Figure 5.18 Genomic imprinting of the Igf2 gene in mice and humans affects fetal growth.

Epigenetics

• Some traits are influenced by alterations on DNA, but not on it’s sequence.

• Example of genomic imprinting;• Patterns of DNA methylation which inhibit

gene expression.

5.4 Anticipation Is the Stronger or Earlier Expression of Traits in Succeeding Generations

• Anticipation: A genetic trait becomes more strongly expressed or is expressed at an earlier stage as it is passed from generation to generation.

Extensions of MendelPenetrance vs. expressivity

• Some factors that affect penetrance/expressivity of a gene 1) Other genes (epistasis) - One gene can block expression of another - An individual w/ genes encoding brown hair won't have brown hair if they are bald

2) Environment - Diet, temperature, pH, stress, etc... can all affect phenotype (independent of genotype) - Do so by altering gene expression - See this w/ identical twins raised in different environments - also meditation (for humans…) http://psyphz.psych.wisc.edu/web/News/Meditation_Alters_Brain_WSJ_11-04.htmhttp://well.blogs.nytimes.com/2011/01/28/how-meditation-may-change-the-brain/

http://www.nytimes.com/2007/05/08/health/psychology/08medi.html

Life is about change, self-determined change, towards a predetermined

goal, to create a future for ourselves by

self-effort

Extensions of MendelPenetrance vs. expressivity

• Some factors that affect penetrance/expressivity of a gene 1) Other genes (epistasis) - One gene can block expression of another - An individual w/ genes encoding brown hair won't have brown hair if they are bald

2) Environment - Diet, temperature, pH, stress, etc... can all affect phenotype (independent of genotype) - Do so by altering gene expression - See this w/ identical twins raised in different environments - also meditation (for humans…)

… and more exercise……and more dieting….

…and some starvation……. and no junk food….

Life is about change, self-determined change, towards a predetermined

goal, to create a future for ourselves by

self-effort

Extensions of MendelPenetrance vs. expressivity

• More environment effects on phenotype:1) Phenylketonuria (PKU) autosomal recessive gene that causes mental retardation. Low [Phe] prevents phenotype

2) Temperature-sensitive allele:An allele whose product is functional only at certain temperature.

vestigial mutation in Drosophila Expression on Himalayan rabbit

• When environmental factors alone produce a phenotype that is the same as one produced by a genotype, it’s called a PHENOCOPY

• Polygenic inheritance Many genes affect a single trait (aka gene interaction) - Expression of one gene is dependent on other genes - More genes More phenotypic variability (height). Their effects are additive.

Extensions of MendelMulitple alleles, pleiotropy and polygenic inheritance

Genotype Males Females

aabbcc 5'0" 4'7"

Aabbcc (or aaBbcc etc.) 5'3" 4'10"

AaBbcc etc. 5'6" 5'1"

AaBbCc etc. 5'9" 5'4"

AaBbCC etc. 6'0" 5'7"

AaBBCC etc. 6'3" 5'10"

AABBCC 6'6" 6'1"

Example: 3 loci (however, the total number of genes involved is unknown)Suppose that there are 3 loci with 2 alleles per locus (A, a, B, b, C, c).

Assume that:Each active allele A, B, or C adds 3 inches of height.The effect of each active allele is equal, A = B = C.Males (aabbcc) are 5' tall.Females (aabbcc) are 4'7".

• Many genes have more than two alleles (in the population, not in the individual) - More alleles More variable genotypes and phenotypes in the population - Example: MHC in humans (100s of alleles) - Can have a dominance series - Example: Allele 1 is dom. to 2 which is dom. to 3 which is dom. to 4

• Pleiotropy Genes that affect more than one trait are called pleiotropic.EX 1: People with Marfan syndrome may be tall, thin, have long legs, arms and fingers, and may be nearsighted.  Their connective tissue is defective. If unrepaired, the connective tissue surrounding the aorta will eventually rupture and kill the person.  All of these characteristics are due to a single gene.http://www.youtube.com/watch?v=ab_B0lZqq6M

EX 2: Sickle-cell anemia: Individuals with two mutant versions of Hb beta subunit (HbS/HbS) have defects in kidneys, skull, lungs, circulation,......

