lactic acid bacteria and their antimicrobial peptides ...1. lactic acid bacteria lactic acid...

16/2010

Lactic Acid Bacteria and Their Antimicrobial Peptides: Induction, Detection, Partial Characterization,

and Their Potential Applications

Dissertationes bioscientiarum molecularium Universitatis Helsingiensis in Viikki

HANAN T. ABBAS HILMI

Division of MicrobiologyDepartment of Food and Environmental Sciences

Faculty of Agriculture and ForestryUniversity of Helsinki

LACTIC ACID BACTERIA AND THEIRANTIMICROBIAL PEPTIDES:

INDUCTION, DETECTION, PARTIAL CHARACTERIZATION, AND THEIR POTENTIAL APPLICATIONS

Hanan T. Abbas Hilmi

Department of Food and Environmental Sciences Division of Microbiology Faculty of Agriculture and Forestry University of Helsinki

Finland

Academic Dissertation in Microbiology

To be presented, with permission of the Faculty of Agriculture and Forestry of the University of Helsinki, for public criticism in auditorium 1041, Viikki Biocenter,

Viikinkaari 5, Helsinki, on June 18th at 12 o’clock noon.

Helsinki 2010

Supervisor: Professor Per Saris Department of Food and Environmental Sciences University of Helsinki Finland

Reviewers: Professor Seppo Salminen Department of Biochemistry and Food Functional Food Forum Faculty of Mathematics and Natural Sciences University of Turku Finland

Professor Matti Karp Institute of Environmental Engineering and Biotechnology Tampere University of Technology Finland

Opponent: Professor Djamel Drider Nantes Atlantic College of Veterinary Medicine, Food Science and Engineering,ONIRIS-Nantes. France

Printed: Yliopistopaino 2010, Helsinki, FinlandLayout: Timo Päivärinta

ISSN: 1795-7079ISBN: 978-952-10-6329-9 (paperback)ISBN: 978-952-10-6330-5 (PDF)

email: [email protected]

To my beloved parents,husband, son and daughter

TABLE OF CONTENTS

LIST OF ORIGINAL PUBLICATIONSTHE AUTHOR’S CONTRIBUTIONABBREVIATIONSABSTRACTINTRODUCTION .............................................................................................................. 11. LACTIC ACID BACTERIA ................................................................................... 1 1.1. Antimicrobial peptides produced by lactic acid bacteria ..................................... 1 1.2. Impact of LAB and their antimicrobial peptides in food safety and therapy ......... 22. NISIN ................................................................................................................... 5 2.1. Nisin biosynthesis ........................................................................................... 6 2.2. Regulation of nisin .......................................................................................... 7 2.3. Nisin secretion; transport and proteolytic processing .......................................... 8 2.4. Detection and quantifi cation of nisin ................................................................. 93. FLOW CYTOMETRY (FCM) AND FLUORESENCE-ACTIVATED CELL SORTING (FACS) OF BACTERIAL CELLS .............................................. 114. CHICKEN MICROBIOTA AND POTENTIAL OF LAB AND/OR THEIR ANTIMICROBIAL PEPTIDES IN CHICKEN FARMING ......................... 13 4.1. Alternatives to growth-promoting antibiotics (GPA) in poultry production ........ 13 4.1.1. Competitive enhancement techniques (CE) ........................................... 14 4.1.1.1. Competitive exclusion ............................................................. 14 4.1.1.2. Probiotics ............................................................................... 16 4.1.1.3. Prebiotics .............................................................................. 17 4.2. Campylobacter and chicken farming ............................................................... 18 4.2.1. Peptide bacteriocins ............................................................................. 19 4.2.2. Phage therapy ...................................................................................... 205. AIMS OF THE STUDY ....................................................................................... 216. MATERIALS AND METHODS ........................................................................... 22 6.1. Strains and plasmids ..................................................................................... 22 6.2. Methods ....................................................................................................... 24 6.2.1. Northern hybridization analysis ............................................................ 24 6.2.2. Nisin bioassay ..................................................................................... 25 6.2.3. GFP and GFPuv based bioassays ............................................................ 25 6.2.4. Fluorescence-activated cell sorting ....................................................... 26 6.2.5. Chickens and diets ............................................................................... 26 6.2.6. Isolation and enumeration of crop bacteria ............................................ 27 6.2.7. Identifi cation of the crop microbiota ..................................................... 27 6.2.8. Fatty acid analysis and FAME chromatography of L. reuteri strains ........ 27 6.2.9. Detection of antagonistic activity of L. salivarius strains against C. jejuni 28 6.2.10. Purifi cation of the bacteriocin from bacterial culture ............................ 28 6.2.11. Solid phase extraction(SPE) ............................................................... 28 6.2.12. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) .............................................................. 29

7. RESULTS AND DISCUSSION ............................................................................ 30 7.1. Nisin induction studies (I, II) ......................................................................... 30 7.1.1. Knockout of the nisT gene in L. lactis caused induction of the PnisZ promoter ............................................................. 30 7.1.2. Nisin detection in the medium and the cytoplasm of L. lactis cells .......... 30 7.1.3. Activation of fully modifi ed nisin precursor in the cytoplasm of L. lactis .......................................................................... 31 7.1.4. How does intracellular nisin induce the nisin promoters? ....................... 32 7.1.5. Isolation of natural mutants of the GFPuv nisin bioassay indicator L. lactis LAC275 cells by FACS(II) .......................... 33 7.2. Applied focus:secreening of bacteriocinogenic lab strains for future feeding trials in chicken(III,IV) ............................................ 34 7.2.1. Characterization of the crop microbiota(III) ........................................... 34 7.2.2. Characterization of L. salivarius bacteriocin which exhibit antagonistic activity against Campylobacter jejuni(IV) .......................... 358. CONCLUSIONS ................................................................................................. 379. FUTURE PROSPECTS ........................................................................................ 3810. ACKNOWLEDGEMENTS ................................................................................ 3911. LITERATURE CITED ....................................................................................... 41

LIST OF ORIGINAL PAPERS

This thesis is based on the following original papers, referred to in the text by their Roman numerals.

I. Hanan T. Abbas Hilmi, Kari Kylä-Nikkilä, Runar Ra and Per E. J. Saris. 2006. Nisin induction without secretion. Microbiology 152: 1489-1496.

II. Hanan T. Abbas Hilmi, Kaisa Hakkila and Per E. J. Saris. 2009. Isolation of sensitive nisin-sensing GFPuv bioassay Lactococcus lactis strains using FACS. Biotechnol. Lett. 31: 119–122.

III. Hanan T. Abbas Hilmi, Anu Surakka, Juha Apajalahti and Per E. J. Saris. 2007. Identifi cation of the most abundant Lactobacillus species in the crop of 1- and 5-week-old broiler chickens. Appl. Environ. Microbiol. 73: 7867-7873.

IV. Hanan T. Abbas Hilmi, and Per E.J. Saris. 2010. Characterization of Lactobacillus salivarius bacteriocin inhibitory to Campylobacter jejuni. Submitted to J. Appl. Microbiol.

The original papers were reproduced with the kind permission of the copyright holders: Society for General Microbiology,American Society for Microbiology and Springer.

The author’s contribution

Publication IHanan Abbas Hilmi performed all the experimental work (excluding the Northern hybridization), interpreted the results and wrote the Paper in collaboration with the corresponding author.

Publication IIHanan Abbas Hilmi performed all experimental work (excluding FCM SOFTWANAk),interpreted the results and wrote the article in collaboration with the corresponding author.

Publication IIIHanan Abbas Hilmi performed all the experimental work, (excluding the isolation and identifi cation of Lactobacillus species, though the identifi ty of L. salivarius LAB47 was confi rmed by Abbas Hilmi).Abbas Hilmi interpreted the results, and the diversity results were interpreted in collaboration with Anu Surakka and corresponding author. Abbas Hilmi wrote the article in collaboration with the corresponding author.

Publication IVHanan Abbas Hilmi designed the experiments, performed all experimental work, interpreted the results and wrote the article in collaboration with the corresponding author.

ABBREVIATIONS

aaABCAbuDhaDhbAMPCE CFU DFMe. g.et al. etc.GALTGFP GFPuv GITGPAGRASHKIM IUkDaLABLanLBLBS MeLan MICODFACSFCMPCRPMSFRKSCFASDSTCSQS

Amino acidATP-binding cassetteAminobutyric acidDihydroalanineDihydrobutyrineAntimicrobial peptidesCompetitive exclusionColony-forming unitDirect-fed microbialsexample gratia, for exampleet alii , and otherset cetera, and so onGut-associated lymphoid tissueGreen fl uorescent proteinUltraviolet variant of green fl uorescent proteinGastrointestinal tractGrowth promoting antibioticsGenerally recognized as safeHistidine kinaseIntegral membraneInternational unitKilodaltonLactic acid bacteriaLanthionineLuria Bertani mediumLactobacillus selective mediumMethyl-lanthionineMinimum inhibitory concentrationOptical densityFluorescence activated cell sortingFlow cytometryPolymerase chain reactionPhenylmethylsulfonyl fl uoride Response regulatorShort chain fatty acid Sodium dodecyl sulphateTwo-component systemQuorum sensing

ABSTRACT

Bacteriocin-producing lactic acid bacteria and their isolated peptide bacteriocins are of value to control pathogens and spoiling microorganisms in foods and feed. Nisin is the only bacteriocin that is commonly accepted as a food preservative and has a broad spectrum of activity against Gram-positive organisms including spore forming bacteria. In this study nisin induction was studied from two perspectives, induction from inside of the cell and selection of nisin inducible strains with increased nisin induction sensitivity. The results showed that a mutation in the nisin precursor transporter NisT rendered L. lactis incapable of nisin secretion and lead to nisin accumulation inside the cells. Intracellular proteolytic activity could cleave the N-terminal leader peptide of nisin precursor, resulting in active nisin in the cells. Using a nisin sensitive GFP bioassay it could be shown, that the active intracellular nisin could function as an inducer without any detectable release from the cells. The results suggested that nisin can be inserted into the cytoplasmic membrane from inside the cell and activate NisK. This model of two-component regulation may be a general mechanism of how amphiphilic signals activate the histidine kinase sensor and would represent a novel way for a signal transduction pathway to recognize its signal.

In addition, nisin induction was studied through the isolation of natural mutants of the GFPuv nisin bioassay strain L. lactis LAC275 using fl uorescence-activated cell sorting (FACS). The isolated mutant strains represent second generation of GFPuv bioassay strains which can allow the detection of nisin at lower levels.

The applied aspect of this thesis was focused on the potential of bacteriocins in chicken farming. One aim was to study nisin as a potential growth promoter in chicken feed. Therefore, the lactic acid bacteria of chicken crop and the nisin sensitivity of the isolated strains were tested. It was found that in the crop Lactobacillus reuteri, L. salivarius and L. crispatus were the dominating bacteria and variation in nisin resistance level of these strains was found. This suggested that nisin may be used as growth promoter without wiping out the dominating bacterial species in the crop. As the isolated lactobacilli may serve as bacteria promoting chicken health or reducing zoonoosis and bacteriocin production is one property associated with probiotics, the isolated strains were screened for bacteriocin activity against the pathogen Campylobacter jejuni. The results showed that many of the isolated L. salivarius strains could inhibit the growth of C. jejuni. The bacteriocin of the L. salivarius LAB47 strain, with the strongest activity, was further characterized. Salivaricin 47 is heat-stable and active in pH range 3 to 8, and the molecular mass was estimated to be approximately 3.2 kDa based on tricine SDS-PAGE analysis.

1

1. LACTIC ACID BACTERIA

Lactic acid bacteria (LAB) constitute a diverse group of Gram-positive bacteria, characterized by some common morphological, metabolic and physiological traits. They are anaerobic bacteria, non-sporulating, acid tolerant and produce mainly lactic acid as an end product of carbohydrate fermentation. Lactic acid bacteria consist of a number of diverse genera which include both homofermenters and heterofermenters based on the end product of their fermentation.The homofermenters produce lactic acid as the major product of fermentation of glucose and include the genera Lactococcus, Streptococcus and Pediococcus. In contrast, the heterofermenters produce a number of products besides lactic acid, such as carbon dioxide, acetic acid, and ethanol from the fermentation of glucose and includes the genus Leuconostoc and a subgroup of the genus Lactobacillus, the Betabacteria (Jay 1986; Kandler et al. 1986; Schillinger and Lücke 1987).

Lactic acid bacteria consist of a number of bacterial genera within the phylum Firmicutes. Recent taxonomic studies suggested that the LAB group includes the following genera; Carnobacterium, Enterococcus, Lactobacillus, Lactococcus, Lactosphaera, Leuconostoc, Melissococcus, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, Vagococcus and Weissella (Ercolini et al. 2001; Holzapfel et al. 2001; Carr et al. 2002). Species of these genera can be found in the GIT of man and animal as well as in fermented food. LAB strains used as probiotics usually belong to species of the genera Lactobacillus, Enterococcus or Bifi dobacterium.

Gram-positive bacteria belonging to the phylum Actinobacteria, such as the genera Aerococcus, Microbacterium, Propionibacterium (Sneath and Holt 2001) and Bifi dobacterium (Gibson and Fuller 2000; Holzapfel et al. 2001) also produce lactic acid.

The core LAB genera Lactobacillus, Lactococcus, Leuconostoc, Pediococcus and Streptococcus share a long history of safe usage in the processing of fermented foods. The antimicrobial effects and safety of LAB in food preservation is widely accepted (EFSA, 2005; de Vuyst and Leroy 2007; Sit and Vederas 2008). Their preservative effect is mainly due to the production of lactic acid and other organic acids which results in lowering of pH (Daeschel 1989). Preservation is enhanced by the production of other antimicrobial compounds, including hydrogen peroxide, CO2, diacetyl, acetaldehyde, and bacteriocins (Stiles and Hastings 1991; Klaenhammer 1988; 1993).

In addition to the antimicrobial effects specifi c LAB also possess health promoting properties. Evidence from in vitro systems, animal models, and human clinical studies suggest that LAB function as immunomodulators and can enhance both specifi c and non-specifi c immune responses (Ouwehand et al. 1998; 2002; O’Flaherty and Klaenhammer 2009) justifying their use as health promoting supplements or probiotics both for humans and animals.

1.1. Antimicrobial peptides produced by lab

Lactic acid bacteria are capable of producing a wide range of ribosomally synthesized proteins and peptides which have antimicrobial activity to compete with other bacteria of the same species (narrow spectrum) or to counteract bacteria of other genera (broad spectrum) (Cotter et al. 2005). The first description of bacteriocin-mediated growth

Introduction

2

inhibition was reported 85 years ago, when antagonism between strains of Escherichia coli was fi rst discovered (Gartia 1925). The inhibitory substances were called ‘colicins’, to refl ect the producer organism, whereas gene-encoded antibacterial peptides produced by bacteria are now referred to as ‘bacteriocins’.

Since their initial discovery in 1925, numerous bacteriocins have been isolated from LAB. Continuous discovery of new bacteriocins with novel features requires an updating of the classifi cation of bacteriocins.

Based on a recently proposed classifi cation (Drider et al. 2006), there are three main classes of LAB-produced bacteriocins as shown in table (1).

According to database BACTIBASE (Hammami et al. 2007), http://bactibase.pfba-lab-tun.org/bacteriocinslist.php?start=1, a list of 180 entries, including 45 lanthionine-containing bacteriocins (Class I), 55 non-lanthionine-containing bacteriocins (Class II) and 80 other unclassifi ed entries are listed.

Table 1. Classifi cation of LAB bacteriocins according to Drider et al. 2006.

Category Subcategory Characteristics Examples

Class I Lantibiotics, lanthionine containing

Class IINon-modifi ed heat –stable bacteriocins

Class IIIProtein bacteriocins

Type A

Type Type B

Subclass IIa(antilisterial pediocin-like bacteriocins)

Subclass IIb(two-peptide bacteriocins) Subclass IIc(other peptide bacteriocins)

elongated molecules: molecular mass <4 kDa

globular molecules;molecular mass 1.8 to 2.1 kDa

molecular masses <10 kDa

molecular masses>30 kDa

Nisin

Mersacidin

Pediocin PA-1

Plantaricin EF

Lactococcin 972

Helveticin J

1.2. Impact of lab and their antimicrobial peptides in food safety and therapy

In 2005 an estimated 1.8 million people died from diarrhoeal diseases, largely attributable to contaminated food and drinking water (Newell et al. 2010). About 76 million cases of food-borne diseases, resulting in 325,000 hospitalizations and 5000 deaths, are estimated to occur each year in the United States of America (USA) alone (Newell et al. 2010). In Finland, a total of 39 500 persons contracted food-borne illness in outbreaks during years 1975-2006 (Niskanen et al. 2007).

Introduction

3

Clearly, food and water safety need to be improved. Microbes have an extraordinary array of defense systems. These include classical antibiotics, metabolic by-products such as lactic acid, numerous types of protein exotoxins, and antimicrobial peptides such as bacteriocins. The most promising antimicrobial peptides are those produced by LAB. Most LAB bacteriocins are non-toxic to eukaryotic cells and generally recognized as safe substances being active in the nanomolar range (Cotter et al. 2005; Peschel and Sahl 2006). LAB antimicrobial peptides typically exhibit antibacterial activity against food-borne pathogens, as well as spoilage bacteria. Therefore, they have attracted the greatest attention as tools for food biopreservation (Collins et al. 1998; O’Sullivan et al. 2002; Reid et al. 2003).

Bacteriocins can be introduced into food in three different ways: (1) bacteriocins can be produced in situ in fermented food by bacterial cultures that substitute for all or part of the starter culture; (2) purifi ed or semi-purifi ed bacteriocins can be added directly to food; (3) or as an ingredient (Cotter et al. 2005; Calo-Mata et al. 2008).

The incorporation of bacteriocins as biopreservative ingredients into model food systems has been shown to be effective in the control of pathogenic and spoilage microorganisms (Leroy et al 2005; Leroy and de Vuyst 2005). Nisin is produced by L. lactis and has the most widespread usage and is the only bacteriocin having a status as a food additive designated as E234 (EEC 1983). Different strategies for the addition of LAB bacteriocins, especially those not accepted as food additives have been proposed. They may be produced ex situ and added as spent fermentation preparations or produced in situ in the food by bacteriocinogenic LAB. Food starters known to produce bacteriocins are on the market (Danisco) resulting in bacteriocin production during the food processing. Preparations containing nisin (commercialized in the form of Nisaplin™) or pediocin PA-1/AcH (commercialized in the form of ALTA2341) are commercially available. It may be practical and economical to incorporate bacteriocins into foods by the addition of bacteriocin-producing cultures for in situ production (O’Sullivan et al. 2002). Nowadays, antimicrobial peptide producing LAB are routinely employed as starter cultures in the manufacture of dairy, meat and vegetable products for increased quality and food safety (O’Sullivan et al. 2002). LAB have successfully been employed, at laboratory scale, as ‘protective cultures’ to inhibit pathogenic microorganisms in a variety of food systems (Ryan et al. 1996; 1999; Oumer et al. 2001).

Some LAB strains also have a health promoting capacity in humans (Avonts and de Vuyst 2001; Avonts et al. 2004) which may be explained in part by the production of antibacterial peptides which inhibit the growth of pathogens. Antimicrobial activity by probiotic cultures has at least been demonstrated in vitro (Pridmore et al. 2008; Ryan et al. 2009). Support for in vivo action has been presented by Corr and others (2007) who demonstrated that oral intake of Lactobacillus salivarius UCC118 protected mice against infection with the food-borne pathogen Listeria monocytogenes, which was sensitive to the bacteriocin produced by the UCC118 strain. Starter cultures that offer functionalities beyond acidifi cation like the production of bacteriocins are being explored (Leroy and de Vuyst 2004; de Vuyst et al. 2004; Gänzle 2009). In some countries LAB are already extensively used as probiotics in food processing and preservation (de Vuyst and Leroy 2007). LAB-derived bacteriocins have been utilized as oral, topical antibiotics or disinfectants. Nisin is one of few examples of AMP-based antibiotic therapies that have been commercialized (Cotter et al. 2005; Dufour et al. 2007; Rossi et al. 2008). Nisin is used as an active agent in

Introduction

4

Wipe-Out (a teat wipe), and lacticin 3147-containing teat seals (Cross Vetpharm Group Ltd) have been shown to prevent infection by mastitic Staphylococci and Streptococci in animal challenge trials (Ryan et al. 1999). Nisin also has potential for treatment of human mastitis (Fernandez et al. 2008). A dietary supplement BLIS K12 throat guard, which contains Streptococcus salivarius K12 that produces two lantibiotics, salivaricin A2 and B, is sold in New Zealand as a culture for helping to maintain a healthy throat. S. salivarius K12 is also reported as an inhibitor of the bacteria responsible for bad breath (Tagg et al. 2004). Interestingly, nisin effi ciently inhibits sperm motility, showing potential as a contraceptive (Aranha et al. 2004).

An antiviral peptide produced by E. faecium was fi rst reported by Wachsman et al. (1999). The peptide, 3.5 kDa in size, inhibited late stages of the herpes simplex (HSV-1 and HSV-2) multiplication cycle (Wachsman et al. 2003).

Limited data on the development and the mechanisms of bacteriocin resistance is available. Bacteriocin resistance is of concern for food preservation and potential therapeutic treatment by specifi c bacteriocins. Both Gram-positive and Gram-negative bacteria can develop resistance to bacteriocins. The mechanism of bacteriocin resistance is complex and various structural and physiological changes in the bacterial cell envelope can lead to resistance (Ennahar et al. 1999; Cleveland et al. 2001; Peschel and Sahl 2006; Sahl and Bierbaum 2008). Recently, it has been proposed that bacteriocins may have multiple low-affi nity targets. Therefore, it is possible that such low-affi nity interactions of bacteriocins with multiple targets do not promote the development of antimicrobial resistance explaining why bacteria have not developed effective resistance mechanisms towards natural AMPs, including bacteriocins (Peschel and Sahl 2006; Sahl and Bierbaum 2008). In contrast, many therapeutic antibiotics act on a single, high-affi nity target, which makes it comparatively easy for bacteria to develop high-level resistance (Peschel and Sahl 2006; Sahl and Bierbaum 2008).

