Publications of the University of Eastern Finland

Dissertations in Health Sciences

isbn 978-952-61-1026-4

Publications of the University of Eastern FinlandDissertations in Health Sciencesd

issertation

s | 151 | An

tti Ko

tima

a | Vascular E

ndoth

elial Grow

th Factor D

- Biology an

d Fun

ction in Tran

sgenic and K

nockdow

n Mice

Antti KotimaaVascular Endothelial

Growth Factor D Biology and Function in Transgenic and

Knockdown Mice

Antti Kotimaa

Vascular Endothelial Growth Factor DBiology and Function in Transgenic and

Knockdown Mice

Disturbances in the development

and function of blood- or lymphatic

vasculature are involved in many

diseases. Vascular endothelial

growth factors are central mediators

in vascular development. In this

thesis, a lentiviral perivitelline

transgenesis method was used

to study the role of VEGF-D in

cardiovascular diseases, ischemic

conditions and tumor formation. It

clarifies the function of VEGF-D in

angiogenesis and shows a potential

use as a treatment in tissue ischemia.

However, unregulated long-

term expression promoted tumor

formation.

ANTTI KOTIMAA

Vascular Endothelial Growth Factor D

Biology and Function in Transgenic and Knockdown Mice

To be presented by permission of the Faculty of Health Sciences, University of Eastern Finland for public examination in Medistudia auditorium 2, Kuopio, University of Eastern Finland

on Friday, February 22nd 2013, at 12 noon

Publications of the University of Eastern Finland Dissertations in Health Sciences

Number 151

Department of Biotechnology and Molecular Medicine A.I. Virtanen Institute of Molecular Sciences

Faculty of Health Sciences University of Eastern Finland

Kuopio 2013

Kopijyvä OY Kuopio, 2013

Series Editors:

Professor Veli-Matti Kosma, M.D., Ph.D. Institute of Clinical Medicine, Pathology

Faculty of Health Sciences

Professor Hannele Turunen, Ph.D. Department of Nursing Science

Faculty of Health Sciences

Professor Olli Gröhn, Ph.D. A.I. Virtanen Institute for Molecular Sciences

Faculty of Health Sciences

Distributor: University of Eastern Finland

Kuopio Campus Library P.O.Box 1627

FI-70211 Kuopio, Finland http://www.uef.fi/kirjasto

ISBN (print): 978-952-61-1026-4 ISBN (pdf): 978-952-61-1027-1

ISSN (print): 1798-5706 ISSN (pdf): 1798-5714

ISSN-L: 1798-5706

III

Author’s address: Department of Biotechnology and Molecular Medicine A.I. Virtanen Institute for Molecular Sciences Faculty of Health Sciences University of Eastern Finland KUOPIO FINLAND

Supervisors: Professor Seppo Ylä-Herttuala, M.D., Ph.D.

Docent Tuomas Rissanen, M.D., Ph.D. Department of Biotechnology and Molecular Medicine A.I. Virtanen Institute for Molecular Sciences Faculty of Health Sciences University of Eastern Finland KUOPIO FINLAND

Reviewers: Emmy Verschuren, Ph.D.

Institute for Molecular Medicine Finland University of Helsinki HELSINKI FINLAND

Taina Partanen, M.D., Ph.D. Department of Plastic Surgery Helsinki University Hospital HELSINKI FINLAND

Opponent: Professor Seppo Vainio, Ph.D.

Department of Medical Biochemistry and Molecular Biology Institute of Biomedicine Faculty of Medicine University of Oulu OULU FINLAND

IV

V

Kotimaa, Antti Vascular Endothelial Growth Factor D. Biology and Function in Transgenic and Knockdown Mice University of Eastern Finland, Faculty of Health Sciences, 2013 Publications of the University of Eastern Finland. Dissertations in Health Sciences Number 151. 2013. 71 p. ISBN (print): 978-952-61-1026-4 ISBN (pdf): 978-952-61-1027-1 ISSN (print): 1798-5706 ISSN (pdf): 1798-5714 ISSN-L: 1798-5706 ABSTRACT The aim of this work was to study the role of vascular endothelial growth factor (VEGF)-D in cardiovascular diseases and ischemic conditions. A secondary aim was to evaluate the potential role of VEGF-D in tumor formation. Transgenic (TG) and knockdown (KD) models were used to study VEGF-D function in mice.

Disturbances in vascular or lymphatic development and function may be involved in a variety of diseases. VEGFs are central mediators in the development and the maintenance of blood and the lymphatic vasculature. Five mammalian VEGFs have been identified, VEGF-A, -B, -C, -D and placental growth factor (PlGF), all of them having distinct binding properties to their receptors VEGFR-1, -2 and -3. VEGFs are known to be upregulated in tumors, where they remodel the tumoral vasculature. VEGF-D contributes to the growth and formation of blood- and lymphatic vessels by binding to both VEGFR-2 and -3.

Lentiviral constructs with ubiquitous and endothelial specific promoters were used to overexpress VEGF-D in mice. In addition, a construct with a small hairpin RNA (shRNA) to silence VEGF-D was used. The lentiviral perivitelline injection method was used to produce TG and KD mice. Founder mice positive for the VEGF-D transgene were born and they were further bred and studied for up to five generations. Littermates lacking the transgene were used as controls. Hindlimb ischemia was induced to study the role of VEGF-D in angiogenesis and in the recovery from ischemic injury.

The perivitelline transgenesis method was very efficient, since there were several TG-positive founders. The transgene was expressed in various tissues, with differing expression levels between the mouse lines. The expression level was starting to fade in consecutive generations. Increased capillary density was observed in the skeletal muscle and myocardium of the ubiquitously expressing mice. The mice also showed improved muscle regeneration after ischemia, but no changes were observed in the lymphatic system. However, increased tumor formation was found in both overexpressing mouse lines, which significantly decreased their lifespan. In the ubiquitously VEGF-D expressing TG mice, the tumors were mainly breast adenocarcinomas. In the shVEGF-D mice, the transgene was effectively silenced in all studied tissues. These mice had a phenotype which displayed variable pathological conditions. This may be attributable to the widespread effects of expressed shRNA, which disturbs the endogenous micro RNA (miRNA) machinery.

