lecture 3 genes and proteins 10212009
TRANSCRIPT
![Page 1: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/1.jpg)
10/27/09 Lecture 3: Genes and Proteins 1
bio 1.0
Online bioscience course for grades 6-12
Fall 2009
![Page 2: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/2.jpg)
10/27/09 Lecture 3: Genes and Proteins 2
bio 1.0
Class mechanics…
• Attend the online Office Hour on Tuesdays at 3 PM via tokbox-Discuss previous week’s video lecture• Online video lecture e-mailed every Wednesday-view lecture and prepare to discuss the following Tuesday• Comment on video lecture using website discussion board• Online Final Exam given 12/9/2009
![Page 3: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/3.jpg)
10/27/09 Lecture 3: Genes and Proteins 3
bio 1.0
Lecture 3: Genes and proteins
![Page 4: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/4.jpg)
10/27/09 Lecture 3: Genes and Proteins 4
bio 1.0
Take Homes:
I. What is a gene?II. Many genes code for proteinsIII. Genes are regulated IV. The proteins encoded by genes shape the cell and do its workV. How proteins work
![Page 5: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/5.jpg)
10/27/09 Lecture 3: Genes and Proteins 5
bio 1.0
What is a gene?:
• A gene is a discrete unit of heritable information• Genes are typically, but not always, encoded by DNA• Genes typically, but not always code for proteins• A protein gene is an “Open Reading Frame” (ORF) of codons (but only for prokayotes…sorta…)
![Page 6: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/6.jpg)
10/27/09 Lecture 3: Genes and Proteins 6
bio 1.0
Take Home I
Genes are DNA sequences that encode a heritable trait…
What is a gene?
![Page 7: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/7.jpg)
10/27/09 Lecture 3: Genes and Proteins 7
bio 1.0
http://en.wikipedia.org/wiki/Genetic_code
How the genetic code works I:
![Page 8: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/8.jpg)
10/27/09 Lecture 3: Genes and Proteins 8
bio 1.0
How the genetic code works II:
Transcribed strand
mRNA
Peptide (“protein”)
![Page 9: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/9.jpg)
10/27/09 Lecture 3: Genes and Proteins 9
bio 1.0
How the genetic code works III
![Page 10: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/10.jpg)
10/27/09 Lecture 3: Genes and Proteins 10
bio 1.0
Reading frames
![Page 11: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/11.jpg)
10/27/09 Lecture 3: Genes and Proteins 11
bio 1.0
Using a computer program to definea gene from a sequence:
http://www.ncbi.nlm.nih.gov/gorf/gorf.html
![Page 12: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/12.jpg)
10/27/09 Lecture 3: Genes and Proteins 12
bio 1.0
Step-by-step video showing how to use the ORF Finder with our DNA sequence to find out if it encodes a protein…
http://www.screencast.com/t/gzxXnMwLWNI
![Page 13: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/13.jpg)
10/27/09 Lecture 3: Genes and Proteins 13
bio 1.0
>EXPERIMENTAL DNA SEQUENCE I
ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA
GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT
GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG
GGTGAAGGTGATGCTACATACGGAAAGCTTACC
CTTAAATTTATTTGCACTACTGGAAAACTACCT
GTTCCATGGCCAACACTTGTCACTACTTTCTCT
TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT
CATATGAAACGGCATGACTTTTTCAAGAGTGCC
ATGCCCGAAGGTTATGTACAGGAACGCACTATA
TCTTTCAAAGATGACGGGAACTACAAGACGCGT
GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT
AATCGTATCGAGTTAAAAGGTATTGATTTTAAA
GAAGATGGAAACATTCTCGGACACAAACTCGAG
TACAACTATAACTCACACAATGTATACATCACG
GCAGACAAACAAAAGAATGGAATCAAAGCTAAC
TTCAAAATTCGCCACAACATTGAAGATGGATCC
GTTCAACTAGCAGACCATTATCAACAAAATACT
CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC
AACCATTACCTGTCGACACAATCTGCCCTTTCG
AAAGATCCCAACGAAAAGCGTGACCACATGGTC
CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA
CATGGCATGGATGAGCTCTACAAAT
Test DNA Sequence:
![Page 14: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/14.jpg)
10/27/09 Lecture 3: Genes and Proteins 14
bio 1.0
So, our sequence contains the Green Fluorescent Protein (GFP) Gene sequence…
![Page 15: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/15.jpg)
10/27/09 Lecture 3: Genes and Proteins 15
bio 1.0
http://en.wikipedia.org/wiki/Green_fluorescent_protein
![Page 16: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/16.jpg)
10/27/09 Lecture 3: Genes and Proteins 16
bio 1.0
Cells “engineered” to express GFP:
![Page 17: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/17.jpg)
10/27/09 Lecture 3: Genes and Proteins 17
bio 1.0
Take Home II
Many genes encode for the amino acid sequence of proteins…
Many genes code for proteins
![Page 18: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/18.jpg)
10/27/09 Lecture 3: Genes and Proteins 18
bio 1.0
The lac Operon-an example of how bacterial genes are turned “on” and “off”…
http://www.youtube.com/watch?v=oBwtxdI1zvk
![Page 19: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/19.jpg)
10/27/09 Lecture 3: Genes and Proteins 19
bio 1.0
Take Home III
Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences…
Genes are regulated
![Page 20: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/20.jpg)
10/27/09 Lecture 3: Genes and Proteins 20
bio 1.0
Protein Functions in the Body
http://www.youtube.com/watch?v=T500B5yTy58
![Page 21: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/21.jpg)
10/27/09 Lecture 3: Genes and Proteins 21
bio 1.0
Take Home IV
Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins…
The proteins encoded by genes shape the cell and do its work…
![Page 22: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/22.jpg)
10/27/09 Lecture 3: Genes and Proteins 22
bio 1.0
Protein Functions in the Body: An example-ATP Synthase
http://www.youtube.com/watch?v=3y1dO4nNaKY
![Page 23: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/23.jpg)
10/27/09 Lecture 3: Genes and Proteins 23
bio 1.0
Looking at GFP at the molecular level…
![Page 24: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/24.jpg)
10/27/09 Lecture 3: Genes and Proteins 24
bio 1.0
Download and install CN3D:
http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml
![Page 25: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/25.jpg)
10/27/09 Lecture 3: Genes and Proteins 25
bio 1.0
A look at GFP structure with CN3D…
http://www.screencast.com/t/oCq2i3YcX
![Page 26: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/26.jpg)
10/27/09 Lecture 3: Genes and Proteins 26
bio 1.0
Take Home V
Proteins function according to their 3 Dimensional structures…
How proteins work…
![Page 27: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/27.jpg)
10/27/09 Lecture 3: Genes and Proteins 27
bio 1.0
Virtual experiment: making bacteria that glow green by giving them aGFP gene…
http://www.youtube.com/watch?v=Jyfi5e2JoYc&
http://www.youtube.com/watch?v=7zJ-Xe9rZh8
![Page 28: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/28.jpg)
10/27/09 Lecture 3: Genes and Proteins 28
bio 1.0
Next Week:
The bacterial world
How bacteria are structured and how they function…
![Page 29: Lecture 3 Genes And Proteins 10212009](https://reader036.vdocuments.site/reader036/viewer/2022062419/55987e021a28abf07d8b4645/html5/thumbnails/29.jpg)
10/27/09 Lecture 3: Genes and Proteins 29
bio 1.0
instructorMark E Minie PhD