF6, correlated with breast tumor invasiveness andsuggested that in metastatic breast cancer, ARF6 was likelyregulated via posttranscriptional mechanisms (21). It ispossible that miRs may play an important role in regulatingARF6 expression.

Here, we find that in TNBC loss of miR-145 promotes tumorcell invasion in which activation ofmiR-145 can inhibit invasion.We examine themolecularmechanisms formiR-145 loss and findthat overexpression of lincRNA-RoR in breast tumors mayfunction as ceRNA, thereby silencing miR-145. Next, weidentify a novel target of miR-145, the small GTPase ARF6,which was previously implicated in the breast tumor–invasiveprocess. We find that competitive inhibition of miR-145 bylincRNA-RoR results in ARF6 overexpression. We examine thefunction of ARF6 in breast cancer cells and find that ARF6 canaffect cell–cell adhesion (via localization of E-cadherin) andtumor cell invasion. Furthermore, we find that in clinicalsamples ARF6 protein levels are higher in lymph nodemetastasis compared with primary tumors, suggesting that thisprotein may play an important role in the metastatic process.

Materials and MethodsCell culture

HEK293T, MCF-7, HS578T, and MDA-MB-231 cells weremaintained in DMEM with 5% FBS and 1% glutamine(Invitrogen). MCF10A were grown in DMEM/F-12 mediumsupplemented with 10 mg/mL insulin, 100 ng/mL choleratoxin, 0.5 mg/mL hydrocortisone (Sigma), 20 ng/mL EGF,and 5% horse serum (Invitrogen). Cells were grown at 37�Cin an atmosphere containing 5% CO2.

Human tissue arrayImmunostaining of paraffin-embedded breast tumor tissue

microarray (TMA; BR952; US Biomax) was performed to detectARF6 protein expression. Additional paraffin-embedded ductalcarcinoma in situ (DCIS) samples were obtained from theUniversity of Maryland Pathology Biorepository and ResearchCore. Sections were deparaffinized and rehydrated using xyleneand gradient ethanol. Antigens were retrieved by boiling insodium citrate (10 mmol/L, pH 6.0), which was proceeded byblocking in 10%, goat serum in PBS for 1 hour. This was followedby overnight incubation (at 4�C) withmouse anti-ARF6, 1:200 inblocking buffer (Santa Cruz Biotechnology; sc7971) followedwith biotin goat anti-mouse secondary antibody (1:200). TheAvidin-Biotin Peroxidase Substrate Kit (Vector Laboratories) wasused to develop brown precipitate. Hematoxylin was used fornuclei staining. Using light microscopy, cores were scored on a 0to 3 scale (none, light, moderate, and intense) for stainingintensity of ARF6.

RNA quantificationTotal RNA was extracted with TRizol reagent (Invitrogen). Small

RNA was converted to complimentary DNA using the poly-Apolymerase–based First-Strand Synthesis Kit (SABioscience).Subsequent miR analysis was performed by real-time PCR withmiR-145 primer assays (SABiosciences) normalizing to control U6snRNA levels. Total RNA was converted to cDNA by first treatingwith DNase I to remove genomic DNA and then using M-MLVreverse transcriptase (Invitrogen) and oligodT12-18 or randomhexamer primers. The following primers were used for qRT-PCR.ROR F: CTCAGTGGGGAAGACTCCAG, R: AGGAAGCCTGAGAG-TTGGC. ARF6: F: ATGGGGAAGGTGCTATCCAAAATC R: GCAG-TCCACTACGAAGATGAGACC, pri-miR-145: F: AGGGCCAGCAG-CAGGC R: TCAGGAAATGTCTCTGGCTGTG, pre-miR-145: F: GT-CCAGTTTTCCCAGGAATC R:AGAACAGTATTTCCAGGAAT. ARF6and ROR data were normalized to GAPDH using the followingprimers: F: GAAGGTGAAGGTCGGAGTC, R: GAAGAT-GGTG-ATGGGATTTC. All real-time PCR was carried out with the LightCycler 480 II (Roche Diagnostics).

Western blotting and proliferation assayWestern blotting was performed as previously described (25)

using ARF6 (Santa Cruz Biotechnology 3A-1), E-cadherin (BDTransduction), or N-cadherin (Santa Cruz Biotechnology H-63)antibodies. Data were normalized to b-actin (Sigma). Forproliferation assays, 1 � 10^4 MDA-MB-231 cells (control andoverexpressing miR-145) were plated in 96-well plates. After 3days, MTT solution was added to wells [final (0.5 mg/mL)]. Cellswere incubated for 4hours at 37�C.Mediawere removed andMTTformazan crystals were solubilized in DMSO. Absorbance wasmeasured at 560 nm in a microplate reader (Bio-Rad).

