leader of the capsid protein in feline calicivirus ...jvi.asm.org/content/82/19/9306.full.pdf ·...

JOURNAL OF VIROLOGY, Oct. 2008, p. 9306–9317 Vol. 82, No. 190022-538X/08/$08.00�0 doi:10.1128/JVI.00301-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Leader of the Capsid Protein in Feline Calicivirus PromotesReplication of Norwalk Virus in Cell Culture�

Kyeong-Ok Chang,1* David W. George,1 John B. Patton,1Kim Y. Green,2 and Stanislav V. Sosnovtsev2

Kansas State University, Manhattan, Kansas 66506,1 and National Institute of Allergy and Infectious Disease,National Institutes of Health, Bethesda, Maryland 208922

Received 11 February 2008/Accepted 10 July 2008

The inability to grow human noroviruses in cell culture has greatly impeded the studies of their pathogenesisand immunity. Vesiviruses, in the family Caliciviridae, grow efficiently in cell culture and encode a uniqueprotein in the subgenomic region designated as leader of the capsid protein (LC). We hypothesized that LCmight be associated with the efficient replication of vesiviruses in cell culture and promote the replication ofhuman norovirus in cells. To test this hypothesis, a recombinant plasmid was engineered in which the LCregion of feline calicivirus (FCV) was placed under the control of the cytomegalovirus promoter (pCI-LC) sothat the LC protein could be provided in trans to replicating calicivirus genomes bearing a reporter gene. Weconstructed pNV-GFP, a recombinant plasmid containing a full-length NV genome with a green fluorescentprotein (GFP) in the place of VP1. The transfection of pNV-GFP in MVA-T7-infected cells produced fewGFP-positive cells detected by fluorescence microscopy and flow cytometry analysis. When pNV-GFP wascotransfected with pCI-LC in MVA-T7-infected cells, we observed an increase in the number of GFP-positivecells (ca. 3% of the whole-cell population). Using this cotransfection method with mutagenesis study, weidentified potential cis-acting elements at the start of subgenomic RNA and the 3� end of NV genome for thevirus replication. We conclude that LC may be a viral factor which promotes the replication of NV in cells,which could provide a clue to growing the fastidious human noroviruses in cell culture.

Caliciviruses are plus-strand RNA viruses in the family Cali-civiridae that consists of four genera: Norovirus, Sapovirus, Lago-virus, and Vesivirus. Viruses in the genera Norovirus and Sapoviruscause gastroenteritis in humans and animals. Recent studies es-timate that noroviruses are responsible for more than 90% ofnonbacterial gastroenteritis outbreaks (7) and as many as 23 mil-lion cases of gastroenteritis in the United States each year (21).Norwalk virus (NV) is a prototype strain of the noroviruses andwas associated with an outbreak of gastroenteritis in Norwalk,OH, in 1968 (16). The viral genome of caliciviruses is 7 to 8 kb inlength and organized into either two or three open reading frames(ORFs) that encode a polyprotein of approximately 1,800 aminoacids (aa), the major capsid protein (VP1), and a minor capsidprotein (VP2) (11, 14, 19, 33). The first known calicivirus, vesic-ular exanthema swine virus (Vesivirus), was initially recognized in1932. Vesicular exanthema swine virus may have arisen in swinefrom feed containing marine mammals infected with San Miguelsea lion virus, which causes vesicular lesions and reproductivefailure in sea lions (23). The genus Vesivirus includes feline cali-civiruses (FCV), which is a major respiratory virus in cats andcauses persistent respiratory infection (10). The vesiviruses havebeen efficiently isolated in cell culture and provided a surrogatesystem for studying replication of the fastidious human entericcaliciviruses. Interestingly, vesiviruses encode a unique protein inthe subgenomic region designated leader of the capsid protein(LC), and the expression of LC is a part of the LC-VP1 precursor

that is processed to each mature protein by viral proteinase (Pro)(27).

Although recent studies have presented evidence for the rep-lication of human noroviruses in cells (1, 12, 29), studies of thereplication of these viruses have been severely hampered by thelack of a reliable cell culture system (6). Among the noroviruses,only murine noroviruses (including MNV-1) (17) have been suc-cessfully propagated in cell culture (30). Murine noroviruses arepresent widely in laboratory mouse colonies without apparentclinical symptoms (13, 31). MNV-1 has a tissue tropism of mac-rophage-like cells in vivo and in vitro (30), but it is not clear ifhuman noroviruses target such cells. In the present study, wehypothesized that LC might be associated with the efficient rep-lication of vesiviruses in cell culture and as a consequence maypromote human norovirus replication in cells. We constructed arecombinant plasmid containing cDNA encoding the LC fromFCV under the control of the cytomegalovirus (CMV) promoter(pCI-LC) to test this hypothesis. Previously, we reported an NVreplicon system (NV replicon-bearing cells) using a recombinantplasmid containing a full-length NV genome (pNV101) (8) with aneomycin resistance gene (Neor) in the place of VP1 (pNV-Neo)(3, 5). Using a similar strategy, we constructed pNV-GFP, whereNeor was replaced by a gene encoding green fluorescent protein(GFP). We also constructed a similar plasmid with GFP insertedinto the ORF2 of the infectious clone of FCV (pQ14), pQ-GFP,for comparative studies. Cotransfection studies with pNV101,pNV-GFP, pQ14, or pQ-GFP with pCI-LC showed that LC pro-moted the replication of both FCV and NV in cells. Furthermore,we found that this cotransfection method was useful in the iden-tification of cis-acting elements for NV replication in cells, whichprovides a novel tool for studying RNA elements. Using this

* Corresponding author. Mailing address: Department of Diagnos-tic Medicine and Pathobiology, College of Veterinary Medicine, Kan-sas State University, 1800 Denison Ave., Manhattan, KS 66506. Phone:(785) 532-3849. Fax: (785) 532-4039. E-mail: [email protected].

� Published ahead of print on 16 July 2008.

9306

on July 19, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

system, we identified RNA elements at the start of the sub-genomic RNA and 3� end of NV genome essential for virusreplication.

MATERIALS AND METHODS

Cells and reagents. BHK21, HEK293T, and Vero cells were maintained inDulbecco minimal essential medium containing 10% fetal bovine serum and anti-biotics (chlortetracycline [25 �g/ml], penicillin [250 U/ml], and streptomycin [250�g/ml]). Crandell-Ress feline kidney (CRFK) cells were maintained in minimalessential medium containing 5% fetal bovine serum and antibiotics. Polyclonalantibodies to NV VP1 or FCV VP1 have been described previously (24). We alsoused a polyclonal antibody to FCV LC that was described previously (25). Mono-clonal antibodies to NV VP1 were purchased from Chemicon (Temecula, CA).