In conclusion, VEGF-D may be effective in the treatment of tissue ischemia. However, unregulated long-term expression may be harmful by promoting malignant transformation. National Library of Medicine Classification: QU 107, QU 450, QY 60.R6, QZ 170, WG 120 Medical Subject Headings: Vascular Endothelial Growth Factor D; Cardiovascular Diseases; Ischemia; Mice, Transgenic; Gene Knockdown Techniques; Gene Silencing; Gene Expression; Transgenes; Lentivirus; RNA, Small Interfering; Capillaries; Muscle, Skeletal; Myocardium; Neoplasms

VI

VII

Kotimaa, Antti Verisuonen Endoteelin Kasvutekijä D. Biologia ja toiminta siirtogeenisillä ja hiljennetyillä hiirimalleilla. Itä-Suomen yliopisto, terveystieteiden tiedekunta, 2013 Publications of the University of Eastern Finland. Dissertations in Health Sciences Numero 151. 2013. 71 s. ISBN (print): 978-952-61-1026-4 ISBN (pdf): 978-952-61-1027-1 ISSN (print): 1798-5706 ISSN (pdf): 1798-5714 ISSN-L: 1798-5706 TIIVISTELMÄ Tutkimuksen tarkoituksena oli tutkia VEGF-D:n merkitystä sydän- ja verisuonisairauksissa sekä kudosiskemiassa. Halusimme myös tutkia VEGF-D:n merkitystä kasvainten muodostuksessa. VEGF-D:n toimintaa tutkittiin siirtogeenisten ja hiljennettyjen hiirimallien avulla.

Veri- ja imusuonten kehityksen tai toiminnan häiriöt voivat altistaa monille eri sairauksille. Verisuonen endoteelin kasvutekijät (VEGF) ovat keskeisiä tekijöitä veri- ja imusuonten kasvussa ja muokkauksessa. Nisäkkäiltä on löydetty viisi eri VEGF kasvutekijää, VEGF-A, -B, C, -D sekä istukan kasvutekijä (PlGF), jotka sitoutuvat eri tavoin VEGFR-1, -2 ja -3 reseptoreihin. Kasvaimet ilmentävät runsaasti VEGF:iä ja ne muokkaavat aktiivisesti kasvaimen verisuonistoa. VEGF-D sitoutuu VEGFR-2 ja -3 reseptoreihin ja osallistuu veri- ja imusuonten kasvuun sekä muokkaukseen.

Lentiviruskonstrukteja, joissa hyödynnettiin yleisesti ilmentävää sekä endoteelispesifistä promoottoria, käytettiin ilmentämään VEGF-D:tä hiirillä. Hiljennetty VEGF-D hiirimalli (shVEGFD) luotiin shRNA:n avulla. Siirtogeeniset hiiret sekä hiljennetty hiirimalli luotiin lentivirusten perivitelliini-injektio-menetelmällä. Siirtogeenin suhteen positiiviset kantahiiret paritettiin edelleen ja tutkittiin viiden sukupolven ajan. Kontrollieläiminä käytettiin siirtogeenin suhteen negatiivisia hiiriä. Alaraajaiskemiamallin avulla selvitettiin VEGF-D:n merkitystä angiogeneesissä sekä iskeemisen vaurion paranemisessa.

Perivitelliinitransgeneesi oli erittäin tehokas menetelmä, koska TG-positiivisten kantahiirten määrä oli korkea. Siirtogeeniä ilmennettiin monissa eri kudoksissa, mutta ilmentymistasot vaihtelivat hiirilinjojen välillä. Sukupolvien edetessä siirtogeenin ilmentyminen vähentyi. Yleisilmennettävällä hiirimallilla hiussuonten määrä oli lisääntynyt luurankolihaksissa sekä sydänlihaksessa. Myös lihasten toipuminen iskeemisestä vauriosta nopeutui, mutta imusuonistossa ei havaittu muutoksia. Molemmilla yli-ilmentävillä hiirimalleilla havaittiin lisääntynyttä tuumorimuodostusta, joka lyhensi merkittävästi eläinten elinikää. Yleisesti yli-ilmentävien hiirien kasvaimista suuri osa oli rintarauhasen adenokarsinoomia. Hiljennetyllä hiirimallilla VEGF-D oli hiljennetty tehokkaasti kaikissa tutkituissa kudoksissa. Näillä hiirillä oli epäspesifinen fenotyyppi ja vaihtelevia patologisia muutoksia. Tämä voi johtua ilmennetyn shRNA:n laaja-alaisesta vaikutuksesta, joka häiritsee hiiren omaa miRNA mekanismia.

Väitöskirjatyössä osoitettiin, että VEGF-D voi olla tehokas iskemian hoidossa. Säätelemätön pitkäaikainen ilmentyminen voi olla kuitenkin haitallista edistämällä pahanlaatuisia muutoksia elimistössä. Luokitus: QU 107, QU 450, QY 60.R6, QZ 170, WG 120 Yleinen Suomalainen asiasanasto: verisuonten endoteelikasvutekijä D; sydän- ja verisuonitaudit; iskemia; hiiret; geenitekniikka; geeniekspressio; hiussuonet; poikkijuovainen lihas; sydänlihas; kasvaimet

VIII

IX

Acknowledgements

This work was done in the University of Eastern Finland, at the A.I. Virtanen Institute for Molecular Sciences in the Department of Biotechnology and Molecular Medicine during the years 2006-2013.