Plasmids, transfections, and luciferase assaypCMV-miR-145 expression vector and pCMV-MIR control

vectors were obtained from Origene. pBabe–lincRNA-RoR wasobtained from Addgene (plasmid 45763). shRNA for lincRNA-RoR and scramble control shRNA was purchased from Origeneusing pGFP-C-shLenti backbone and the following targetsequence: GGAAGCCTGAGAGTTGGCATGAAT and loop: TC-AAGAG. Constitutively active ARF6 (Q67L) expression vectorwas obtained from Addgene (plasmid 10835). ARF6 30-untranslated region (UTR) was amplified using the following

lincRNA-RoR and miR-145 Regulate Invasion in Triple-Negative Breast Cancer

www.aacrjournals.org Mol Cancer Res; 13(2) February 2015 331




primers: F: CAGTACGCTAGCACCTGCTCCAGTCACCAATG R:CAGTACCTCGAGAAACTTAG CCCACAGTGGCA. PCR productwas cloned downstream luciferase ORF into NheI and XhoI sitesin pSGG 30UTR reporter (SwitcGear Genomics). For pSGG–RORluciferase reporter construct, ROR cDNA was amplified using theprimers 50-ACAATGCTCGAGTTTATTTTTTGAGGAACTGTCATA-30

and 50-ACAATGGCTAGCG GTGAAATAAACAGCCATGTTGCT-30

and cloned into the NheI and XhoI sites of pSGG vector.Transient transfections were performed using lipofectamine 2000according to the manufacturer's instructions (Invitrogen). Stableinfections were performed for lentiviral constructs. Briefly,HEK293T cells were transfected with second-generation lentiviralpackaging constructs and expression constructs. After 12 hours,mediumwas changed and at 24 and 48 hours lentivirus containingsupernatant was harvested. Cells were infected with viruscontaining medium containing 8 mg/mL polybrene (AmericanBioanalytical). Luciferase reporter assays were performed aspreviously described using the dual luciferase assay system(Promega) normalizing to Renilla luciferase activity (26).

tet-ON–lincRNA-RoR. The ROR cDNA was amplified by PCRusing primers 50-ACAATGGAATTCTTTATTTTTTGAGGAACTG-TCATA-30 and 50-ACAATGGAATTCGGTGAAATAAACAGCCA-TGTTGCT-30, and cloned into the EcoRI sites of FUW-tetovector (Addgene: 20326). Cells were cotransfected with FUW-M2rtTA (Addgene 20342) at the 1:8 ratio.

Fluorescence in situ hybridization of lincRNA-RoRCy3-labed lincRNA-RoR probe was obtained from Exiqon.

Cells were fixed in 4% formaldehyde and permeabilized using0.5% Triton-X-100 in PBS, followed by blocking with 3% BSA in4� saline–sodium citrate buffer. Cells were hybridized for 1 hourat 60�C with lincRNA-RoR probes (2 ng/mL dilution in buffercontaining 10% dextran sulfate in 4� saline–sodium citratebuffer). Cells were washed in 4�, 2�, 1� saline–sodiumcitrate buffer and slides mounted in Prolong Gold.

MS2-binding assayTwenty-four MS2-binding sites were cloned downstream of

pBABE–lincRNA-ROR (ROR-MS2). The Phage-cmv–cfp–24xms2vector (Addgene 40651) was digested with BamHI, treated withT4 DNA polymerase and then digested with AgeI. The vectorbackbone was recovered. The ROR cDNA was amplified by PCRusing the primers 50-ACAATGACCGGTGGTGAAATAAACA-GCCATGTTGCT-30 and 50-ACAATGCTCGAGTTTATTTTTTGA-GGAACTGTCATA-30, treated with T4 DNA polymerase andAgeI sequentially and cloned into the phage-cmv-24xms2vector prepared as described above. phage–ubc–nls–ha–tdMCP–gfp (MS2–GFP) fusion construct was obtained fromAddgene (plasmid 40649). Cells were cotransfected with ROR–MS2 and MS2–GFP constructs and GFP localization wasmonitored with confocal microscopy.

Three-dimensional cell culture and immunofluorescenceMCF-10A cells were dissociated into single cells and cultured

with DMEM/F-12 containing 5% Matrigel, 5% heat-inactivatedFBS, 0.5 mg/mL hydrocortisone, 100 ng/mL cholera toxin, 10 mg/mL insulin, 10 ng/mL EGF, and 5 mmol/L Y-27632. Cells wereembedded into Matrigel-coated chamber-slides and grown for 7to 14 days with replacement of fresh assay medium every 4 days.MDA-MB-231 cells transfected with control or miR-145expression vectors were grown in chamber slides for 48 hours.

Fluorescencewas visualizedusing anOlympus IX81 spinning diskconfocal microscope. Immunofluorescence staining wasperformed as previously described (27), by costaining withARF6 and E-cadherin antibodies or Ki67 antibody (Sigma;SAB4501880) followed by Alexa Fluor–conjugated secondaryantibodies (Life Technologies) and DAPI counterstaining

Transwell invasion assayInvasion assays were carried out using Transwell migration

chambers (8-mm pore size; Costar) coated with 0.5 mg/mLMatrigel (BD Biosciences) on top of the membrane. A total of0.5 � 10^5 cells/mL were seeded in the upper chamber inserum-free medium. The lower chamber contained 15% FBS.The cells were allowed to migrate toward the 15% FBS gradientovernight. Nonmigrated cells on the top of the membrane wereremoved with cotton swabs. The migrated cells were stainedwith 1% crystal violet in methanol/PBS and counted using alight microscope.