Plasmid construction and generation of region-specific antisera. Standardrecombinant DNA methods were used for the construction of plasmids. The con-sensus full-length clone of NV, pNV101, has been described previously (8). Wereported pNV-Neo, which is used for generating NV replicon-bearing cells based inBHK21 or Huh-7 cells (5). We generated a similar reporter plasmid based on NV101with a gene encoding GFP, pNV-GFP, to study the replication of NV (Fig. 1). Forthe construction of pNV-GFP, the GFP gene was amplified from the pAcGFP1vector (Clontech, Mountain View, CA) with the primers GFP-NV-F (aattggatccTATGGTG AGCAAGGGCGAGGA) and GFP-NV-R (aattaccggtTCAAGCTCGAGATCTGAGTC) (the italic bases in the primers indicate the start and stop codons ofGFP). The PCR product was digested with BamHI and AgeI (the sites underlinedin the primers) and cloned into the corresponding sites of pNV-Neo. The resultingconstruct contained the GFP gene engineered into the 5�-end region of the ORF2so that the expressed product would contain the first 33 aa of the VP1 fused in framewith GFP (Fig. 1B). Similarly, we constructed pNV-RL (for Renilla luciferase) afterthe Renilla luciferase was amplified with primers NV-Bam-Luc-F (ataaggatccTATGGAAGACGCCAAAAAC) and NV-Age-Luc-R (aattaccggtTTACAATTTGGACTTTCCG), using pRL-CMV (Promega, Madison, WI) as a template. The viralpolymerase (Pol) active site, GDD in pNV101, pNV-GFP, or pNV-RL, was deletedby using a site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the primers

N-�GDD-F (CATGTCATATTTCTCATTTTATGAGATTGTGTCAACTGACATAG) and N-�GDD-R (CTATGTCAGTTGACACAATCTCATAAAATGAGAAATATGACATG), generating the pNV101�GDD, pNV-GFP�GDD, or pNV-RL�GDD plasmids, respectively (underlined bases indicate the position of thedeletion of nine bases encoding GDD between them). To examine transfectionefficiency, we generated a plasmid expressing chimeric VP1(33aa)-GFP fused to theend of NV ORF1 by deleting a base (G) at position 5354 in pNV-GFP by mutagen-esis. The primers used for this deletion were M5354DG-F (CTTCTGCCCGAATTCTAAATGAT GATGGCG) and M5354DG-R (CGCCATCATCATTTAGAATTCGGGCAGAAG) (underlined bases indicate the position of the deletion of Gbetween them). Transfection of this plasmid yields expression of GFP, as a part ofviral Pol-VP1(33aa)-GFP (unpublished observation). This plasmid was used to mea-sure the transfection efficiency for the expression of NV ORF1 in MVA-T7-infectedcells. We also generated pCI-GFP, which produces the expression of GFP under theCMV promoter control to measure overall transfection efficiency. The GFP genewas amplified by PCR using pAcGFP1 as a template with the primers GFP-Xho-F(aattctcgagATGGTGAGCAAGGGCGAGGA) and GFP-Not-R (aattgcggccgcTCAAGCTCGAGATCTGAGTC). The amplicon was cloned into pCI vector using theenzyme sites for XhoI and NotI.

For comparative studies, we also generated pQ-GFP based on the infectious cloneof FCV Urbana strain, pQ14 (24). We utilized the enzyme sites of SanDI and SpeIin the ORF2 of FCV to insert GFP. Briefly, the GFP gene was amplified from thepAcGFP1 vector (Clontech) with the primers GFP-FCV-F (aattgggacccCATGGTGAGCAAGGGCGAGGA) and GFP-FCV-R (aattactagtTCAAGCTCGAGATCTGAGTC). The PCR product was digested with SanDI and SpeI and cloned intothe corresponding sites of the pQ14 plasmid. Also, the viral Pol active-site GDD inpQ14 or pQ-GFP was deleted by using the site-directed mutagenesis kit with theprimers FCV-�GDD-F (CGACATGATGACTTATGGTGTTTACATGTTTC)and FCV-�GDD-R (GAAACATGTAAACACCATAAGTCATCATGTCG),generating pQ14�GDD and pQ-GFP�GDD, respectively.

To examine the effects of LC from FCV on the replication of FCV or NV, wegenerated a plasmid containing the LC gene under the control of CMV promoter(pCI-LC). For the pCI-LC, the region encoding LC in FCV was amplified withthe primers FCVLC-Xho-F (aattctcgagATGTGCTCAACCTGCGCTAACG)

FIG. 1. Genomic organization of NV, FCV, and recombinant plasmids based on the full-length genome of NV or FCV. (A) Schematic diagramof the genome organization of NV and FCV. FCV has a unique protein, LC, at the start of the subgenomic RNA. (B) Recombinant plasmids ofpNV101 (a plasmid containing the full-length genome of NV under the T7 promoter): pNV-GFP, pQ14 (an infectious clone of FCV), andpQ-GFP. pNV-GFP was generated using unique sites of BamHI and AgeI in ORF2 of the NV genome, and GFP gene was cloned in place of VP1.pQ-GFP was generated using the unique restriction sites SanDI and SpeI in ORF2 of the FCV genome, and the GFP gene was cloned in the placeof LC and VP1.

VOL. 82, 2008 LC IN FCV PROMOTES REPLICATION OF NV 9307


.org/D

ownloaded from

http://jvi.asm.org/

and FCVLC-Not-R (aattgcggccgcTTATCATTCCAATCTGAACAATGGCA)by PCR, using pQ14 as a template. The amplicon was cloned into pCI vectorusing the enzyme sites of XhoI and NotI. Similarly, we generated a plasmidcontaining the V gene of simian virus 5 (SV5) under the control of the CMVpromoter (pCI-V). The gene encoding the V protein in SV5 (DA strain) wasamplified with the primers SV5V-Nhe-F (aattgctagcATGGATCCCACTGATCTGAGC) and SV5V-Not-R (aattgcggccgcTTAAGTATCTCGTTCACATTCAG) by reverse transcription-PCR (RT-PCR), using viral RNA as a template.The RT-PCR was performed using the following conditions: 45°C for 30 min (forRT) and 95°C for 10 min, followed by 30 cycles of denaturation at 95°C for 30 s,annealing at 50°C for 1 min, and elongation at 72°C for 1 min. The amplicon wascloned into pCI vector using the enzyme sites of NheI and NotI. Also, wegenerated a plasmid, pNVP1 to express NV VP1 in cells for a control. The regionencoding NV VP1 was amplified by PCR with the primers NVP1-Xho-F (aattctcgagATGATGATGGCGTCTAAGG) and NVP1-Not-R (aattgcggccgcTTATCGGCGCA GACCAAGC) (the italic bases in the primers indicate the start andstop codons of VP1) using pNV101 as a template. The amplicon was cloned intopCI vector using the enzyme sites XhoI and NotI.

Transfection study. All transfections were performed with Lipofectamine 2000(Invitrogen, Carlsbad, CA) with 2 �g of each plasmid per well in six-well plates(ca. 1 � 106 to 2 � 106 cells). Cells including BHK21, HEK293T, or Vero cellswere infected with the modified vaccinia virus (Ankara strain) expressing T7 Pol(MVA-T7) (32) at a multiplicity of infection of 10 for 1 h before transfection.The plasmid pNV101, pNV-GFP, pQ14, pQ-GFP, pNV101�GDD, pNV-GFP�GDD, pQ14�GDD, or pQ-GFP�GDD was transfected alone or cotrans-fected with pCI-LC or pCI-V to study the effects of LC or V in the replicationof FCV or NV. The plasmid NV-GFP or pNV-GFP�GDD was also cotrans-fected with pCI-LC and pCI-V to study the combined effects of LC and V on NVreplication. Similarly, each mutant plasmid of pNV-GFP (described below) wascotransfected with pCI-LC and pCI-V into MVA-T7-infected Vero cells to studycis-acting elements of NV. After transfection, the replication of FCV or NV wasmonitored by detecting the expression of VP1 or GFP (GFP-based constructs)with the various assays described below. In addition, plasmid pNV-RL or plasmidpNV-RL�GDD was transfected alone or with pCI-LC, pCI-V, or pCI-LC pluspCI-V into MVA-T7-infected Vero cells. For the control of this transfection, weused pCI and pNV-GFP. At 20 h posttransfection, cell lysates were prepared forRenilla luciferase activity using the Renilla luciferase assay system (Promega).