I have had the opportunity to work under the supervision of Professor Seppo Ylä-Herttuala. His encouragement and inspiration have kept me going through all these years. Seppo’s deep knowledge has also widened my scientific thinking and imagination. I wish to thank my other supervisor Docent Tuomas Rissanen for his expert views, while processing my thesis.

I am thankful for the reviewers, Dr Emmy Verschuren and Dr Taina Partanen, whose expertise and valuable comments helped to improve this thesis. I want to thank Ewen MacDonald for the linguistic revision of my thesis.

I want to acknowledge all my co-authors, who gave invaluable help and effort to this scientific work. I owe my deepest gratitudes to Anna-Mari Zainana, with whom I worked at my side for many years. Thank you for sharing your knowledge and ideas and for your friendship. I am extremely thankful for Jenni Huusko and Eveliina Pulkkinen for their generous help with my projects. I want to acknowledge the contribution of Ivana Kholová for her help and expertise.

Technical personnel, especially Seija Sahrio, Anneli Miettinen, Mervi Nieminen, Anne Martikainen and Svetlana Laidinen are appreciated for the valuable, everyday work. I am deeply grateful to Helena Pernu and Marja Poikolainen for the general help in mostly everything. I am grateful for the valuable help of the personnel of the Lab Animal Centre of the University of Eastern Finland for taking care of the animals.

The SYH group is a large and diverse team, full of fun people, crazy ideas and good friends. I want to thank all my colleagues for all these years, for sharing the ups and downs in work and out-of-office. Special regards to Jari Lappalainen, Hanna Stedt, Johannes Laitinen and others throughout the years for sharing the office with me. I am deeply grateful for the badminton team that taught me never to quit, even if you lose all the time.

Life would be nothing without friends who are there when needed, pull you up when you’re down, making and sharing the precious things in life. I want to thank Ville for the unforgettable moments we’ve shared since childhood, for all the adventures, constantly searching our limits. All the Puolukka-friends, I thank you for every written story, all the movie nights and for the cabin trips. I’m deeply grateful to Hanna, Kimi and the girls for sharing the everyday life and for the innumerable joyful moments. You are like a second family. I am thankful for everyone in Luppo, with whom I have grown up, a part of me is always with you. I’m deeply grateful to the people sharing my most precious hobby, thanks Puikkarilaiset.

I want to thank my mother-in-law Inka, for having me in the family, for the endless times when she took care for Ada and Ella and for being there whenever needed. Thanks to Laura and Juho for your friendship and all the good times together. I am grateful to Mataleena and Samuli for all the joyful moments with you and for bringing the sparkle to the academic world and for inspiring me to go on.

My deepest thanks go to my parents, who have always trusted and believed in me. Mom and Harri, you have always been there, supporting, pushing me forward, and taking care of the kids and Ronja. Dad and Riitta, thank you for your love and support, the relaxing times at the cottage and for taking care of our precious girls. Arto, my dearest big brother, I have always looked up to you. Your family, Anne-Mari and the kids, thank you for being in my life.

X

Finally, I thank my closest family. Johanna, we have had some struggles in our life

together, in addition I am not the easiest person to live with. Still, I find you there, everyday, beside me. I’m amazed at your patience and I admire the way you handle the kids. You are the best mother they could hope for. Words cannot describe my love and gratitude to you. Ada and Ella, my precious ones, for you I’ll do everything, I love you.

Kuopio, January 2013

Antti Kotimaa

This study was supported by grants from the Academy of Finland, the Kuopio University Foundation, the Leducq Foundation, the Finnish Foundation for Cardiovascular Research, Sigrid Juselius Foundation, Lymphangiogenomics EU Network, the Jenny and Antti Wihuri Foundation, the Finnish Cultural Foundation, Emil Aaltonen Foundation, Paulo Foundation, Aarne and Aili Turunen Foundation and the Antti and Tyyne Soininen Foundation.

XI

List of the original publications

This dissertation is based on the following original publications:

I Kärkkäinen A-M, Kotimaa A, Huusko J, Kholova I, Heinonen SE, Stefanska A, Dijkstra MH, Purhonen H, Hämäläinen E, Mäkinen PI, Turunen MP, Ylä-Herttuala S. Vascular endothelial growth factor-D transgenic mice show enhanced blood capillary density, improved post ischemic muscle regeneration and increased susceptibility to tumor formation. Blood 113:4468-4475, 2009.

II Kotimaa AA, Zainana A-M, Pulkkinen E, Huusko J, Heinonen SE, Kholová I, Stedt H, Lesch HP, Ylä-Herttuala S. Endothelium-specific over expression of human VEGF-D in mice leads to increased tumor frequency and a reduced lifespan. The Journal of Gene Medicine 14:182-90, 2012.

III Kotimaa AA, Zainana A-M, Huusko J, Stedt H, Heinonen SE, Kholová I, Mäkinen

P, Lesch HP, Alhonen L, Ylä-Herttuala S. Knockdown of endogenous VEGF-D in mice with lentiviral short-hairpin RNA technology leads to reduced lifespan and increased incidence of malignancies. Manuscript 2013

The publications were adapted with the permission of the copyright owners.

In addition, previously unpublished data are also presented.