Extensions of MendelMulitple alleles, pleiotropy and polygenic inheritance

http://www.youtube.com/watch?v=_HhUpT3g-m8&list=PLC038F6E6BFE2738A&index=41&feature=plpp_video

END OF CH5

GENETICS

A Conceptual ApproachFOURTH EDITION

Benjamin A. Pierce

© 2012 W. H. Freeman and Company

CHAPTER 6Pedigree Analysis, Applications, and

Genetic Testing

Chapter 6

• 6.2 Geneticists Often Use Pedigrees To Study the Inheritance of Characteristics in Humans, 137

• 6.3 Studying Twins and Adoptions Can Help Assess the Importance of Genes and Environment, 143

• 6.4 Genetic Counseling and Genetic Testing Provide Information to Those Concerned About Genetic Diseases and Traits, 146

• 6.5 Comparison of Human and Chimpanzee Genomes Is Helping to Reveal Genes That Make Humans Unique.

Defect in Lamina A: Hutchinson-Gilford Progeria

Lamin A/C (a)Lamin A (c)

DAPI

Control Patient

http://www.progeriaresearch.org/the_science_behind_progeria.html

How do people inherit Hutchinson-Gilford progeria syndrome?Hutchinson-Gilford progeria syndrome is considered an autosomal dominant condition, which means one copy of the altered gene in each cell is sufficient to cause the disorder. The condition results from new mutations in the LMNA gene, and almost always occurs in people with no history of the disorder in their family.

http://posters.f1000.com/P1813

• Pea plants, fruit flies, and other simple organisms great for learning basic genetic mechanisms - Ultimately we care about human genetics

• Scientists can look at families and determine how certain traits, conditions, or diseases are inherited - Dominant/recessive, autosomal/sex-linked/sex-influenced, etc.

• To do this, scientists construct what's known as a PEDIGREE

• Once mode of inheritance is determined, can calculate chances of passing on disease to next generation - Can help people make reproductive decisions ethical??

Human geneticsPedigrees and genetic screening

circle = female open = no conditionsquare = male filled = condition

• Human special features:– Controlled mating is not

possible– Long generation time– Small family size • Pedigree: Pictorial

representation of a family history, a family tree that outlines the inheritance of one or more characteristics.

– Proband: The person from whom the pedigree is initiated.

• More about representation of Pedigrees

• Autosomal Recessive Traits: Fig. 6.4

• Autosomal Dominant Traits: Fig. 6.5

• X – Linked Recessive Traits: Fig. 6.7 & 6.8

• X – Linked Dominant Traits: Fig. 6.9

• Y – Linked Traits: Fig. 6.10

6.2 When deciphering pedigrees, There are 5 basic traits to look for:

• Can look at patterns in pedigrees to determine a traits mode of inheritance - Note: Generally only used in cases of single-gene diseases 1) Autosomal dominant - Every affected individual has an affected parent Its dominant - Males and females equally likely to have it - Normal siblings never pass it on to their children 2) Autosomal recessive - Condition is often rare and sporadic (not always) - Affected offspring rarely have affected parents - Again, males and females equally likely to have it

3) Y-linked (dominant or recessive) - Only ever see it in males (NEVER in females) - Females do not have a Y chromosome - Not too many conditions (<50 or so genes on the Y chromosome)

Human geneticsPedigrees and genetic screening

Human geneticsPedigrees and genetic screening

• Can look at patterns in pedigrees to determine a traits mode of inheritance 4) X-linked recessive (e.g. XrXr or XrY) - Never passed from father to son (why?) - Males always get from mom - See mostly males with the condition - Women have 2 X chr. – usually get 1 good copy - Affected individuals rarely have affected parents (recessive)

5) X-linked dominant (e.g. XRXr or XRY) - Never passed from father to son - Affected males only produce affected daughters