Virus replication assay. Virus replication was measured by various assaysincluding immunofluorescence assay (IFA), Western blot analysis, enzyme-linked immunosorbent assay (ELISA), plaque-forming assay (for FCV), and flowcytometry analysis.

(i) Detection of NV or FCV VP1. The expression of NV or FCV VP1 wasmeasured by IFA using antibody against NV virus-like particles (VLPs) or FCV

virions. Cells transfected with various plasmids were fixed with cold methanol at18 to 24 h posttransfection for IFA. Monoclonal antibody to NV VLPs orpolyclonal antibody (guinea pig serum) to FCV virions were added to the fixedmonolayers, and the binding of antibodies was detected with fluorescein isothio-cyanate-conjugated, affinity-purified goat antibodies to mouse or guinea pigimmunoglobulin G (Sigma-Aldridge, St. Louis, MO) as described previously (4).NV VP1 was also detected by Western blot analysis using polyclonal antibody tothe protein as described previously (5). We also used ELISA for detecting NVVP1 after the transfections. Briefly, 96-well plates (Nunc, Rochester, NY) werecoated with monoclonal antibody to NV VP1 as a capture antibody. Reagentswere added to triplicate wells in the following sequence: cell lysate samples;hyperimmune guinea pig antiserum specific for NV VP1; goat anti-guinea pigimmunoglobulin G conjugated to horseradish peroxidase; and the substratetetramethylbenzidine (Kirkegaard & Perry Laboratories, Gaithersburg, MD).The absorbance was measured at 610 nm. The cutoff value was calculated as anabsorbance at 610 nm that was at three standard deviations above the absorbancein cell control wells (cells infected with MVA-T7).

(ii) Detection of NV genome. To examine NV genome levels in the cells withvarious transfections, real-time quantitative RT-PCR (qRT-PCR) was per-formed by using a One-Step Platinum qRT-PCR kit (Invitrogen) according tothe protocol established for the analysis of genogroup 1 norovirus samples (15).The primers COG1F (CGYTGGATGCGNTTYCATGA) and COG1R (CTTAGACGCCATCATCATTYAC) and the probe RING1(a)-TP (FAM-AGATYGCGATCYCCTGTCCA-TAMRA) were used for the real-time qRT-PCR, whichtargets genomic RNA (sequence between positions 5291 and 5375) (15). As aquantity control of cellular RNA levels, qRT-PCR for �-actin with the primersactin-F (GGCATCCACGAAACTACCTT) and actin-R (AGCACTGTGTTGGCGTACAG) and the probe actin-P (HEX-ATCATGAAGTGTGACGTGGACATCCG-TAMRA) was performed as described previously (3, 28). For qRT-PCR, the total RNA of cells (in six-well plates) was extracted with an RNeasy kit(Qiagen, Valencia, CA). The qRT-PCR amplification was performed in a Cephe-id SmartCycler with the following parameters: 45°C for 30 min and 95°C for 10min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 50°C for1 min, and elongation at 72°C for 30 s. The relative genome levels in cells withvarious transfection were calculated after the RNA levels were normalized withthose of �-actin.

(iii) Expression of GFP. After the transfection of plasmids encoding the GFPgene, GFP-positive cells were detected by fluorescence microscopy or enumeratedby using flow cytometry analysis. After 16 to 20 h of transfection, the cells weretreated with trypsin, fixed with 4% formaldehyde for 1 h, and then washed twice withphosphate-buffered saline by centrifugation and resuspended with phosphate-buff-ered saline. Flow cytometry analysis was performed on a population of 10,000 cellsby using a FACSCalibur (BD Biosciences, Franklin Lakes, NJ).

TABLE 1. Primers used in the mutagenesis study

Primer Designation Sequence (5� to 3�)a

M5354RC-F G5354C CTTCTGCCCGAATTCCTAAATGATGATGGCGM5354RA-F G5354A CTTCTGCCCGAATTCATAAATGATGATGGCGM5354RT-F G5354U CTTCTGCCCGAATTCTTAAATGATGATGGCGM5355RA-F U5355A CTTCTGCCCGAATTCGAAAATGATGATGGCGM5355RC-F U5355C CTTCTGCCCGAATTCGCAAATGATGATGGCGM5355RG-F U5355G CTTCTGCCCGAATTCGGAAATGATGATGGCGM5356RT-F A5356U CTTCTGCCCGAATTCGTTAATGATGATGGCGTCM5356RC-F A5356C CTTCTGCCCGAATTCGTCAATGATGATGGCGTCM5356RG-F A5356G CTTCTGCCCGAATTCGTGAATGATGATGGCGTCM5357RT-F A5357U TTCTGCCCGAATTCGTATATGATGATGGCGTCTAM5357RC-F A5357C TTCTGCCCGAATTCGTACATGATGATGGCGTCTAM5357RG-F A5357G TTCTGCCCGAATTCGTAGATGATGATGGCGTCTAM7080Age-F D to 7080 CAAAGCCAAAGGTATCACCGGTATTTGCAACTGCAAGM7280Age-F D to 7280 CTGCTCCCGAGTCCACCGGTACCACATTGAGATCCGM7480Age-F D to 7489 GCGGAGGCTCTCAATACCGGTTGGTTGACTCCACCCM7534Age-F D to 7534 CTACACTGTCTTCTGTACCGGTTGGTTATTTCAATACAGM7500Age-F D to 7500 TGGTTGACTCCAACCGGTTCAACAGCCTCTTCTACM7600Age-R D to 7600 CGCAAATAATAGGCACCGGTGTTGTAATATGAAATGTGGM7610Age-F D to 7610 GTGGGCATCATATTCACCGGTTTAGGTTTAATTAGGM7630Age-F D to 7630 CATCATATTCATTTAATTACCGGTAATTAGGTTTAATTTGM7640Age-F D to 7640 CATTTAATTAGGTTACCGGTGGTTTAATTTGATG

a The sequences listed in the table represent the forward primers only. Underlined bases are mutated bases in the primers. Italic bases are AgeI recognition sitesin the primers.

9308 CHANG ET AL. J. VIROL.


.org/D

ownloaded from

http://jvi.asm.org/

Mutagenesis of potential cis-acting elements in pNV-GFP. The potential pro-moter or cis-acting elements located at the start of subgenomic RNA or the 3� endin NV genome was examined by substitution and deletion mutagenesis of pNV-GFP(see Fig. 6A and 7). First, we generated a series of substitute mutants at the start ofthe subgenomic RNA focusing on four untranslated bases, GUAA, using the prim-ers listed in Table 1. The substitution mutants at the first base (G) in the subgenomicRNA to U, A, or C were designated as pNV-GFP-G5354U, pNV-GFP-G5354A, orpNV-GFP-G5354C, respectively. These mutations resulted in amino acid changes inthe sequences of the virus Pol from valine to leucine (pNV-GFP-G5354U) or iso-leucine (pNV-GFP-G5354A and pNV-GFP-G5354C). The second base (U) in thesubgenomic RNA was also mutated to A, C, or G with the plasmids designatedpNV-GFP-U5355A, pNV-GFP-U5354C, or pNV-GFP-U5354G, yielding amino acidchanges from valine to glutamic acid, alanine, or glycine, respectively. The third base(A) was mutated to U, C, or G with the plasmids designated pNV-GFP-A5356U,pNV-GFP-A5356C, or pNV-GFP-A5356G (all were silent mutations). Mutation ofthe fourth base (A) to U, C, or G yielded plasmids designated pNV-GFP-A5357U,pNV-GFP-A5357C, or pNV-GFP-A5357G. These mutations changed the asparagineto tyrosine, histidine, or aspartic acid, respectively. Second, to examine the RNAelements at the 3� end of NV genome for virus replication, we generated a series ofdeletion mutations targeting the regions between the stop codon of GFP and the endof genome (Fig. 7). Nine deletion mutants were generated between the bases after

the GFP gene, and the deletions corresponded to bases 7080, 7089, 7480, 7500, 7534,7600, 7610, 7630, and 7640 (Fig. 7). These mutations were generated by inserting anAgeI site at the desired bases using the mutagenesis kit and primers listed in Table1. The plasmids containing the mutants were digested with AgeI, which removed thedeletion fragments and then they were religated to generate each mutant plasmid.The presence of the mutation for all plasmids described above was confirmed bysequencing analysis.