Introduction

5

2. NISIN

Nisin is the most characterized bacteriocin among the antimicrobial peptides produced by lactic acid bacteria. Nisin is the prototype of the lantibiotic group of antimicrobial peptides and is produced by specifi c strains of Lactococcus lactis subsp. lactis and Streptococcus uberis (Wirawan et al. 2006).Nisin (E243) is approved as a food preservative in over 50 countries, and it is used particularly in processed cheese, dairy products and canned foods (EEC 1983; Delves-Broughton et al. 1996).The inhibitory effects of nisin and nisin-producing L. lactis cells in food matrices are well described and have been shown to inhibit the growth of a wide range of gram-positive bacteria including food spoilage and pathogenic bacteria such as B. cereus, C. perfringens, S. aureus, and L. monocytogenes (McAuliffe et al. 2001).Nisin has been commercially exploited on a large scale (Delves-Broughton et al. 1996; Twomey et al. 2002), due to its low toxicity, stability during processing and storage, effi cacy at low concentration, economic viability, and the absence of deleterious effects on the food (Hurst 1981; O’Keeffe and Hill 2000). Moreover, this safe and natural food additive has been utilized recently in clinical applications as an antimicrobial agent against the causative bacteria of bovine mastitis, and therefore it has been incorporated into commercial products that are used as an alternative treatment to antibiotics (Sears et al. 1992; Wu et al. 2007). Nisin has successfully been used to control respiratory tract infection by S. aureus in animal model (De Kwaadsteniet et al. 2009) as well as in pharmaceutical applications as tooth paste and skin care products (Arauz et al. 2009).

Six natural nisin variants have been identified and characterized to date: nisin A (Kaletta and Entian 1989), nisin Z (Graeffe et al. 1990, Kuipers et al. 1990; Rauch et al. 1990), nisin Q (Zendo et al. 2003), and nisin F (De Kwaadsteniet et al. 2008) are produced by L. lactis species while nisin U and nisin U2 are produced by S. uberis (Wirawan et al. 2006) as illustrated in Figure 1.

Nisin killing activity involves the formation of voltage-dependent pores in the cell membrane (Hechard and Sahl 2002; Wiedemann et al. 2004), the prevention of murein synthesis (Reisinger et al. 1980), and the induction of autolysis of susceptible cells (Bierbaum and Sahl 1985).

Autolysis of cells is a consequence of the release of two cell wall-hydrolyzing enzymes, N-acetylmuramoyl-l-alanine amidase and N-acetylglucosaminidase (Bierbaum and Sahl 1987). Nisin has also been shown to reduce thermal resistance of Bacillus spores (Beard et al. 1999) and to prevent the germination of Bacillus (Nissen et al. 2001) and Clostridium

Figure 1. Variants of the nisin bacteriocin. Black circles indicate amino acid differences compared to nisin A. Post-translational modifi cations are indicated in grey. Adapted from Field et al. 2008.

Introduction

6

(Thomas et al. 2002) spores. Mutational analyses have shown that the rings situated in the N-terminal domain (rings A, B and C) are involved in lipid II binding, whereas mutations in the fl exible middle part (Asn20–Met21–Lys22) of the peptide affect the ability of nisin to form pores in the membrane of the target cell (Breukink et al. 1999; Wiedemann et al. 2001) and the dehydroalanine residue at position 5 effects the inhibition of the outgrowth of bacterial spores (Chan et al. 1996).The effect of nisin on germinating spores may depend not only on the presence of Dha5 but might be also dependent on pore formation in the cell membrane of the germinating spores (Rink et al. 2007).

2.1. Nisin biosynthesis

The structural genes nisA/Z/Q encodes the 57-aa prepeptide containing a 23-aa N-terminal leader peptide (55-aa prepeptide and 24-aa leader in nisin U, and 34-aa prepeptide and 13-aa leader in nisin F ) (Buchman et al.1988; Kaletta and Entian 1989; Dodd et al. 1990; Steen et al. 1991; Graeffe et al. 1991; Mulders et al. 1991; Zendo et al. 2003; Wirawan et al. 2006; de Kwaadsteniet et al. 2008).

Prenisin is subjected to various post-translational modifi cations including dehydration, lanthionine ring formation, secretion, and cleavage of the leader peptide to become biologically active. The production of active nisin in L. lactis requires a total of 14 kb of DNA in a conjugative nisin-sucrose transposon carrying eleven nis genes, nisA/Z/QBTCIPRKFEG (Fig. 2) (McAuliffe et al. 2001; Zendo et al. 2003). The nsu genes in S. uberis nisin U locus are closely similar to the lactococcal nis genes, but they are arranged in different order, nsuPRKFEGABTCI (Wirawan et al. 2006).

Biosynthesis of nisin is encoded by gene clusters containing conserved genes that are involved in production, maturation, immunity, and regulation (Engelke et al. 1994; Kuipers et al. 1995; Qiao 1996; Qiao et al.1996; Siezen et al. 1996; Kleerebezem and Quadri 2001), which are located on a large conjugative nisin-sucrose transposon (~70 kb), Tn5276.

The nisin regulon includes the genes responsible for intracellular post-translational modifi cations, the dehydration reactions and ring formation (NisBC) (Engelke et al. 1992; Kuipers et al. 1993; Koponen et al. 2002), transport across the cytoplasmic membrane (NisT) and cleavage of the leader peptide (NisP) (van der Meer et al. 1993; Qiao and Saris

Figure 2. Scheme of the nisin A/Z/Q regulon adapted from Takala and Saris 2007. Promoters marked in (fi lled triangle) are controlled by a two-component system NisRK. Transcription of nisRK and nisI is mainly from the nisA/Z promoter but in non-nisin production conditions expression is weak and constitutive (open triangles). Hairpins indicate transcription terminator loops or for stabilization of the mRNA end.

Introduction

7

1996), which liberates biologically active nisin. The biosynthesis of nisin is autoregulated by the two-component regulatory system NisRK (Engelke et al. 1994; Kuipers et al. 1995; Qiao et al. 1996; Kleerebezem and Quadri 2001; Kleerebezem 2004). Nisin immunity is encoded by four genes in the nisin operons. Three of the immunity proteins, NisF, NisE, and NisG, form an ABC transport complex (Siegers and Entian 1995; Immonen and Saris 1998). NisF is a cytoplasmic ATP-binding protein. NisE and NisG are hydrophobic integral membrane proteins. The function of NisFEG complex is to export cell-associated nisin to the external environment (Stein et al. 2003). NisI is a lipoprotein attached to the extracellular side of the cell membrane encoded by the nisI gene and protects the cell against nisin (Kuipers et al. 1993; Qiao et al. 1995). However, the actual mechanism of NisI-mediated immunity is not fully clear. NisI could function as an interceptive protein lowering the quantity of nisin molecules on the membrane. It has also been suggested that NisI may prevent nisin from reaching the membrane, hinder nisin insertion into the membrane (Saris et al. 1996), or it may act as a binding protein delivering nisin to NisFEG transporter (Immonen and Saris 1998). Takala et al. (2004) showed a new mechanism of nisin immunity mediated by secretion of lipid-free NisI. In this study the signal sequence of NisI was replaced with a non-lipoprotein signal sequence. Consequently, all NisI produced was secreted into the medium. This NisI secretion resulted in a low level of nisin immunity. External addition of lipid-free NisI to cells did not protect cells from the lethal action of nisin. On the contrary, external addition of lipid-free NisI enhanced the activity of nisin (Koponen et al. 2004). Therefore, protection by lipid-free NisI seemed to require a constant fl ow of NisI for clearing the membrane from nisin. During the transport from the membrane to the growth medium lipid-free NisI could potentially interact with NisFEG as the protection mediated by secretion of lipid-free NisI was much higher in a NisFEG expressing background (Takala et al. 2004).

2.2. Regulation of nisin

Survival of LAB in different niches is in partly due to their ability to sense other members and signals within their environment, which facilitates the coordination of nutrient acquisition, and awareness to the presence of other competitors. Therefore, LAB have evolved different communication methods to sense the environment around them and to initiate an appropriate transcriptional response (O’Flaherty and Klaenhammer 2009). Several lantibiotics are produced in a growth-phase-dependent (or cell-density-dependent) manner and their biosynthesis is under the control of bacterial two-component regulatory system (TCS). Typically, it consists of a histidine protein kinase (HPK), usually a membrane protein capable of sensing a specifi c environmental signal, and a cytoplasmic response regulator (RR), which translates the incoming signal into a cellular adaptive response (Klein et al. 1993; Engelke et al. 1994; Kuipers et al. 1995; Qiao et al. 1996; Ra et al. 1996; Altena et al. 2000; Kleerebezem and Quadri 2001; McAuliffe et al. 2001). Genes encoding both response regulators and sensor histidine kinases have been identifi ed in the gene clusters of nisin (nisR and nisK, Engelke et al. 1994), subtilin (spaR and spaK, Klein et al. 1993), salivaricin (salR and salK, Ross et al. 1993).

As shown in Figure 3, the sensor kinase NisK autophosphorylates a conserved histidine residue in the C-terminal cytoplasmic transmitter domain of the protein in response to the external signal by fully modifi ed nisin. The phosphoryl group is transferred

Introduction

8

to a conserved aspartic acid residue of the corresponding intracellular NisR which is a transcriptional activator (McAuliffe et al. 2001) that activate the induction of the nisA and nisF promoters of nisABTCPIRK and nisFEG inducing transcription of genes that are required for nisin biosynthesis and immunity within the nisin gene cluster via the two-component signal transduction machinery composed of NisK and NisR (Kuipers et al. 1995; Ra et al. 1996; Kleerebezem et al. 1999; Kleerebezem and Quadri 2001).

Figure 3. Scheme of nisin biosynthesis and regulation in Lactococcus lactis (adapted from Chatterjee et al. 2005).

Introduction

2.3. Nisin secretion; transport and proteolytic processing

Deletion or disruption of nisT abolishes the secretion of nisin, and leads to accumulation of nisin in the cytoplasm (Qiao and Saris 1996). Secretion of nisin can be restored by providing the nisT gene on a plasmid (Qiao and Saris 1996). These results strongly suggested that the modifi ed nisin precursor is secreted from the cell by the ABC-type transporter NisT (Qiao and Saris 1996). Finally, the leader sequence is removed by the protease NisP and biologically active nisin is released (van der Meer et al. 1993).

There are two separate ABC transporters associated with nisin production/immunity, one exporting the prenisin and another involved in immunity. The prenisin exporter (NisT) fall into class 1 (Dassa and Bouige (2001), which comprises the majority of known exporters with fused ABC and integral membrane domains (IM). Class 2 ABC transporters are often involved in cellular processes other than transport. Protein transporters associated

9

with nisin immunity are found in class 3. ABC exporters commonly share two main regions of homology, i.e. membrane-spanning domains in the N-terminal half, and an ATP-binding motif in the C-terminal, where ATP hydrolysis is the source of energy for secretion (Fath and Kolter 1993). Siegers et al. (1996) suggested that at least two NisT molecules form a dimer and showed an interaction between the carboxyl terminal domain of NisT and NisC with yeast two-hybrid system.

As shown in Figure 4, post-translational processing of nisin occurs most likely at the cytoplasmic membrane. Ribosomally synthesized nisin is fi rst dehydrated by NisB (step 1 to 2), then cyclized by NisC (step 2 to 3) and transported across the lipid bilayer by NisT (step 3 to 4). Subsequently, the nisin leader sequence is cleaved off by the protease NisP (4).

NisT transporter have shown by Kuipers et al. (2004) to have a broad substrate specifi city, transporting the unmodifi ed prenisin, dehydrated prenisin, and non-lantibiotic peptides, which may enable the synthesis and export of a wide variety of peptides.

The presence of the leader sequence attached to the fully modifi ed nisin keeps the peptide in an inactive state. NisP is a serine protease with an amino terminal secretory signal sequence (N-terminal sec-signal sequence), a potential signal peptidase cleavage site (predicted to be between Gly-22 and Glu-23), a catalytic site, and a C-terminal cell wall anchor, the LPXTG sequence involved in anchoring surface proteins of Gram-positive bacteria (Siezen, 1999). Kuipers et al. (2004) have shown that neither unmodifi ed nor

Figure 4. Post-translational processing of prenisin. A) Processing takes place at the cytoplasmic membrane (adapted from Siegers et al. 1996). B) Post-translational modifi cation steps (adapted from Kuipers et al. 2004).

Introduction

10

dehydrated prenisin can be cleaved by NisP and its activity is not coupled to the transport step by NisT. NisP is assumed to be a protease with rather narrow substrate specifi city (van der Meer et al. 1993; Qiao et al. 1996).

2.4. Detection and quantifi cation of nisin

The maximum levels of nisin as a food additive in foods have been set in various countries (Cleveland et al. 2001). Therefore, several methods for nisin detection and quantifi cation have been developed.

The most commonly used analytical tools for the determination of nisin concentration are biological assays (agar diffusion tests) (Tramer and Fowler 1964; Wolf and Gibbons 1996), but the drawbacks of these methods include lack of specifi city and limited sensitivity.

Immunochemistry-based methods (Suárez et al. 1996; Bouksaim et al. 1998) are gaining attention (Bernbom et al. 2006), although cross-reactivity with lantibiotic subtilin (Falahee and Adams 1992) or other variants of nisin, such as nisin Z (Suárez et al. 1996) can occur with such methods.

Nisin bioassays based on inducible bioluminescence (Wahlström and Saris 1999; Immonen and Karp 2007), or fl uorescence (Reunanen and Saris 2003; Hakovirta et al. 2006) are the most sensitive achieving detection limits in the range of picograms per millilitre.

Presently, the most sensitive nisin detection system is the improved luciferase assay introduced by Immonen and Karp (2007). In this assay, the complete set of luciferase genes from Photorhabdus luminescens, luxABCDE, are under the control of the nisA promoter. The detection limit for nisin quantifi cation was reduced to 0.1 pg nisin ml-1 in pure solution and 3 pg nisin ml-1 in milk.

The sensitivity of the nisin GFPuv bioassay allows extensive dilution of foods, thus minimizing materials which could interfere with the analysis, and has been shown to be compatible with different food matrices (Hakovirta et al. 2006).

Introduction

11

3. FLOW CYTOMETRY (FCM) AND FLUORESENCE-ACTIVATED CELL SORTING (FACS) OF BACTERIAL CELLS

FCM is a standard method for making rapid measurements on each cell within a suspension. As the cells in a fl uid stream fl ow individually through a sensing point, manifold cellular properties can then be measured from fl uorescence and light scatter (Shapiro 1995; Davey and Winson 2003).

In the late 1970’s improvements in optics technology and the development in staining techniques and reporter gene technology have increased the usability of FCM in microbiological research (Steen 2000; Longobardi and Givan 2001; Müller-Taubenberger and Anderson 2007).

FCM-based applications have been utilized for analysis of the bacterial cell cycle, detection of clones and mutants by reporter genes, such as lux and gfp, assessment of antibiotic susceptibility, to the determination of expression of intracellular or cell surface antigens (Link et al. 2007).

A typical fl ow cytometer (Fig. 5A) composes of four major units: a light source, fl uidics system, optics, and signal processing (Longobardi and Givan 2001).Sample suspension is injected into the centre of an enclosed channel through which liquid is fl owing in the center of the sheath fl uid (a cell-free fl uid) surrounding the centre sample stream holding cells aligned in single fi le.

Figure 5. Schematic presentation of fl ow cytometer and fl uorescence-activated cell sorter (FACS). A) Flow cytometery setup. B) A cell passing through the laser beam is monitored for fl uorescence. Droplets containing single cells are given a negative or positive charge, depending on whether the cell is fl uorescent or not. The droplets are then defl ected by an electric fi eld into collection tubes ac-cording to their charge. Adapted from Alberts et al. 2002.

Introduction

12

Particles/cells passing through the laser beam will scatter light, which is detected as forward scatter (FS) and side scatter (SS). Forward scatter refl ects the particle’s size and side scatter is roughly proportional to the granularity of a particle (Davey and Kell 1996).

Forward and side scattered light and fl uorescence from stained cells are split into defi ned wavelengths and channeled by a set of fi lters and mirrors within the fl ow cytometer. The fl uorescent light is fi ltered so each sensor will detect fl uorescence only at a specifi ed wavelength. These sensors are called photomultiplying tubes (PMT’s), and they convert the energy of a photon into an electronic signal (voltage). Each pulse for each cell is known as an event. The measured voltage pulse area will correlate directly to the intensity of fl uorescence for that event. In this manner cell populations can often be distinguished based on differences in their size and density.

In the mid 1960s the demand to analyze a cell of interest led to the inclusion of cell sorting feature in the fl ow cytometers (Fulwyler 1965; Kamentsky and Melamed 1967).

Cell sorting has greatly extended the research and diagnostic potential of the fl ow cytometer and such important extension is particularly relevant to microbiology (Kaprelyants et al. 1996; Wallner et al. 1997; Robinson 2004).

Cell sorting is the process of physically separating particles or cells of interest from the mixed population. Cell sorters have the ability to electronically defl ect cells (sort) with defi ned properties between two high voltage plates, and collected into separate collection tubes as it shown in Figure 5B. When appropriate cell staining and sample preparation methods are used to maintain viability, sorted cells can be grown to give clonal colonies or broth suspensions, which has particular advantages in molecular biology for isolating mutants (Bell et al. 1998).

Introduction

13

4. CHICKEN MICROBIOTA AND THE POTENTIAL OF LAB AND/OR THEIR ANTIMICROBIAL PEPTIDES IN CHICKEN

FARMING

Lactic acid bacteria (LAB) are important components of the healthy intestinal microbiota of chicken. The LAB population levels in the chicken digestive tract are higher than 107 viable cell g-1 (Fuller 1977). The dominance of LAB species can vary depending on anatomical site (Zhu and Joerger 2003). Collado and Yolanda (2007) analyzed GIT of chickens by fl uorescence in situ hybridization combined with fl ow cytometry (FCM-FISH) and showed that LAB were one of the predominant mucosa-associated bacteria in broilers. They account for 20 % of the total crop microbiota, 29 % of the small intestine, and 23 % of the large intestine.

During the fi rst week of life, the genus Lactobacilli and Enterococci are the dominant species in the crop, duodenum, and ileum (Knarreborg et al. 2002; Guan et al. 2003).Whereas Lactobacilli, coliforms, and Enterococci are present in high numbers in the caecum (Mead and Adams 1975; van der Wielen et al. 2000; Snel et al. 2002; Zhu et al. 2002). After the fi rst week, Lactobacilli dominate the crop, duodenum, and ileum, while a group of obligate anaerobes begins to dominate the caecum. After 2 to 3 weeks, a stable intestinal microbiota is established (Snel et al. 2002). Zhu and Joerger (2003) indicated that some 240 species are recognized residents of the GIT of broiler chicken using 16S rRNA-based analysis.

The GIT of chickens may offer a potential source for: (i) isolation of probiotic LAB strains suitable for use as feed supplements for poultry or other animals (ii) and AMPs that reduce the colonization of pathogen-infected chickens which represent a source for human infections. Lactic acid bacteria probiotics and competitive exclusion preparations have been studied for application in poultry production and some are currently in use (Nurmi and Rantala 1973; Morishita et al. 1997; Pascual et al. 1999). Additionally, LAB antimicrobial peptides are believed to be important in the ability of LAB to compete in non-fermentative ecosystems such as the gastro-intestinal tract (Dyke et al. 1995). On the other hand, intestinal pathogens have to overcome a multifaceted defense system consisting of low gastric pH, rapid transit through sections of the intestinal tract, as well as the intestinal microbiota, epithelium, and immune systems.

LAB and/or their AMPs are essential to a functional gastrointestinal tract and immune system in animals. They serve many functional roles for the animal, including the degradation of ingesta, pathogen exclusion, the production of short-chain fatty acids, detoxifi cation of harmful components (Salminen 1990), vitamin supplementation, and immune development (Nurmi and Rantala 1973; Stevens and Hume 1998; Hooper et al. 2003).

4.1 The alternatives to growth-promoting antibiotics (GPA) in poultry production

In the poultry industry, antibiotics are used to prevent poultry pathogens and disease as well as to improve meat and egg production. An improvement in poultry growth due to antibiotic usage was fi rst described in the mid 1940s and since then the addition of GPA became a common practice (Moore et al. 1946). Bedford (2000) pointed out that the growth-promoting effects of antibiotics in animal diets are clearly related to the gut

Introduction

14

microbiota because they exert no benefi ts on the performance of germ-free (GF) animals. The extensive use of antibiotics in animal farms has led to an imbalance of the benefi cial intestinal microbiota and accumulation of antibiotic resistance factors (Bedford 2000).

Furthermore, bacteria resistant to antibiotics may also enter the food chain and transfer the antibiotic resistance factors to the microbiota of humans (Patterson and Burkholder 2003).

The emergence of antibiotic resistant pathogens from animals fed with antibiotics has led the European Union to pass legislation that prohibits the subtherapeutic application of antibiotics in animal agriculture (Casewell et al. 2003). Anticoccidial substances, such as antibiotics ionophores, will be prohibited as feed additives before 2013. After this date, medical substances in animal feeds will be limited to therapeutic use by veterinary prescription.

Moreover, the consumer demand for minimally processed or natural food has led to reduction in antibiotic usage in animal feed. Therefore, an intensive pressure is placed on natural alternatives for enhancing animal productivity and improving product safety.

Cervantes (2005) reviewed the impact of the antibiotic ban in the EU based on the Danish integrated anti-microbial resistance monitoring and research programme (DANMAP, 2004) and how it has resulted in a signifi cant decrease of antibiotic resistance among bacteria isolated from raw meat products. Therefore, the major focus of alternative strategies has been to prevent the proliferation of pathogenic bacteria and the modulation of indigenous bacteria so that the health, immune status and performance of chickens are improved (Ravindran, 2006).

The use of LAB and/or their AMPs has been proposed for poultry to contribute in maintaining the integrity of the animal and the humans consuming the animals. Specifi c probiotic LAB are fed to animals to improve animal performance, and CE product bacteria are fed to eliminate animal pathogen colonization. They seem logical alternatives to growth promoter antibiotics (Patterson and Burkholder 2003).

4.1.1 Competitive enhancement techniques

Strategies have been devised to reduce the populations of food-borne pathogenic bacteria in poultry on the farm level, which rely on the natural competitive nature of bacteria to eliminate pathogens that negatively impact animal production or food safety.