XII

XIII

Contents

1 INTRODUCTION ................................................................................................................. 1 2 REVIEW OF THE LITERATURE ....................................................................................... 3

2.1 Vascular system ................................................................................................................ 3 2.1.1 Growth and organization ........................................................................................ 3 2.1.2 Vasculogenesis .......................................................................................................... 3 2.1.3 Angiogenesis ............................................................................................................. 4 2.1.4 Arteriogenesis ........................................................................................................... 5 2.1.5 Lymphangiogenesis ................................................................................................. 6

2.2 Vascular growth factors................................................................................................... 6 2.2.1 VEGFs ......................................................................................................................... 7 2.2.2 VEGF receptors ......................................................................................................... 9 2.2.3 Other vascular growth factors ................................................................................ 11

2.3 Diseases associated with VEGFs .................................................................................... 11 2.3.1 Atherosclerosis .......................................................................................................... 12 2.3.2 Cancer ......................................................................................................................... 12 2.3.3 Lymphatic disorders ................................................................................................ 13 2.3.4 Disease models .......................................................................................................... 13

2.4 Generation of gene modified animals ........................................................................... 14 2.4.1 Traditional ways of creating transgenic and knockout animals ........................ 14 2.4.2 Transgenesis, knockout and knockdown methods based on lentiviral gene transfer ............................................................................................................. 14 2.4.3 Gene silencing ........................................................................................................... 16 2.4.4 Viral vectors ............................................................................................................... 17

2.5 Phenotype analysis of gene modified animals ............................................................. 18 3 AIMS OF THE STUDY ........................................................................................................ 19 4 MATERIAL AND METHODS ........................................................................................... 21

4.1 Vectors ............................................................................................................................... 21 4.2 Generation of transgenic and knockdown mice .......................................................... 22 4.3 Transgene expression ...................................................................................................... 23 4.4 Ischemia operations ......................................................................................................... 23 4.5 Histological analyses ....................................................................................................... 23 4.6 Protein expression ............................................................................................................ 24 4.7 Clinical chemistry ............................................................................................................. 24 4.8 Statistical analyses ............................................................................................................ 25

XIV

5 RESULTS ................................................................................................................................ 27

5.1 Generation of TG mice and VEGF-D expression ......................................................... 27 5.2 Hindlimb ischemia model .............................................................................................. 31 5.3 Tumor formation .............................................................................................................. 33

6 DISCUSSION ........................................................................................................................ 37 7 CONCLUSIONS ................................................................................................................... 41 8 REFERENCES ........................................................................................................................ 43 APPENDIX: ORIGINAL PUBLICATIONS (I-III)

XV

Abbreviations

AAV Adeno-associated virus ABC Avidin-biotin complex AFOS Alkaline phosphate Ago Argonaute Akt V-akt murine thymoma viral

oncogene homolog 1 Ang Angiopoietin ANOVA Analysis of variance ASAT Aspartate aminotransferase BIV Bovine immunodeficiency

virus BMD Bone marrow derived CAD Coronary arterial disease CD8 Cluster of differentiation 8 CD31 Cluster of differentiation 31,

platelet endothelial cell adhesion molecule

CD34 Cluster of differentiation 34 cDNA Complementary DNA CK Cytokeratin CK Creatinine kinase CMV Cytomegalovirus CPPT Central polypurine tract Cre Cre-recombinase CTP Cytidine triphosphate DAB Diaminobenzene Dll4 Delta-like ligand 4 DNA Deoxyribonucleic acid Ds Double-stranded EC Endothelial cell ECM Extracellular matrix ELISA Enzyme-linked immunoassay Env Envelope Eph Ephrin

Erk Extracellular signal regulated kinase, MAPK

ESC Embryonic stem cell FGF Fibroblast growth factor FGFR FGF receptor FIGF Fos-induced growth factor FIV Feline immunodeficiency

virus Flk Fetal liver kinase Flt Fms-induced tyrosine kinase

receptor FOX Forkhead box protein Fw Forward GFP Green fluorescence protein H1 Human H1 promoter HDL High-density lipoprotein HE Hematoxylin eosin HIF Hypoxia inducible factor HIV Human immunodeficiency

virus HLI Hindlimb ischemia hU6 Human U6 small nuclear

promoter Ig Immunoglobulin in vivo Within a living organism KD Knockdown KDR Kinase insert domain

containg receptor KO Knockout LD Lactate dehydrogenase LDL Low-density lipoprotein LoxP Lox sequence LTR Long terminal repeat LV Lentivirus LYVE-1 Lymphatic vessel endothelial

hyaluronan receptor

XVI

MAPK Mitogen activated protein kinase

MCP Monocyte chemotactic protein

MCS Multiple cloning site Mek Tyrosine/threonine kinase MI Microinjection miRNA Micro RNA MMP Matrix metalloproteinase mRNA Messenger RNA NO Nitric oxide NOS Nitric oxide synthase NGFR Nerve growth factor receptor Nrf2 Nuclear factor-like 2 Nrp Neuropilin PAD Peripheral arterial disease PAI-1 Plasminogen activator

inhibitor-1 PBS Phosphate buffered saline PCR Polymerase chain reaction PDGF Platelet derived growth factor PFA Paraformaldehyde PGK Phosphoglycerate kinase PI Perivitelline injection PI3K Phosphatidylinositol-3 kinase PlGF Placental growth factor PolII RNA polymerase II PolIII RNA polymerase III qPCR Quantitative PCR Raf Serine/threonine-selective

protein kinase RISC RNA-induced silencing

complex RNAi RNA interference RRE Rev-responsive element RTK Receptor tyrosine kinase shRNA Small hairpin RNA SIN Self-inactivating siRNA Small interfering RNA

SIV Simian immunodeficiency virus

SMC Smooth muscle cell Src Sarcoma, tyrosine kinase

proto oncogene SRV Simian retrovirus SSRE Shear stress response element TG Transgenic TGF-b Transforming growth factor

beta Tie Tyrosine kinase with Ig-like

and EGF-like domains TU Transforming units U5 5’ LTR VEGF Vascular endothelial growth

factor VEGFR VEGF receptor WPRE Woodchuck hepatitis virus

post-transcriptional regulatory element

1 Introduction

The vascular system can be differentiated into four types of vessels; arteries, veins, capillaries and lymphatic vessels. The heart pumps oxygen rich blood via arteries to the capillaries, where oxygen and nutrients diffuse to tissues. The blood flows from arteries to capillaries and then through veins back to the heart. The arteries control the blood pressure and blood flow by contracting and dilating, although veins can also participate in the maintenance of blood pressure by storing and releasing large volumes of blood. The lymphatic system collects excess fluids from cells, transfers it back to the blood circulation and it also delivers cells of the immune system. The formation, development and stabilization of the blood- and lymphatic vascular system is maintained to a large extent by vascular endothelial growth factors (VEGFs). Five different mammalian VEGFs have been found, which bind to their VEGF receptors (VEGFR) signaling for growth and maintenance of blood or lymphatic vessels (Ellis, Hicklin 2008).