Statistical analysis. All experiments, including flow cytometry, Renilla lucif-erase assay, IFA, and ELISA, were conducted with at least three independentmeasurements, and the effects of LC protein, V protein, and the combination ofLC protein plus V protein on FCV or NV replication were analyzed by using theStudent t test. The results were considered statistically significant when the Pvalue was �0.05.

RESULTS

The expression of LC in cells promoted the replication ofFCV. The expression of LC in various cell lines (BHK21,HEK293T, and Vero cells) after the transfection of pCI-LC

FIG. 2. Transfection of pQ14 or pQ-GFP with or without pCI-LC into MVA-T7-infected Vero cells. (A) Flow cytometry analysis of cells transfectedwith pQ-GFP alone (upper panel), cotransfected with pQ-GFP and pCI-LC (middle panel), or cotransfected with pQ-GFP�GDD and pCI-LC (bottompanel) into MVA-T7-infected Vero cells. In all flow cytometry analyses, cells were collected after 18 to 20 h of transfection, and the figures represent thecounts of 10,000 cells with cell size (y axis) and GFP expression (x axis). The numbers in the panel represent the averages and standard deviations of atleast three independent experiments in all figures. An asterisk (*) indicates that the number of GFP-expressing cells by cotransfection with pQ-GFP andpCI-LC was significantly higher (P � 0.05) than the transfection with pQ-GFP alone. (B) In the upper panel, GFP-positive cells were observed undera fluorescence microscope after Vero cells were transfected with pQ-GFP alone (left panel), pQ-GFP plus pCI-LC (middle panel), or pQ-GFP�GDDplus pCI-LC (right panel). In the bottom panel, IFA staining was performed with antibody against FCV VP1 after Vero cells were transfected with pQ14alone (left panel), pQ14 plus pCI-LC (middle panel), or pQ14�GDD plus pCI-LC (right panel). (C) Plaque-forming assay of recovered progeny virusesafter Vero cells were transfected with pQ14 alone (upper panel) or pQ14 plus pCI-LC (bottom panel).



.org/D

ownloaded from

http://jvi.asm.org/

with MVA-T7 infection showed that more than 50% of thecells were positive with LC as detected by IFA. Also, thetransfection of pCI-GFP showed similar rates of cells express-ing GFP in each cell type. We first examined the effects of LCin FCV replication using pQ14 and pQ-GFP, which served asthe framework of the system for studying the replication ofNV. The transfection of pQ14 or pQ-GFP into MVA-T7-infected BHK21, HEK293T, and Vero cells resulted in thecells expressing VP1 or GFP, respectively. When we enumer-ated cells expressing GFP after the transfection of pQ-GFP inVero cells, �4% of the whole population were GFP positive(Fig. 2A). The overall proportions of cells expressing GFP orVP1 (detected by IFA) after transfection of pQ14 or pQ-GFPwere similar (Fig. 2B). Cells transfected with pQ14 producedviable FCV, which indicated complete replication in these celllines (Fig. 2). For example, the titers of viral progeny aftertransfections of pQ14 in Vero cells were between 103 and 104

PFU/ml (Fig. 2C). The transfection of RNA transcripts derivedfrom pQ14 or pQ-GFP showed lower percentages (�1%) ofcells expressing VP1 or GFP, respectively (unpublished obser-vations).

When pQ14 or pQ-GFP was cotransfected with pCI-LC inVero cells after MVA-T7 infection, the cells expressing VP1 or

GFP increased to �2-fold over those with pQ14 or pQ-GFPtransfection alone (Fig. 2A and B). The number of GFP ex-pressing cells by the cotransfection with pCI-LC and pQ-GFPwas significantly higher (P � 0.05) than the transfection withpQ-GFP alone. Although the cotransfection increased thenumber of GFP-positive cells, the overall intensity of GFPexpression in each cell was reduced by the cotransfection. InFig. 2A, the distribution of GFP-expressing cells leaned towardto the cutoff line by the cotransfection with pQ-GFP andpCI-LC (middle panel) compared to the transfection with pQ-GFP alone (upper panel). The virus titers after the transfectionof pQ14 with or without pCI-LC in Vero cells were similar toeach other, yielding approximately 2 � 103 PFU/ml (Fig. 3C).Transfection of pQ14�GDD or pQ-GFP�GDD with or with-out pCI-LC did not produce VP1- or GFP-positive cells abovethe level of the control MVA-T7-infected cells (Fig. 2A and B).

In the presence of LC, the replication of NV was promotedin cells. The transfection of pNV-GFP in BHK21, HEK293T,or Vero cells did not produce GFP-positive cells above thelevel of control MVA-T7-infected cells as measured by flowcytometry analysis (Fig. 3B), although under a fluorescencemicroscope, few GFP-positive cells (fewer than five cells) wereobserved in one well of a six-well plate. The transfection of

FIG. 3. Transfection of pNV-GFP or pNV-GFP�GDD with or without pCI-LC into MVA-T7-infected Vero cells. (A) GFP-positive cellsobserved under a fluorescent (left panel) or a light microscope (right panel) after cells were transfected with pNV-GFP with or without pCI-LC.Cotransfection of pNV-GFP�GDD and pCI-LC served as a negative control, and transfection of pNV-ORF1-GFP serves as a measurement oftransfection efficiency in the present study. (B) Flow cytometry analysis to enumerate GFP-positive cells after the transfection of pNV-GFP,pCI-GFP plus pCI-LC, pNV-GFP�GDD plus pCI-LC, or pNV-ORF1-GFP into MVA-T7-infected Vero cells. The numbers in the panel representthe averages and standard deviations of at least three independent experiments in the figures.



.org/D

ownloaded from

http://jvi.asm.org/

pNV-ORF1-GFP, which served as a control for transfectionefficiency in Vero cells infected with MVA-T7, produced ca.20% GFP-positive cells by flow cytometry analysis (Fig. 3A andB). When pNV-GFP was cotransfected with pCI-LC intoMVA-T7-infected Vero cells, we found that ca. 3% cells ex-pressed GFP as detected by flow cytometry analysis (Fig. 3Aand B). Cotransfection of the same plasmids in BHK21 orHEK293T cells also produced GFP-positive cells, but with arate of ca. 1%. The transfection of pNV-GFP�GDD with orwithout pCI-LC into MVA-T7-infected Vero, BHK21, andHEK293T cells did not yield GFP-positive cells by fluores-cence microscopy or flow cytometry analysis (Fig. 3A and B).The transfection study with pNV-RL or pNV-RL�GDD wasconsistent with the results of pNV-GFP or pNV-RL�GDD,showing that while transfection of pNV-RL alone induced aslight increase in Renilla luciferase expression, the cotransfec-tion with pCI-LC significantly increased (P � 0.01) the expres-sion levels of Renilla luciferase (Table 2).