Feed products that are classifi ed as probiotics, prebiotics and competitive exclusion cultures have been utilized as strategies for reducing pathogens in animals. The effi cacy of such products is often due to specifi c microbial ecological factors that alter the competitive pressures experienced by the microbial population in the gut. Competitive enhancement techniques include: (1) introduction of a normal microbial population to the gastrointestinal tract (CE products), (2) addition of a microbial supplement called a probiotic that improves gastrointestinal health (Collins and Gibson 1999), (3) providing a specific nutrient ‘prebiotic’ that allows commensal microbial species to expand its current niche or to occupy a new niche in the gastrointestinal tract and (4) the use of peptide bacteriocins.

4.1.1.1 Competitive exclusion (CE)

The normal intestinal microbiota protects the host against invading pathogens and this phenomenon has been described in the literature as ‘bacterial antagonism’, ‘bacterial

Introduction

15

interference’, ‘competitive exclusion’ (Nurmi and Rantala 1973; Fuller 1973; 1989) or the “Nurmi concept” according to the father of this invention in poultry (Pivnick and Nurmi 1982). Rantala and Nurmi (1973) attempted to control a severe outbreak of S. infantis in Finnish broiler fl ocks. In their studies, it was determined that very low challenge doses of Salmonella (1 to 10 cells into the crop) were suffi cient to initiate salmonellosis in chickens during the fi rst week post-hatch. Use of a Lactobacillus strain did not give protection, and this forced them to evaluate an unmanipulated population of intestinal bacteria from adult chickens that were resistant to the S. infantis. On oral administration of this undefi ned mixed culture, adult-type resistance to Salmonella was achieved. Later, this procedure became known as the Nurmi or competitive exclusion (CE) concept.

CE technology involves the addition of a nonpathogenic bacterial culture of a single or multiple strains in order to reduce colonization populations of pathogenic bacteria in the gastrointestinal tract (Fuller 1989; Nurmi et al. 1992; Nisbet et al. 1993; Steer et al. 2000).

Lactobacillus and Bifi dobacterium species have been used most extensively in humans, whereas species of Bacillus, Enterococcus, and Saccharomyces yeast have been the most common organisms used in livestock (Salminen et al. 1998).

Although competitive exclusion fits the definition of probiotics, the competitive exclusion approach provides the chickens on the day-of-hatch with an adult intestinal microbiota instead of adding one or a few bacterial species to an established microbial population.

In the poultry industry, chickens can be quickly colonized by pathogens after hatching (Cox et al. 1990) due to delayed development of their intestinal fl ora. Therefore, an introduction of a mixed microbial product to the gut of a neonate can aid in the early establishment of a normal microbial population and prevent the establishment of a pathogenic bacterial population (Crittenden 1999; Steer et al. 2000).

Most CE research has focused on poultry (Nava et al. 2005) which can be attributed to the need to control Salmonella colonization and other bacterial diseases in poultry. Commercial CE products comprised of several defi ned species of bacteria are available such as Aviguard (Life-Care Products Ltd, UK), MSC (Stern et al. 1995), Preempt (Corrier et al. 1995) and Broilact® (Orion Corporation, Finland). Broilact® is a selected mixture of 22 strictly anaerobic rods and cocci and 10 different facultatively anaerobic rods and cocci derived from the caecum of a healthy adult hen. Broilact® has been used to protect chickens from intestinal colonization and invasion of the heart, liver and spleen by S. enteritidis and S. typhimurium (Schneitz et al. 1990; Bolder et al. 1992; Cameron and Carter 1992; Nuotio et al. 1992; Methner et al. 1997; Schneitz and Hakkinen 1998). In addition, it decreased Campylobacter jejuni numbers in the cecal contents (Bolder et al. 1995; Hakkinen and Schneitz 1999), and it provided good protection against E. coli and E. coli O157:H7 (Hakkinen and Schneitz 1996).

A Lactobacillus reuteri culture (Talarico et al. 1988) is also marketed for use against enteropathogens, but seems to be rather ineffective (Edens et al. 1994; 1997). In poultry farming, CE treatment is normally given to newly hatched chickens or turkeys soon after hatching, either by spraying (Schneitz et al. 1990) in the hatchery or on the farm or in the fi rst drinking water (Schneitz et al. 1990; Martin et al. 2000). CE cultures are considered a viable technique for poultry due to their short production cycle explaining their wide use (Weinack et al. 1982; Fuller 1989; Nurmi et al. 1992; Stavric 1992; Stavric and D’Aoust, 1993; Bielke et al. 2003).

Introduction

16

The intestinal bacteria including pathogens are believed to grow as fast as the passage rate of their environment, if not the constant fl ow of digesta would ‘wash out’ the pathogen. When a CE preparation or the natural fl ora is established within the gut, bacteria bind to the surface of the intestinal epithelium preventing opportunistic pathogens from attaching (Fuller 1989; Nurmi et al. 1992; Collins and Gibson 1999; Steer et al. 2000). Additionally, some bacteria produce antimicrobial protein compounds, such as traditional antibiotics and bacteriocins or colicins that can inhibit or eliminate species competing within the same niche (Nurmi et al. 1992; Crittenden 1999; Steer et al. 2000, Stahl et al. 2004; Al-Qumber and Tagg 2006). Moreover, a synergistic interaction of two or more of the above mentioned activities may infl uence the effectiveness of a CE preparation.

CE preparations showed limited success in preventing colonization by Campylobacter spp. in chicken ceacum (Stern et al. 1992). Stern et al. (1992; 1994) reported that CE preparations, effective against Salmonella, are not consistently effective against chicken colonization by C. jejuni. It is known that C. jejuni occupies another intestinal niche than Salmonella, primarily moving freely in the mucus layer of the caecal crypts (Beery et al. 1988). This suggests that different composition of the protective bacteria may be needed to improve the result of CE. However, protection against Campylobacter has also been shown by using two of the CE products (Hakkinen and Schneitz 1999; Stern et al. 2001). With pig mucus Collado et al. (2007) showed that the combination of the probiotic cultures L. rhamnosus LGG and B. lactis Bb12 increased the percentages of adhesion of both strains and also inhibited the adhesion of pathogens signifi cantly better than inhibition achieved usingby monocultures. This result urge for more research of which combination of strains would be favorable for development of effective CE preparations.

In Finland, the broiler industry is relatively small and the climate is colder than in many other countries, which may aid in the control of Salmonella and Campylobacter by CE treatment and other means. Potentially, CE cultures are expected to be a green method to reduce Salmonella in eggs and in broilers shipped into the EU.

4.1.1.2 Probiotics

Benefi cial bacteria applied to animal feed stuffs are commonly referred to as probiotics. The term probiotic means “for life” in Greek (Gibson and Fuller 2000), and has been defi ned as “a live microbial feed supplement which benefi cially affects the host animal by improving its intestinal balance” (Fuller 1989). LAB are used as probiotics for human and animals (Donohue and Salminen 1996; Salminen et al. 1998).

A potentially LAB probiotic strain is expected to have several desirable properties to exert within its host. They should be able to overcome the low pH of gastric juice and the bile salts effect and arrive at the site of action in a viable physiological state (Salminen et al. 1989; 1999), and to adhere and colonize the mucosal surfaces to prevent pathogens through competition for binding site and nutrients (Ouwehand 1998; Ouwehand et al. 1999; Naidu et al. 1999).

The list of microorganisms used in animal feed in the European Union (EU) includes mainly strains of Gram-positive bacteria belonging to Bacillus (B. cereus var. toyoi, B. licheniformis, B. subtilis), Enterococcus (E. faecium), Lactobacillus (L. acidophilus, L. casei, L. farciminis, L. plantarum, L. rhamnosus), Pediococcus (P. acidilactici), Streptococcus (S. infantarius), and some yeasts like Saccharomyces cerevisiae and Kluyveromyces (Arturo et al. 2006). There are many reports indicating the effectiveness of

Introduction

17

LAB probiotic products as an alternative to antibiotic use in broiler production. L. salivarius has potential for use as a probiotic for chickens. Garriga et al. (1998) isolated eight different L. salivarius strains with high effi ciency of adherence to the epithelial cells of chickens and they were able to inhibit enteric pathogens Salmonella enteritidis and Escherichia coli. The effi cacy of probiotics may be enhanced through the selection of more effi cient strains, gene manipulation, the combination of several strains, and by combining them with prebiotics (probiotic + prebiotic = symbiotics).

Typically, probiotic preparations for use in animals are comprised of single species or mixtures of lactic acid bacteria (LAB), yeasts, or their end products (Wiemann 2003). Probiotics comprised of Bifi dobacterium lactis and Lactobacillus rhamnosus individually reduced adherence of Salmonella, E. coli and Clostridum spp. to the intestinal mucosa in swine. Together the two organisms were more effective but reduced each other’s adherence (Collado et al. 2007).

In poultry, the development of the immunological function of gut-associated lymphoid tissue (GALT) is critical for survival immediately after hatching. Clancy (2003) proposed the concept of immunobiotics for microorganisms that stimulate activation of mucosal immunity in the GALT (Clancy 2003). Stimulation of immune responses by probiotic cultures has been described in several animal models. The use of probiotic products have been shown to affect immune parameters and increase CD8 production, as well as IgG and IgM concentrations in the serum and gut of swine (Duncker et al. 2006, Walsh et al. 2008).

A recent study by Sato et al. (2009) investigated in vitro-selected immunobiotic lactic acid bacteria effect on the development of GALT immune function in posthatch chicks. Immunobiotic lactic acid bacteria (i.e., L. jensenii TL2937 and L. gasseri TL2919 in particular) are appropriate immunomodulators to stimulate the gut-associated immune system in chicks. These selected immunobiotic LAB might therefore be useful supplements for improving the immune system without decreasing growth performance in neonatal chicks.

4.1.1.3 Prebiotics

Numerous defi nitions of prebiotics with subtle variations have been given in the past decades (Gibson and Roberfroid 1995; Gibson 1998; Patterson and Burkholder 2003; Lan 2004). According to FAO (2007) the defi nition of a prebiotic is”a non-viable food component that confers a health benefi t on the host associated with modulation of the microbiota”. The application of prebiotics in chicken diets does not have as long a history as in human or pet’s food. The prebiotics effects on the activity of the chicken microfl ora are limited and variable based upon the type of prebiotic (Yang et al. 2009).

It has been shown that dietary supplementation of prebiotics has stimulated the unculturable important commensal bacteria in humans (Rastall et al. 2005) and animals (Snel et al. 2002). Most current successes have been derived by non-digestible oligosaccharides, especially those containing fructose, xylose, galactose, glucose and mannose (Gibson and Roberfroid 1995; Gibson 1998). Prebiotics have been studied in humans and animals to improve resistance to pathogens. Buddington et al. (2002) has shown that dietary supplementation of fructooligosaccharides and inulin was protective against enteric pathogens (E. coli O157:H7 and Campylobacter) and tumor inducers in mice.

Introduction

18

The impact of such selective-fermentation prebiotics is that they increase lactic acid producing bacteria and short-chain fatty acid (SCFA) in the caecum leading to decreased GIT pH, which inhibit susceptible Gram-negative organisms. The rise in intestinal lactic acid bacteria stimulated phagocytic activity (cellular immune response) and/or IgA secretion (humoral immune response) and may affect the colonization of pathogens, such as Salmonella and rotavirus (Manning and Gibson 2004). Many studies have reported that combining a number of probiotics (Jin et al. 1998; Line et al. 1998; Fritts et al. 2000) and prebiotics (Chambers et al. 1997; Fukata et al. 1999) may result in reduced colonization and shedding of Salmonella and Campylobacter. Such a combination could improve the survival of the probiotic organism due to the availability of its specifi c substrate for fermentation. Hence, the dietary supplementation of prebiotics is a good approach that may reduce enteric disease or colonization of zoonotic pathogens in poultry and subsequent contamination of poultry products (Patterson and Burkholder 2003).

4.2 Campylobacter and chicken farming

Food-borne illnesses are a major public health concern. C. jejuni and C. coli are food-borne pathogens of humans causing enteritis and neurologic disease. The association of Campylobacter infections with chronic and potentially life-threatening autoimmune conditions such as Guillain-Barre´syndrome (Rees et al. 1993) have served to heighten concern over this organism since its isolation from human stools in the 1970s (Sanders et al. 2002). Campylobacteriosis in humans is characterized by watery or bloody diarrhea, abdominal cramps and nausea (Skirrow and Blaser 2000). Only a few species of Campylobacter result in clinical disease in animals, including C. fetus ssp. fetus and Campylobacter fetus ssp. venerealis, which cause reproductive diseases (Sanders et al. 2002). Other species of Campylobacter, including those causing enteritis in humans, do not result in clinical disease in animals. Frequently, the poultry fl ocks are colonized with C. jejuni without apparent symptoms (Shane 2000) and risk assessment analyses have identifi ed handling and consumption of poultry meat as one of the most important sources of human campylobacteriosis (Potter et al. 2003; Friedman et al. 2004). Several studies have demonstrated that horizontal transmission is the major route of Campylobacter colonization of poultry as the same strain has been shown to colonize multiple fl ocks on a farm (Sahin et al. 2002; Newell and Fearnley 2003). However, some investigations have detected egg-associated bacteria, suggesting that vertical transmission could occur (Neill et al. 1985; Allen and Griffi ths 2001; Cox et al. 2002). Campylobacter´s colonization sites are the caecum, small intestine, large intestine, and cloaca. Although it is generally accepted that campylobacters have evolved to rapidly and effi ciently colonize the avian gut (Beery et al. 1988), poor colonizers have been also identifi ed (Korolik et al. 1988). Mutations in certain genes associated with motility, capsule formation, chemotaxis, and microaerobic respiration, result in a reduced ability to colonize chickens (Jones et al. 2004). Several studies reported that 80% of broiler chickens that are between 5 and 7 weeks old can carry C. jejuni or C. coli in the intestinal tract (Sahin et al. 2002; Newell and Fearnley 2003). Crops of market age broilers often contain Campylobacter (Berrang et al. 2000), and crop contents are a source of carcass contamination with campylobacteria (Byrd et al. 1999; Berrang et al. 2000). Campylobacter are commensal organisms in chickens, and are a common contaminant of raw poultry products (Korolik et al. 1989; Farerell and Harris

Introduction

19

1991; Speed et al. 1999). Raw poultry meat is considered to be an important vector of Campylobacter (Samuel et al. 2004). Campylobacter -infected chickens represent the main source of human campylobacteriosis and 90% of the cases are caused by C. jejuni and only 10% by C. coli.

It is generally accepted that Campylobacter –contaminated broilers is a signifi cant risk factor of human campylobacteriosis and hence the control of C. jejuni in poultry would reduce the risk of human exposure to Campylobacter. Elimination of Campylobacter in the poultry reservoir is a crucial step to control this food safety problem. The greatest impact to control campylobacteria would be a farm-based strategy as it represents an amplifi cation point for campylobacteria throughout the food chain (Newell and Wagenaar 2002; Wagenaar et al. 2008).

Several farm-based interventions have been proposed to control campylobacteria in poultry which can be summarized as three strategies: 1) reduction of environmental exposure (2) an increase in poultry’s host resistance to reduce Campylobacter in the GIT of poultry e. g., competitive exclusion and vaccination, and (3) the use of antimicrobial alternatives to reduce Campylobacter from colonized chickens e. g., bacteriophage therapy and bacteriocin treatment. Currently strategies 1 and 2 are still under development. At present, there is an urgent need for control measures that can be used in the fi eld and that are acceptable to consumers.

4.2.1 Antimicrobial peptides

LAB represent the majority of bacteriocin producing bacteria which are commensals in intestine (Cotter et al. 2005) and subsequently the intestinal bacteriocin–producing bacteria may function as an innate barrier against pathogens in the gut. Isolation of chicken commensal bacteria inhibitory to Campylobacter and characterization of their bacteriocins have been described (Svetoch et al. 2005; Stern et al. 2006; Line et al. 2008; Svetoch et al. 2008). Such potent anti-Campylobacter bacteriocins are SRCAM 602 (Svetoch et al. 2005), OR-7 (Stern et al. 2006), E 50–52 (Line et al. 2008) and E-760 (Svetoch et al. 2008).

Svetoch and colleagues reported the identifi cation and characterization of novel anti-Campylobacter bacteriocin named SRCAM 602 produced by P. polymyxa NRRL B-30509. An evaluation study of the purifi ed bacteriocin was carried out (Stern et al. 2005). Oral administration of the purifi ed bacteriocin SRCAM 602 resulted in elimination of detectable Campylobacter colonization in the caecum.

Bacteriocin OR-7 from L. salivarius NRRL B-30514 is nearly identical to acidocin A produced by Lactobacillus acidophilus (Kanatani et al. 1995). This bacteriocin appears useful in reducing C. jejuni in poultry prior to processing since the OR-7 treatment reduced Campylobacter colonization more than million fold in chicken. Another two novel bacteriocins, E-760 and E 50–52 produced by E. durans and E. faecium, respectively, and isolated from broiler caecum (Line et al. 2008; Svetoch et al. 2008) has shown potential in reducing campylobacteria in chickens. Treatment with purifi ed E-760 and E 50–52 resulted in more than 6.6 log reduction in10-day-old chickens with a dose as low as 31.2 mg/kg feed and > 6.4 log reduction in 15-day-old chickens with a dose as low as 31.2 mg/kg feed. Both bacteriocins displayed strong broad spectrum antibacterial activity against food-borne pathogens Salmonella spp., E. coli O157:H7, Listeria spp., and Shigella spp. as well as showing potent anti-Campylobacter activity.

Introduction

20

Clearly, anti-Campylobacter bacteriocin treatment is an effective strategy to reduce C. jejuni load in chickens.

4.2.2 Phage therapy

Bacteriophages have unique advantages over antibiotics in that they are both self-replicating and self-limiting. The lytic capability and host specificity of phages also present an opportunity for using them to reduce the numbers of campylobacteria from animal sources and subsequently reducing cross contamination during processing.

Campylobacter-specific bacteriophages have been isolated from various sources; pig manure, abattoir, sewage, and broiler chickens (Grawjewski et al. 1985; Atterbury et al. 2003; Goode et al. 2003). However, Hudson et al. (2005) showed that the activity of bacteriophages is maximal at the optimal growth temperature of their host which is 40°C in Campylobacter.

Phages have been used to treat animal diseases such as Salmonella (Sklar et al. 2001) and Escherichia coli (Huff et al. 2003). Group II Campylobacter phage, CP220 (El-Shibiny et al. 2009), with a genome size of 197 kb was administered as a single 7-log PFU dose to both C. jejuni- and C. coli-colonized birds resulting in 2-log CFU/g decline in cecal Campylobacter counts after 48 h. Wagenaar et al. (2005) reported a10-fold reduction in Campylobacter colonization compared with control chickens by using Campylobacter-specifi c lytic phages. After an initial reduction, the camplylobacterial stabilized to levels of the untreated control chickens. Phages are unlikely to be applicable for the reduction of enteric pathogens in the intestine of poultry on rearing farms, since fecal shedding of both pathogen and phages would rapidly lead to resistance.

Phage therapy against campylobacteria in chickens is not yet commercially available. Using a phage to control Campylobacter may not meet with public acceptance unless it is successfully implicated and comprehensively presented (Atterbury et al. 2003). Communication with the public is essential, and public acceptance may be as diffi cult to obtain as with genetically modifi ed organism or their products. Leisner et al. (2005) described the obstacles for the introductionof pasteurization and starter cultures in the late 19th century to indicate that the gap between industry, consumers and pressure groups is not an entirely new issue.

Introduction

21

5. AIMS OF THE STUDY

The consumer demand for fresh, less processed food has increased the demand for natural food preservatives. Reducing the risk of human exposure to food-borne pathogens has a signifi cant impact on food safety and public health. Thus, the goal of this study was to characterize the functions of nisin in different ecosystems knowing that nisin is a natural food preservative and has a capacity to kill food-borne pathogens, and in addition to fi nd new bacteriocins for inhibition of campylobacteria.

The detailed objectives are:

1. To study why the knockout of the NisT mutant caused induction of the nisZ promoter without addition of extracellular nisin.

2. To isolate natural mutants of the GFPuv nisin bioassay strain L. lactis LAC275 using fl uorescence-activated cell sorting FACS.

3. To analyze the composition of the chicken crop microbiota and study the nisin resistance of the dominate crop species.

4. To isolate crop lactobacilli inhibiting Campylobacter jejuni and to characterize the inhibitory substance.

Aims of the study

22

6. MATERIALS AND METHODS

6.1 Strains and plasmids

The bacterial strains used in this study are shown in Table 1, plasmids in Table 2 and primers in Table 3. The methods used in this study are indicated in Table 4, but are described in more detail in the Materials and Methods sections of the Publications I- IV. All strains used are deposited in the Saris laboratory culture collection (Helsinki, Finland) and some strains also in the HAMBI culture collection.