- Females have 2 Xs (2x the chance of getting the “bad” allele than males who only have 1 X)

• Dizygotic twins = non-identical twins

• Monozygotic twins = identical twins

• Concordant trait: The trait shared by both members of a twin pair.• Concordance: The percentage of twin pairs that are concordant for a trait. • Twin Studies:

6.3 Studying Twins and Adoptions Can Help Assess the Importance of Genes and Environment

Concept Check

A trait exhibits 100% concordance in both monozygotic and dizygotic twins. What conclusion can you draw about the role of genetic factors in determining differences in the trait?

a. Genetic factors are extremely importantb. Genetic factors are somewhat importantc. Genetic factors are unimportantd. both genetic and environment factors are important.

6.4 Genetic Counseling and Genetic Testing Provide Information to Those Concerned About Genetic Diseases and Traits

Ultrasonography can be used to detect some genetic disordersand for fetal location.

Amniocentesis: Collection of fetal cells for genetic testing

Chorionic Villus Sampling (CVS): also used for fetal cell genetic testing

6.5 Comparison of Human and Chimpanzee Genomes Is Helping to Reveal Genes That Make Humans Unique.

• Microcephalin 1 through microcephalin 6 regulate human brain size.

• FOXP 2 regulates human speech.

6.5 Comparison of Human and Chimpanzee Genomes Is Helping to Reveal Genes That Make Humans Unique.

GENETICS

A Conceptual ApproachFOURTH EDITION

Benjamin A. Pierce

© 2012 W. H. Freeman and Company

CHAPTER 7Linkage, Recombination, and

Eukaryotic Gene Mapping

Chapter 7 Outline

• 7.1 Linked Genes Do Not Assort Independently, 162

• 7.2 Linked Genes Segregate Together and Crossing Over Produces Recombination Between Them, 163

• 7.3 A Three-Point Testcross Can Be Used To Map Three Linked Genes, 176

• 7.4 Physical-Mapping Methods Are Used To Determine the Physical Positions of Genes on Particular Chromosomes, 187

• 7.5 Recombination Rates Exhibit Extensive Variation, 191

• Genes located closely on the same chromosome are inherited as one unit (NOT INDEPENDENT ASST) - Where one goes, the other follows (inherited as a pair) - Example: Red hair (gene A), freckles (gene B) - Will either get A-B or a-b (won't inherit A and b)

• Only way to split up two genes on the same chromosome is for crossing over to occur between them - No crossing over – keep parental combos (non-recombinant) - Crossing-over – get new combos (recombinant gametes)

Frequency of crossing over between two genes depends on how close the two genes are

Linked genesGenes on the same chromosome

A B a b2M 2D

A

aB

b

• If two genes are very close on the chromosome (e.g. B and C) - Crossing over will most likely NOT occur between them - Will almost always stay closely linked together during gamete formation - Very few recombinant gametes produced (all will be either BC or bc) • If the genes are far apart on the chromosome (e.g. A and C) - More likely that crossing over will occur between them - Will NOT always stay linked together during gamete formation - Will see a greater proportion of recombinants (mostly AC and ac, but also some Ac and aC)

Farther apart = more crossing over = more recombinant gametes

A A

B B

a a

b bcC C c

A and C lots of crossover eventsB and C few to no crossover events

Linked genesGenes on the same chromosome

• Scientists can use crossing over (recombination) frequency to determine where genes are located on a chromosome (w/ respect to one another) - Recombination frequency = (# recombinant progeny/ #total progeny) x 100 • Example Gene pair Recombinant frequency A and D 8 B and D 13 C and D 23 B and C 36 A and C 15 A and B 21

With the above info, you know that A and D are the closest and B and C are the farthest.

Linked genesDetermining gene location

Now… How do you map these genes on a chromosome?

Start with the farthest and put them on the ends. Add the next farthest...