FIG. 4. Transfection of pNV101 or pNV101�GDD with or without pCI-LC into MVA-T7-infected Vero cells. (A) IFA staining (withmonoclonal antibody) detecting NV VP1 in cells transfected with pNV101 with or without pCI-LC (magnification, �100). A cell in the box in thebottom panel shows the expression of NV VP1 in the cytoplasm with a higher magnification (�400). (B) Western blot analysis detecting NV VP1in cells transfected with pNV101 with or without pCI-LC. Transfection of pCI-NVP1 serves as the positive control for VP1 expression in thetransfected cells. (C) ELISA to detect NV VP1 in cell lysates after transfecting pNV101 with or without pCI-LC into MVA-T7-infected Vero cells.Transfection of pCI-NVP1 or cotransfection pNV-GFP�GDD and pCI-LC serves as a positive or negative control, respectively, in the presentstudy. The cutoff value was calculated as the average 3 standard deviations of cell lysates prepared with the transfection of mock-medium intoMVA-T7-infected cells. An asterisk (*) indicates that the level of VP1 expression by cotransfection with pCI-LC and pNV101 was significantlyhigher (P � 0.05) than the transfection with pNV101 alone.

TABLE 2. Expression of Renilla luciferase after transfection ofpNV-RL or pNV-RL�GDD alone or with pCI-LC, pCI-V,

or pCI-LC�pCI-V into MVA-T7-infected Vero cells

PlasmidFold induction inRenilla luciferase(mean SD)a

pCI......................................................................................... 1pNV-GFP .............................................................................0.95 0.1pNV-RL................................................................................ 1.5 0.7pNV-RL�GDD....................................................................0.90 0.3pNV-RL/pCI-LC.................................................................. 7.1 2.1**pNV-RL/pCI-V.................................................................... 4.8 2.4*pNV-RL/pCI-LC�pCI-V ...................................................20.2 8.7**pNV-RL�GDD/pCI-LC�pCI-V....................................... 1.1 0.2

a Cell lysates were prepared after 20 h of transfection for the Renilla luciferaseactivity. Standard deviations were calculated with at least three independentmeasurements. *, P � 0.05; **, P � 0.01 (compared to the pNV-RL group).



.org/D

ownloaded from

http://jvi.asm.org/

We next examined cotransfection of pNV101 and pCI-LCinto Vero cells to evaluate the effect of LC on NV replication.The transfection of pNV101 alone into MVA-T7-infected cellsshowed no evidence of VP1 expression (by IFA, Western blotanalysis, or ELISA; Fig. 4). However, when pNV101 was co-transfected with pCI-LC into MVA-T7-infected cells, we couldobserve cells expressing VP1 by IFA (Fig. 4A) and Westernblot analysis (Fig. 4B) and ELISA (Fig. 4C). When the Polmotif GDD was deleted in pNV101 (pNV101�GDD), thetransfection of this mutant plasmid with or without pCI-LC incells did not produce any expression of VP1 (Fig. 4). The NVRNA levels after the transfection measured by real-time qRT-PCR showed that cotransfection of pNV101 or pNV-GFP withpCI-LC increased the RNA levels �2-fold (P � 0.05) over

those of cells transfected with pNV101 or pNV-GFP alone(Table 3).

The expression of LC and V synergistically increased NVreplication. The V protein of SV5 downregulates the inter-feron (IFN) system by degrading STAT1 and enhances thereplication of various viruses in vitro (34). First, we confirmedthe expression of V protein after transfection of pCI-V invarious cells (BHK21, HEK293T, and Vero cells) using a fireflyluciferase reporter plasmid under the control of the IFN stim-ulating response element (pISRE-luc) (unpublished observa-tions) as described previously (5). The cotransfection of pNV-GFP and pCI-V into MVA-T7-infected Vero cells alsoproduced GFP-positive cells but with much less efficiency thanpCI-LC (ca. 1% of total cells; Fig. 5). Interestingly, there weresynergistic effects of LC and V in promoting NV replication.Cotransfection of pNV-GFP, pCI-LC, and pCI-V yielded ca.5.5% of GFP-positive cells in Vero cells (Fig. 5). The cotrans-fection study with pNV-RL, pCI-LC, and pCI-V confirmed thesynergistic effects of LC and V protein, since cotransfectionsignificantly increased Renilla luciferase expression levels bycotransfection over that of LC or V protein alone (Table 2).

Mutagenesis studies. We applied the cotransfection methodwith three plasmids—pNV-GFP, pCI-LC, and pCI-V—to theidentification of a potential cis-acting element in the start ofsubgenomic region and 3� end of the NV genome. Each pNV-GFP-based mutant plasmid was cotransfected with pCI-LCplus pCI-V, and GFP expression was observed under a fluo-rescence microscope and enumerated with flow cytometry

TABLE 3. NV RNA levels after transfection of pNV-GFP orpNV-GFP alone or with pCI-LC in MVA-T7-infected

Vero cells detected by real-time qRT-PCR

PlasmidFold induction in

RNA levels(mean SD)a

pCI ......................................................................................... NApNV-GFP.............................................................................. 1pNV-GFP�GDD.................................................................. 0.92 0.3pNV-GFP/pCI-LC................................................................ 2.1 0.3*pNV-GFP�GDD/pCI-LC ................................................... 1.1 0.2

a Total RNA was extracted from cell lysates after 20 h of transfection for thereal-time qRT-PCR. NA, not available. *, P � 0.05 (compared to the pNV-GFPgroup).

FIG. 5. Transfection of pNV-GFP alone, pNV-GFP�pCI-V, or pNV-GFP�pCI-LC�pCI-V in MVA-T7-infected Vero cells. (A) GFP-positivecells observed under fluorescence after cells were transfected with pNV-GFP alone (left panel), pNV-GFP�pCI-V (middle panel), or pNV-GFP�pCI-LC�pCI-V (right panel). (B) Flow cytometry analysis to enumerate GFP-positive after cells were transfected with pNV-GFP alone (leftpanel), pNV-GFP�pCI-V (middle panel), or pNV-GFP�pCI-LC�pCI-V (right panel).



.org/D

ownloaded from

http://jvi.asm.org/

analysis. Table 4 and Fig. 6 to 8 summarize the results of thecotransfection study. First, the noncoding bases (GUAA) atthe start of subgenomic RNA were examined for their role invirus replication by mutagenesis study. The first base at thebeginning of subgenomic RNA, G, was essential for the repli-cation of NV in this system. When the first base, G, wasmutated to U, A, or C (pNV-GFP-G5354U, pNV-GFP-G5354A,or pNV-GFP-G5354C), cotransfection of each plasmid withpCI-LC and pCI-V yielded few GFP-positive cells rangingfrom ca. 0.02 to 0.03% (Fig. 6B and Table 4). For the secondbase, U, while its mutation to A or C abolished the replicationof NV in the system (0.02 to 0.03%), its mutation to G resultedin comparable numbers of GFP-positive cells (5.1%) to that ofthe parental pNV-GFP (Fig. 6C, Table 4, and Fig. 5). The third(A) or fourth base (A) did not appear to be essential for virusreplication. The mutation of the third or fourth base to anybases yielded similar (or slightly lower, but without statisticalsignificance) numbers of GFP-positive cells ranging from 4.1 to4.5% to that of the parental pNV-GFP after cotransfection inVero cells (Table 4).