Inadequate blood flow causes tissue ischemia which may clinically manifest itself as claudication, which may lead to amputation of lower limbs, transient ischemic attack or stroke in the brain and angina or myocardial infarction in the heart depending on the severity and location of the perfusion deficit. In tumors, VEGFs restructure the vasculature and in this way they can promote malignant growth (Ellis, Hicklin 2008). Anti-angiogenic therapies such as bevacizumab (humanized anti-VEGF antibody), are already approved in the treatment of metastatic breast-, colorectal-, ovarian-, kidney- and lung cancer (Rossari et al. 2012, Bates et al. 2012, Banerjee, Kaye 2012, Lambrechts et al. 2012, Sandler et al. 2006).

Therapeutic angiogenesis is a promising treatment for ischemic conditions and lymphatic diseases (Yla-Herttuala 2009). In clinical trials, therapeutic angiogenesis has been proved to be relatively safe (Hedman et al. 2003, Hedman et al. 2009). However, some concerns have been raised from results emerging from animal studies, such as tissue edema, inflammation, fibrosis, vessel instability, excessive vessel growth and tumors (Rutanen et al. 2004, Korpisalo et al. 2008a, Markkanen et al. 2005). Proangiogenic treatment may exert harmful effects in atherosclerosis or diabetes, since it may accelerate disease progression.

During the last decade, vascular growth factors have received increased attention in biomedical studies. VEGF-D is a relatively new member of the VEGF family and its exact role in vivo is still largely unclear. In this thesis, the role of VEGF-D was studied in vivo using transgenic (TG) and knockdown (KD) mice generated using lentiviral techniques. It was found that overexpressed VEGF-D caused malignant tumors when expressed ubiquitously or in the endothelium. The KD of VEGF-D evoked a variety of pathologies pointing to a more diverse effect not only of the silenced gene but perhaps also of the used short hairpin (sh) RNA-RNA interference (RNAi) system.

2

3

2 Review of the literature

2.1 VASCULAR SYSTEM

2.1.1 Growth and organization The cardiovascular system in vertebrates is the first functional structure to develop during embryogenesis. The heart pumps blood via vessels and the circulation plays many crucial roles in the body; oxygen and nutrient delivery to cells, waste disposal, hormonal traffic and also transfer of immune responses. A functional circulatory system is essential for providing sufficient oxygen and nutrients to the developing embryo. The system differentiates into arterial, venous and lymphatic vessels (Risau, Flamme 1995, Rossant, Howard 2002).

During early development, the heart starts to pump which produces a high-pressured blood flow through the arterial vessels. The arterial vessels have a large diameter to allow large blood volumes and smooth muscle cells (SMCs) and extracellular matrix (ECM) components to support the vessel wall. Blood flows back to the heart through veins, which have a lower pressure than the arteries. Veins have valves to prevent the backflow of blood. Previous studies have shown that these hemodynamic differences direct the specification of blood vessels (Riha et al. 2005, Ando, Yamamoto 2009). Other studies demonstrate different molecular signals in arteries and veins from the early stages of development. Small capillaries can also be distinguished based on their molecular markers. These markers are proteins involved in regulating the initial step in differentiation of arteries and veins (Wang, Chen & Anderson 1998, Yancopoulos, Klagsbrun & Folkman 1998, Torres-Vazquez, Kamei & Weinstein 2003).

2.1.2 Vasculogenesis Early blood vessels are formed by vasculogenesis when endothelial precursor cells (angioblasts) differentiate and form a network of new capillaries (Figure 1). This event starts when a group of cells grows and starts to experience a lack of oxygen. This causes the cells to produce hypoxia-related signals and initiates vascular growth. The process is complex including a variety of regulatory mechanisms such as the VEGF/VEGFR and angiopoietin (Ang)/Tie -pathways (Carmeliet 1996, Ferrara 1996, Ferrara 1999, Shalaby 1995). Also Ephrin (Eph) / Eph receptor (Gale, Yancopoulos 1999) and Delta/Notch pathways, platelet derived growth factor (PDGF), fibroblast growth factors (FGF) (Zhou et al. 1998, Lindahl et al. 1998) and transforming growth factor beta (TGF-β) (Dickson et al. 1995) have important roles in the vascular development. However, the major regulators of the formation of vasculature are VEGF–A and delta-like ligand 4 (Dll4) (Shutter et al. 2000, Lobov et al. 2007).

4

Figure 1. Formation of primary vascular plexus from angioblasts (vasculogenesis) and further development into a mature vascular system via different forms of angiogenesis and arteriogenesis (Korpisalo, Yla-Herttuala 2010).

2.1.3 Angiogenesis Angiogenesis is defined as the growth of new blood vessels, which can happen in three main ways: sprouting, intussusception and elongation (Figure 1). Circulating endothelial cells (EC) can also be incorporated into vessel walls (Chung, Ferrara 2011). New vascular sprouts are formed from pre-existing vessels. Quiescent ECs are activated by an angiogenic stimulus; they start to produce proteases, which open the basal lamina and the surrounding tissue allowing the sprouts to grow. Eventually the sprouts meet and connect (anastomosis), creating a closed tubular system. The mature network of vessels differentiates into arteries and veins. During embryogenesis before a complete circulation this maturation process is regulated by signaling molecules such as VEGF, Notch and Eph-B2 (Salvucci et al. 2009, Coultas, Chawengsaksophak & Rossant 2005). However, when the blood is circulating, laminar and shear stress partly regulate the arterial/vein differentiation (Shutter et al. 2000, Lawson et al. 2001, Swift, Weinstein 2009).