• Example Gene pair Recombinant frequency A and D 8 B and D 13 C and D 23 B and C 36 A and C 15 A and B 21

Linked genesDetermining gene location

B CD A

GENETICS

A Conceptual ApproachFOURTH EDITION

Benjamin A. Pierce

© 2012 W. H. Freeman and Company

CHAPTER 10DNA: The Chemical Nature of the Gene

Chapter 10 Outline

• 10.1 Genetic Material Possesses Several Key Characteristics

• 10.2 All Genetic Information Is Encoded in the Structure of DNA or RNA

• 10.3 DNA Consists of Two Complementary and Antiparallel Nucleotide Strands That Form a Double Helix

• 10.4 Special Structures Can Form in DNA and RNA

10.1 Genetic Material Possesses Several Key Characteristics

1. Genetic material has to contain complex information.

2. Genetic material must replicate faithfully.

3. Genetic material must encode the phenotype.

10.2 All Genetic Information Is Encoded in the Structure of DNA or RNA

• Early Studies of DNA• 1869 – Johann Miescher studied the chemistry of pus:

– Pus contained WBCs with large nuclei. He isolated the nuclei and found an acidic substance high in phosphorus.

– Called it “nuclein” and later “nucleic acid”

• 1887 – physical basis of heredity is in the nucleus. Chromatin consists of nucleic acids and proteins.

– Which one is it?

• Late 1800’s – Albrecht Kossel determined that DNA contained 4 nitrogenous bases (A,C,T,G)

• Early Studies of DNA (cont)• 1910 – Phoebus Levene at the Rockefeller Institute (NYC)

– Discovered that DNA has a large number of linked, repeating units (nucleotides).

– Each nucleotide contains a sugar, a phosphate and a base.– Suggested DNA was repetitive ATGC-ATGC-ATGC...

• 1948 – Erwin Chargaff discovered that within each species there is regularity in the # of bases: A=T and C=G

– Chargaff’s rules

• A gene is not a hermit!!!

• Scientists are not hermits either!!!

• They will often depend on the work of others.

History of geneticsDiscovery of the genetic material

• Early "evidence" that protein (and not DNA) was the genetic material - Complexity of proteins - 4 bases vs 20 amino acids - Proteins can also adopt billions of different shapes - Thousands of different proteins - Abundance of proteins - 50% of dry weight of the cell

• Evidence that DNA is really the genetic material

- Griffith transformation study (1920s) - studying strains of bacterium that causes pneumonia(Streptococus pneumoniae).

Isolated virulent (Smooth) strain and non-virulent strain (Rough).

- S strain killed mice. R strain did not.

R strain vs S strain - Mix dead S + Live R Live S - Live R took something up from

its environment

• Avery, MacLeod, and McCarty (1944) – Demonstrated the DNA was the transforming principle

• Hershey and Chase experiment (1952) - Used bacteriophage composed of just DNA and protein - When infecting a cell, it injects the genetic material into the cell - Used as instructions to make new virus particles

- Created two batches of phage - One labeled with radioactive sulfur – 35S (only labels protein) - One labeled with radioactive phosphorus – 32P (only labels DNA)

- Infected cells with phage and looked to see what type of radioactivity is injected - If 35S is injected Proteins are the genetic material - If 32P is injected DNA is the genetic material

History of geneticsDiscovery of the genetic material

http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter14/animations.html#

RESULTS: Radioactive phosphorus was injected only!! 32P

- DNA is the genetic material

RESULTS: no 35S here

• Is DNA universal genetic material or just for microbes?

• Indirect evidence that DNA is a universal genetic material 1. Diploid cells should contain twice the amount of genetic material than haploid cells (e.g. sperm and eggs) - Saw that trend with DNA - Protein concentrations were the same in the two cell types

2. UV light at a wavelength of 260 nm mutates the genetic material - DNA absorbs at 260 nm - Proteins absorb at 280 nm

• Direct evidence: Genetic engineering - Add DNA to a cell See the expected protein