We also examined the 3� end of the NV genome for potentialcis-acting elements by generating a series of deletion mutants ofpNV-GFP. The designation of each plasmid—pNV-GFPD7080,pNV-GFPD7089, pNV-GFPD7480, pNV-GFPD7500, pNV-GFPD7534, pNV-GFPD7600, pNV-GFPD7610, pNV-GFPD7630,and pNV-GFPD7640—was based on the deletion that starts justafter the stop codon of the GFP gene to the base numbered in theconstruct (Fig. 7). While cotransfection of pNV-GFPD7080,pNV-GFPD7089, pNV-GFPD7480, or pNV-GFPD7500 withpCI-LC and pCI-V in Vero cells produced GFP-positive cells atrates similar to that of the parental plasmid (pNV-GFP), thecotransfection of pNV-GFPD7534, pNV-GFPD7600, pNV-GFPD7610, pNV-GFPD7630, or pNV-GFPD7640 did not pro-

duce any GFP-positive cells (Table 4 and Fig. 7 and 8), Theseresults indicated that the 3� untranslated region (3�UTR) and thelast part of the RNA sequences encoding ORF3 was essential,containing cis-acting elements for virus replication.

DISCUSSION

The inability to grow human noroviruses in cell culturegreatly impedes studies of their pathogenesis and immunity. Inthis report, we report NV replicon plasmids with reportergenes, pNV-GFP or pNV-RL, for studying the replication ofNV in cells. During the generation of NV replicon-bearingcells with pNV-Neo in our previous study, we noticed that onlya few populations of cells (either BHK21 or Huh-7) couldsupport NV replication when selected by the antibiotics. Theinitial study of transfecting pNV-GFP alone was consistentwith the observation that only few of the transfected cellsexpressed GFP. The enumeration of GFP-positive cells by flowcytometry failed to yield significant numbers above the level ofcontrol cells. However, we were consistently able to observesome GFP-positive cells under a fluorescence microscope afterthe transfection of pNV-GFP regardless of cell types. In thecase of hepatitis C virus (HCV), a phenomenon similar to thatseen for NV was observed during the generation of replicon-bearing cells: only a few cells in the population of Huh-7 weresusceptible to replication of HCV (20). Viral and cellular fac-tors that promote the replication of HCV in cell culture havebeen identified. As viral factors, adaptive mutations in theHCV genome led to the susceptible population and efficiencyof selecting replicon-harboring cells increased up to 1,000-foldin Huh-7 cells (2, 18). Cellular factors have also been identifiedfor HCV replication: cells with mutations in the IFN system(the retinoid-inducible gene 1) were much more susceptible toHCV replication than the parental cells (2, 9). However, unlikeHCV, we could not identify such adaptive mutations in theviral genome for NV replication in a similar study with NVreplicon-bearing cells (5). To identify any viral factors whichmay promote the replication of NV, our attention was focusedon the observation that vesiviruses grow efficiently in cell cul-ture and encode a unique protein in the subgenomic regiondesignated LC. Our hypothesis was that LC might be associ-ated with the efficient replication of vesiviruses in cell cultureand, if so, it might promote human norovirus replication incells. When we enumerated cells expressing GFP after thetransfection of pQ-GFP alone in various cells, including Vero,BHK21, or 293T cells, with MVA-T7, �4% of the cell popu-lation was GFP positive, suggesting that even FCV has somerestrictions on replication within the cells. This was consistentwith the transfection of pQ14, where virus replication wasmeasured by the IFA staining with VP1 antibody. However,cotransfection of pQ14 or pQ-GFP with pCI-LC indicated thatLC increased the cell population susceptible to FCV replica-tion by �2-fold in these cell lines (Fig. 2A and B). Althoughthe number of cells expressing GFP or VP1 increased by thecotransfection, virus titers after the transfection of pQ14 withor without pCI-LC were similar to each other (Fig. 2C). Onepossible explanation is that the intensity of GFP and VP1expression was reduced by the cotransfection with pCI-LC inthe cells (Fig. 2A and B), which may offset the titers. Theoverexpression of LC triggers morphological changes (cell

TABLE 4. Summary of mutagenesis study

Plasmid Bases Amino acidchange

Mean no. ofGFP-positivecells SDa

NVreplication

Wild type GUAApNV-GFP-G5354C CUAA Val to Leu 0.03 0.02 –pNV-GFP-G5354A AUAA Val to Ile 0.02 0.01 –pNV-GFP-G5354U UUAA Val to Ile 0.02 0.02 –pNV-GFP-U5355A GAAA Val to Glu 0.03 0.01 –pNV-GFP-U5355C GCAA Val to Ala 0.02 0.01 –pNV-GFP-U5355G GGAA Val to Gly 5.1 1.2 �pNV-GFP-A5356U GUUA Val to Val 4.3 1.4 �pNV-GFP-A5356C GUCA Val to Val 4.1 0.8 �pNV-GFP-A5356G GUGA Val to Val 4.5 1.1 �pNV-GFP-A5357U GUAU Asn to Tyr 4.2 2.2 �pNV-GFP-A5357C GUAC Asn to His 4.5 1.3 �pNV-GFP-A5357G GUAG Asn to Asp 4.4 0.9 �pNV-GFP-Dto7080 NA NA 5.4 1.2 �pNV-GFP-Dto7089 NA NA 5.1 1.4 �pNV-GFP-Dto7480 NA NA 4.9 0.8 �pNV-GFP-Dto7500 NA NA 4.7 1.6 �pNV-GFP-Dto7534 NA NA 0.02 0.02 –pNV-GFP-Dto7600 NA NA 0.02 0.01 –pNV-GFP-Dto7610 NA NA 0.03 0.02 –pNV-GFP-Dto7630 NA NA 0.02 0.01 –pNV-GFP-Dto7640 NA NA 0.03 0.01 –

a GFP-positive cells were measured as the expression of GFP as determined byflow cytometry analysis.



.org/D

ownloaded from

http://jvi.asm.org/

rounding) and apoptosis of cells (unpublished observation).We also found that LC significantly reduced the expression ofluciferase under the promoter of CMV after transfection (un-published observation), suggesting that it might have an inhib-

itory effect on overall protein translation, probably due to theapoptosis. We are conducting further experiments to examinethe role of LC in protein translation and apoptosis in correla-tion with the increased expression of FCV VP1 and GFP.

FIG. 6. Mutagenesis study for the potential promoter activity at the start of subgenomic RNA of NV genome. (A) Conserved bases at the startof NV genome and subgenomic RNA. The first 26 conserved bases contain the start codons (boldface) for ORF1 and VP1 and the stop codon forORF1 (underlined). In pNV-GFP, the GFP gene was inserted in place of VP1 using the BamHI site (positions 5465 to 5470). (B) GFP-positivecells observed under a fluorescent (left panel) or a light microscope (right panel) after Vero cells were cotransfected with pNV-GFP-G5354C orpNV-GFP-U5355G and pCI-LC plus pCI-V (after MVA-T7 infection). (C) Flow cytometry analysis of Vero cells were cotransfected withpNV-GFP-G5354C or pNV-GFP-U5355G and pCI-LC plus pCI-V (after MVA-T7 infection).

FIG. 7. Mutagenesis study for cis-acting elements in 3�-end region of NV genome. (A) Schematic diagram of the 3�-end region of NV genomeincluding ORF2, ORF3, and 3�UTR. The enzyme site of AgeI is located at positions 6753 to 6758 in ORF2, and there are 66 bases in the 3�UTRbetween the stop codon of VP2 (ORF3) and the poly(A) tail. (B) Summary of deletion mutants targeting ORF2, ORF3, and 3�UTR and GFPexpression after cotransfection of each mutant, pCI-LC and pCI-V into MVA-T7-infected Vero cells.