The Cancer Genome AtlasData from The Cancer Genome Atlas (TCGA) were analyzed

using the UCSC Cancer Genome Browser (http://genome-cancer.soe.ucsc.edu/). The publicly available dataset analyzed was theTCGA breast–invasive carcinoma exon expression by RNAseq(IlluminaHiSeq) N ¼ 1,160. ER, PR, and HER2 status wereanalyzed using UCSC Cancer Browser tools.

Statistical analysisStatistical analysis was performed using the Student t test and P

values of<0.05were considered significant.Datawere representedas mean� SE. GraphPad Prism 4.0 software was used for all dataanalysis.

ResultsmiR-145 is downregulated in TNBC inwhichmiR-145 regulatesbreast tumor cell invasion

The molecular underpinnings of TNBC are poorly understoodand as such, there are no available molecularly targeted therapies.To gain a better understanding of the pathways drivingtumorigenesis in TNBC, we began by examining the uniquemiR signatures of this breast cancer subtype. Analysis of breasttumor deep sequencing data had previously revealed that miR-145 loss is a hallmark of TNBC (4). We began our study by usingpublicly available databases to verify previous observationsregarding miR-145 expression. We examined RNAseq datafrom TCGA, which contained data from 1,106 breast cancerpatient samples. As shown in Fig. 1A, miR-145 isdownregulated in nearly every breast tumor sample comparedwith normal breast tissue (fold D and P value shown inSupplementary Fig. S1; ref. 28). Furthermore, we examined ER,PR, and HER2 status in patient data from TCGA and found thatpatients with TNBC clustered with the tumors having the lowestmiR-145 expression. We also examined miR-145 expression inseveral samples of invasive ductal carcinoma (IDC) and matchednormal tissue and again identified miR-145 loss in all samples ofbreast tumor tissue (Fig. 1B). Next, we examined TNBC cellmodels MDA-MB-231 and HS578T compared with theenontumorigenic mammary epithelial cell line MCF10A andthe ER-positive breast cancer cell line MCF-7. We observed thestrongest repression of miR-145 in TNBC models compared with

Eades et al.

Mol Cancer Res; 13(2) February 2015 Molecular Cancer Research332




nontumorigenic mammary epithelial cells or ER-positive breastcancer cells (Fig. 1C). Combinedwith previous studies, these datastrongly indicate that miR-145 is dramatically silenced in TNBC.

Next, we began investigating what function miR-145 may playin TNBC. In ER-positive breast cancer, miR-145 was previouslyshown to regulate tumor cell proliferation (29). We examinedthe impact of miR-145 overexpression on the proliferation onMDA-MB-231 cells. We found that in TNBC cells miR-145activation failed to significantly affect cell proliferation asexamined via MTT assay (Fig. 1D). Furthermore, we alsoexamined cell proliferation by performing Ki67 staining. Wefound that nearly 100% of control MDA-MB-231 cells andmiR-145-overexpressing cells positively stained for nuclearKi67, indicating active proliferation (Supplementary Fig. S2A).We next examined what impact miR-145 might have on tumorcell invasion in TNBC.We grew cells onMatrigel-coated Transwellinserts and tested the impact of miR-145 overexpression. Wefound that miR-145-overexpressing TNBC cells demonstrated a

significant decrease in tumor cell invasion compared with controlcells (Fig. 1E and F). These data suggest thatmiR-145may regulateinvasion-related gene expression in TNBC. We also confirmedthese results in a separate TNBC cell line, HS578T, again findingthat miR-145 affects invasion but not proliferation in TNBC cells(Supplementary Fig. S2B and S2C).

lincRNA-RoR is overexpressed in TNBC in which it serves ascompetitive endogenous RNA for miR-145

We next wanted to identify the molecular mechanismsresponsible for miR-145 downregulation in TNBC. It wasrecently shown that in ESCs miR-145 is subjected toposttranscriptional regulation via competitive endogenous RNA(19) . lincRNA-RoR was found to contain miR-145-bindingelements and function as a competitive sponge for miR-145binding. To test whether lincRNA-RoR might regulate miR-145inTNBC,webeganby examining the expressionprofile of lincRNA-RoR in normal breast tissue, early-stage tumors (DCIS), and

TCGA breast invasive carcinoma (BRCA) exon expression by RNAseq (IlluminaHiSeq)