Organism n 2n

Human 3.25 7.30 Chicken 1.26 2.49 Trout 2.67 5.79 Carp 1.65 3.49

History of geneticsDiscovery of the genetic material

• RNA as genetic material

• Fraenkel-Conrat and Singer (1956)• Some viruses have RNA as genetic

material

10.3 DNA Consists of Two Complementary and Antiparallel Nucleotide Strands That Form a Double Helix

• The primary structure of DNA– Deoxyribonucleotides

• Nucleotides– Fig. 10.12

• Secondary structure of DNA– The double helix– Hydrogen bond and base pairing– Antiparallel complementary DNA strands

• Fig. 10.13

• DNA (deoxyribonucleic acid) is composed of 4 different nucleotides - Each nucleotide contains a 5-carbon sugar called deoxyribose, a phosphate group, and one of 4 nitrogen-containing bases - The four bases are adenine (A), thymine (T), guanine (G), and cytosine (C). - A and G each have 2 RINGS Purines (GACAPU2 ~ caca-P U too) - T and C each have 1 RING Pyrimidine

DNA compositionNucleotides

(A) (G) (C) (T)

S

BP

S

BP

• Closer look at deoxyribose sugar - Learn the numbering scheme - Base is connected to C1 of the sugar, Phosphate is on C5 - Notice C2 has an H and not an OH - C3 has a OH

DNA compositionNucleotides

• Nucleotides are connected via a phosphodiester bond - Between 5' phosphate group of 1 nucleotide and the 3’ OH group of a second nucleotide Each phosphate is connected to 2 sugars

- One end of a polynucleotide will have a free 5’ phosphate (5’ end) and the other end will have an unbound 3’ OH group (3’ end)

DNA structureHow are nucleotides connected to one another?

• Information known pre-1953 - DNA is a polynucleotide strand(s) that consists of nucleotides • Maurice Wilkins and Rosalind Franklin at King’s College (UK) (1952)

DNA structure3-D shape

• Watson, Crick, Franklin, and Wilkens model (1953)

1) DNA is a double-stranded polynucleotide that adopts a right-handed helix

- The two strands are antiparallel (opposite directions) - 5' end of one interacts with 3' of the other 2) Bases lie flat in 3-D (perpendicular to axis)

DNA structure3-D shape

• Watson and Crick model of DNA 3. Outside of each strand (the backbone) - Consists of sugar and phosphate groups attached to one another as described previously

4. The bases face the inside and form the hydrogen bonds with the bases from the opposite strand. - Hydrogen bonds only form between A-T (2) and C-G (3) 5. Contains alternating major and minor grooves - Empty spaces in the 3-D structure of the double helix - Common location of protein binding

A-T2 H-bonds

G-C3 H-bonds

DNA structure3-D shape

• The type of DNA described by Watson and Crick and the type found in most normal cells is called B-DNA

• However, DNA can adopt other 3-D shapes 1. A-DNA – Observed when water is removed from the DNA (dehydration/high-salt) - It is more compact than B DNA (11-12 bases/turn) - Still a right-handed helix - Bases are tilted upwards slightly (not flat) - Grooves are deeper, but narrower

2. Z-DNA – Observed when DNA is constructed to have mostly C-G base pairs - Has a spread-out, zig-zag shape - LEFT-HANDED helix - Major groove is not present

DNA structureAlternate forms of DNA

• A and Z DNA have some biological relevance 1. A DNA and bacterial endospores - Some bacteria species (Gram positive) form protective endospores when environmental conditions become too harsh - Protected against heat, UV light, most harsh chemicals, drying, etc...

1. Remove most of their water and have a tough outer coat 2. Produce SASPs (spores associated proteins)

that bind to the DNA and convert it from B to A - Tightens the DNA and protects it from damaging agents (e.g. UV light)

2. Z-DNA and the proteins that bind to them - Scientists have discovered cellular and viral proteins that have the ability to bind tightly to Z DNA (but not A or B DNA) - Cells wouldn’t have such proteins if Z DNA did not exist naturally - Now believe that many genes have stretches of sequence (GC rich) that adopt a Z like conformation (may be involved in transcription regulation)

DNA structureAlternate forms of DNA

Concept Check

The antiparallel nature of DNA refers to:

a. its charged phosphate groups.b. the pairing of bases on one strand with bases on the other strand.c. the formation of hydrogen bonds between bases from opposite strands.d. the opposite direction of the two strands of nucleotides.