In sprouting angiogenesis, new capillary branches are formed when pseudopods guide the development of capillary sprout growth into the surrounding tissue. The capillary sprout hollows out to form a tube. The secretion of proteases induces the resolution of basal lamina, EC proliferation and migration towards chemotactic gradient. High oxygen levels with low concentration of hypoxia inducible factor (HIF) keeps the cells quiet. When the oxygen level is low, HIF-1α is expressed, upregulating many angiogenic genes. However, the strongest factor to be upregulated is VEGF, which guides the capillary sprouts (Pugh, Ratcliffe 2003). The rearrangement and remodeling of ECs to create new vessels is called intussusceptive

5

angiogenesis. This saves resources in the embryo, since EC proliferation is not needed for remodeling (Makanya, Hlushchuk & Djonov 2009, De Spiegelaere et al. 2012).

Physiological angiogenesis takes place in many conditions, e.g. in embryonic development, wound healing, ischemia and uterine function. Pathological angiogenesis is important in many diseases such as tumor growth, atherosclerosis and pathological neovascularization in the diabetic retina. In unwanted vascular growth, the basement membrane is degraded, ECs proliferate and migrate leading to the tube formation, remodeling and maturation of newly formed vessels (Djonov et al. 2000).

Mature blood vessels have an EC layer lining the inside of the vessel, surrounded by supportive pericytes and SMCs. In addition to mechanical support, the perivascular cells regulate blood flow. The pericytes and SMCs also produce growth factors for ECs, like VEGF, FGF2 and Ang1. SMCs and pericytes stabilize mature vessels by preventing EC hyperproliferation (Bergers, Song 2005, Chan-Ling et al. 2004, Hirschi, Rohovsky & D'Amore 1998). Long-term VEGF-A expression matures and stabilizes blood vessels (Djonov et al. 2000). VEGF-A also induces SMC and pericyte proliferation (Rutanen et al. 2004, Rissanen et al. 2005).

The vasculature of specific organs, such as liver and spleen is highly permeable due to discontinuous ECs. The kidney and endocrine glands have fenestrated ECs. On the contrary, ECs in the brain and retinal capillaries have tight-junctions. Other tissues e.g. bone, skeletal muscle, myocardium and gonad capillaries, have continuous ECs. These findings have led to the concept of an organ-specific regulation of angiogenesis (Ioannidou et al. 2006, Stan, Kubitza & Palade 1999, Roberts, Palade 1995, LeCouter et al. 2001).

2.1.4 Arteriogenesis Arteriogenesis is the growth and enlargement of arteries (collateral vessel formation) from pre-existing vessels (arterioles). Arteries enable a high-pressure transport of blood to capillaries, which is supported by SMCs and specialized matrix. The formation of collateral arteries to provide some blood flow to the ischemic tissue after the atherosclerotic occlusion of the main artery is of crucial importance as this may save the integrity of a lower limb or prevent myocardial infarction. The driving force is blood pressure and increased shear stress against the endothelium, which causes the deformation of EC and SMC. In contrast, ischemia is not a direct force to drive collateral vessel formation as it occurs in non-ischemic area (Scholz, Schaper 2005, Pipp et al. 2004). Nitric oxide synthase (NOS) and nitric oxide (NO) production activates VEGF expression from ECs and monocyte chemotactic protein (MCP) -1 from SMCs. Macrophages have been postulated to play an important role in arteriogenesis by producing growth factors and matrix metalloproteinases (MMP). Macrophages and T-cells accumulate in the adventitia or become attached to endothelium. Basement membrane synthesis and turnover, cell-cell adhesion and contact inhibition, soluble factors and their receptors are all regulating arteriogenesis (van Royen et al. 2001, Kamihata et al. 2002, Heil et al. 2002, Buschmann et al. 2001).

Arterial and venous ECs have specific molecular signatures that guide the cells to become differentiated (Swift, Weinstein 2009, Adams 2003). ECs become activated in response to shear stress with caveoli, integrins and tyrosine kinase receptors (VEGFR-1) acting as possible receptors. These activate multiple signaling pathways in the cells, and also shear stress response elements (SSRESs) are activated.

6

Circulating monocytes invade the vascular wall due to shear stress. Monocytes are transformed into macrophages and they start producing fibronectin, proteoglycans and proteases that remodel the ECM. Macrophages also produce vascular growth factors, mostly members of the FGF family. EC and SMC proliferation is stimulated by bFGF when it binds its receptors FGFR1-4 (Resnick et al. 2003).

2.1.5 Lymphangiogenesis Lymphatic vessels are formed from differentiating lymphangioblasts or from pre-existing veins. VEGF-C and –D together with VEGFR-3 are guiding the formation of vascular system (Kaipainen et al. 1995, Joukov et al. 1996, Achen et al. 1998, Makinen 2001). VEGF-C and –D also bind to neuropilin (Nrp) -2, which is expressed in lymphatic capillaries supporting lymphatic development (Karkkainen et al. 2001, Yuan et al. 2002). In contrast to blood capillaries, the lymphatic capillaries consist of overlapping ECs, allowing macromolecules to penetrate the vessel wall and they also lack supporting pericytes. Lymphatic vessels are needed for fluid drainage from tissues, the immune system and absorption of lipids from the intestine. The main function is to collect excess fluid filtered from arterial capillaries into the interstitium where extra fluid is drained into lymphatic vessels through endothelial junctions. The fluid is returned to blood circulation at the left subclavian vein. Lymph nodes filter e.g. micro-organisms and cancer cells out of the lymphatic fluid. The lymphatic vessels in intestinal villi absorb lipids. Protective tissues (skin and mucous membranes) have a rich lymphatic network. They also have an important task in immune surveillance in importing antigens and antigen presenting cells into lymph nodes, and exporting immune effector cells and humoral responses into the blood circulation. Defects in the lymphatic system can cause lymph and fat accumulation, lymphedema and decreased immune responses (Lund, Swartz 2010, Jurisic, Detmar 2009).