ER

miR-145

A

B

D

F

E

C

miR-145Control

miR-145Control

miR-145Control

MTT Cell invasion

miR-145

Normal IDC 10A MCF7 578T 231

n = 31.5

1.0

0.5

0.0

1.0

0.5

0.0

Rel

ativ

e ex

pres

sion

1.5

1.0

0.5

0.0

Rel

ativ

e su

rviv

al

Inva

ded

cells

per

fiel

d 400

300

200

100

0

Rel

ativ

e ex

pres

sion

PR HER2

Tumorn = 974

Normal

1.0 0 –1.0

Figure 1.miR-145 is downregulated in TNBCcells inwhichmiR-145 regulates breasttumor cell invasion. A, RNAseq datafor miR145 in a breast tumor datasetfrom TCGA. B, expression profilingof miR-145 in normal and breasttumor tissues via qRT-PCR withnormalization to U6 snRNA.C, miR-145 expression measured innontumorigenic MCF-10A mammaryepithelial cells and compared withMCF-7 (ERþ), HS578T (TNBC), andMDA-MB-231 (TNBC) tumor cells. D,cell proliferation as measured byMTT assay for MDA-MB-231 cellstransfected with control or miR145expression plasmids. E and F, MDA-MB-231 cells overexpressing miR-145were cultured in Transwell invasionassays; � , P < 0.05.






invasive breast tumors (IDC) using qRT-PCR. We found thatlincRNA-RoR was significantly upregulated in DCIS and IDCtumor tissues, showing the highest expression in invasive tumortissues (Fig. 2A). Next, we examined lincRNA-RoR in breast cancercell lines. We found that lincRNA-RoR was significantlyoverexpressed in MDA-MB-231 and HS578T TNBC cells whencompared with normal tissue (Fig. 2B). Subsequently, wewanted to examine cellular localization of lincRNA-RoR toprobe its potential to interact with cytoplasmic miR-145. Weperformed in situ hybridization and were able to detect lincRNA-RoR in the cytoplasm and nucleus of breast cancer cells(Supplementary Fig. S3A). For further confirmation, weperformed MS2-binding assays, in which we cloned 24 MS2-binding sites downstream of lincRNA-RoR, and tested the abilityfor a GFP–MS2 fusion protein with a nuclear localization signal tosequester lincRNA-RoR–MS2 in the cytoplasm. In the absence oflincRNA-RoR–MS2, all the GFP–MS2 is localized in the nucleus(Supplementary Fig. S3B). However, in the presence of lincRNA-RoR–MS2, there are foci of GFP–MS2 in the cytoplasm. Theseresults also support the cyoplasmic localization of lincRNA-RoRin which it may interact with miR-145.

We next wanted to confirm the interaction of miR-145 with thesites predicted by Miranda (30) targeting algorithms (Fig. 2C). Webegan by testing the impact of lincRNA-RoR overexpression on

miR-145 levels in HEK-293t cells (which lack lincRNA-RoRexpression). We found that lincRNA-RoR overexpression resultedin a significant decrease in miR-145 levels (Fig. 2D). Next, weexamined the impact of cotransfection of miR-145 and lincRNA-RoR and found that cotransfection overcame the negativerepression of endogenous miR-145 and resulted in decreasinglincRNA-RoR levels. This suggests a tug of war between thesetwo molecules with some threshold where either the miR or thelincRNA gains the upper hand and silences its partner. We alsocloned lincRNA-RoR sequence into a luciferase miR reporterconstruct to examine the ability of miR-145 to bind sequencesin lincRNA-RoR.We found thatmiR-145overexpression resulted indecreased luciferase activity compared with control cells (Fig. 2F),indicating miR-145 binding to sites in lincRNA-RoR. Next, weexamined this interaction in breast cancer cell lines. We foundthat lincRNA-RoR overexpression resulted in decreasing mature,but not primary or precursor miR-145 levels in MDA-MB-231TNBC cells (Fig. 2G). Finally, using lentiviral shRNA, weknocked down lincRNA-RoR in MDA-MB-231 cells and foundthat this lead to an increase in miR-145 expression. Takentogether, these results suggest that in TNBC cells lincRNA-RoRcan function as a sponge and repress miR-145 expression.

Finally, we examined whether lincRNA-RoR regulation of miR-145 could affect breast cancer cell invasion. We transfected MCF7