Pathways of information transfer within the cell

10.4 Special Structure Can Form in DNA and RNA

• Hairpin structure: in single strands of nucleotides, when sequences of nucleotides on the same strand are inverted complements, a hairpin structure will be formed.

• When the complementary sequences are contiguous, the hairpin has a stem but no loop.

10.4 Special Structure Can Form in DNA and RNA

• RNA molecules may contain numerous hairpins, allowing them to fold up into complex structures.

• RNA/DNA similarities - Helical-shaped, polynucleotide chain that is composed of 4 types of nucleotides - Nucleotides are attached via phosphodiester bonds

• RNA/DNA structural differences - RNA is mostly single-stranded (but can fold back on itself and form double-stranded regions)

- RNA does not contain the base thymine. Instead, it contains a different pyrimidine called uracil (A-U hydrogen bond) - The sugar in the RNA nucleotides is RIBOSE (not deoxyribose)

• RNA serves as the genetic material for a number of viruses - e.g. influenza, HIV, polio, yellow fever

RNA structureBasics

• Common techniques for measuring and analyzing DNA include: 1. Absorption of UV light (Spectroscopy) - DNA absorbs UV light with a wavelength of 260 nm very well - Other macromolecules (proteins, carbs, lipids) do not - Put sample into spectrophotometer and set to 260 nm - Measures amount of light absorbed/transmitted - More absorbance = more quantity of DNA

- Can also be used to measure DNA purity - Proteins and other contaminants absorb light at 280 nm - Measure sample at 260 nm and 280 nm and get the ratio (Abs260/Abs280) - Example: Abs260 Abs280 Sample 1 0.75 1.5 Sample 2 1.5 1.5 Which would you want? Sample 3 0.5 0.1

Techniques for analyzing nucleic acidsAbsorption of UV light

• Common techniques for measuring and analyzing DNA include: 2. Centrifugation - Centrifuge – Machine with an internal rotor that spins at very high speeds - The force generated from the spinning causes any particle with mass to move to the bottom of the tube

- Can take a mixture of DNA, protein, carb, lipid and spin it in a centrifuge - Different components will separate out based on mass, shape, and density (ANALYSIS AND PURIFICATION)

- Two major classes of centrifugation a) Sedimentation equilibrium centrifugation - A density gradient (usually CsCl) is created and mixture is applied

- Mixture is spun for a fixed time - Molecules separate from one another based on their density - They move to their buoyant density and form a band in the tube

Techniques for analyzing nucleic acidsCentrifugation

• Common techniques for measuring and analyzing DNA include: 2. Centrifugation - Two major classes of centrifugation a) Sedimentation equilibrium centrifugation - Once done, pop hole in bottom of the tube and collect fractions

- Measure each fraction for the presence of DNA or protein b) Sedimentation velocity centrifugation - This spins and measures how “fast” a molecule moves down a tube during centrifugation (analyzes and separates) - DNA/RNA shape and mass both influence how fast it moves - Expressed in Svedberg units (S) –used to calculate mass

Techniques for analyzing nucleic acidsCentrifugation

• Common techniques for measuring and analyzing DNA include: 3. Denaturation and renaturation - Can learn a lot about DNA by separating the two strands and allowing them to get back together - Heat DNA Hydrogen bonds between the two strands break and the 2 strands separate - No covalent (phosphodiester) bonds are broken - Called denaturation - Cool DNA Strands go right back together (forming proper hydrogen bonds) - Called renaturation or annealing a) Determining relative ratios of A/T and G/C - Remember: G and C form 3 hydrogen bonds A and T form 2 hydrogen bonds DNA with more G-C pairs will require hotter temps to denature

Techniques for analyzing nucleic acidsDenaturation and renaturation

• Common techniques for measuring and analyzing DNA include: 3. Denaturation and renaturation a) Determining relative ratios of A/T and G/C - Can plot the rate of separation with respect to temp. - Melting temperature (Tm) = Temp. at which half the DNA molecules have denatured Such analysis provides valuable info on the base composition of a piece of DNA (how many A, T, C, G) - A piece of DNA with a ton of G-C pairs will have a high melting temp., whereas a piece of DNA with fewer G-C, will have a lower melting temp. - Not about speed of denaturation - Its all about the temp!!!