Table 1. Strains used in this study

Strain Relevant properties Used in

Reference/source

Lactococcus lactis ssp. lactis N8L. lactis ssp. lactis NZ9800L. lactis ssp. lactis NZ9000L. lactis LAC46 L. lactis LAC53 L. lactis LAC104 L. lactis LAC67L. lactis LAC85L. lactis LAC109L. lactis LAC108L. lactis MG1614

L. lactisMG1614/pNZ9111L. lactis LAC240L. lactis LAC275 L. lactis LAC344 L. lactis LAC345 Lactobacillus reuteri HAN1-HAN19L. reuteri HAN20-HAN41 L. reuteri HAN42-HAN88L. reuteri HAN89-HAN98Lactobacillus reuteri CHCC1956

L. reuteri ATCC 55730

L. crispatus HAN1-HAN56 Lactobacillus salivarius LAB47 L. salivarius LAB48-LAB86L. salivarius NRRLB-30514 Lactobacillus acidophilus/johnsonii HAN156-HAN170 Lactobacillus sp. oral cloneLactobacillus sp. strain CLE-4L. gallinarum HAN171L. helveticus HAN172L. pentosus HAN173Pediococcus acidilactici HAN174-180Micrococcus luteus A1NCIMB8166

Campylobacter jejuni SAA553-560

Wild-type nisin producerNon- nisin producernisRK genes∆nisT ∆nisB∆nisC∆nisZLAC46/pLEB384LAC53/pLEB384 LAC104/pLEB384Host strain for constructed plasmidsFully modifi ed prenisinIndicator strain of GFP bioassayIndicator strain of GFPuv bioassayNatural mutant of LAC275Natural mutant of LAC275Resistant > 500 IU nisin ml-1

Sensitive ≤ 50 IU nisin ml-1

Sensitive 50-500 IU nisin ml-1

Crop isolatesType strain for FAME analysis

Type strain for FAME analysis

Crop isolatesSalivaricin 47 producerCrop isolatesBacteriocin OR-7 producerCrop isolates

Crop isolateCrop isolateCrop isolateCrop isolateCrop isolateCrop isolates

Nisin- sensitive indicator strain

Indicator strains for detection of antagonistic activity of L. salivarius strains

IIIIIIIIIIIII

III,IIIIIIIIII

IIIIIIIIIIII

III

IIIIII,IVIVIVIII

IIIIIIIIIIIIIIIIII

I

IV

Valio Ltd, Graeffe et al.1991NIZO, Kuipers et al. 1993 NIZO, Kuipers et al. 1998Ra et al. 1996Qiao et al. 1996 Koponen et al. 2002Qiao et al. 1996 This study This study This studyGasson 1984

Kuipers et al. 1995Reunanen and Saris 2003 Hakovirta et al. 2006This study This study This study

This study This study This studyChristian Hansen CultureCollection, DenmarkAmerican Type Culture CollectionThis study This study This study Stern et al. 2006This study

This study This studyThis study This study This study This study

National Collection of Industrial and Marine Bacteria, UK.This study

Materials and methods

23

Table 2. Plasmids used in this study.

Plasmid Antibiotic resistance

Relevant properties Used in

Reference

pLEB384 Ampr, Ermr lactococcal expression plasmid, P45 I Qiao et al. 1996pKTH1984 Camr, Ermr source for nisZ probe I Graeffe et al. 1991pLEB651 Camr lactococcal expression plasmid, PnisA II Hakovirta et al. 2006

Amp = ampicillin, Cam = chloramphenicol, r = resistance

Table 3. Sequences of PCR primers used in this study.

Primer name Sequence 5’→ 3’ Used in Original reference

pA(forward primer) AGAGTTTGATCCTGGCTCAG III Edwards et al.1989pE (reverse primer) CCGTCAATTCCTTTGAGTTT III Edwards et al.1989COLl (C. coli -specifi c primer)

AGGCA AGG GAG CCT l T A ATC IV Vandamme et al.1997

COL2 (C. coli -specifi c primer)

TAT CCC TAT CTA CAA ATT CGC IV Vandamme et al.1997

JUN3 (C. jejuni -specifi c primer)

CA TCT TCC CTA GTC AAG CCT IV Vandamme et al.1997

JUN4 (C. jejuni -specifi c primer)

AAG ATA TGGCTC TAG CAA GAC IV Vandamme et al.199


24

6.2 Methods

A detailed description of the methods is presented in the original publications I-IV. A brief summary and some additional information are presented in the following chapters.

Table 4. Methods used in this study.Methods Used inStrain isolation and/or growthL. lactis strains, M17G, growth medium (Oxoid, Unipath Ltd, England) containing 0.5% (w/v) glucoseLactobacillus strains, Modifi ed Lactobacillus Selective Medium, mLBS (Becton Dickinson Microbiology Systems, Cockeysville, MD, USA) without acetic acid. For bacteriocin production L. salivarius LAB 47 were grown in minimal medium (Stern et al., 2006)Campylobacter jejuni Agar Base CM0689, Preston Campylobacter selective supplement SR0117 and lysed horse blood SR0048 (Oxoid Ltd, Finland)

I, II

III, IV

IV

IV

Induction & Identifi cationBasic DNA techniques: DNA isolation, plasmid isolation, electrophoresis, PCRNorthern hybridizationElectrotransformation (Sambrook et al. 1989): E. coli and L. lactis (Holo and Nes 1989)Agar diffusion test (Tramer and Fowler 1964 ) Partial 16S rRNA gene sequencing Alignment and identifi cation data base NCBI Blast Library (www.ncbi.nlm.nih.gov) Fatty acid analysis and FAME Chromatography, MIDI Inc., Newark, DE, USA. Bioscreen C (Labsystem, Finland)Nisin-induced GFP fl uorescence (Reunanen and Saris 2003) Nisin-induced GFPuv fl uorescence (Hakovirta et al. 2006 )Fluorescence-activated cell sorting(FACS) Multiplex PCR assay (Vandamme et al. 1997) Well-diffusion assay (Schillinger and Luke 1989)Ammonium sulphate precipitationSolid –phase extraction (Phenomenex, Torrance, California, USA)Tricine SDS-PAGE Coomassie brilliant blue staining

I-IVII, IIIIIIIIIIIII IIIII,IIIIIIVIVIV IVIVIV

6.2.1. Northern hybridization analysis

L. lactis strains were grown to the exponential growth phase, collected by centrifugation and broken by sonication. RNA was isolated according to Ra and Saris (1995). Thirty micrograms of RNA and 3 mg RNA ladder (Gibco-BRL) were fractionated on 2% agarose gels containing formaldehyde. After electrophoresis the gel was soaked in water for 20 min and then for 1 h in transfer buffer (8 mM Na2HPO4, 17 mM NaH2PO4). RNA was transferred to Hybond N membrane with a Bio-Rad Trans-Blot cell overnight at 250 mA at 4 °C. After transfer, membranes were rinsed in transfer buffer and then incubated in a vacuum oven at 80 ◦C for 2 h. Membranes were prehybridized for 4 h at 57 ◦C (5x SSC, 5x Denhardt’s solution, 0.5% SDS and 200 mg denatured herring sperm DNA ml-1). After addition of the probe, hybridization was performed in the same buffer overnight at 57 ◦C. Membranes were washed for 10 min with 26 SSC/0.1% SDS at 57 ◦C, for 20 min with 16 SSC/0.1% SDS at 57 ◦C, for 20 min with 0.56 SSC/0.1% SDS at 57 ◦C and for 20 min at


25

65 ◦C, and fi nally with 0.16 SSC/0.1% SDS at 65 ◦C. Membranes were exposed to Kodak X-Omat 100 fi lms at 270 ◦C overnight before developing.

Labeling of 50 ng of probe was performed with the Multiprime labeling system (Amersham) according to the manufacturer’s instructions, in the presence of Amersham’s [32P] dCTP (3000 Ci mmol-1, 111 TBq mmol-1). Free nucleotides were separated from labeled DNA with Sephadex C-50 Nick columns (Pharmacia). The nisZ-specifi c DNA for the probe was madeby digestion of plasmid pLEB1984 (Graeffe et al. 1991) with SspI and SacI, generating a 227 bp fragment (the ends of the fragment are at bp 125–352 in the nisZ sequence at EMBL accession no. Z18947), which was isolated from a 0.8% agarose gel using a Magic PCR prep kit (Promega).

6.2.2. Nisin bioassay

In order to detect the activity of nisin in the cytoplasm of lactococcal cells, L. lactis strains were grown to OD600 0.6. The cells were collected from 10 ml of culture by centrifugation and resuspended in 200 ml distilled water acidifi ed to pH 2.5 with HCl.

PMSF was used to irreversibly inhibit serine proteases NisP and trypsin at a fi nal concentration of 10 mg ml-1 when needed. For isolation of intracellular nisin the cells were frozen by liquid nitrogen and thawed several times prior to sonication. Cytoplasm of LAC85 cells was also isolated without addition of PMSF for comparison. After sonication using a Labsonic U (Labsystems), the particulate fraction was removed by centrifugation at 14 000 g for 10 min and the supernatant was further fi ltered through a membrane with a cut-off of 0.2 mm. Antibacterial activity of nisin was determined as growth inhibition zones on Luria–Bertani soft agar plates inoculated with M. luteus. The indicator strain M. luteus was grown to OD600 0.7 and 10 μl of the culture was added to 3 ml Luria–Bertani soft agar.

Three μl of the samples (both cells and supernatant for each strain) to be tested was applied as a droplet on the agar surface and allowed to dry. Plates were incubated overnight at 37 ◦C. The samples (both cells and supernatant) were heated at 80 ◦C for 10 min and stored frozen prior to the GFP bioassay.

6.2.3. GFP and GFPuv based nisin bioassays

Two highly sensitive nisin bioassays were performed in this study as described by Reunanen and Saris (2003) and Hakovirta et al. (2006). The indicator strain LAC240 was used in the fi rst assay and LAC275 in the latter. When LAC275 was used in the GFP bioassay the freezing step was omitted, chloramphenicol (10 mg ml-1) was added to the growth medium instead of erythromycin, less nisin was used for the standard curve, and the excitation and emission fi lters were different. Cells of the two indicator strains were inoculated 1 : 100 in M17 (Oxoid) containing 0.5% (w/v) glucose, 0.1% (w/v) Tween 80; when needed, 5 mg ml-1 erythromycin or 10 mg ml-1 chloramphenicol was added. The indicator strain inoculum was divided into aliquots of 175 ml on a microplate, then 50 ml aliquots of the samples were applied and the nisin standards (Sigma) were prepared so that the concentration of nisin in the culture medium ranged from 2.5 to 125 ng ml-1 for LAC240 and from 10 to 90 pg ml-1 for LAC275. The bacterial suspensions were divided into 225 ml aliquots on a microtitre plate, and incubated overnight at 30 ◦C. Before the fl uorescence measurements 175 ml of each supernatant was removed. The maturation of newly synthesized GFP


26

molecules is a temperature-dependent process proceeding faster at low temperature (Lim et al. 1995). Thus, the incubated LAC240 cells were frozen for 30 min at 220 ◦C and thawed at room temperature prior to the detection of fl uorescence. Cells of LAC275 did not require freezing for correct folding due to mutations in the gfp gene (Crameri et al. 1996). Green protein fl uorescence was detected in terms of relative fl uorescence units (RFU) with a Fluoroscan Ascent 374 fl uorometer using the Ascent software (version 2.4.2; Labsystems). The excitation and emissions fi lters were 485 and 538 nm for LAC240, and 373 and 583 nm for LAC275. Growth was measured by determining the OD600 with an UltrospecII spectrophotometer (Pharmacia LKB).

6.2.4. Fluorescence-activated cell sorting

FACSVantage fl ow cytometer SE (BD Biosciences) was used to sort cells of the L. lactis LAC275 strain at the Cell Imaging Core Facility Turku in Finland. Prior to sorting, cells of LAC275 were grown for 24 h at 30◦C with 10 pg nisin ml-1 for induction of GFPuv.

After growth cells were diluted 1 : 1000 in PBS (0.15 M NaCl, 0.01 M sodium/potassium phosphate buffer, pH 7.2) and analyzed with FACS using 488 nm argon laser for excitation and fl uorescence was detected through 530/30 nm band-pass fi lter.

Forward and side scatters and fl uorescence data were collected using logarithmic amplifi cation. About 2,000 events/s were analyzed with WinMDI program (version 2.8, Joseph Trotter http//facs.scripps.edu/).

The sorted putative mutant L. lactis LAC275 cells were cultivated on plates overnight. Single colonies were separately tested by GFPuv nisin bioassay (Hakovirta et al. 2006) to analyze any change in nisin induction of the sorted LAC275 isolates. GFPuv fl uorescence was measured as relative fluorescence units (RFU) with the Fluoroscan Ascent 374 fl uorometer with Ascent software, version 2.4.2 (Labsystems).

6.2.5. Chickens and diets

One- and 5-week-old broiler chickens with the same genetic background originating from the same hatchery (Broilertalo, Eura, Finland) were obtained from four Finnish farms (designated farm 1 [F1], in Eurajoki, F2, in Halikko, F3, in Lemu, and F4, in Marttila). The killing and sampling of birds were carried out under the Finnish law and statute on animal experiments and followed the ethical principles of the University of Helsinki.

The chickens were fed with two brands (diet A and diet B) of wheat-based diets from two different commercial feed manufacturers, diet A was obtained from Suomen Rehu Ltd. (Espoo, Finland), and diet B was obtained from Raisio Feed Ltd. (Raisio, Finland), with both feeds providing two different wheat-based diets according to the growth phases of the chickens. Starter diets (including, at day 1, Broilact [Orion Corporation, Turku, Finland]) were fed during the fi rst 2 weeks, followed by feeding with the grower diets. Broilact is a competitive exclusion preparation developed from the cecum content of chickens. Eight different lactobacilli have been isolated from the original inoculum, with one identifi ed as being L. plantarum, one as being L. salivarius, and six as being obligate anaerobes without identifi cation to the species level (Orion Corporation).

The main difference between diet A and diet B was that diet A was supplemented with salinomycin (47 mg kg of feed-1) and diet B was supplemented with naracin (50 mg kg of feed-1) coccidiostat during the whole feeding period. Otherwise, the diets were very similar,


27

as the differences in dry matter (6.7 and 5.6% in diet A versus 6.3 and 5.9% in diet B), total fat (7.5 and 7.1% in diet A versus 6.7 and 6.3% in diet B), crude protein (20% in diet A versus 22 and 20% in diet B), and fi ber (3 and 3.5% in diet A versus 3.6 and 3.7% in diet B) contents were minor.

6.2.6. Isolation and enumeration of crop bacteria

Ten chickens, at 1 and 5 weeks of age, were randomly selected from each fl ock 2 h after feeding and humanely killed by cervical dislocation. Whole crops were removed from the carcasses and transported on ice to the laboratory. The crop (n=10) contents were pooled and homogenized in LBS medium (1:10) in a Stomacher laboratory blender (SewardMedical, London, United Kingdom) for 2 min. The crop homogenate was dilutedin LBS broth and cultivated by spread plating and pour plating onto LBS agar.

The plates were incubated at 41.5°C for 48 h aerobically and anaerobically. For isolation of the crop bacteria located in the vicinity of or associated with the crop epithelium, a 1-cm2

piece from each of the 10 chicken crops (after gravity removal of the digesta and visual inspection to verify a clean mucosa) was cut, placed with the internal sides towards the surface of the LBS agar plates, and incubated overnight at 41.5°C. Before cutting the piece from the crop, the crop was opened with a knife, and the crop digesta was shaken away. The crop digesta dropped easily away from the mucosa, as it was almost solid, revealing the inner epithelium of the crop as being very clean by visual inspection. Bacteria from the obtained lawns of the 10 crop epithelium pieces were resuspended, pooled, and diluted in LBS broth, followed by plating onto LBS agar in order to obtain single colonies. The lactobacilli of the corresponding pooled crop contents were isolated as described above.Colonies were randomly selected and grown to pure cultures before DNA isolation.

6.2.7. Identifi cation of the crop microbiota

Identifi cation of the crop isolates was based on partial 16S rRNA gene sequencing. To obtain a partial rRNA gene sequence, purifi ed chromosomal DNA (van der Meer et al. 1993) from the isolates served as a template in PCR. The amplifi ed area was defi ned by universal primers pA (5’-AGA GTT TGA TCC TGG CTC AG-3’) and pE (5’-CCGTCA ATT CCT TTG AGT TT-3’), which hybridize to the 16S rRNA gene at nucleotides 8 to 28 and 928 to 908 in Escherichia coli (Edwards et al. 1989). The PCR started with heating for 3 min at 94°C, followed by annealing for 1 min at 53°C and extension for 90 s at 72°C and by 30 cycles of PCR (consisting of 45 s at 94°C, 60 s at 53°C, and 90 s at 72°C) and ending the last cycle with storage at 4°C. One strand of the amplifi ed 900-bp fragments was sequenced by the Synthesis and Sequencing Laboratory (Institute of Biotechnology, Helsinki, Finland). Strains with 16S rRNA genes exhibiting a sequence homology of 97% were regarded as belonging to the same species (Drancourt et al. 2000). The sequences obtained were compared against the National Center for Biotechnology Information genome BLAST library (version 2.2.8; http://www.ncbi.nlm.nih.gov/BLAST/).

6.2.8. Fatty acid analysis and FAME chromatography of L. reuteri strains

The diversity of L. reuteri isolates was analyzed by gas chromatographic analysis of the whole-cell fatty acids. The extraction and derivatization method was done as described


28

previously by Miller (1982) and according to the protocol of the Sherlock microbial identi-fi cation system (MIDI Inc.). Briefl y, approximately 40 mg (wet weight) of cells was scraped from the surface of the agar and transferred into a tube with a Tefl on-lined cap. Cells were saponifi ed by heating the cells at 100°C/30 min following the addition of 1 ml of 15% NaOH in 50% aqueous methanol. The hydrolysate was cooled, 2 ml of methanolic HCl was added, and the mixture was heated at 80°C for 10 min. The methylated fatty acids were quickly cooled and extracted through the addition of 1.25 ml of hexane-methyl-tert-butyl ether (1:1, vol/vol) with end-end mixing. The phases were allowed to separate, the lower aqueous layer was removed, and 3 ml of dilute NaOH was added to the remaining organic layer. To further clarify the phase interface, saturated NaCl was added. Approximately two-thirds of the organic layer (containing FAMEs) was transferred to a septum-capped vial for analysis. MIDI gas chromatography runs were calibrated against a standard mixture of known fatty acids provided by MIDI. Detected sample peaks were named by interpolation of the retention time using the equivalent chain length method. Peaks that did not display equivalent chains were unnamed. Two microliters of the fatty acid methyl esters was then analyzed using a 5890 A gas chromatograph fi tted with a 5% phenyl methyl silicone capil-lary column, a fl ame ionization detector, an automatic sampler, and an integrator (Agilent Technologies, Diegem, Belgium) with the Microbial Identifi cation system.

6.2.9. Detection of antagonistic activity of L. salivarius against C. jejuni

L. salivarius cell-free supernatants (CFS) were obtained by centrifuging the cultures at 12 000 x g for 10 min, collecting the supernatants, which were adjusted to pH 6.5 with 1M NaOH, and fi ltered through a 0.22 μm fi lter (Millipore). Inhibitory activity from hydrogen peroxide was avoided by the addition of catalase (5 mg ml-1). A well diffusion assay (Schil-linger and Luke 1989) was performed by using 15 ml Campylobacter selective medium (Oxoid, Finland) overlaid with 1% of an overnight culture of the indicator strain mixed with 5 ml of soft agar. Wells of 5 mm in diameter were cut into these agar plates and 25 μ1 of CFS of the potential producer strain was placed into well. The plates were incubated for 24 to 48 h at 37°C in a microaerophilic atmosphere. Activity was assessed by measuring the diameter of the zone of inhibition formed around the CFSs loaded wells.

6.2.10. Purifi cation of the bacteriocin from the bacterial culture

A cell-free solution (CFS) was obtained by centrifuging the 1 L -culture at 12 000 x g for 10 min. The pH of the CFS was then adjusted to 6.5 with 1N NaOH. The proteins of 500 ml CFS was precipitated with ammonium sulphate (45% saturation) overnight at 4°C with gentle stirring and centrifuged at 10 000 g for 30 min. The precipitate fraction was resus-pended in 0.5 ml sodium phosphate buffer pH 7.2.

6.2.11. Solid phase extraction (SPE)

Twenty μl of phosphoric acid was added to the resuspended fraction from the ammonium precipitation and loaded on strata-X (1 g/1 ml) column (Phenomenex, Torrance, California, USA). Then, the column was washed with 10% acetonitrile in 0.1% trifl uoroacetic acid (TFA). Polypeptides were eluted from the column using acetonitrile/water (80:20 v/v). The eluted fraction (0.4 ml) was assayed for antimicrobial activity.


29

6.2.12. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) In order to determine which polypeptide in the elution fraction had anti-camplylobacterial activity a 15 μl sample was subjected to16.5% Tris-tricine-SDS-PAGE. After electrophoresis at 100 mA for 3 h, the gel was fi xed with a solution containing 15% ethanol and 1% acetic acid. The gel was then washed with distilled water for 4 h. The gel was stained with a solution containing 0.15% Coomassie brilliant blue R-250 (Bio-Rad) in 40% ethanol and 7% acetic acid. Destaining was done with 10% acetic acid 3 times for 15 min. This gel with visible bands was further washed with phosphate-buffered saline (pH 7.2) for 1.5 h and then with deionized water for 3 h for the C. jejuni inhibition assay. To measure bacteriocin activity, the washed gel was placed onto semisolid Brucella agar (0.75% agar) overlaid with soft agar seeded with cells of C. jejuni SAA554, 555, 557 or 559 (Bhunia et al. 1987). Plates were incubated at 42°C for 48 h under a microaerobic atmosphere and inhibitory zones around the polypeptide bands were identifi ed.


30

7. RESULTS AND DISCUSSION

7.1. Nisin induction studies (I, II)

7.1.1 The knockout of the NisT mutant L. lactis caused induction of the PnisZ promoter (I)

The regulation of nisin production by specifi c strains of Lactococcus lactis involves three genetically linked components: a secreted peptide pheromone, a histidine protein kinase (HPK) and a response regulator (RR) (Kleerebezem et al. 1997). The transmembrane HPK NisK senses nisin as signal, and activates the intracellular RR NisR, and subsequently results in activation of the nisin promoters, creating an autoinduction loop (Kuipers et al. 1995; de Ruyter et al. 1996; Qiao et al. 1996).

Previously, Qiao and Saris (1996) reported that a L. lactis mutant with a deletion in the nisT gene did not secrete nisin and nisin could be detected upon lysis of these cells. Furthermore, complementation of this strain with a NisT encoding plasmid was suffi cient to restore the nisin secreting phenotype. However, in that study nisin was detected from cytoplasmic fraction of the NisT mutant strain, but induction of nisin promoters by intracellularly accumulated nisin was not investigated. In this study, we present evidence of a novel, nisin induction of the nisZ promoter, which functions without secretion of nisin. In (I) the plasmid pLEB384, which has the nisin structural gene under the control of the nisin-inducible PnisZ and the constitutive P45 promoters, was transformed into NisT mutant LAC46 in an attempt to achieve greater prenisin production inside the cells (LAC46/pLEB384 = LAC85). Northern analysis of LAC85 with a nisZ probe showed that the PnisZ promoter was activated without addition of extracellular nisin.