miR-145

A B

D

H I

F GE

C

ROR +miR-145

RORControl

Control

ROR +miR-145

ROR +Control

pre-miR-145

pri-miR-145

miR-145Empty miR-145Control

RORControl

miR-145

Normal IDCDCIS

linc-ROR

linc-ROR

linc-ROR

linc-ROR

shRORshROR Control shROR

shScramble

10A MCF7 578T231

15

10

5

0

Rel

ativ

e ex

pres

sion

1.5

1.0

0.5

0.0Rel

ativ

e ex

pres

sion

1.5

1.0

0.5

0.0Rel

ativ

e ex

pres

sion

1.5

1.0

0.5

0.0Rel

ativ

e lu

cife

rase

Act

. Luciferase-ROR

miR145-Binding elements in linc-RNA–ROR

140

130

120

Rel

ativ

e ex

pres

sion

4

3

2

1

0

Rel

ativ

e ex

pres

sion

1.5

1.0

0.5

0.0Rel

ativ

e ex

pres

sion 2.5

2.0

1.5

1.0

0.5

0.0Rel

ativ

e ex

pres

sion

1.5

1.0

0.5

0.0

Figure 2.LincRNA-RoR is overexpressed in TNBC where it serves as competitive endogenous RNA for miR-145. A, lincRNA-RoR expression in breast tumor tissues asmeasured by qRT-PCR. B, lincRNA-RoR expression in breast cancer cell lines. C, miR-145 response element in lincRNA-RoR as predicted by MiRanda 4.0algorithm. D, miR-145 expression analysis following lincRNA-RoR overexpression in HEK-293T cells. E, lincRNA-RoR expression analysis following miR-145overexpression inHEK-293T cells. F, luciferase reporter assay for lincRNA-RoR inHEK-293T cells overexpressingmiR-145. G,miR-145 expression analysis inMDA-MB-231 breast cancer cells following lincRNA-RoR overexpression. H, fluorescent images of MDA-MB-231 cells stably infected with lincRNA-RoR shRNA. I,expression analysis of lincRNA-RoR and miR-145 following lincRNA-RoR knockdown via qRT-PCR; � , P < 0.05.

Eades et al.





cells with tetON–lincRNA-RoRþ rtTA and after 24 hours inducedlincRNA-RoR expression with 100 ng/mL doxycycline. Inducedcells were grown atop Matrigel-coated Transwell inserts and cellswere allowed to migrate for 24 hours. Following 24 hours, weobserved a significant increase in invasive cells, whereas controlMCF7 cells showed little to no invasive activity (SupplementaryFig. S4A).

miR-145 directly targets the 30UTR of ARF6 mRNAIn addition to understanding the molecular mechanisms

underlying the regulation of miR-145, we wanted to probewhat invasive pathways miR-145 might regulate in TNBC cells.We examined computationally predicted targets ofmiR-145 usingTargetScan algorithm (31). Among the highest scoring predictedmRNA targets of miR-145 was ADP-ribosylation factor 6 (ARF6).ARF6 is a small GTPase that has been previously implicated as acritical regulator of tumor cell invasion inmetastatic breast cancer(21). A previous proteomics study revealed that miR143/145modulation altered ARF6 protein levels in colon cancer cells,

suggesting that ARF6 might be a direct target for miR-145 (32).ARF6 mRNA 30UTR contains an impressive five predicted miR-145-binding elements (Fig. 3A). We began by examining ARF6expression in TNBC. We found that ARF6 demonstrated inverseexpression relative to miR-145. ARF6 was dramaticallyoverexpressed in TNBC cells compared with nontumorigenicmammary epithelial cells (Fig. 3B and C). To test the predictedbinding of miR-145 to ARF6 mRNA, we cloned the ARF6 30UTRdownstream a luciferase ORF and performed luciferase reporterassays for ARF6 30UTR.We found that overexpression of miR-145resulted in a significant decrease in luciferase activity comparedwith control cells (Fig. 3D). Next, we examined ARF6 expressionin MDA-MB-231 cells following miR-145 overexpression. Wedetected a small but significant decrease in ARF6 mRNA levelsfollowing miR-145 overexpression (Fig. 3E). However, followingmiR-145 overexpression, we detected a dramatic decrease in ARF6protein levels (Fig. 3F). These data suggest that miR-145inhibition of ARF6 is mostly occurring by interfering withARF6 translation. Finally, to test whether our previously

A B

D E F

G H

C

miR-145Control miR-145Control

miR-145Control

ARF6Control

ARF6

ARF6 mRNAARF6 3′UTR

ARF6

Control

Control

10A

ARF6 mRNA

ARF6 (26 kD)

Actin (42 kD)

ARF6 (26 kD)

Actin (42 kD)

ARF6 (26 kD)

E-Cad (135 kD)

Actin (42 kD)

MCF7

MCF7 578T231

10A 231

1.5

1.0

0.5

0.0Rel

ativ

e ex

pres

sion

6

4

2

0Rel

ativ

e ex

pres

sion

20

15

10

5

0Inva

ded

cells

per

fiel

d

1.5

1.0

0.5

0.0

Rel

ativ

e lu

cife

rase

act

ivity

miR-145-Binding elements in ARF6 mRNA 3′UTR

Figure 3.miR-145 directly targets the 30UTR of ARF6mRNA. A, table of the predictedmiR-145-binding sites in theARF6mRNA30UTR as predicted by TargetScan algorithm. B,ARF6 mRNA expression in breast cancer cell lines via qRT-PCR. C, ARF6 protein expression in MDA-MB-231 cells. D, luciferase reporter for ARF6 mRNA 30UTRfollowing miR-145 overexpression. E, ARF6 mRNA levels in MDA-MB-231 cells following miR-145 overexpression. F, ARF6 protein levels in MDA-MB-231 cellsfollowing miR-145 overexpression. G and H, MCF-7 cells overexpressing constitutively active ARF6. A loss of E-cadherin demonstrated via Western blotting and amore invasive phenotype as evidenced by Matrigel-coated invasion assays; � , P < 0.05.






identifiied interaction between lincRNA-RoR and miR-145 affectthe targeting of ARF6 mRNA by miR-145, we examined ARF6protein levels following knockdown of lincRNA-RoR by shRNA.We found that knockdown of lincRNA-RoR inMDA-MB-231 cellsresulted in decrease in ARF6 protein (Supplementary Fig. S4B).These results support a lincRNA-RoR/miR-145/ARF6 pathway inTNBC cells.