.org/D

ownloaded from

http://jvi.asm.org/

When testing pCI-based plasmids containing LC from otherFCV strains such as F9 (vaccine strain) or Ari (22) for thecotransfection study, we observed similar results, as they en-hanced the expression of VP1 or GFP with FCV-based plas-mids (unpublished observation).

When we performed the same experiments with the reporterplasmids of NV, we found that LC promoted the replication ofNV as well. First, the transfection of pNV101 or pNV-GFPinto MVA-T7-infected cells (BHK21, HEK293T, or Verocells) produced few VP1- or GFP-positive cells. However, co-transfection of pNV101 or pNV-GFP and pCI-LC producedsignificantly increased numbers of VP1- or GFP-positive cells,

respectively, in those cells. The percentage of GFP-positivecells after the cotransfection of pNV-GFP and pCI-LC was ca.3% of the whole population (Fig. 3). Cotransfection of pNV-GFP and pCI-V also produced increased numbers of GFP-expressing cells, indicating the importance of innate immunityas a restriction factor for NV replication in cells. Furthermore,we found that there were synergistic effects of LC and V inpromoting NV replication. We observed similar results withthe full-length clone of NV, pNV101. Although transfection ofpNV101 alone produced few VP1-positive cells, cotransfectionof pNV101 and pCI-LC resulted in significant numbers of cellsexpressing VP1 as detected by various methods including IFA,

FIG. 8. Cotransfection of each pNV-GFP mutant, pCI-LC, and pCI-V into MVA-T7-infected Vero cells. (A) GFP-positive cells observedunder a fluorescence microscope after cells were transfected with pNV-GFP-d7500 or pNV-GFP-d7534 and pCI-LC plus pCI-V. The bottom panelis the corresponding area observed under a light microscope (after MVA-T7 infection). (B) Flow cytometry analysis to enumerate GFP-positivecells after Vero cells were transfected with pNV-GFP-d7500 or pNV-GFP-d7534 and pCI-LC plus pCI-V (after MVA-T7 infection).



.org/D

ownloaded from

http://jvi.asm.org/

Western blot analysis, and ELISA. Using IFA with monoclonalantibody against NV VP1, we could observe distinct localiza-tion of VP1 in the cells reminiscent of that of MNV-1-infectedcells (Fig. 4A) (30), suggesting that VP1 may be the part of thereplicase complexes and/or virions are assembled within thereplicase complexes during the replication of NV in cells. Sincethe transfection of pQ14 resulted in the production of approx-imately 2 � 103 PFU of viable viruses/ml, it is possible that thecotransfection of pNV101 and pCI-LC produces viable virusesin cells. We are currently working on the identification ofviable NV or NV particles in the supernatant and/or cell lysatesof the cotransfection. To rule out the effects of MVA-T7 in NVreplication in the cotransfection study, we used BHK21 cellsstably expressing T7 Pol for the cotransfection study and foundsimilar results. Cotransfection of pNV-GFP and pCI-LC intothe cells yielded GFP-positive cells but with much less effi-ciency than the MVA-T7 system (unpublished observation).

Using the cotransfection approach, we could identify poten-tial cis-acting elements for NV replication. This is a significantadvance because this cell-based system provides a valuable toolto study RNA elements for the fastidious virus. In the presentstudy, we focused on RNA elements at the beginning of thesubgenomic RNA and 3�-end region, including 3�UTR andORF3 for NV replication. Our first observation noted that thefirst base (G) at the beginning of subgenomic RNA was essen-tial for virus replication. The mutant plasmids with substitutionto other bases at the first base (G) did not produce any GFP-positive cells. It has been postulated that the first base G is thesite of VPg linkage, and the mutations may abolish this activity.The second base (U) is also important in the virus replication,and the mutation to bases other than G abolished the replica-tion, as confirmed through the cotransfection study (Table 4).However, we cannot rule out that the lack of GFP expressionby pNV-GFP-G5354U, pNV-GFP-G5354A, pNV-GFP-G5354C,pNV-GFP-U5355A, or pNV-GFP-U5355C is due to defects inPol activity because the mutations also altered the amino acidsat the end of the enzyme (Table 4). The third and fourth baseswere not essential for virus replication, and substitution muta-tions only slightly reduced GFP-positive cells in the cotrans-fection experiments. As for RNA bases essential for NV rep-lication at the 3� end of genome, we found that both the3�UTR (66 bases) and the last stretch of bases encoding VP2were essential for virus replication (Table 4 and Fig. 7 and 8).This finding was in accordance with our previous studies withFCV in which we also demonstrated that the ORF3 nucleotidesequence itself overlaps a cis-acting RNA signal at the genomic3� end (26). It is possible that the secondary RNA structures inthe region may interact with viral replicase complexes for suc-cessful replication. We plan to generate additional mutants inthe region based on the predicted RNA structure to examineits roles in NV replication.

In summary, we conclude that LC may be a viral factor thatpromotes the replication of NV in cells. Also, we found thatinhibiting the STAT1 pathway promoted NV replication. Atpresent, we are trying to produce cell lines constitutively ex-pressing LC, V, or LC plus V to examine whether they supportNV replication without cotransfection. It is not yet clear bywhat mechanism LC has an effect on the replication of FCVand NV. It is possible that LC may interfere with the IFNpathway or interact with viral components to promote virus

replication. We are currently conducting experiments to iden-tify the potential mechanisms focused on the role of LC in theIFN pathway and interaction with viral proteins. We also re-port a reliable NV replicon system with reporter genes to studythe replication of NV. Identification of viral or cellular factorswhich promote NV replication could provide vital clues togrowing the fastidious human noroviruses in cell culture.

ACKNOWLEDGMENTS

This study was partly supported by NIH COBRE grant 2 P20RR016443-07.

This paper is contribution no. 08-208-J from the Kansas AgriculturalExperiment Station.

REFERENCES

1. Asanaka, M., R. L. Atmar, V. Ruvolo, S. E. Crawford, F. H. Neill, and M. K.Estes. 2005. Replication and packaging of Norwalk virus RNA in culturedmammalian cells. Proc. Natl. Acad. Sci. USA 102:10327–10332.

2. Blight, K. J., J. A. McKeating, J. Marcotrigiano, and C. M. Rice. 2003.Efficient replication of hepatitis C virus genotype 1a RNAs in cell culture.J. Virol. 77:3181–3190.

3. Chang, K. O., and D. W. George. 2007. Interferons and ribavirin effectivelyinhibit Norwalk virus replication in replicon-bearing cells. J. Virol. 81:12111–12118.

4. Chang, K. O., Y. Kim, K. Y. Green, and L. J. Saif. 2002. Cell-culturepropagation of porcine enteric calicivirus mediated by intestinal contents isdependent on the cyclic AMP signaling pathway. Virology 304:302–310.

5. Chang, K. O., S. V. Sosnovtsev, G. Belliot, A. D. King, and K. Y. Green. 2006.Stable expression of a Norwalk virus RNA replicon in a human hepatomacell line. Virology 353:463–473.

6. Duizer, E., K. J. Schwab, F. H. Neill, R. L. Atmar, M. P. Koopmans, andM. K. Estes. 2004. Laboratory efforts to cultivate noroviruses. J. Gen. Virol.85:79–87.

7. Fankhauser, R. L., J. S. Noel, S. S. Monroe, T. Ando, and R. I. Glass. 1998.Molecular epidemiology of “Norwalk-like viruses” in outbreaks of gastroen-teritis in the United States. J. Infect. Dis. 178:1571–1578.