Compared to LAC109 (the nisB mutant) and LAC108 (the nisC mutant), which contain unmodifi ed nisin precursor and dehydrated nisin precursor (Koponen et al. 2002), LAC85 cells were the only cells having active nisin in the cytoplasm and the PnisZ promoter activated without external nisin addition. Since nisin can be found inside LAC85 cells (I), it seems unlikely that the induction of the PnisZ promoter observed in these cells could have been due to intracellular production of nisin with the leader still attached, transported by some other transport protein followed by cleavage by NisP. This suggests that nisin can activate the nisin-inducible PnisZ promoter from inside the cells. This promoter is normally activated via the two-component regulatory proteins NisRK, but that requires external nisin (Kuipers et al. 1995). Cell lysing in a culture of LAC85 would release the intracellular nisin and may result in nisin induction of the neighboring cells. A sensitive nisin detection method was needed to detect if lysis of the cells could release enough nisin for the neighboring cells to get induced or if another explanation is needed for the induced state of the LAB85 cells.

7.1.2. Nisin detection in the medium and the cytoplasm of L. lactis cells

To avoid the possibility that nisZ promoter activation was due to cell lysis leading to the release of nisin to the medium, and subsequently induction of intact cells, we determined the nisin content in cultures of the NisT mutant LAC85 using a sensitive nisin bioassay (Hakovirta et al. 2006). Cells of L. lactis LAC275 containing the nisin-inducible GFPuv gene were grown together with the growth supernatant of strain LAC85. The growth supernatant of LAC85 contained less than 10 pg nisin ml-1 (the detection limit of the assay) as the

Results and discussion

31

supernatant was not able to induce any fl uorescence in the cells of LAC275. To ensure that the LAC85 cells do not release nisin to the growth supernatant for other cells to be induced, LAC85 cells were grown together with LAC275 cells. No GFP-related fl uorescence was obtained from the cell mixtures. These results indicated that the induced state of LAC85 cells do not arise from nisin in the media released by lysed LAC85 cells. Clearly, LAC85 cells are not inducing other cells in the surrounding as the co-growth with LAC275 should else have yielded induced LAC275 cells. All these results suggest that LAC85 cells can only induce themselves.

In 1996 when Qiao and Saris fi rst discovered that in a NisT mutant intracellular nisin accumulates in the cytoplasm without the leader (later also shown by van den Bergh et al., 2008) the possibility for leader processing by extracellular NisP after cell breakage was not excluded. Therefore, to verify whether the nisin activity detected from the isolated cytoplasm of LAC85 was formed before or after the breakage of the cells we added the serine protease inhibitor PMSF to the LAC85 cells before breakage of the cells. PMSF should be capable of inhibiting the NisP as it is a serine protease (van der Meer et al. 1993) anchored on the outside of the cells. We showed that PMSF could inhibit the NisP activity of intact LAC85 cells. No nisin activity was detected in LAC85 cells incubated together with PMSF and the fully modifi ed nisin precursor still having the leader attached. To verify that the LAC85 cells contained active nisin and not prenisin with the leader still attached, the cells were broken in the presence of PMSF, to avoid the possibility that breakage of the cells would release nisin precursor with the leader to the NisP protease present on the surface of the cells, resulting in false positive results. Nisin from the cytoplasm of LAC85 isolated in the presence of PMSF was quantifi ed using the nisin-induced green fl uorescence bioassay (Reunanen and Saris 2003). The results showed that the cytoplasm of LAC85 cells in the logarithmic growth phase (OD600 = 0.5) contained nisin at a concentration of 6.2±1.6 ng nisin ml-1. Nisin could also be isolated from the cytoplasm of LAC85 cells that had been grown in the presence of PMSF. This showed that nisin with the leader attached and for some reason crossing the cytoplasmic membrane without NisT and potentially cleaved by NisP resulting in induction is not an explanation for the induced state of the LAC85 cells.

In addition, the nisin activity of the cytoplasm of LAC85 isolated with or without PMSF was analyzed using nisin-sensitive M. luteus as an indicator. If the cytoplasm of LAC85 contained fully modifi ed nisin precursor with the leader still attached, then isolation of the cytoplasm without PMSF would result in cleavage of the leader, resulting in increased inhibition compared to cytoplasm isolated with PMSF included. The nisin activity of the cytoplasm of LAC85 cells +/- PMSF during isolation was in the same range (I, Fig. 2b) showing further that when nisin transport is blocked active nisin is accumulated in the cytoplasm. This has also been verifi ed in another NisT mutant (van Saparoea et al. 2008).

7.1.3. Activation of fully modifi ed nisin precursor in the cytoplasm of L. lactis

The fact that the cytoplasm of LAC85 contains active nisin provides evidence that L. lactis does have intracellular proteolytic activity capable of degrading the leader from the fully modifi ed nisin precursor. We have not identifi ed the protease capable of nisin leader cleavage from the genome of the sequenced L. lactis subsp. lactis IL1403 strain (Bolotin et al. 2001), but the gene content of different strains may differ (Kok et al. 2005). Proteins have a certain half-life in cells and several proteolytic systems for this protein turnover are


32

present in all living cells. The leader has an elongated α-helical structure and could fi t into the proteasome and be degraded, whereas the rest of the molecule has a more rigid and compact structure and may not fi t into the proteasome (Groll and Clausen 2003).

7.1.4. How does intracellular nisin induce the nisin promoters?

One key question is how does the intracellular nisin of LAC85 cells, defi cient in nisin-specifi c secretion capacity, reach the externally located signal recognition domain of the NisK? One possibility was that the LAC85 cells had lysed, and released nisin to the intact cells resulting in induction of PnisZ . This possibility was excluded as nisin could not be detected in the culture supernatant using the sensitive nisin detection and quantifi cation system (Hakovirta et al. 2006), which could detect nisin in concentrations as low as 10 pg nisin ml -1. Moreover, if the LAC85 cells released less than 10 pg nisin ml -1, then this concentration would not have been suffi cient to induce the nisZ promoter as strongly as judged from the Northern blots (I, Fig. 1).

The possibility that nisin could to some extent be translocated to the pseudoperiplasmic space by transporter other than the NisT transporter cannot be excluded. In the pseudoperiplasmic space nisin is either adsorbed to the membrane surface or to the cell

Figure 6. Nisin and signal recognition possibilities by NisK. A) extracellular nisin recognition (Kuipers et al. 1995). B) transport of nisin by ABC transporter NisFEG. C, D, and E are suggested locations for nisin: C) nisin adsorbs to the membrane; D) nisin inserts to membrane and presents the C-terminus of the molecule into the pseudoperiplasmic space for the NisK signal recognition domain ;E) nisin is in the pseudoperiplasmic space.


33

wall or ends up in the growth medium by diffusion or active transport. Stein et al. (2003) showed that the nisin ABC transporter NisFEG acts as a nisin exporter that expels nisin molecules from cells into surface. It seems that nisin in LAC85 is situated such that NisFEG cannot expel nisin to the medium as nisin could not be detected in the culture medium of LAC85 cells. Therefore, we suggest that in LAC85 cells, a fraction of the intracellular nisin is inserted into the membrane and some part of nisin is extruded to the outer side of the membrane and there recognized by NisK.

Peptide pheromones seem to use their amphiphilic C-terminal domain to bind to the histidine protein kinase, possibly at membrane level, in a relative non-specifi c fashion (van Belkum et al. (2007). The weak interaction is greatly improved by the N-terminal domain of the peptide pheromone that is highly specifi c for the cognate receptor. This interaction will enable the peptide pheromone to activate bacteriocin production at less than nanomolar levels. van Belkum et al. (2007) reported that the C-terminal domain of the peptide LV17A and enterocins A and B pheromones interact relatively non-specifi cally with the receptor, and that induction is greatly facilitated by the N-terminal domain that recognizes specifi cally its cognate receptor. The possibility that these peptide pheromones interact with the receptor via the membrane environment is in line with our hypothesis.

Changes throughout the nisin molecule affect the signaling capacity, the A ring being essential (Dodd et al. 1996). It has been suggested that when nisin is inserted in the membrane the C-terminal part of the protein would not be inside the membrane and that the positive charge(s) would interact with the negatively charged phospholipids (van den Hooven et al. 1996). Additionally, charge alterations in the C-terminal part of nisin also resulted in a reduction of induction capacity (van Kraaij et al. 1997). Kuipers et al. (2007) reported that the C-terminal truncation of residues 23 to 34 reduced the induction capacity.

Taking all the available data together, we suggest that it is the C-terminus of nisin that is available for NisK. The part of nisin needed for interaction with NisK may possibly stick out from the membrane into the aqueous pseudoperiplasmic space and be available for signal recognition by NisK (Fig 6). This part of nisin could well be involved in signaling function of nisin explaining why functional nisin inside the cells is capable of inducing the PnisZ promoter in the cells of LAC85. This could represent a general feature of amphiphilic peptides as signaling molecules in TCST pathways. The possibility that nisin interacts with NisK via the membrane environment is in line with the suggestion of van Belkum et al. (2007).

7.1.5. Isolation of natural mutants of the GFPuv nisin bioassay indicator L. lactis LAC275 cells by FACS(II)

In this study we aimed to test the utilization of FACS to isolate natural mutants, with increased sensitivity to nisin induction, of a nisin-sensing L. lactis LAC275 indicator GFPuv bioassay strain. No mutagenesis procedure was included prior sorting to avoid the risk of creating multiple mutations.

Prior to the sorting analysis, we induced the cell with 10 pg nisin ml-1. Approximately 10,000 cells/particles were sorted. The constructed fl uorescence histograms revealed a population of fl uorescing cells showing higher fl uorescence intensities than the majority of the nisin induced L. lactis LAC275 cells. The sorted cells were plated on two M17G plates (1/10 and 1/20 of the sorted cells) and grown over night at 30 C°. The viability of L. lactis LAC275 cells was high as the majority (>90%) of the sorted cells survived the sorting


34

conditions compared to studies of Hakkila (2006) in which only 1–10% of the Escherichia coli cells survived in a similar sorting. Probably, the thick cell wall is giving rigidity to the L. lactis cells and affects viability in the sorting conditions. Sixty-eight pure cultures were isolated for further analysis. Sixty-six of these cultures showed a similar responsiveness to nisin as the parental LAC275 strain. Two mutant L. lactis LAC275 strains, LAC344 and LAC345, showed more sensitive linear responsiveness (0.2–0.7 pg ml-1) to nisin than the parental LAC275, which has a linear responsiveness in the range of 10–70 pg nisin ml-1. The sensitivity of LAC344 and LAC345 strains were in the same range of sensitivity achieved by Immonen and Karp (2007).

In the low nisin concentrations (0.1–0.7 pg ml-1) the parental LAC275 cells were not expected to show any linear responsiveness to nisin (Hakovirta et al. 2006) as was evident as cells of this strain got induced fi rst by nisin in concentrations above 10 pg ml-1.

The obtained LAC344 and LAC345 strains in this study can be used as second generation assay strains of the GFPuv nisin bioassay for even more sensitive detection of nisin. Such strains are needed if the sample amount is scaled down for ‘‘lab-on-a-chip’’ applications.

Such compact miniaturized devices allow samples to be analyzed at the point of need rather than in a centralized laboratory.

While flow cytometry is a well-established tool for the characterization of eukaryotic cells and their interactions, it has apparently still not reached its full potential for microbiological applications (Steen 2000; Longbardi Givan 2001; Link et al. 2007). In our study, FACS was proven to be a useful method for rapid and accurate isolation of natural mutants having a desired phenotype.

7.2. Applied focus: screening of bacteriocinogenic lab strains for future feeding trials in chicken (III, IV)

The genus Lactobacillus is essential for modern food and feed technologies. They are consumed by humans and fed to animals of commercial value as probiotics in efforts to maintain a balanced microbiota and to reduce the numbers of potential pathogens residing in the intestinal tract. Therefore, knowledge of the composition of chickens’ crop microbiota is critical for understanding the contribution of the microbiota members to the well-being of the avian host and for the selection of direct-fed microbials (DFM) commonly referred to as probiotics ( Flint and Garner 2009).

7.2.1. Characterization of the crop microbiota (III)

In this study the crop was chosen as source for future selection of candidate probiotic since it has been suggested that the crop microbiota acts as a bacterial inoculum for the remainder of the gut (Fuller 1977, Lu et al. 2003). In addition, ingested pathogens will fi rst come to the crop after ingestion and thereby crop could be a fi rst line of defense if it harbors anti-pathogenic strains. Therefore, bacteria from crops of 1- and 5-week-old broiler chickens fed with two wheat-based diets (A and B) were grown on Lactobacillus-selective medium and identifi ed (n = 300) based on partial 16S rRNA gene sequence. The most abundant Lactobacillus species were L. reuteri (33%), L. crispatus (18.7%), and L. salivarius (13.3%) (I, Table 1). L. reuteri was the most abundant species (P < 0.005) in the crops of the younger


35

chickens and signifi cantly reduced in the crops of the 5-week-old chickens regardless of the feed (P = 0.016). The diversity of L. reuteri isolates was revealed by fatty acid analysis, whereas 94 L. reuteri isolates arranged into several clusters.

Nisin has potential as a growth-promoting antibiotic (GPA). Therefore, we tested the nisin sensitivity of the strains of the most dominant bacteria, e. g. L. reuteri. If nisin would be used as a GPA it would be preferable if the strains of the most dominant specie would be resistant to nisin. Most of the sensitive isolates were found in younger chickens (77%) compared to the 5-week-old chickens (23%), whereas chickens fed with commercial feed B had a higher proportion of nisin-resistant isolates (73%) than did chickens fed with feed A (45%). The diversity of the L. reuteri population and the frequency of nisin resistant L. reuteri strains in the crops suggest that it could be possible to use nisin as a GPA without wiping out the dominant L. reuteri strains from the crop. Using nisin as a GPA could be combined with several strains representing different clusters and nisin resistance phenotypes in candidate feed supplements for chickens.

7.2.2. Characterization of L. salivarius bacteriocin which exhibit antagonistic activity against Campylobacter jejni (IV)

The majority of LAB of animal microbiota is believed to be benefi cial to the host. This study aimed at screening lactobacilli from chicken microbiota for antimicrobial activity against C. jejuni. Secondly, any strains exhibiting antibacterial activity were to be isolated and characterized for usage evaluation as bacteria potentially promoting chicken health or as potent anti-food-borne pathogens.

From our collection (N = 40) of crop Lactobacillus salivarius many strains produced antibacterial activity against C. jejuni but LAB47 showed the strongest activity and the broadest activity range. Therefore, it was chosen for further studies including partial purification of the inhibitory substance. The bacteriocin was partially purified using ammonium sulphate precipitation and further purified by solid phase extraction. The isolated peptides were run on SDS-PAGE and the obtained polypeptides were overlaid with a bacteriocin sensitive Campylobacter culture identifying one of the polypeptides to have anti-camplylobacter activity. This polypeptide named salivaricin 47 was subjected to molecular mass analysis showing it to have a molecular mass of approximately 3.2 kDa, representing a novel size for bacteriocins of L. salivarius. The anti-Campylobacter activity of salivaricin 47 was not affected by catalase, but was abolished by the proteolytic enzymes, trypsin and Proteinase K. The salivaricin 47 was heat stable (15 min at 90°C) and showed inhibitory activity over a wide pH range (3 to 8).

To our knowledge, only four bacteriocins from L. salivarius isolates have been purifi ed and their primary structure has been characterized (Flynn et al. 2002; Stern et al. 2006; Busarcevic et al. 2008; Pingitore et al. 2009).

Salivaricin 47 characterized in this study is a novel bacteriocin judged from the approximated molecular mass (about 3.2 kDa) and may be used for improving food safety regarding the threat caused by Campylobacter jejuni as well as be used as a protective culture in the crop of chickens potentially lowering the prevalence of Campylobacter in chickens. To date, four bacteriocins have been previously characterized and showed to have potent activity against C. jejuni (Table 5).


36

Table 5. Bacteriocins produced by Lactobacillus salivarius and bacteriocins with anti-C. jejuni activity.

Bacteriocin-producer Name of bacteriocin

Molecular masskDa

Anti-campylobacter activity

References

Lactobacillus salivariusL. salivariusL. salivariusL. salivarius

L. salivariusPaenibacillus polymyxaEnterococcus duransEnterococcus faecium

ABP-118OR-7LS1Salivaricin CRL 1328, Salα and SalβSalivaricin47SRCAM 602E-760E 50–52

4.09 5.13 104.096 and 4.33

3.20 3.865.363.34

ND+NDND

++++

Flynn et al. 2002 Stern et al. 2006Busarcevic et al. 2008Vera Pingitore et al. 2009

This studyStern et al. 2005Line et al. 2008Svetoch et al. 2008

ND= not determined


37

8. CONCLUSIONS

The induction of the PnisZ in LAC85 cells occurred most likely via NisK. The mechanism of how nisin reaches NisK from the cytoplasm is unclear, but it is possible that nisin inserts into the membrane and from there presents segments of the molecule into the pseudoperi-plasmic space for the NisK signal recognition domain. This also suggests that in the wild-type nisin producers, NisK recognizes nisin not from the water-soluble phase but from the membrane. This may represent a general feature of amphiphilic peptides functioning as self-signaling molecules in TCST pathways as has also been suggested by van Belkum et al. (2007).

FACS could easily be used to isolate natural mutants of L. lactis LAC275 without any mu-tagenesis, suggesting that the sensitivity of many other bioassays based on GFPuv induced production, may be easily improved in a similar manner.

The obtained LAC344 and LAC345 strains can be used as second generation assay strains in the GFPuv nisin bioassay for even more sensitive detection of nisin.

In this study, the most abundant Lactobacillus species in the 1- and 5-week-old chicken crops was L. reuteri. The diversity of the L. reuteri population suggests a need of including several strains representing different clusters and nisin resistance phenotypes in candidate probiotic feed supplements for chickens. The change in the nisin resistance of L. reuteri isolates with age suggests that adding nisin to feed as a potential growth promoter may negatively affect the L. reuteri population of young chickens, whereas this may be less in-fl uencial in older chickens. On the other hand, the nisin-resistant L. reuteri strains isolated in this study could be added to nisin-containing feed fed to young chickens, thereby poten-tially maintaining L. reuteri as part of the dominating crop microbiota. The nisin-sensitive L. reuteri isolates could be used as hosts for the transformation of plasmids using food-grade nisin selection in attempts to add extra value or functions to the bacteria in the feed supplement. However, such strains would be defi ned as GMO in EU restricting their use to countries with less strict legislation.

Feed and food safety is an important component of any new animal antimicrobial applica-tions. The food safety problem, Campylobacter –contaminated broilers is a signifi cant risk factor of human campylobacteriosis and hence the control of C. jejuni in poultry would reduce the risk of human exposure to Campylobacter.

The chicken intestinal bacteriocin–producing Lactobacillus salivarius are believed to func-tion as an innate barrier against pathogens in the GIT. Salivaricin 47 is a potent bacteriocin against C. jejuni and has potential use as a protective culture in the crop of chickens which may lower the prevalence of Campylobacter in chickens.

Conclusions

38

9. FUTURE PROSPECTS

In this study the exact location of nisin as inducer molecule was not shown. A future goal is to determine if the activation of NisK by nisin in LAC85 is from nisin inserted in the membrane, nisin on the membrane surface or from soluble nisin in the pseudoperiplasmic space. One way to study this would be to use different mutants expressing nisin instead of the wild-type nisin and measure changes in nisin induction in relation to differences in hydrophilicity of the expressed nisin mutants.

The mutant strains LAC344 and LAC345 (II) are natural mutants affecting some unknown factor leading to improved nisin sensitivity when the strains are used in the nisin GFPuv bioassay. One future prospect is to identify the mutations and analyze the mechanism by which these mutations affect the nisin sensitivity of the bioassay strains. The mutations may be isolated by cloning fragments from LAC85 into LAC275 and screen for effects on nisin induced fl uorescence.

The results in study III open up the possibility for feed studies adding nisin to the feed together with nisin resistant strains. A good CE preparation may require several strains and species. The three most common species in the chicken crop were L. reuteri, L. crispatus and L. salivarius, but nisin resistant strains were only screened among the L. reuteri isolates (III). Therefore, nisin resistant strains need to be identifi ed among the L. crispatus and L. salivarius strains. Then, the feeding study with nisin and nisin resistant strains can begin.

The anti-campylobacter activity of the chicken crop strain L. salivarius 47 urges further characterization. The isolated bacteriocin needs to be purifi ed in higher quantities for detailed characterization including N-terminal amino acid sequencing, mass analysis, specifi c activity and spectrum of activity. A future prospect is also to clone the corresponding gene and eventual specifi c genes involved in biosynthesis of salvaricin 47. All such data would help to evaluate the potential of this bacteriocin in applications aiming at using the producer strain or the bacteriocin to improve food safety.

Future prospects

39

10. ACKNOWLEDGEMENTS

The work described in this thesis was carried out at the Division of Microbiology, Department of Food and Environmental Sciences, University of Helsinki.

I wish to express my deep gratitude to the each of the following:

Centre of Excellence “Microbial Resources Research Unit” of Academy of Finland and the Research Foundation of University of Helsinki for personal grants, Rasio Ltd., and The Finnish Cultural Foundation for funding this thesis.

Professor Per Saris for his thorough supervision, expert guidance, encouraging and inspiring discussions at all stages of my study.

The pre-examiners professors Seppo Salminen and Matti Karp for carefully reviewing this thesis and giving me invaluable suggestions for improving it.

Co-authors Juha Apajalahti, Kaisa Hakkila, Anu Surakka, Kari Kylä-Nikkilä, and Runar Ra for their valuable contribution to the papers.

The present and former heads of our division, professors Per Saris, and Mirja Salkinoja-Salonen, for providing excellent facilities for the research.

Professor Kristiina Lindström for organizing excellent courses.

Dr.Timo Takala for critical reading an earlier draft of the thesis and his invaluable comments. His scientifi c knowledge has great impact on our research group and is highly acknowledged.

The present and former LAB group members: Janetta Hakovirta, Timo Takala, Päivi Ramu, Titta Manninen, Fang Cheng, Justus Reunanen, Sahar Navidghasemizad, Ulla Saarela, Ömer Simsek, Kari Kylä-Nikkilä, Ossian Saris, Yurui Tang, Ruiqing Li, and Adewale Ariwo-Ola, for creating a pleasant working atmosphere and for many relaxing food breaks.

Janetta is warmly thanked for being a true friend over these years, for sharing thoughts and talks that could have been endless, and for the weekly jogging sessions we had together.