2.2 VASCULAR GROWTH FACTORS

Members of the VEGF-family and their receptors (VEGFR) are the main mediators in the formation of blood and lymphatic vessels in the developing embryo as well as in adults. Five members have been identified in the mammalian VEGF-family; VEGF-A, -B, -C, -D and placental growth factor (PlGF) (Figure 2).

7

Figure 2. The VEGF family (VEGF-A, -B, -C, -D, -E, PlGF-1 and -2), their tyrosine kinase receptors (VEGFR-1, -2, -3) and neuropilins (Nrp-1 and -2) guiding vasculogenesis, angiogenesis and lymphangiogenesis (Ylä-Herttuala 2007).

2.2.1 VEGFs VEGF-A is a major regulator in angiogenesis, in physiological and pathological conditions (Ferrara, Davis-Smyth 1997, Shibuya, Claesson-Welsh 2006). Its crucial role in angiogenic development has been shown with knockout (KO) mice, which die during embryonic development (Carmeliet 1996, Ferrara 1996). The mice have delayed EC differentiation, malformation of hematopoietic cells and disorganized blood vessels. VEGF-A signals via two tyrosine kinase receptors (VEGFR-1 and VEGFR-2). VEGF-A can induce vascular leakage, which relates strongly to inflammatory states and various pathological conditions. VEGF-A affects EC function by activating mitogen activated protein kinase (MAPK), phosphatidylinositol 3-kinase (PI3K) and other pathways (Ferrara, Gerber & LeCouter 2003). Multiple isoforms of VEGF-A are formed by alternative exon splicing, the main forms in humans are VEGF-A121, VEGF-A165, VEGF-A189 and VEGF-A206 named according to their amino acid length (Carmeliet 1996, Ferrara 1996, Houck et al. 1991, Tischer et al. 1991). In mice the isoforms are VEGF-A120, VEGF-A164 and VEGF-A188 (Ferrara et al. 1992, Shima et al. 1996). They each have unique properties and bind differently to VEGFR-1, -2, -3, Nrp-1 and -2. The VEGF

8

activates its target cells to proliferate, migrate and alter gene expression (MMPs, cytokines) (Ribatti 2005, Ribatti 2008). VEGF-A165 is the major isoform. VEGF is the prime angiogenic molecule during development, adult physiology and pathology.

In cancer therapy, inhibition of VEGF via the humanized monoclonal anti-VEGF antibody bevacizumab is used, which improves the patient’s survival (Braghiroli, Sabbaga & Hoff 2012, Rapisarda, Melillo 2012). VEGF via adenoviral overexpression has been a promising proangiogenic treatment for myocardial and lower limb ischemia (Hedman et al. 2003, Makinen et al. 2002).

VEGF-B was discovered as a homolog to VEGF-A (Olofsson et al. 1996, Grimmond et al. 1996). VEGF-B has two spliced forms, VEGF-B167 and VEGF-B189,

which bind differently to heparin adjusting their release and bioavailability. It forms heterodimers with VEGF-A (Olofsson et al. 1996, Olofsson 1996), changing receptor specificity and biological effects. VEGF-B is expressed in various tissues, mostly in heart and skeletal muscles (Olofsson et al. 1996). It is a survival factor for vascular ECs, pericytes and SMCs (Li 2008, Zhang et al. 2009). VEGF-B binds specifically to VEGFR-1 stimulating urinary plasminogen activator and plasminogen activator inhibitor-1 (PAI-1) expression and activation in ECs (Olofsson et al. 1998). It also binds to Nrp-1 (Makinen 1999). VEGF-B KO mice are viable but they have a smaller heart and coronary vasculature is impaired. In addition, recovery from induced myocardial ischemia is impaired (Bellomo 2000, Lahteenvuo 2009). VEGF-B deficiency restores insulin sensitivity and glucose tolerance in diabetic mice, evidence for a therapeutic function for VEGF-B antagonists (Hagberg et al. 2012).

VEGF-C is closely related to VEGF-D with the N- and C-terminal extensions and they are proteolytically spliced into a mature form (Joukov et al. 1996, Kukk et al. 1996). VEGF-C activates VEGFR-3; it has mainly a lymphangiogenic role, but it also possesses some angiogenic properties via VEGFR-2 and it also binds Nrp2 (Lohela et al. 2003). KO mice die at E15.5 due to the absence of lymphatic vasculature, which leads to fluid accumulation in tissues (Karkkainen et al. 2004). This indicates an important role for VEGF-C in embryonic lymphangiogenesis. The lymphatic ECs differentiate but they do not migrate and form the primary lymphatic sacks. A homozygous deletion leads to severe defects in lymphatic vessels. This shows the role of VEGF-C as a chemotactic and survival factor in lymphangiogenesis (Karkkainen et al. 2004). Overexpression of VEGF-C leads to hyperplastic lymphatic vessels (Jeltsch et al. 1997). Inhibition of VEGF-C signal transduction has been effective in preventing lymphatic metastasis of cancer. The stimulation of this pathway can be used in treating lymphedema (Tammela et al. 2005).