It was previously reported that ARF6 might contribute tobreast cancer invasion via regulating invadopodia or byregulating cell–cell adhesion through controlling E-cadherinlocalization (33, 34). This group found that in the presence ofEGF ligand (activating EGFR signaling) ARF6 was able torepress E-cadherin at the protein level. We examined theimpact of overexpression of constitutively active ARF6 on theinvasive activities of nonmetastatic MCF-7 breast cancer cells.As confirmation of the earlier observations, we found that inthe presence of EGF, MCF-7 cells overexpressing ARF6 showed adecrease in E-cadherin protein levels (Fig. 3G). Furthermore,MCF-7 cells overexpressing ARF6 were capable of invading

Matrigel in Transwell invasion assays as evidenced by thestaining of invasive protrusions on the bottom of Transwellinserts, whereas control MCF-7 cells demonstrated no invasivecapabilities in this assay (Fig. 3H).

ARF6 overexpression alters E-cadherin localization anddisrupts cell–cell junctions

To further examine the potential importance of ARF6overexpression in breast cancer, we performed gain-of-functionstudies in MCF10A nontumorigenic mammary epithelial cells.We performed three-dimensional (3D) cell culture experimentswith MCF10A cells overexpressing ARF6 and examined E-cadherin localization using immunofluorescence. 3D cellculture can be used to recapitulate mammary organogenesis inwhich control MCF10A cells grow into hollow acinar structureswithpolarized luminal andbasolateral surfaces. ControlMCF10Acells formed hollow acinii structures with E-cadherin localizationto cell–cell junctions (Fig. 4A). In ARF6-overexpressing MCF10Acells, there was an obvious loss of E-cadherin expression andlocalization to cell–cell junctions. Furthermore, morphology ofARF6-overexpressing acinii was altered with greater spacingbetween nuclei as evidenced by DAPI staining, suggesting adisruption in cell–cell junctions.

The miR-145 target ARF6 is overexpressed in lymph nodemetastasis

As there is previously no clinical data suggesting that ARF6expression is associated with breast tumor invasiveness, weexamined ARF6 expression using IHC in a TMA with coresamples from matched normal breast, primary tumor, andlymph node metastasis (Fig. 4B). We detected higher levelsof ARF6 in some samples of primary tumor (IDC); however, itdid not account for a statistically significant difference withARF6 levels detected in our normal breast tissue. On the otherhand, we did detect a statistically significant increase in ARF6

10A Control 10A ARF6

AR

F6

E-C

adhe

rinD

AP

I

NormalBA

DCIS

IDC MET

Normal

3

2

1

0DCIS

*P < 0.03

3 = Intense2 = Moderate1 = Light0 = None

IDC Met

Mer

ge

Figure 4.The miR-145 target ARF6 isoverexpressed in lymph nodemetastasis. A, 3D cell culture ofMCF-10A cells stably infected withARF6. Cells are grown in EGFsupplemented media (10 ng/mL) for 7days followed by fixation and stainingwith ARF6 and E-cadherin antibodiesfollowed by DAPI counterstaining.Acinii were examined via confocalmicroscopy. B, IHC for ARF6 wasperformed on a TMA of matchednormal and breast tumor tissue,including matched primary and lymphnode metastasis core samples.Normal tissue n ¼ 5, DCIS n ¼ 6,IDC n ¼ 26, MET n ¼ 9.

miR-145

miR-145

lincRNA-ROR

ARF6 mRNA

ARF6 mRNA

E-Cadherin endocytosis

3′UTR

Figure 5.Illustration of miR-145 regulation of TNBC invasion. This is our proposedmodel for miR-145 regulation of TNBC invasion. Competition betweenlincRNA-RoR and miR-145 prevents miR-mediated suppression of ARF6, thisin turn leads to overexpression of ARF6 and altered E-cadherin localization.

Eades et al.





staining in lymph node metastasis cores (P < 0.03). These dataoffer support for the clinical relevance of ARF6 in breast cancermetastasis.

DiscussionDeep sequencing studies have previously shown that miR-

145 downregulation is a hallmark of TNBC (4). Here, usingTranswell invasion assays, we have found that miR-145 regulatestumor cell invasion in TNBC and not apoptosis or proliferation.We examined the molecular mechanism responsible for miR-145downregulation in TNBC and found that the lincRNA-RoRregulates mature miR-145 by serving as a competitiveendogenous RNA sponge. This is the first report of this ceRNAnetwork in human cancer.

To better understand the function of miR-145 in TNBC, weexamined the predicted targets of miR-145 and identified ARF6, asmall GTPase known to regulate endocytic recycling andpreviously implicated in breast tumor invasion (21). ARF6mRNA 30UTR contains five predicted miR-145-binding sites.Using a 30UTR luciferase reporter, qRT-PCR, and Westernblotting, we validated miR-145 targeting of the 30UTR of ARF6mRNA. Next, we found that ARF6 overexpression in MCF-7 cellspromoted a more invasive phenotype as evidenced by Transwellinvasion assays. We examined ARF6 function via 3D cell cultureand found that overexpression of ARF6 results in loss of E-cadherin localization and disruption of cell–cell junctions.Finally, we examined ARF6 expression in a breast tumor tissuearray and found that ARF6 levels were significantly higher inlymph nodemetastasis, suggesting a role of ARF6 in breast cancermetastasis. On the basis of our in vitro findings, it is important tonext examine whether miR-145 and ARF6 can regulate TNBCmetastasis in vivo.