My colleagues from the MSS research group, Camelia Constantin, Minna Peltola, Mari Raulio, Douwe Hoornstra, and Jaakko Ekman for their friendly attitudes and generous assistance with all manner of things.

Irina Tsitko for her excellent help with FAME chromatography and for being such a cheerful person.

All former and current colleagues and staff at the Division of Microbiology, especially David ,Taina, Pauliina, Aila, Marja, Beata, Lara, Outi, Pekka, Mannu, Riitta, Mika, Taru,Tarja, and Tuula for creating relaxed working atmosphere.

Leena Steininger, Hannele Tukiainen and Tuula Suortti for all the secretarial help.

Acknowledgements

40

Dr. Ulrike Lyhs for the Campylobacter strains and introduction to the Campylobacter world.

Terttu Terho from Turku Centre for Biotechnology for his brilliance with FACSVantage and cell sorting.

Viikki Science Library for the excellent information service.

I have been blessed with true friends: Mike, Manu, Ramzi, Fatima, Mona and Marah for sharing joys and sorrows.

My heartfelt thanks go to my father and my mother for their everlasting love and support in all aspects of my life. My sister Taim and my brothers Ziyad and Kahled whom I missed so much during all this time and not forgetting their children, relatives, and my extended family.

This dissertation is also dedicated to the memory of my father in law.

The biggest love goes to my husband, Haki, for his love and years of standing by me, and to our son, Alharith and our daughter Dania “DoDo”. Your love, encouragement and patience have been vital to me and helped me fi nish this thesis.

Helsinki, June 2010

Hanan Hilmi

Acknowledgements

41

11. LITERATURE CITED

Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002) Molecular biology of the cell. 4th edition. Garland science. New York.

Al-Qumber, M. , and Tagg J. R. (2006) Commensal bacilli inhibitory to mastitis pathogens isolated from the udder microbiota of healthy cows. J Appl Microbiol 101: 1152–1160.

Allen, K. J. and Griffi ths, M. W. (2001) Use of luminescent Campylobacter jejuni ATCC 33291 to assess eggshell colonization and penetration in fresh and retail eggs. J Food Prot 64: 2058–2062.

Altena, K., Guder, A., Cramer, C., and Bierbaum, G. (2000) Biosynthesis of the lantibiotic mersacidin: organization of a type-B lantibiotic gene cluster. Appl Environ Microbiol 66: 2565–2571.

Arturo, A., Maria Rosa, M.L., and Maria Aranzazu, M. (2006) Probiotics for animal nutrition in the European Union. Regulation and safety assessment. Regul Toxicol Pharm 45: 91-95.

Atterbury, R. J., Connerton, P. L., Dodd, C. E. , Rees, C. E. , and Connerton, I. F.(2003) Isolation and characterization of Campylobacter bacteriophages from retail poultry. Appl Environ Microbiol 69:4511–4518.

Aranha, C., Gupta, S., and Reddy, K.V. R. (2004) Contraceptive effi cacy of antimicrobial peptide nisin: in vitro and in vivo studies. Contraception 69: 333–338.

Arauz L. J., Jozala, A.. F., Mazzola, P. G., and Vessoni Penna, T. C. (2009) Nisin biotechnological production and application: a review. Trends Food Sci Technol 20: 146-154.

Avonts, L., and de Vuyst, L. (2001) Antimicrobial potential of probiotic lactic acid bacteria. Proc 15th Forum for Applied Biotechnology. Gent 24: 543–550.

Avonts, L., van Uytven, E., and de Vuyst, L. (2004) Cell growth and bacteriocin production of probiotic Lactobacillus strains in different media. Int Dairy J 14: 947–955.

Beard, B. M., Sheldon, B. W., and Foegeding, P. M. (1999) Thermal resistance of bacterial spores in milk-based beverages supplemented with nisin. J Food Prot 62: 484–491.

Bedford, M. (2000) Removal of antibiotic growth promoters from poultry diets: implications and strategies to minimise subsequent problems. World’s Poultry Sci J 56: 347-365.

Beery, J. T., Hugdahl, M. B., and Doyle, M. P. (1988) Colonization of gastrointestinal tracts of chicks by Campylobacter jejuni. Appl Environ Microbiol 54:365–2370.

Bell, P. J. L., Deere, D., Shen, J., Chapman, B., Bissinger, P. H., Attfi eld, P.., and Veal, D. A. (1998) A fl ow cytometric method for rapid selection of novel industrial yeast hybrids. Appl Environ Microbiol 64: 1669-1672.

Berrang, M. E., Buhrand, R. J., and Cason, J. A. (2000) Campylobacter recovery from external and internal organs of commercial broiler carca ss prior to scalding. Poult Sci 79: 286-290.

Bhunia, A. K., Johnson, M. C., and Ray, B. (1987) Direct detection of an antimicrobial peptide of Pediococcus acidilactici in sodium dodecyl sulfatepolyacrylamide gel electrophoresis. J Ind Microbiol 2:319–322.

Bielke, L. R., Elwood, A. L., Donoghue, D. J., Donoghue, A. M., Newberry, L. A., Neighbor, N. K., and Hargis, B. M. (2003) Approach for selection of individual enteric bacteria for competitive exclusion in turkey poults. Poult Sci 82: 1378–1382.

Bierbaum, G., and Sahl, H. G. (1985) Induction of autolysis of staphylococci by the basic peptide antibiotics Pep5 and nisin and their infl uence on the activity of autolytic enzymes. Arch Microbiol 141: 249–254.

Literature cited

42

Bierbaum, G., and Sahl, H. G. (1987) Autolytic system of Staphylococcus simulans 22: Infl uence of cationic peptides on activity of N-acetylmuramoyl-L-alanine amidase. J Bacteriol 169: 5452-5458.

Bolder, N. M., and Palmu, L. (1995) Effect of antibiotic treatment on competitive exclusion against Salmonella enteritidis PT4 in broilers.Vet Rec 137: 350–351.

Bolotin, A., Wincker, P., Mauger, S., Jaillon, O., Malarme, K.,Weissenbach, J., Ehrilch, S. D. and Sorokin, A. (2001) The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res 11: 731–753.

Bouksaim, M., Fliss, I., Meghrous, J., Simard, R., and Lacroix, C. (1998) Immunodot detection of nisin in milk and whey using enhanced chemiluminescence. J Appl Bacteriol 84: 176-184.

Bradshaw, J. P. (2003) Cationic antimicrobial peptides: issues for potential clinical use. Bio Drugs 17: 233–240.

Brashears, M. M., Amezquita, A., and Jaroni, D. (2005) Lactic acid bacteria and their uses in animal feeding to improve food safety. Adv Food Nutr Res 50: 1–31.

Breukink, E., Wiedemann, I., van Kraaij, C., Kuipers, O. P., Sahl, H.-G., and de Kruijff, B. (1999) Use of the cell wall precursor lipid II by a pore-forming peptide antibiotic. Science 286: 2361–2364.

Buddington, K. K., Danohoo, J. B, and Buddington, R. K. (2002) Dietary oligofructose and inulin protect mice from enteric and systemic pathogens and tumour inducers. J Nutr 132: 472–477.

Busarcevic, M., Kojic, M., Dalgalarrondo, M., Chobert, J. M., Haertle, T., Topisirovic, L. (2008) Purifi cation of bacteriocin LS1 produced byhuman oral isolate Lactobacillus salivarius BGHO1. Oral Microbiol Immunol 23: 254-258.

Byrd, J. A., Hargis, B. M., Corrier, D. E., Brewer, R. L., Caldwell, D. J., and Stanker, L. H. (1999) Fluorescent marker for the detection of crop and upper gastrointestinal leakage in poultry processing plants. Poult Sci 81: 70–74.

Cameron, D. M., and Carter, J. N. (1992) Evaluation of the effi cacy of BROILACT in preventing infection of broiler chicks with S. enteritidis PT4. Inter J Food Microbiol 15: 319–326.

Carr, F. J., Hill, D., and Maida, N. (2002) The lactic acid bacteria: A literature survey. Crit Rev Microbiol 28: 281-370.

Casewell, M., Friis, C., Marco, E., McMullin, P., and Phillips, I. (2003) The European ban on growth-promoting antibiotics and emerging consequences for human and animal health. J Antimicrob Chemother 52: 159–161.

Calo-Mata , P., Arlindo, S. , Boehme, K., de Miguel, T., Pascoal, A., and Barros-Velazquez, J. (2008) Current applications and future trends of lactic acid bacteria and their bacteriocins for the biopreservation of aquatic food products. Food Bioprocess Technol 1: 43-63.

Cervantes, H. (2005) Assessing the results of the European Union ban of antibiotics feed additives. Pages: 38-45. In: Proceedings, Thirty Second Annual Carolina Poultry Nutrition Conference, North Carolina, October, 26-27.

Chambers, J. R., Spencer, J. L., and Modler, H. W. (1997) The infl uence of complex carbohydrates on Salmonella typhimurium colonization, pH, and density of broiler ceca. Poult Sci 76: 445–451.

Chan, W. C., Dodd, H. M., Horn, N., Maclean, K., Lian, L. Y., Bycroft, B.W., Gasson, M. J., and Roberts, G. C. K. (1996) Structure–activity relationships in the peptide antibiotic nisin: role of dehydroalanine 5. Appl Environ Microbiol 62: 2966–2969.

Chandrapati, S., and O’Sullivan, D. J. (1999) Nisin independent induction of the nisA promoter in Lactococcus lactis during growth in lactose or galactose. FEMS Microbiol Lett 170: 191–198.

Literature cited

43

Chatterjee, C., Paul, M., Xie, L., and van der Donk, W. A. (2005) Biosynthesis and mode of action of lantibiotics. Chem. Rev. 105: 633–684.

Collins, M. D., and Gibson, G. R. (1999) Probiotics, prebiotics, and synbiotics: approaches for modulating the microbial ecology of the gut. Am J Clin Nutr 69:042S–1057S.

Clancy, R. (2003) Immunobiotics and the probiotic evolution. FEMS Immunol Med Microbiol 38: 9-12.

Cleveland, J., Montville, T. J., Nes, I. F., and Chikindas, M. L. (2001) Bacteriocins: safe natural antimicrobials for food preservation. Int J Food Microbiol 71: 1–20.

Collado, M. C., and Sanz, Y. (2007) Characterization of the gastrointestinal mucosa-associated microbiota of pigs and chickens using culture-based and molecular methodologies. J Food Prot 70:2799–2804.

Collado, M. C., Grzeskowiak, C., and Salminen, S. (2007) Probiotic strains and their combination inhibit in vitro adhesion of pathogens to pig intestinal mucosa. Curr Microbiol 55: 260–265.

Collins, D., and Gibson, G. (1999) Probiotics, prebiotics, and synbiotics: approaches for modulating the microbial ecology of the gut. Am J Clin Nutr 69: 1052S–1057S.

Cotter, P. D., Hill, C., and Ross, R. P. (2005) Bacteriocins: developing innate immunity for food. Nat Rev Microbiol 3: 777–788.

Corr, S. C., Li, Y., Riedel, C. T., O’Toole, P.W., Hill, C., and Gahan, C.G.M. (2007) Bacteriocin production as a mechanism for the anti infective activity of Lactobacillus salivarius

UCC118. Proc Natl Acad Sci USA 104: 7617–7621.Corrier, D. E., Nisbet, D. J., Scanlan, C. M., Hollister, A. G., and DeLoach, J. R. (1995) Control of

Salmonella typhimurium colonization in broiler chicks with continuous-fl ow characterized mixed culture of cecal bacteria. Poult Sci 74: 916–924.

Crameri, A., Whitehorn, E. A., Tate, E., and Stremmer, W. P. C. (1996) Improved green fl uorescent protein by molecular evaluation using DNA shuffl ing. Nat Biotechnol 14: 315–319.

Cox, N. A., Bailey, J. S., Mauldin, J. M., and Blankenship, L. C. (1990) Research note: Presence and impact of Salmonella contamination in commercial broiler hatcheries. Poult Sci 69: 1606–1608.

Cox, N. A., Stern, N. J., Wilson, J. L., Musgrove, M. T., Buhr, R. J., and Hiett, K. L. (2002) Isolation of Campylobacter spp. from semen samples of commercial broiler breeder roosters. Avian Dis 46: 717–720.

Crittenden, R.G. (1999) Prebiotics. In: Tannock GW (ed.) Probiotics: A Critical Review. Wymondham, UK: Horizon Scientifi c Press, pp. 141–156.

Daeschel, M. A. (1989) Antimicrobial substances from lactic acid bacteria for use as food preservatives. Food Technol 43: 164–167.

DANMAP. (2004) Use of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from food animals, foods and humans in Denmark. Annual Report.

Dassa, E., and Bouige, P. (2001) The ABC of ABCS: a phylogenetic and functional classifi cation of ABC systems in living organisms. Res Microbiol 152: 211-229.

Davey, H. M., and Kell, D. B. (1996) Flow cytometry and cell sorting of heterogeneous microbial populations: the importance of single-cell analyses. Microbiol Rev 60: 641–696.

Davey, H. M., and Winson, M. K. (2003) Using fl ow cytometry to quantify microbial heterogeneity. Curr Issues Mol Biol 5: 9-15.

Delves-Broughton, J. (1990) Nisin and its use as food preservative. Food Technol 40: 100–117.

Literature cited

44

de Kwaadsteniet ,M., Ten Doeschate, K., and Dicks, L. M. T. (2008) Characterization of the structural gene encoding nisin F, a new lantibiotic produced by a Lactococcus lactis subsp. lactis isolate from freshwater fi sh (Clarius gariepinus). Appl Environ Microbiol 74: 547–549.

d e Kwaadsteniet, M., Ten Doeschate, K., and Dicks, L. M. T. (2009) Nisin F in the treatment of respiratory tract infections caused by Staphylococcus aureus. Lett Appl Microbiol 48: 65-70.

der Meer, J. R., Polman, J., Beerthuyzen, M. M., Siezen, R. J., Kuipers, O. P and de Vos,W. M. (1993) Characterization of the Lactococcus lactis nisin A operon genes nisP, encoding a subtilisin-like serine protease involved in precursor processing, and nisR, encoding a regulatory protein involved in nisin biosynthesis. J Bacteriol 175: 2578–2588.

de Ruyter, P.G.G.A., Kuipers, O. P., Beerthuyzen, M. M., van Alen-Boerrigter, I., and de Vos, W. M. (1996) Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis. J Bacteriol 178: 3434-3439.

de Vuyst, L., Avonts, L., Makras, L.(2004) Probiotics, prebiotics and gut health; in Remacle C, Reusens B (eds) : Functional Foods, Ageing and Degenerative Disease. Cambridge, Woodhead Publishing: 416–482.

de Vuyst, L., and Frederic, L.(2007) Bacteriocins from lactic acid bacteria: production, purifi cation, and food applications. J Mol Microbiol Biotechnol 13: 194–199.

Dodd, H. M., Horn, N., and Gasson, M. J. (1990) Analysis of the genetic determinant for production of the peptide antibiotic nisin. J Gen Microbiol 136: 555–566.

Dodd, H. M., Horn, N., Chan, W. C., Giffard, C. J., Bycroft, B. W., Roberts, G. C. K., and Gasson, M. J. (1996) Molecular analysis of the regulation of nisin immunity. Microbiol 142: 2385–2392.

Donohue, D. C., and Salminen, S. (1996) Safety of probiotic bacteria. Asia Paci J Clin Nutr 5: 25-28.Drancourt, M., Bollet, C., Carlioz, R. , Martelin, R. , Gayral, J. P., and Raoult, D. (2000)16S

ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifi able bacterial isolates. J Clin Microbiol 38:3623–3630.

Drider, D., Fimland, G., Hechard, Y., McMullen, L. M., and Prevost, H. (2006) The continuing story of class IIa bacteriocins. Microbiol Mol Biol Rev 70: 564–582.

Duncker, S. C., Lorentz, A., Schroeder, B., Breves, G., and Bischoff, S.C. (2006) Effect of orally administered probiotic E. coli strain Nissle 1917 on intestinal mucosal immune cells of healthy young pigs. Vet Immunol Immunopathol 111: 239–250.

Drouault, S., Corthier, G., Ehrlich, S. D., and Renault, P. (1999) Survival, physiology, and lysis of Lactococcus lactis in the digestive tract. Appl Environ Microbiol 65: 4881–4886.

Dunne, C., Murphy, L., Flynn, S., O’Mahony, L., O’ Halloran, S., Feeney, M., Morrissey, D., Thornton, G., Fitzgerald, G., Daly, C., Kiely, B., Quigley, E. M. M., O’ Sullivan, G.C., Shanahan, F., and Collins, J.K. (1999) Probiotics: from myth to reality. Demonstration of functionality in animal models of disease and in human clinical trial. Antonie van Leeuwenhoek 76: 279-292.

Dufour, A., Hindre, T., Haras, D., and Le Pennec, J. P. (2007) The biology of lantibiotics from the lacticin 481 group is coming of age. FEMS Microbiol Rev 31: 134–167.

Dykes, G.A. (1995) Bacteriocins: Ecological and evolutionary signifi cance. Trends Ecol Evol 10:186-189.

EEC, 1983. EEC Commission Directive 83/463/EEC.Edens, F. W., Parkhurst, C. R., and Casas, I. A. (1991) Lactobacillus reuteri and whey reduce

Salmonella colonization in the ceca of turkey poults. Poult Sci 70: 158.

Literature cited

45

Edens, F. W., Parkhurst, C. R., and Casas, I. A. (1997) Principles of ex ovo competitive exclusion and in ovo administration of Lactobacillus reuteri. Poult Sci 76: 179–196.

Edwards, U., Rogall, T., Blocker, H., Emde, M., and Böttger, E. C. (1989) Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res 17: 7843–7853.

EFSA, 2005. EFSA scientifi c colloquium summary report. QPS Qualifi ed Presumption of Safety of micro-organisms in food and feed, 13-14 December 2004, Brussels, Belgium. ISBN 92-9199-012-4. <http://www.efsa.eu.int/science/colloquium_series/no2_qps/948_en.html/>.

El-Shibiny, A., Scott, A., Timms, A., Metawea, Y., Connerton, P., and Connerton, I. (2009) Application of group II Campylobacter bacteriophage to reduce strains of Campylobacter jejuni and Campylobacter coli colonizing broiler chickens. J Food Prot 72: 733–740.

Ennahar, S., Sonomoto, K., and Ishizaki, A. (1999) Class IIa bacteriocins from lactic acid bacteria: antibacterial activity and food preservation. J Biosci Bioeng 87: 705–716.

Engelke, G., Gutowski-Eckel, Z., Hammelmann, M., and Entian, K. D. (1992) Biosynthesis of the lantibioticnisin: genomic organization and membrane localization of the NisB protein. Appl Environ Microbiol 58: 3730–3743.

Engelke, G., Gutowski-Eckel, Z., Kiesau, P., Siegers, K., Hammelmann, M., and Entian, K. D. (1994) Regulation of nisin biosynthesis and immunity in Lactococcus lactis 6F3. Appl Environ Microbiol 60: 814-825.

Ercolini, D., Moschetti, G., Blaiotta, G., and Coppola, S. (2001) The potential of a polyphasic PCR-DGGE approach in evaluating microbial diversity of natural whey cultures for water-buffalo mozzarella cheese production: bias of culture-dependent and culture-independent analyses. Syst and Appl Microbiol 24: 610–617.

FAO (Food and Agriculture Organisation) (2007, September 15-16) FAO Technical Meeting on Prebiotics. FAO:Rome.http://www.fao.org/ag/agn/agns/fi les/Prebiotics_Tech_Meeting_Report.pdf

Fath, M. J., and Kolter, R. (1993) ABC transporters: bacterial exporters. Microbiol Rev 57: 995-1017.

Falahee, M. B., and Adams, M. R. (1992) Cross-reactivity of bacteriocins from lactic acid bacteria and lantibiotics in a nisin bioassay and ELISA. Lett Appl Microbiol 15: 214-216.

Farerell, D. J., and Harris, M. T. (1992) A case of intrauterine fetal death associated with maternal Campylobacter coli bacteraemia. Aust N Z J Obstet Gynaecol 32: 172-174.

Fernandez, L., Delgado, S., Herrero, H., Maldonado, A. and Rodrıguez, J. M. (2008) The bacteriocin nisin, an effective agent for the treatment of staphylococcal mastitis during lactation. J Human Lact 24: 311–316.

Field, D., Connor, P. M., Cotter, P. D., Hill, C., and Ross, R. P. (2008) The generation of Nisin variants with enhanced activity against specifi c Gram positive pathogens. Mol Microbiol 69: 218–230.

Flint, J. F., and. Garner, M. R. (2009) Feeding benefi cial bacteria: A natural solution for increasing effi ciency and decreasing pathogens in animal agriculture. J Appl Poult Res 18:367–378.

Flynn, S., van Sinderen, D., Thornton, G. M., Holo, H., Nes, I. F., Collins, J. K. (2002) Characterization of the genetic locus responsible for the production of ABP-118, a novel bacteriocin produced by the probiotic bacterium Lactobacillus salivarius subsp. salivarius UCC118. Microbiol 148: 973–984.

Literature cited

46

Friedman, C. R., Neimann, J., Wegener, H. C., and Tauxe, R.V. (2000) Epidemiology of Campylobacter jejuni infections in the United States and other industrialized nations. In: Campylobacter, 2nd edition. Nachamkin I and Blaser MJ (eds.). Washington, DC:American Society for Microbiology. pp. 121–138.

Fritts, C. A., Kersey, J. H., Motl, M. A., Kroger, E. C., Yan, F., Si, J., Jiang, Q., Campos, M. M., Waldroup, A. L., and Waldroup, P. W. (2000) Bacillus subtilis C-3102 (Calsporin) improves live performance and microbiological status of broiler chickens. J Appl Poult Res 9: 149–155.

Fukata, T., Sasai, K., Miyamoto, T., and Baba, E. (1999) Inhibitory effects of competitive exclusion and fructooligosaccharide, singly and in combination, on Salmonella colonization of chicks. J Food Prot 62: 229–233.

Fuller, R. (1973) Ecological studies on the lactobacillus fl ora associated with the crop epithelium of the fowl. J Appl Bacteriol 36: 131–139.