8. Fernandez-Vega, V., S. V. Sosnovtsev, G. Belliot, A. D. King, T. Mitra, A.Gorbalenya, and K. Y. Green. 2004. Norwalk virus N-terminal nonstructuralprotein is associated with disassembly of the Golgi complex in transfectedcells. J. Virol. 78:4827–4837.

9. Foy, E., K. Li, R. Sumpter, Jr., Y. M. Loo, C. L. Johnson, C. Wang, P. M.Fish, M. Yoneyama, T. Fujita, S. M. Lemon, and M. Gale, Jr. 2005. Controlof antiviral defenses through hepatitis C virus disruption of retinoic acid-inducible gene-I signaling. Proc. Natl. Acad. Sci. USA 102:2986–2991.

10. Geissler, K., K. Schneider, G. Platzer, B. Truyen, O. R. Kaaden, and U.Truyen. 1997. Genetic and antigenic heterogeneity among feline calicivirusisolates from distinct disease manifestations. Virus Res. 48:193–206.

11. Green, K. Y. 2007. Caliciviridae: the noroviruses, p. 949–980. In D. M. Knipe(ed.), Fields virology, 5th ed., vol. 1. Lippincott/The Williams & Wilkins Co.,Philadelphia, PA.

12. Guix, S., M. Asanaka, K. Katayama, S. E. Crawford, F. H. Neill, R. L. Atmar,and M. K. Estes. 2007. Norwalk virus RNA is infectious in mammalian cells.J. Virol. 81:12238–12248.

13. Hsu, C. C., L. K. Riley, H. M. Wills, and R. S. Livingston. 2006. Persistentinfection with and serologic cross-reactivity of three novel murine norovi-ruses. Comp. Med. 56:247–251.

14. Jiang, X., M. Wang, K. Wang, and M. K. Estes. 1993. Sequence and genomicorganization of Norwalk virus. Virology 195:51–61.

15. Kageyama, T., S. Kojima, M. Shinohara, K. Uchida, S. Fukushi, F. B.Hoshino, N. Takeda, and K. Katayama. 2003. Broadly reactive and highlysensitive assay for Norwalk-like viruses based on real-time quantitative re-verse transcription-PCR. J. Clin. Microbiol. 41:1548–1557.

16. Kapikian, A. Z., R. G. Wyatt, R. Dolin, T. S. Thornhill, A. R. Kalica, andR. M. Chanock. 1972. Visualization by immune electron microscopy of a27-nm particle associated with acute infectious nonbacterial gastroenteritis.J. Virol. 10:1075–1081.

17. Karst, S. M., C. E. Wobus, M. Lay, J. Davidson, and H. W. t. Virgin. 2003.STAT1-dependent innate immunity to a Norwalk-like virus. Science 299:1575–1578.

18. Krieger, N., V. Lohmann, and R. Bartenschlager. 2001. Enhancement ofhepatitis C virus RNA replication by cell culture-adaptive mutations. J. Vi-rol. 75:4614–4624.

19. Lambden, P. R., E. O. Caul, C. R. Ashley, and I. N. Clarke. 1993. Sequenceand genome organization of a human small round-structured (Norwalk-like)virus. Science 259:516–519.

20. Lohmann, V., F. Korner, J. Koch, U. Herian, L. Theilmann, and R. Barten-schlager. 1999. Replication of subgenomic hepatitis C virus RNAs in ahepatoma cell line. Science 285:110–113.



.org/D

ownloaded from

http://jvi.asm.org/

21. Mead, P. S., L. Slutsker, V. Dietz, L. F. McCaig, J. S. Bresee, C. Shapiro,P. M. Griffin, and R. V. Tauxe. 1999. Food-related illness and death in theUnited States. Emerg. Infect. Dis. 5:607–625.

22. Ossiboff, R. J., A. Sheh, J. Shotton, P. A. Pesavento, and J. S. Parker. 2007.Feline caliciviruses (FCVs) isolated from cats with virulent systemic diseasepossess in vitro phenotypes distinct from those of other FCV isolates. J. Gen.Virol. 88:506–517.

23. Smith, A. W., D. E. Skilling, N. Cherry, J. H. Mead, and D. O. Matson. 1998.Calicivirus emergence from ocean reservoirs: zoonotic and interspeciesmovements. Emerg. Infect. Dis. 4:13–20.

24. Sosnovtsev, S., and K. Y. Green. 1995. RNA transcripts derived from acloned full-length copy of the feline calicivirus genome do not require VpGfor infectivity. Virology 210:383–390.

25. Sosnovtsev, S. V., G. Belliot, K. O. Chang, and K. Y. Green. 2004. Inductionof apoptosis in feline calicivirus-infected cells: implication of the p30 (3A-like) protein in caspase activation, abstr. P2H7. Seventh International Sym-posium on Positive Strand RNA Viruses, San Francisco, CA.

26. Sosnovtsev, S. V., G. Belliot, K. O. Chang, O. Onwudiwe, and K. Y. Green.2005. Feline calicivirus VP2 is essential for the production of infectiousvirions. J. Virol. 79:4012–4024.

27. Sosnovtsev, S. V., S. A. Sosnovtseva, and K. Y. Green. 1998. Cleavage of thefeline calicivirus capsid precursor is mediated by a virus-encoded proteinase.J. Virol. 72:3051–3059.

28. Spann, K. M., K. C. Tran, B. Chi, R. L. Rabin, and P. L. Collins. 2004.

Suppression of the induction of alpha, beta, and lambda interferons by theNS1 and NS2 proteins of human respiratory syncytial virus in human epi-thelial cells and macrophages. J. Virol. 78:4363–4369.

29. Straub, T. M., K. Honer zu Bentrup, P. Orosz-Coghlan, A. Dohnalkova,B. K. Mayer, R. A. Bartholomew, C. O. Valdez, C. J. Bruckner-Lea, C. P.Gerba, M. Abbaszadegan, and C. A. Nickerson. 2007. In vitro cell cultureinfectivity assay for human noroviruses. Emerg. Infect. Dis. 13:396–403.

30. Wobus, C. E., S. M. Karst, L. B. Thackray, K. O. Chang, S. V. Sosnovtsev,G. Belliot, A. Krug, J. M. Mackenzie, K. Y. Green, and H. W. T. Virgin. 2004.Replication of norovirus in cell culture reveals a tropism for dendritic cellsand macrophages. PLoS Biol. 2:e432.

31. Wobus, C. E., L. B. Thackray, and H. W. t. Virgin. 2006. Murine norovirus:a model system to study norovirus biology and pathogenesis. J. Virol. 80:5104–5112.

32. Wyatt, L. S., B. Moss, and S. Rozenblatt. 1995. Replication-deficient vacciniavirus encoding bacteriophage T7 RNA polymerase for transient gene ex-pression in mammalian cells. Virology 210:202–205.

33. Xi, J. N., D. Y. Graham, K. N. Wang, and M. K. Estes. 1990. Norwalk virusgenome cloning and characterization. Science 250:1580–1583.

34. Young, D. F., L. Andrejeva, A. Livingstone, S. Goodbourn, R. A. Lamb, P. L.Collins, R. M. Elliott, and R. E. Randall. 2003. Virus replication in engi-neered human cells that do not respond to interferons. J. Virol. 77:2174–2181.



.org/D

ownloaded from

http://jvi.asm.org/

leader of the capsid protein in feline calicivirus ...jvi.asm.org/content/82/19/9306.full.pdf ·...

Documents