Previously, miR-145 and lincRNA-RoR have been implicatedin embryonic and adult stem cells (10). These moleculesmay also be critical regulators of cancer stem cell biology, as

it was previously reported that miR-145 is silenced in breastcancer stem cells. There is mounting evidence of a powerfulconnection between epithelial–mesenchymal transition andbreast cancer stem cell (12). Here, we have demonstrated aconnection between miR-145 and invasion/metastasis thatinvolves altered cell morphology and loss of epithelialadherens junction protein E-cadherin. In future studies, itwill be interesting to test whether miR-145 and lincRNA-RoRplay important roles in regulating the cancer stem cellphenotype in TNBC, which has previously been shown toplay a critical role in drug resistance and metastasis.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: G. Eades, Q. ZhouDevelopment of methodology: Y. Zhang, Y. YaoAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): B. Wolfson, Y. Zhang, Y. YaoAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): Y. Zhang, Y. YaoWriting, review, and/or revision of the manuscript: G. Eades, Q. ZhouAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): Q. Li, Q. ZhouStudy supervision: Q. Zhou

Grant SupportThis work was supported by NCI F31 CA183522 (to G. Eades) and by grants

from ACS, and the NCI R01 (to Q. Zhou)The costs of publication of this article were defrayed in part by the

payment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

ReceivedMay 7, 2014; revised August 11, 2014; accepted September 12, 2014;published OnlineFirst September 24, 2014.

References1. Siegel R, Ward E, Brawley O, Jemal A. Cancer statistics, 2011. CA Cancer

J Clin 2011;61:212–36.2. Foulkes WD, Smith IE, Reis-Filho J. Triple-negative breast cancer. N Engl

J Med 2010;363:1938–48.3. Carey LA, Perou CM, Livasy CA, Dressler LG, Cowan D, Conway K, et al.

Race, breast cancer subtypes, and survival in the carolina breast cancerstudy. JAMA 2006;295:2492–502.

4. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, et al.A micRoRNA expression signature of human solid tumors defines cancergene targets. Proc Natl Acad Sci U S A 2006;103:2257–61.

5. ChoWCS,ChowASC, Au JSK.MiR-145 inhibits cell proliferationof humanlung adenocarcinoma by targeting EGFR and NUDT1. RNA Biol2011;8:125–31.

6. Zaman MS, Chen Y, Deng G, Shahryari V, Suh SO, Saini S, et al. Thefunctional significance of micRoRNA-145 in prostate cancer. Br J Cancer2010;103:256–64.

7. Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, et al.MicRoRNA gene expression deregulation in human breast cancer. CancerRes 2005;65:7065–70.

8. Zhang J, Guo H, Zhang H, Wang H, Qian G, Fan X, et al. Putative tumorsuppressor miR-145 inhibits colon cancer cell growth by targetingoncogene friend leukemia virus integration 1 gene. Cancer 2011;117:86–95.

9. Chiyomaru T, EnokidaH, Tatarano S, Kawahara K, Uchida Y, NishiyamaK,et al. miR-145 and miR-133a function as tumour suppressors and directly

regulate FSCN1 expression in bladder cancer. Br J Cancer 2010;102:883–91.

10. Xu N, Papagiannakopoulos T, Pan G, Thomson JA, Kosik KS. MicRoRNA-145 regulatesOCT4, SOX2, andKLF4 and represses pluripotency in humanembryonic stem cells. Cell 2009;137:647–58.

11. Yang B,GuoH, Zhang Y, Chen L, YingD,Dong S.MicRoRNA-145 regulateschondrogenic differentiation ofmesenchymal stem cells by targeting Sox9.PLoS ONE 2011;6:e21679.

12. GuoW,Keckesova Z,Donaher J, Shibue T, Tischler V, Reinhardt F, et al. Slugand Sox9 cooperatively determine the mammary stem cell state. Cell2012;148:1015–28.

13. Harrow J, Frankish A, Gonzalez JM, Tapanari E, DiekhansM, Kokocinski F,et al. GENCODE: the reference human genome annotation for theENCODE project. Genome Res 2012;22:1760–74.

14. GuttmanM,Amit I,GarberM, FrenchC, LinMF, FeldserD, et al. Chromatinsignature reveals over a thousand highly conserved large non-coding RNAsin mammals. Nature 2009;458:223–7.

15. Rinn JL, Chang HY. Genome regulation by long noncoding RNAs. AnnuRev Biochem 2012;81:145–66.

16. Cesana M, Cacchiarelli D, Legnini I, Santini T, Sthandier O, Chinappi M,et al. A long noncodingRNA controlsmuscle differentiation by functioningas a competing endogenous RNA. Cell 2011;147:358–69.