Fuller, R. (1989) A review: Probiotics in man and animals. J Appl Bacteriol 66: 365–378.Fuller, R. (1977) The importance of lactobacilli in maintaining normal microbial balance in the

crop. Br Poult Sci 18: 85–94.Fulwyler, M. J. (1965) Electronic separation of biological cells by volume. Science 150: 910–911.

Gänzle, M. G. (2009) From gene to function: Metabolic traits of starter cultures for improved quality of cereal foods. Int J Food Microbiol 134: 29-36.

Gao, F. H., Abee, T. and Konings, W. N. (1991) Mechanism of action of the peptide antibiotic nisin in liposomes and cytochrome c oxidase-containing proteoliposomes. Appl Environ Microbiol 57: 2164–2170.

Garriga, M., Pascual, M., Monfort, J. M., and Hugas, M. (1998) Selection of lactobacilli for chicken probiotic adjuncts. J Appl Microbiol 84: 125-132.

Gartia, A. (1925) Sur un remarquable exemple d’antagonisme entre deux souches de colibacille. Comput Rend Soc Biol 93: 1040–1041.

Gasson, M. J. (1984) Transfer of sucrose fermenting ability, nisin resistance and nisin production in Streptococcus lactis 712. FEMS Microbiol Lett 21: 7–10.

Gibson, G. R., and Fuller, R. (2000) Aspects of in vitro and in vivo research approaches directed toward identifying probiotics and probiotics for human use. J Nutr 130:91S-395S.

Gibson, G. R., and Roberfroid, M. B. (1995) Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J Nutr 125: 1401–1412.

Goode, D., Allen, V. M., and Barrow, P. A. (2003) Reduction of experimental Salmonella and Campylobacter contamination of chicken skin by application of lytic bacteriophages. Appl Environ Microbiol 69: 5032–5036.

Grawjewski, B. A., Kusek, J. W., and Gelfand, H. M. (1985) Development of a bacteriophage typing scheme for Campylobacter jejuni and Campylobacter coli. Epidemiol Infect 104: 403–414.

Graeffe, T., Rintala, H., Paulin, L., and Saris, P. (1991) A natural nisin variant. In Nisin and Novel Lantibiotics, G. Jung and H.-G. Sahl, ed. (Leiden: ESCOM Science Publishers B.V.).pp. 260–268.

Groll, M. and Clausen, T. (2003) Molecular shredders: how proteasomes fulfi ll their role. Curr Opin Struct Biol 13: 665–673.

Guan, L. L., Hagen, K. E., Tannock, G. W., Doug, R. D., Korver, R. G., Fasenko, M., and Allison, G. E. (2003) Detection and identifi cation of Lactobacillus species in crops of broilers of different ages by using PCR-denaturing gradient gel electrophoresis and amplified ribosomal DNA restriction analysis. Appl Environ Microbiol 69: 6750–6757.

Literature cited

47

Hakovirta, J., Reunanen, J., and Saris, P. E. J. (2006) Bioassay for nisin in milk, processed cheese, salad dressings, canned tomatoes, and liquid egg products. Appl Environ Microbiol 72: 1001–1005

Hakkila, K. (2006) Metal and the environment: engineering of bacterial, bioreporters for more specifi c metal detection. PhD thesis. University of Turku, Finland.

Hakkinen, M., and Schneitz, C. (1996) Effi cacy of a commercial competitive exclusion product against chicken pathogenic Escherichia coli and E. coli O157:H7. Vet Rec 139: 139–141.

Hakkinen, M., and Schneitz, C. (1999) Effi cacy of a commercial competitive exclusion product against Campylobacter jejuni. Br Poult Sci 40: 619–621.

Hammami, R., Zouhir, A., Ben Hamida, J., and Fliss, I. (2007) BACTIBASE: a web-accessible database for bacteriocin characterization. BMC Microbiol 7: 89.

Hechard, Y., and Sahl, H.-G. (2002) Mode of action of modifi ed and unmodifi ed bacteriocins from Gram-positive bacteria. Biochimie 84: 545–557.

Holo, H., and Nes, I. F. (1989) High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl Environ Microbiol55:3119-3123.

Holzapfel, W. H., Haberer, P., Geisen, R., Björkroth, J., and Schillinger, U. (2001) Taxonomy and important features of probiotic microorganisms in food nutrition. Am J Clin Nutr 73: 365S-373S.

Hooper, L. V., Stappenbeck, T. S., Hong, C. V., and Gordon, J. I. (2003) Angiogenins: A new class of microbiocidal proteins involved in innate immunity. Nat Immunol 4: 269–273.

Hudson, J. A., Billington, C., Carey-Smith, G., Greening, G. (2005) Bacteriophages as biocontrol agents in food. J Food Prot 68: 426–437.

Huff, W. E., Huff, G. R., Rath, N. C., Balog, J. M., and Donoghue, A. M. (2003)Bacteriophage treatment of a severe Escherichia coli respiratory infection in broiler chickens. Avian

Dis 47: 1399–1405.Hurst, A. (1981) Nisin. Adv Appl Microbiol 27: 85-123.Immonen, N., and Karp, M. (2007) Bioluminescence-based bioassays for rapid detection of nisin in

food. Biosens Bioelectron 22: 1982-1987.Immonen, T., and Saris, P. E. J. (1998) Characterization of the nisFEG operon of the nisin Z

producing Lactococcus lactis subsp. lactis N8 strain. DNA Seq. 9: 263–274.Jin, L. A., Ho, Y. W., Abdullah, N., and Jalaludin, S. (1998) Growth performance, intestinal microbial

populations, and serum cholesterol of broilers fed diets containing Lactobacillus cultures. Poult Sci 77: 1259–1263.

Jones, M. A., Marston, K. L., Woodall, C. A., Maskell, D. J., Linton, D., Karlyshev, A. V., Dorrell, N., Wren, B. W., and Barrow, P. A. (2004) Adaptation of Campylobacter jejuni NCTC11168 to high-level colonization of the avian gastrointestinal tract. Infect Immun 72: 3769–3776.

Kaletta, C., and Entian, K.-D. (1989) Nisin, a peptide antibiotic: cloning and sequencing of the nisA gene and posttranslational processing of its peptide product. J Bacteriol 171: 1597–1601.

Kanatani, K., Oshimura, M., and Sano, K. (1995) Isolation and characterization of acidocin A and cloning of the bacteriocin gene from Lactobacillus acidophilus. Appl Environ Microbiol 61: 1061–1067.

Kandler, O., and Weiss, N. (1986) Regular, Nonsporing Gram-Positive Rods, Sneath, P.H.A., Mair, N. S., Sharpe, M. E. and Holt, J. G. Eds., Bergey’s Manual of Systematic Bacteriology Vol.2., Williams and Wilkins, Baltimore, MD: 1208-1234.

Literature cited

48

Kamentsky, L. A., and Melamed, M.R. (1967) Spectrophotometric cell sorter. Science 156: 1364–1365.

Kaprelyants, A. S., Mukamolova, G. V., Davey, H. M., and Kell, D. B. (1996) Quantitative analysis of the physiological heterogeneity within starved cultures of Micrococcus luteus by flow cytometry and cell sorting. Appl Environ Microbiol 62: 1311–1316.

Klijn, N., Weerkamp, A. H., and de Vos., W. M. (1995) Genetic marking of Lactococcus lactis shows its survival in the human gastrointestinal tract. Appl Environ Microbiol 61: 2771–2774.

Klaenhammer, T. R. (1988) Bacteriocins of lactic acid bacteria. Biochimie 70: 337-349.Klaenhammer, T. R. (1993) Genetics of bacteriocins produced by lactic acid bacteria. FEMS

Microbiol Rev 12: 39-85.Klaenhammer, T. R., Altermann, E., Pfeiler, E., Buck, B.L., Goh, Y. J., O’Flaherty, S., Barrangou,

R., and Duong, T. (2008) Functional genomics of probiotic Lactobacilli. J Clin Gastroenterol 42: S160–S162.

Kleerebezem, M. (2004) Quorum sensing control of lantibiotic production; nisin and subtilin autoregulate their own biosynthesis. Peptides 25: 1405–1414.

Kleerebezem, M., Beerthuyzen, M. M., Vaughan, E. E., de Vos, W. M., and Kuipers, O. P. (1997) Controlled gene expression systems for lactic acid bacteria: transferable nisin-inducible expression cassettes for Lactococcus, Leuconostoc, and Lactobacillus spp. Appl Environ Microbiol 63: 4581–4584.

Kleerebezem, M., de Vos, W. M., and Kuipers, O. P. (1999) The lantibiotics nisin and subtilin act as extracellular regulators of their own biosynthesis. In: Dunny GM, Winans SC, editors. Cell–cell signaling in bacteria.Washington, D.C.. ASM Press pp. 159–74.

Kleerebezem, M., and Quadri, L. E. (2001) Peptide pheromone-dependent regulation of antimicrobial peptide production in Gram-positive bacteria: a case of multicellular behavior. Peptides 22: 1579–1596.

Klein, C., Kaletta, C., and Entian, K.D. (1993) Biosynthesis of the lantibiotic subtilin is regulated by a histidine kinase/response regulator system. Appl Environ Microbiol 59: 296–303.

Knarreborg, A., Simon, M. A., Engberg, R. M., Jensen, B. B., and Tannock, G. W. (2002) Effects of dietary fat source and subtherapeutic levels of antibiotic on the bacterial community in the ileum of broiler chickens at various ages. Appl Environ Microbiol 68: 5918–5924.

Kok, J., Buist, G., Zomer, A. L., van Hijum, S. A. F. T., and Kuipers, O. (2005) Comparative and functional genomics of lactococci. FEMS Microbiol Rev 29: 411–433.

Koponen, O., Takala, T. M., Saarela, U., Qiao, M., and Saris, P. E. J. (2004) Distribution of the NisI immunity protein and enhancement of nisin activity by the lipid-free NisI. FEMS Microbiol Lett 231: 85–90.

Koponen, O., Tolonen, M., Qiao, M., Wahlstrom, G., and Saris, P. E. J. (2002) NisB is required for the dehydration and NisC for the lanthionine formation in the post-translational modifi cation on nisin. Microbiol 148: 3561–3568.

Korolik, V., Alderton, M. R., Smith, S. C.,Chang, J., and Coloe, P. J. (1998) Isolation and molecular analysis of colonising and non-colonising strains of Campylobacter jejuni and Campylobacter coli following experimental infection of young chickens. Vet Microbiol 60: 239–249.

Kuipers, O. P., Beerthuyzen, M. M., de Ruyter, P. G. G. A., Luesink, E. J., and de Vos, W. M. (1995) Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem 270: 27299-27304.

Literature cited

49

Kuipers, O. P., Beerthuyzen, M. M., Siezen, R. J., and de Vos, W. M. (1993) Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis; requirement of expression of nisA and nisI genes for development of immunity. Eur J Biochem 216: 281–291.

Kuipers, A., de Boef, E., Rink, R., Fekken, S., Kluskens, L. D., Driessen, A. J. M., Leenhouts, K., Kuipers, O. P., and Moll, G. N. (2004) NisT, the transporter of the lantibiotic nisin, can transport fully modifi ed, dehydrated, and unmodifi ed prenisin and fusions of the leader peptide with nonlantibiotic peptides. J Biol Chem 279: 22176-22182.

Kuipers, O. P., de Ruyter, P. G. G.A., Kleerebezem, M., and de Vos, W. M. (1998) Quorum sensing-controlled gene expression in lactic acid bacteria. J Biotechnol 64: 15–21.

Kuipers, O. P., Yap, W. M. G. J., Rollema, H. S., Beerthuyzen, M. M., Siezen, R. J., and de Vos, W. M. (1991) Expression of a wild-type and mutant nisin genes in Lactococcus lactis. In Nisin and Novel Lantibiotics, G. Jung and H.-G. Sahl, ed. (Leiden: ESCOM Science Publishers B.V.) pp. 250–259.

Lan, Y. (2004) Gastrointestinal health benefi ts of soy water-soluble carbohydrates in young broiler chickens. Ph.D. Thesis, Wageningen University, The Netherlands.

Leisner, J., and Weeds, J. (2005) heat and pure cultures - On the differential success of new technologies in the Danish and American creamery industries in the 1890s. Food Policy 30: 419-433.

Leroy, F., and de Vuyst, L. (2004) Lactic acid bacteria as functional starter cultures for the food fermentation industry. Trends Food Sci Technol 15: 67–78.

Leroy, F., and de Vuyst, L. (2005) Simulation of the effect of sausage ingredients and technology on the functionality of the bacteriocin-producing Lactobacillus sakei CTC 494 strain. Int J Food Microbiol 100: 141–152.

Leroy, F., Lievens, K., de Vuyst, L. (2005) Interactions of meat-associated bacteriocin-producing lactobacilli with Listeria innocua under stringent sausage fermentation conditions. J Food Prot 68: 2078–2084.

Li, H., and O’Sullivan, D. J. (2006) Identifi cation of a nisI promoter within the nisABCTIP operon that may enable establishment of nisin immunity prior to induction of the

operon via signal transduction. J Bacteriol 188: 8496–8503.Lim, C. R., Kimata, Y., Oka, M., Nomaguchi, M. K. and Kohno, K. (1995) Thermosensitivity of

green fl uorescent protein fl uorescence utilized to reveal novel nuclear-like compartments in a mutant nucleoporin NSP1. J Biochem 118: 13–17.

Line, E. J., Bailey, J. S., Cox, N. A., Stern, N. J., and Tompkins, T. (1998) Effect of yeast-supplemented feed on Salmonella and Campylobacter populations in broilers. Poult Sci 77: 405–410.

Line , J. E., Svetoch, E. A., Eruslanov, B.V., Perelygin, V.V., Mitsevich, E.V., Mitsevich, I.P., Levchuk, V. P., Svetoch, O. E., Seal, B. S., Siragusa, G. R., and Stern, N. J. (2008) Isolation and purifi cation of enterocin E-760 with broad antimicrobial activity against gram-positive and gram-negative bacteria. Antimicrob Agents Chemother 52: 1094–1100.

Link , A. J., Jeong, K. J., Georgiou, G. (2007) Beyond toothpicks: New methods for isolating mutant bacteria. Nat Rev 5: 680–686.

Longobardi Givan, A. (2001) Flow cytometry: fi rst principles. 2nd ed. Wiley-Liss, Inc., NewYork, USA.

Literature cited

50

Lu, J., Idris, U., Harmon, B., Hofacre, C., Maurer, J. J., and Lee, M. D. (2003) Diversity and succession of the intestinal bacterial community of the maturing broiler chicken. Appl Environ Microbiol 69: 6816–6824.

Manning, T. and Gibson, G. (2004) Prebiotics. Best Pract Res Clin Gastroenterol 18: 287-298.Martin, C., Dunlap, E., Caldwell, S., Barnhart, E., Keith, N., and Deloach, J. R. (2000) Drinking

water delivery of a defi ned competitive exclusion culture (Preempt) in 1-day-old broiler chicks. J Appl Poult Res 9: 88-91.

McAuliffe, O., Ross, R. P., and Hill, C. (2001) Lantibiotics: structure, biosynthesis and mode of action. FEMS Microbiol Rev 25: 285-308.

Mead, G. C., and Adams, B. W. (1975) Some observations on the caecal microfl ora of the chick during the fi rst two weeks of life. Br Poult Sci16: 169–176.

Methner, U., Barrow, P. A., Martin, G., and Meyer, H. (1997) Comparative-study of the protective effect against Salmonella colonization in newly-hatched Spf chickens using live, attenuated Salmonella vaccine strains, wild-type Salmonella strains or a competitive-exclusion product. Int J Food Microbiol 35: 223–230.

Miller, L. T. (1982) Single derivatization method for routine analysis of bacterial whole-cell fatty acid methyl esters, including hydroxy acids. J. Clin. Microbiol. 16:584–586.

Morishita, T. Y., Aye, P. P., Harr, B. S., Cobb, C. W., and Clifford, J. R.(1997). Evaluation of an avian-specifi c probiotic to reduce the colonization and shedding of Campylobacter jejuni in broilers. Avian Dis 41:850–855.

Moore, P. R., Evenson, A., Luckey, T. D., McCoy, E., Elvehjem, C. A., Hart, E. B. (1946) Use of sulfasuxidine, streptothricin, and streptomycin in nutritional studies with the chick. J Biolog Chem 165: 437-41.

Müller-Taubenberger, A., and Anderson, K. I. (2007) Recent advances using green and red fl uorescent protein variants. Appl Microbiol and Biotechnol 77: 1-12.

Muriana, M. P., and Luchansky, J. B. (1993) Biochemical methods for purifi cation of bacteriocins. In: Hoover D.G. and Steenson L.R. (eds), Bacteriocins of Lactic Acid Bacteria. Academic Press, Inc., London pp 41–61.

Naidu, A. S., Bidlack,W. R., and Clemens, R. A. (1999) Probiotic spectra of lactic acid bacteria (LAB). Crit Rev Food Sci Nutr 38: 13–26.

Nava, G. M., Bielke, L. R., Callaway, T. R., and Castaneda, M. P. (2005) Probiotic alternatives to reduce gastrointestinal infections: the poultry experience. Anim Health Res Rev 6: 105–118.

Neill, S., Campbell, J., and O’Brien J. (1985) Egg penetration by Campylobacter jejuni. Avian Dis 14: 313–320.

Newell, D. G., and Fearnley, C. (2003) Sources of Campylobacter colonization in broiler chickens. Appl Environ Microbiol 69: 4343–4351.

Newell, D. G., and Wagenaar, J. A. (2000) Poultry infections and their control at farm level, pp. 497-510. In I. Nachamkin and M. J. Blaser (ed.), Campylobacter, 2nd ed. ASM Press, Washington, D.C.

Newell , D. G., Koopmans, M., Verhoef, L., Duize, E., Aidara-Kane, A., Sprong, H., Opsteegh, M., Langelaar, M., Threfall, J., Scheutz, F., Giessen, J. V. D., and Kruse, H. (2010) Food-borne diseases — The challenges of 20 years ago still persist while new ones continue to emerge. Int J Food Microbiol.doi:10.1016/j.ijfoodmicro.2010.01.021.

Literature cited

51

Nisbet, D. J., Corrier, D. E., Scanlan, C. M., Hollister, A. G., Beier, R. C., and DeLoach, J. R. (1993) Effect of a defi ned continuous-fl ow derived bacterial culture and dietary lactose on Salmonella typhimurium colonization in broiler chickens. Avian Dis 37: 1017–1025.

Niskanen, T., Johansson, T., Siitonen, A, and Kuusi, M. (2007) Ruokamyrkytykset Suomessa vuonna 2007. Elintarvikeviraston julkaisuja 21/2007.

Nuotio, L., Schneitz, C., Halonen, U., and Nurmi, E. (1992) Use of competitive exclusion to protect newly-hatched chicks against intestinal colonisation and invasion by Salmonella enteritidis PT4. Br Poult Sci 33: 775–779.

Nurmi, E., and Rantala, M. (1973) New aspects of Salmonella infection in broiler production. Nature 241: 210–211.

Ocana, V.S., de Ruiz Holgado, P. A., Nader-Macıas, M. E. (1999) Characterization of a bacteriocin-like substance produced by a vaginal Lactobacillus salivarius strain. Appl Environ Microbiol 65: 5631-5635

O’Flaherty, S., and Klaenhammer, T. R. (200 9) The role and potential of probiotic bacteria in the gut, and the communication between gut microfl ora and gut/host. Int Dairy J 20: 262-268.

O’Keeffe, T., and Hill, C. (2000) Bacteriocins. In Robinson (Ed.), Encyclopaedia of food microbiology. pp. 183–197. London Academic.

O’ Sullivan, L., Ross, R. P., and Hill, C. (2002) Potential of bacteriocin-producing lactic acid bacteria for improvements in food safety and quality. Biochimie 84: 593-604.

Ouwehand, A. C. (1998) Antimicrobial components from lactic acid bacteria. In: Salminen S. von Wright A. (eds) Lactic acid bacteria: microbiology and functional aspects. Marcel Dekker, New York, pp. 139–160.

Ouwehand, A. C., Kirjavainen, P. V., Grönlund, M. M., Isolauri, E., and Salminen, S. J. (1999) Adhesion of probiotic micro-organisms to intestinal mucus. Int J Food Microbiol 64: 119–126.

Ouwehand, A. C., Salminen, S., and Isolauri, E. (2002) Probiotics, an overview of benefi cial effects. Antonie van Leeuwenhoek 82: 279–289.

Pascual, M., Hugas, M. J., Badiola, I., Monfort, J. M., and Garriga, M. (1999) Lactobacillus salivarius CTC2197 prevents Salmonella enteritidis colonization in chickens. Appl Environ Microbiol 65: 4981–4986.

Patterson, J. A., and Burkholder, K. M. (2003) Application of prebiotics and probiotics in poultry production. Poult Sci 82: 627–631.

Peschel A., and Sahl, H. G. (2006) The co-evolution of host cationic antimicrobial peptides and microbial resistance. Nat Rev Microbiol 4: 529–536.

Pivnick, H., and Nurmi, E. (1982) The Nurmi concept and its role in the control of Salmonella in poultry. In R. Davies (Ed.), Developments in food microbiology. 1: 41–70. Barking, Essex, England: Applied Science Publishers Ltd.

Potter, R. C., Kaneene, J. B., and Hall, W. N. (2003) Risk factors for sporadic Campylobacter jejuni infections in rural Michigan: a prospective case-control study. Am J Public Health 93: 2118–2123.

Qiao, M. (1996). Lantibiotic nisin of Lactococcus lactis: biosynthesis, immunity and regulation. PhD thesis. University of Helsinki, Finland.

Qiao, M., Ye, S., Koponen, O., Ra, R., Usabiaga, M., Immonen, T., and Saris, P. E. J. (1996)Regulation of the nisin operons in Lactococcus lactis N8. J Appl Bacteriol 80: 626-634.

Literature cited

52

Qiao, M., Immonen, T., Koponen, O., and Saris, P. E. J. (1995) The cellular location and effect on nisin immunity of the NisI protein from Lactococcus lactis N8. FEMS Microbiol Lett 131: 75-80.

Qiao, M., and Saris, P. E. J. (1996) Evidence for a role of NisT in transport of the lantibiotic nisin produced by Lactococcus lactis N8. FEMS Microbiol Lett 144: 89–93.