Techniques for analyzing nucleic acidsDenaturation and renaturation

• Common techniques for measuring and analyzing DNA include: 3. Denaturation and renaturation b) Determining relative sequence similarity between two pieces of DNA - Take two different pieces of DNA and denature, mix, and allow to renature - DO THE DIFFERENT PIECES HYDROGEN BOND WITH EACH OTHER??

5’3’ 5’

3’

heat

5’3’ 5’

3’

heat

mix and cool

region of sequence similarityregion of sequence difference

Allows to determineevolutionary relationships - Does gene X from humans have a similar sequence as the same gene in apes?

Techniques for analyzing nucleic acidsDenaturation and renaturation

• Common techniques for measuring and analyzing DNA include: 3. Denaturation and renaturation c) Determining sequence complexity - Can determine how complex a sequence is by denaturing DNA and look to see HOW LONG it takes for the DNA to renature - The more repetitive a sequence, the quicker it will renature

- This technique was critical in the identification of repetitive sequences in most of the human chromosomes (our chromosomes have lots of repeated sequences in between genes)

ATATATATATATATATATATATATAT

CTGATGTCAAGTGACTACAGTTCA

Which one would anneal faster if I heated them up?

Techniques for analyzing nucleic acidsDenaturation and renaturation

• Common techniques for measuring and analyzing DNA include: 3. Denaturation and renaturation d) FISH (fluorescence in situ hybridization) - Design a single-stranded DNA probe that is specific for some DNA sequence (e.g. gene) - Tag the probe with a fluorescent dye

- Add to cells (or chromosomes) of interest - Probe will anneal (renature) with its target sequence wherever it is located

Location of fluorescence = Location of target

- Major uses (for DNA): - Is the target gene present in the genome?

- Find location of a gene on a chromosome - Is it where it is supposed to be? Abundance?

Techniques for analyzing nucleic acidsDenaturation and renaturation

• Common techniques for measuring and analyzing DNA include: 4. Radioactivity - Can tag nucleic acids with various radioisotopes - 32P is most common – also have radioactive C, N, or H

- Tagging can be done in vivo or in vitro - Machines (e.g. scintillation counter) exist that can count how much radioactivity is present in a given sample - Can use to measure, follow, detect nucleic acids

- Examples: 1) Hershey and Chase experiment 2) HSV-1 tracking - Tag a population of viral particles with radioactive genome - Infect an animal with that virus - Where is the radioactivity in that animal?

Techniques for analyzing nucleic acidsRadioactivity

• Common techniques for measuring and analyzing DNA include: 5. Gel electrophoresis - Method of separating molecules in a mixture by adding the mixture to a semi- solid gel and applying an electric current through it - Allows for the separation of different DNA fragments based on their SIZE - Procedure a) The mixture of DNA fragments is added to a semi-solid gel (usually made of agarose) - Agarose – A large polysaccharide that is derived from seaweed b) Apply an electric current - Phosphates in DNA make it negatively charged. It will move towards the + electrode

Techniques for analyzing nucleic acidsGel electrophoresis

+

• Common techniques for measuring and analyzing DNA 5. Gel electrophoresis c) Agarose forms a big complex network - DNA fragments have to wiggle their way through it - Smaller the fragment, easier time of getting through the agarose, faster it will move SMALLER DNA FRAGMENTS WILL MIGRATE FASTER THAN LARGE FRAGMENTS - Visualization can also give indication of quantity.

Techniques for analyzing nucleic acidsGel electrophoresis

+small fragment

DNA replication