17. Tay Y, Kats L, Salmena L,WeissD, Tan SM,AlaU, et al. Coding-independentregulation of the tumor suppressor PTEN by competing endogenousmRNAs. Cell 2011;147:344–57.






18. Loewer S, Cabili MN, Guttman M, Loh YH, Thomas K, Park IH, et al. Largeintergenic non-coding RNA-RoR modulates reprogramming of humaninduced pluripotent stem cells. Nat Genet 2010;42:1113–7.

19. WangY, XuZ, Jiang J, XuC,Kang J, Xiao L, et al. EndogenousmiRNAspongelincRNA-RoR regulates Oct4, nanog, and Sox2 in human embryonic stemcell self-renewal. Dev Cell 2013;25:69–80.

20. Gillingham AK, Munro S. The small G proteins of the arf family and theirregulators. Annu Rev Cell Dev Biol 2007;23:579–611.

21. Hashimoto S, Onodera Y, Hashimoto A, Tanaka M, Hamaguchi M,Yamada A, et al. Requirement for Arf6 in breast cancer invasive activities.Proc Natl Acad Sci U S A 2004;101:6647–52.

22. Hu B, Shi B, Jarzynka MJ, Yiin J, D'Souza-Schorey C, Cheng S. ADP-ribosylation factor 6 regulates glioma cell invasion through the IQ-domainGTPase-activating protein 1-Rac1 Mediated pathway. Cancer Res 2009;69:794–801.

23. Grossmann AH, Yoo JH, Clancy J, Sorensen LK, Sedgwick A, Tong Z, et al.The small GTPase ARF6 stimulates {beta}-catenin transcriptional activityduring WNT5A-mediated melanoma invasion and metastasis. Sci Signal2013;6:ra14.

24. Muralidharan-Chari V, Hoover H, Clancy J, Schweitzer J, Suckow MA,Schroeder V, et al. ADP-ribosylation factor 6 regulates tumorigenic andinvasive properties in vivo. Cancer Res 2009;69:2201–9.

25. Eades G, Yang M, Yao Y, Zhang Y, Zhou Q. miR-200a regulates Nrf2activation by targeting Keap1 mRNA in breast cancer cells. J Biol Chem2011;286:40725–33.

26. Eades G, Yao Y, Yang M, Zhang Y, Chumsri S, Zhou Q. miR-200a regulatesSIRT1 expression and epithelial to mesenchymal transition (EMT)-liketransformation in mammary epithelial cells. J Biol Chem 2011;286:25992–6002.

27. Li Q, Yao Y, Eades G, Liu Z, Zhang Y, Zhou Q. Downregulation of miR-140 promotes cancer stem cell formation in basal-like early stage breastcancer. Oncogene 2014;33:2589–600.

28. Li J, Liu S, Zhou H, Qu L, Yang J. starBase v2.0: decoding miRNA-ceRNA,miRNA-ncRNA and protein-RNA interaction networks from large-scaleCLIP-seq data. Nucleic Acids Res 2014;42:D92–7.

29. Wang SF, Bian CF, Yang ZF, Bo Y, Li J, Zeng L, et al. miR-145 inhibits breastcancer cell growth through RTKN. Int J Oncol 2009;34:1461.

30. John B, Enright AJ, Aravin A, Tuschl T, Sander C, Marks DS. HumanmicRoRNA targets. PLoS Biol 2004;2:e363.

31. Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs areconserved targets of micRoRNAs. Genome Res 2009;19:92–105.

32. Bauer KM,HummonAB. Effects of themiR-143/-145MicRoRNA cluster onthe colon cancer proteome and transcriptome. J Proteome Res 2012;11:4744–54.

33. Valderrama F, Ridley AJ. Getting invasive with GEP100 and Arf6. Nat CellBiol 2008;10:16–8.

34. Morishige M, Hashimoto S, Ogawa E, Toda Y, Kotani H, Hirose M, et al.GEP100 links epidermal growth factor receptor signalling to Arf6activation to induce breast cancer invasion. Nat Cell Biol 2008;10:85–92.


Eades et al.




2015;13:330-338. Published OnlineFirst September 24, 2014.Mol Cancer Res Gabriel Eades, Benjamin Wolfson, Yongshu Zhang, et al. Breast Cancer via Targeting ARF6lincRNA-RoR and miR-145 Regulate Invasion in Triple-Negative

Updated version

10.1158/1541-7786.MCR-14-0251doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2014/09/25/1541-7786.MCR-14-0251.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/13/2/330.full#ref-list-1

This article cites 34 articles, 10 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/13/2/330.full#related-urls

This article has been cited by 9 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/13/2/330To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-14-0251

http://mcr.aacrjournals.org/content/suppl/2014/09/25/1541-7786.MCR-14-0251.DC1

http://mcr.aacrjournals.org/content/13/2/330.full#ref-list-1

http://mcr.aacrjournals.org/content/13/2/330.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/13/2/330


lincrna-ror and mir-145 regulate invasion in triple ...m2rtta (addgene 20342) at the 1:8 ratio....

Documents