Ra, R., Qiao, M., Immonen, T., Pujana, I., and Saris, P. E. J. (1996) Genes responsible for nisin synthesis, regulation and immunity form a regulon of two operons and are induced by nisin in Lactococcus lactis N8. Microbiology 142: 1281-1288.

Rantala, M., and Nurmi, E. (1973) Prevention of the growth of Salmonella infantis in chicks by the fl ora of the alimentary tract of chickens. Br Poult Sci 14: 627–30.

Rastall, R. A., Gibson, G. R., Gill, H.S., Guarner, F., Klaenhammer, T.R., Pot, B., Reid, G., Rowland, I.R., and Sanders, M. E. (2005) Modulation of the microbial ecology of the human colon by probiotics, prebiotics and synbiotics to enhance human health: An overview of enabling science and potential applications. FEMS Microbiol Ecol 52: 145-152.

Ravindran,V. (2006) Broiler nutrition in New Zealand - Challenges and Strategies. Accessed in 2006. www.feedinfo.com.

Rauch, P. J., Beerthuyzen, M. M. and de Vos, W. M. (1990) Nucleotide sequence of IS904 from Lactococcus lactis subsp. lactis strain NIZO R5. Nucleic Acids Res. 18: 4253–4254.

Reunanen, J., and Saris, P. E. J. (2003) Microplate bioassay for nisin in foods, based on nisin induced green fl uorescent protein fl uorescence. Appl Environ Microbiol 69: 4214-4218.

Reid, G., Sanders, M. E., Gaskins, H. R., Gibson, G. R., Mercenier, A., Rastall, R., Roberfroid, M., Rowland, I., Cherbut, C., and Klaenhammer, T. R.(2003) New scientifi c paradigms for probiotics and prebiotics. J Clin Gastroenterol 37: 105-118.

Reisinger, P., Seidel, H., Tschesche, H., and Hammes, W. P. (1980) The effect of nisin on murein synthesis. Arch Microbiol 127: 187–193.

Rink, R., Wierenga, J., Kuipers, A., Kluskens, L. D., Driessen, A. J., Kuipers, O. P., Moll, G.N. (2007) Dissection and modulation of the four distinct activities of nisin by mutagenesis of rings A and B and by C-terminal truncation. Appl Environ Microbiol 73: 5809.

Robinson, J. P. (2004) Flow cytometry. Encyclopedia of Biomaterials and Biomedical Engineering. London: Taylor and Francis. pp 630–40.

Rosenquist, H., Nielsen, N. L., Sommer, H. M., Norrung, B., and Christensen, B.B. (2003) Quantitative risk assessment of human campylobacteriosis associated with thermophilic Campylobacter species in chickens. Int J Food 83: 87–103.

Rossi, L.M., Rangasamy, P., Zhang, J., Qiu, X. Q., and Wu, G. Y. (2008) Research advances in the development of peptide antibiotics. J Pharm Sci 97: 1060–1070.

Ross, K. F., Ronson, C.W., Tagg, J. R. (1993) .Isolation and characterization of the lantibiotic salivaricin A and its structural gene salA from Streptococcus salivarius 20P3. J Biol Chem 268: 16361–16368.

Ross, P. R., Galvin, M., McAuliffe, O., Morgan, S. M., Ryan, M. P., Twomey, D. P., Meaney, W. J., and Hill, C. (1999) Developing applications for lactococcal bacteriocins. Antonie van Leeuwenhoek 76: 337-346.

Rees, J. H., Gregson, N. A., Griffi ths, P. L., and Hughes, R. A. (1993) Campylobacter jejuni and Guillain-Barre syndrome. Q. J Med 86: 623–634.

Ryan, M. P., Flynn, J., Hill, C., Ross, R. P., and Meaney, W. J. (1999) The natural food grade inhibitor, lacticin 3147, reduced the incidence of mastitis after experimental challenge with Streptococcus dysgalactiae in nonlactating dairy cows. J Dairy Sci 82: 2625–2631.

Literature cited

53

Ryan, M. P., Rea, M. C., Hill, C., and Ross, R. P. (1996) An application in cheddar cheese manufacture for a strain of Lactococcus lactis producing a novel broad-spectrum

bacteriocin, lacticin 3147. Appl Environ Microbiol 62: 612–619.Sahin, O., Kobalka, P., and Zhang, Q. (2003) Detection and survival of Campylobacter in chicken

eggs. J Appl Microbiol 95: 1070–1079.Salminen, S. (1990) The role of intestinal microbiota in preserving intestinal integrity and health

with special reference to lactic acid bacteria. Ann Med 22: 35. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd ed.

Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.Samuel, M. C., Vugia, D. J., Shallow, S., et al. (2004) Epidemiology of sporadic Campylobacter

infection in the United States and declining trend in incidence, FoodNet 1996–1999. Clin Infect Dis 38 (Suppl 3):S165–74.

Salminen, S., Bouley, C., Boutron-Ruault, M.C., Cummings, J. H., Frank, A., Gibson, G. R., Isolauri, E., Moreau, M-C., Roberfroid, M., Rowland, I. (1998) Functional food science and gastrointestinal physiology and function. Br J Nutr 80: S147-S171.

Salminen, S., Ouwehand, A. C., Benno, Y., Lee, Y. K. (1999) Probiotics: how should they be defi ned? Trends Food Sci Technol 10: 107–110.

Sanders, J., Isenbarger, D., Walz, S., Pang, L., Scott, D., Tamminga, C., Oyofo, B., Hewitson, W., Sanchez, J., Pitarangsri, C., Echeverria, P., and Tribble, D. (2002) An observational clinical-based study of diarrheal illness in deployed United States military personnel in Thailand: presentation and outcome of Campylobacter infection. Am J Trop Med Hyg 67: 533–538.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA.

Saris, P. E. J., Immonen, T., Reis, M., and Sahl, H.G. (1996) Immunity to lantibiotics. Antonie van Leeuwenhoek 69: 151-159.

Sato, K., Takahashi, K., Tohno, M., Miura, Y., Kamada, T., Ikegami, S., and Kitazawa, H. (2009) Immunomodulation in gut-associated lymphoid tissue of neonatal chicks by immunobiotic diets. Poult Sci 88: 2532-2538.

Schillinger, U., and Luke, F. K. (1989) Antibacterial activity of Lactobacillus sake isolated from meat. Appl Environ Microbiol 55: 1901-1906.

Schneitz, C., and Hakkinen, M. (1998) Comparison of two different types of competitive exclusion products. Lett Appl Microbiol 26: 338–341.

Schneitz, C., Hakkinen, M., Nuotio, L., Nurmi, E., and Mead, G. (1990) Droplet application for protecting chicks against Salmonella colonisation by competitive exclusion. Vet Rec 126: 510.

Sears, P. M., Smith, B. S., Stewart, W. K., Gonzalez, R. N., Rubino, S. D., Gusik, S. A., Rubino, S. D., Gusik, S. A., Kulizek, E. S., Projan, S. J., and Blackburn, P. (1992) Evaluation of a nisin-based germicidal formulation on teat skin of live cows. J Dairy Sci 75: 3185–3190.

Shane, S. M. (2000) Campylobacter infection of commercial poultry. Rev Sci Tech 19: 376–395.Schillinger, U., Geisen, R., and Holzapfel, W. H. (1996) Potential of antagonistic microorganisms

and bacteriocins for the biological preservation of foods. Trends Food Sci Technol 7: 158–164.Shapiro, H. M. (1995) Practical fl ow cytometry, 3rd ed. Alan R. Liss, Inc. New York, N.Y.Siezen, R. J. (1999) Multi-domain, cell-envelope proteinases of lactic acid bacteria. Antonie van

Leeuwenhoek 76: 139-155.

Literature cited

54

Siezen, R. J., Kuipers, O. P., and de Vos, W. M. (1996) Comparison of lantibiotic gene clusters and encoded proteins. Antonie van Leeuwenhoek 69: 171–184.

Siegers, K., and Entian, K.D. (1995) Genes involved in immunity to the lantibiotic nisin produced by Lactococcus lactis 6F3. Appl Environ Microbiol 61: 1082–1089.

Siegers, K., Heinzmann, S., and Entian, K.D. (1996) Biosynthesis of lantibiotic nisin. J Biol Chem 271: 12294–12301.

Skirrow, M. B., and Blaser, M. J. (2000) Clinical aspects of Campylobacter infection. In Campylobacter (I. Nachamkin & M. J. Blaser, eds), 2nd Ed. ASM Press, Washington, DC, 69-88.

Sklar, I. B., and Joerger, R. D. (2001) Attempts to utilize bacteriophage to combat Salmonella enterica serovar Enteritidis infection in chickens. J Food Saf 21: 15–30.

Snel, J., Harmssen, H. J. M., van der Wielen, P. W. J. J., and Williams, B. A. (2002) Dietary strategies to influence the gastrointestinal microflora of young animals, and its potential to improve intestinal health. In: BLOK, M. C. (Ed.) Nutrition and health on the gastrointestinal tract, pp. 37-69 (Wageningen Academic Publishers, Wageningen, Netherlands).

Speed, B. R., Kaldor, J., Watson, J., Newton-John, H., Tee, W., Noon, D., and Dwyer, B. W. (1987) Campylobacter jejuni/Campylobacter coli-associated Guillain-Barre syndrome. Immunoblot confi rmation of the serological response. Med J Aust 147: 13-16.

Stahl, C. H., Callaway, T. R., Lincoln, L. M., Lonergan, S. M., and Genovese, K. J. (2004) Inhibitory activities of colicins against Escherichia coli strains responsible for postweaning diarrhea and edema disease in swine. Antimicrob Agents Chemother 48: 3119–3121.

Stavric, S. (1992) Defi ned cultures and prospects. Int J Food Microbiol 55: 245–263.Stavric, S., and D’Aoust, J-Y. (1993) Undefi ned and defi ned bacterial preparations for competitive

exclusion of Salmonella in poultry. J Food Prot 56: 173–180.Stavric, S., and Kornegay, E. T. (1995) Microbial probiotics for pigs and poultry. In: Wallace R. J.

and Chesson, A. (eds) Biotechnology in Animal Feeds and Animal Feeding. New York: VCH, pp. 205–230.

Steen, H. B. (2000) Flow cytometry of bacteria: glimpses from the past with a view to the future. J Microbiol Methods 42: 65–74.

Steer, T., Carpenter, H., Tuohy, K., and Gibson, G. R. (2000) Perspectives on the role of the human gut microbiota and its modulation by pro and prebiotics. Nutr Res Rev 13: 229–254.

Stiles, M. E., and Hastings, J. W. (1991) Bacteriocin production by lactic acid bacteria: potential for use in meat preservation. Trends in Food Sci and Technol 2: 247–251.

Stein, T., Heinzmann, S., Solovieva, I., and Entian, K. D. (2003) Function of Lactococcus lactis nisin immunity genes nisI and nisFEG after coordinated expression in the surrogate host Bacillus subtilis. J Biol Chem 278: 89–94.

Stern, N. J. (1992) Reservoirs for Campylobacter jejuni and approaches for intervention in poultry. Pp. 49–60. In I. Nachamkin, M. J. Blaser, and L. S.Tompkins (ed.), Campylobacter jejuni: current status and future trends. American Society for Microbiology, Washington, D.C.

Stern, N. J. (1994) Mucosal competitive exclusion to diminish colonization of chickens by Campylobacter jejuni. Poult Sci 73: 402–407.

Stern, N. J., Bailey, J. S., Cox, N. A., and Blankenship, L. C. (1995) Mucosal competitive exclusion fl ora. United States Patent 5,451,400.

Stevens, C. E., and Hume, I. D. (1998) Contributions of microbes in vertebrate gastrointestinal tract to production and conservation of nutrients. Physiol Rev 78: 393–427.

Literature cited

55

Stern, N. J., Svetoch, E. A., Eruslanov, B. V., Perelygin, V. V., Mitsevich, E. V., Mitsevich, I. P., Pokhilenko, V. D., Levchuk, V. P., Svetoch, O. E., and Seal, B. S. (2006) Isolation of a Lactobacillus salivarius strain and purification of its bacteriocin, which is inhibitory to Campylobacter jejuni in the chicken gastrointestinal system. Antimicrob Agents Chemother 50: 3111–3116.

Svetoch, E. A., Eruslanov, B. V., Perelygin, V. V., Mitsevich, E. V., Mitsevich, I. P., Borzenkov,V. N., Levchuk, V. P., Svetoch, O. E., Kovalev,Y. N., Stepanshin, Y.G., Siragusa, G. R., Seal, B. S., and Stern, N. J. (2008) Diverse Antimicrobial Killing by Enterococcus faecium E 50-52 Bacteriocin. J Agric Food Chem 56: 1942–1948.

Suárez, A. M., Rodríguez, J. M., Morales, P., Hernándes, P. E., and Azcona-Olivera, J. I. (1996) Development of monoclonal antibodies to the lantibiotic nisin A. J Agric Food Chem 44: 2936-2940.

Tagg, J. R. (2004) Prevention of streptococcal pharyngitis by anti-Streptococcus pyogenes bacteriocin-like inhibitory substances (BLIS) produced by Streptococcus salivarius.

Indian J Med Res 119: 13–16. Takala, T. M., Koponen, O., Qiao, M., and Saris, P. E. J. (2004) Lipid free NisI: interaction with nisin

and contribution to nisin immunity via secretion. FEMS Microbiol Lett 237: 171–177.Takala, T. M., and Saris, P. E. J. (2007) Nisin: past, present, and future. In: Riley, M. A., Gillor O.

(eds) Research and applications in bacteriocins. Cromwell Press, Trowbridge, Wiltshire, UK, pp 181–213.

Talarico, T. L., Casas, I. A., Chung, T. C., and Dobrogosz, W. J. (1988) Production and isolation of reuterin, a growth inhibitor produced by Lactobacillus reuteri. Antimicrob Agents Chemother 32: 1854–1858.

Thomas, L.V., Ingram, R. E., Bevis, H. E., Davies, E. A., Milne, C. F., and Delves-Broughton, J. (2002) Effective use of nisin to control Bacillus and Clostridium spoilage of a pasteurized mashed potato product. J Food Prot 65: 1580–1585.

Tramer, J., and Fowler, J. J. (1964) Estimation of nisin in foods. J Sci Food Agric 15: 522-528.Twomey, D., Ross, R. P., Ryan, M., Meaney, B., and Hill, C. (2002) Lantibiotics produced by lactic

acid bacteria: structure, function, and applications. Antonie van Leeuwenhoek 82: 165-185.van den Berg, B, van Saparoea, H., Bakkes, P. J., Moll, G. N., and Driessen, A. J. M. (2008)Distinct contributions of the nisin biosynthesis enzymes NisB and NisC and transporter NisT to

prenisin production by Lactococcus lactis. Appl Environ Microbiol74: 5541–5548.van Belkum, M. J., Derksen, D. J., Franz, C. M., and Vederas, J. C. (2007) Structure–function

relationship of inducer peptide pheromones involved in bacteriocin production in Carnobacterium maltaromaticum and Enterococcus faecium. Microbiol 153: 3660 – 3666.

van den Hooven, H. W., Doeland, C. C. M., Vandekamp, M., Konings, R. N. H., Hilbers, C. W., and van de Ven, F. J. M. (1996) Three-dimensional structure of the lantibiotic nisin in the presence of membrane-mimetic micelles of dodecylphosphocholine and sodium dodecylsulphate. Eur J Biochem 235: 382–393.

van der Meer, J. R., Polman, J., Beerthuyzen, M. M., Siezen, R. J., Kuipers, O. P., and de Vos, W. M. (1993) Characterization of the Lactococcus lactis nisin A operon genes nisP, encoding a subtilisin-like serine protease involved in precursor processing, and nisR, encoding a regulatory protein involved in nisin biosynthesis. J Bacteriol 175: 2578–2588.

van Saparoea, H. B., Bakkes, P. J., Moll, G. N., and Driessen, A. J. (2008) Distinct contributions of the nisin biosynthesis enzymes NisB and NisC and transporter NisT to prenisin production by Lactococcus lactis. Appl Environ Microbiol 74: 5541–5548.

Literature cited

56

Vandamme, P., van Doorn, L. J., al Rashid, S. T., Quint, W. G., van der Plas, J., Chan, V. L., and On, S. L. W. (1997) Campylobacter hyoilei Alderton et al. 1995 and Campylobacter coli Veron and Chatelain 1973 are subjective synonyms. Int J Syst Bacteriol 47: 1055–1060.

van der Wielen, P. W. J. J., Biesterveld, S., Notermans, S., Hofstra, H., Urlings, B. A. P., and van Knapen, F. (2000) Role of volatile fatty acids in development of the caecal microfl ora in broiler chickens during growth. Appl Environ Microbiol 66: 2536–2540.

van Kraaij, C., Breukink, E., Rollema, H. S., Siezen, R. J., Demel, R. A., de Kruijff, B., and Kuipers, O. P. (1997) Infl uence of charge differences in the C-terminal part of nisin on antimicrobial activity and signaling capacity. Eur J Biochem 247: 114–120.

Vera Pingitore, E., Hébert, E. M., Sesma, F., and Nader-Macias, M. E. (2009a) Infl uence of vitamins and osmolites on growth and bacteriocin production by Lactobacillus salivarius CRL 1328 in a chemically defi ned medium. Can J Microbiol 55: 304–310.

Vera Pingitore, E., Hébert, E. M., Sesma, F., and Nader-Macias, M. E (2009 b) Characterization of salivaricin CRL 1328, a two-peptide bacteriocin produced by Lactobacillus salivarius CRL 1328 isolated from the human vagina. Res Microbiol 160: 401-408.

Wachsman, M. B., Farias, M. E., Takeda, E., Sesma, F., de Ruiz Holgado, A. P., de Torres, R. A., and Coto, C. E. (1999) Antiviral activity of enterocin CRL35 against herpes viruses. Int J Antimicrob Agents 12: 293–299.Wachsman, M. B., Castilla, V., de Ruiz Holgado, A. P., de Torres, R. A., Sesma, F., and Coto, C. E. (2003) Enterocin CRL35 inhibits late stages of HSV-1 and HSV-2 replication in vitro. Antivir Res 58: 17–24.

Wallner, G., Fuchs, B., Spring, S., Beisker, W., and Amann, R. (1997) Flow sorting of microorganisms for molecular analysis. Appl Environ Microbiol 63: 4223–4231.

Walsh, M. C., Gardiner, G. E., Hart, O. M., Lawlor, P. G., Daly, M., Lynch, B., Richert, B. T., Radcliffe, S., Giblin, L., Hill, C., Fitzgerald, G. F., Stanton, C., and Ross, P. (2008) Predominance of abacteriocin-producing Lactobacillus salivarius component of a fi ve-strain probiotic in the porcine ileum and effects on host immune phenotype. FEMS Microbiol Ecol 64: 317–327.

Wagenaar, J. A., Bergen, M. A. P. V., Mueller, M. A., Wassenaar, T. M., and Carlton, R. M. (2005) Phage therapy reduces Campylobacter jejuni colonization in broilers.Vet Microbiol 109: 275–283.

Wolf, C. E., and Gibbons, W. R. (1996) Improved method for quantifi cation of the bacteriocin nisin. J Appl Bacteriol 80: 453-457.

Wagenaar, J. A., Jacobs-Reitsma,W., Hofshagen, M., and Newell, D. G. (2008) Poultry colonization with Campylobacter and its control at the primary production level. In: Campylobacter, 3rd edition. Nachamkin I., Szymanski C. M., and Blaser M. J. (eds.). Washington, DC: Am Soc Microbiol pp. 667–678.

Wahlstöm, G., and Saris, P. E. J. (1999) Nisin bioassay based on bioluminescence. Appl Environ Microbiol 65: 3742-3745.

Weinack, O. M., Snoeyenbos, G. H., Smyser, C. F., and Soerjadi, A. S. (1982) Reciprocal competitive exclusion of Salmonella and Escherichia coli by native intestinal microfl ora of the chicken and turkey. Avian Dis 26: 585–595.

Wiedemann, I., Benz, R., and Sahl, H.-G. (2004) Lipid II-mediated pore formation by the peptide antibiotic nisin: a black lipid membrane study. J Bacteriol 186: 3259–3261.

Wiedemann, I., Breukink, E., van Kraaij, C., Kuipers, O. P., Bierbaum, G., de Kruijff, B., Sahl, H. G. (2001) Specifi c binding of nisin to the peptidoglycan precursor lipid II combines pore formation and inhibition of cell wall biosynthesis for potent antibiotic activity. J Biol Chem 276: 1772-1779.

Literature cited

57

Wiemann, M. (2003) How do probiotic feed additives work? Int Poult Prod 11: 7–9.Willey, J. M., and van der Donk, W. A. (2007) Lantibiotics: peptides of diverse structure and

function. Annu Rev Microbiol 61: 477–501. Wirawan, R. E., Klesse, N. A., Jack, R. W., and Tagg, J. R. (2006) Molecular and genetic

characterization of a novel nisin variant produced by Streptococcus uberis. Appl Environ Microbiol 72: 1148–1156.

Wu, J., Hu, S., and Cao, L. (2007) Therapeutic effect of nisin Z on subclinical mastitis in lactating cows. Antimicrob Agents Chemother 51: 3131–3135.

Yang, Y., Iji, P. A., and Choct, M. (2009). Six kinds of alternatives to in-feed antibiotics. World’s Poult Sci J 65: 97-114.

Zendo, T., Fukao, M., Ueda, K., Higuchi, T., Nakayama, J., and Sonomoto, K. (2003) Identifi cation of the lantibiotic nisin Q, a new natural nisin variant produced by Lactococcus lactis 61-14 isolated from a river in Japan. Biosci Biotechnol Biochem 67: 1616–1619.

Zhu, X. Y., and Joerger, R.D. (2003) Composition of microbiota in content and mucus from caeca of broiler chickens as measured by fl uorescent in situ hybridization with group-specifi c, 16S rRNA-targeted oligonucleotides probes. Poultry Sci 82: 1242–1249.

Zhu, X. Y., Zhong, T., Pandya, Y., and Joerger, R. D. (2002) 16S rRNA-based analysis of microbiota from the cecum of broiler chickens. Appl Environ Microbiol 68: 124–137.

Literature cited

lactic acid bacteria and their antimicrobial peptides ...1. lactic acid bacteria lactic acid...

Documents