Similarly to VEGF-B, PlGF binds to VEGFR-1 and enhances angiogenesis in pathological conditions. PlGF is not needed in embryonic development, since KO-mice are healthy and appear normal (Carmeliet et al. 2001). It is also dispensable in exercise-induced angiogenesis in the heart and muscle (Gigante et al. 2004). This suggests that in healthy adults PlGF is not needed for vasculogenesis or maintenance of vessels. However, PlGF KO-mice show impaired angiogenesis and arteriogenesis in pathological conditions such as tumors and ischemia (Carmeliet et al. 2001, Pipp et al. 2003, Luttun et al. 2002, Rakic et al. 2003). PlGF amplifies VEGF-A mediated angiogenesis via fms-induced tyrosine kinase (Flt-1) and fetal liver kinase (Flk-1) (Carmeliet et al. 2001, Luttun et al. 2002). PlGF also induces collateral growth of blood vessels by recruiting monocytes and by stimulating EC and SMC growth (Pipp et al. 2003, Luttun et al. 2002). PlGF also regulates the interaction between VEGF receptor tyrosine kinases (RTK) amplifying the effects of other VEGF-

9

receptors (Autiero et al. 2003). PlGF has a potential therapeutic use in occlusive atherosclerotic disease. Adenovirus-mediated PlGF transfer in tumor xenografts resulted in growth of vessel lumen, increased inflammatory infiltration and vessel maturation (Tarallo et al. 2010).

VEGF-D (also called c-fos induced growth factor, FIGF) was found by Achen et al. in 1998 (Achen et al. 1998). It is distinguishable from other VEGFs since the VEGF-D has N- and C-terminal extensions, similar to VEGF-C. In addition, it has a central VEGF-homology domain (VHD) and receptor binding domains. In mouse embryo, VEGF-D is expressed widely, but in adults it is abundantly expressed in heart, skeletal muscle, lung, small intestine and colon (Achen et al. 1998, Baldwin et al. 2001, Avantaggiato et al. 1998). VEGF-D is secreted from cells as a full-length homodimer. Proprotein convertases cleave proproteins from both ends of the VHD to form a mature VEGF-D (McColl et al. 2007). The unprocessed VEGF-D binds mainly to VEGFR-3, whereas the mature protein can bind to VEGFR-2 as well. The mature hVEGF-D binds to VEGFR-2 with 290-fold affinity compared to unprocessed VEGF-D and with 40-fold affinity to VEGFR-3 (Stacker et al. 1999). By binding and activating these receptors, the VEGF-D mediates lymphangiogenic and angiogenic effects, respectively. Mouse VEGF-D binds only VEGFR-3 (Baldwin 2001). VEGF-D possesses distinctive functions in different species. The deletion of VEGF-D does not affect lymphatic development (Koch et al. 2009). However, in VEGF-C null mice, the lymphatic vessel sprouting is rescued by exogenous VEGF-D (Karkkainen et al. 2004, Baldwin et al. 2005). VEGF-D can promote metastasis of tumors via the prostaglandin system (Karnezis et al. 2012). Adenoviral VEGF-D overexpression induces efficient angiogenesis in the rabbit hindlimbs and pig myocardium (Rutanen et al. 2004, Rissanen et al. 2003b), showing potential for the use of VEGF-D in ischemic therapy. VEGF-D is also overexpressed in atherosclerotic plaques and has been shown to reduce neointimal growth after arterial injury (Rutanen et al. 2003, Rutanen et al. 2005).

2.2.2 VEGF receptors Originally VEGF binding sites were found on the vascular EC surface but later they were found on monocytes and macrophages. Three main receptors are known that mediate the functions of VEGFs (Figure 2). Each receptor has seven extracellular immunoglobulin (Ig) like domains, one transmembrane domain and a cytosolic tyrosine kinase area with kinase insert domain (Shibuya et al. 1990, Takahashi, Shibuya 2005, Terman et al. 1991). VEGFs also interact with Nrp co-receptors. VEGF-binding causes receptor dimerisation and autophosphorylation leading to intracellular signaling cascades (Figure 2).

VEGFR-1 (Flt-1) was the first RTK that was found to bind VEGF. It binds also PlGF and VEGF-B (Shibuya 2006). In addition to ECs, VEGFR-1 is expressed in many cell types including monocytes, macrophages, vascular SMCs and hematopoietic stem cells, also in different tumor cells (Barleon et al. 1996, Zachary, Gliki 2001, Ishida et al. 2001, Fan et al. 2005). VEGFR-1 inhibits angiogenesis not only in early development but also in adults and it also signals for EC progenitor recruitment (Lyden et al. 2001), EC (Adini et al. 2002) and hematopoietic stem cell survival (Gerber et al. 2002), vascular permeability (Takahashi et al. 2004), monocyte migration (Barleon et al. 1996) and growth factor release (LeCouter 2003). KO mice die at E8.5-9.5 due to excess ECs, disorganized vasculature and obstruction of vascular lumen, pointing to a role in negative regulation of angiogenesis (Gille 2001,

10

Fong et al. 1995, Fong et al. 1999). Half of the embryos lacking the transmembrane- and tyrosine kinase domains die due to vascular malformations, suggesting an important role for VEGFR-1 localization in the membrane (Hiratsuka et al. 2005) Decreased VEGFR-1 expression is related to the formation of hemangiomas (Jinnin et al. 2008). VEGFR-1 is involved in tumor growth and metastasis. The stimulation of VEGFR-1 induces tumor angiogenesis indirectly via monocyte and macrophage activation. These cells migrate into inflammatory lesions and tumors, producing VEGF-A, VEGF-C and cytokines leading to angiogenesis and lymphangiogenesis (Lin et al. 2006, Murakami et al. 2008).

VEGFR-2 (KDR, kinase insert domain containing receptor, Flk-1) is an endothelial RTK that is expressed on ECs and circulating bone marrow derived (BMD) endothelial progenitor cells (Kerbel 2008). It is a crucial player not only in embryonic vascular development, but also in pathologic angiogenesis in tumors. KO mice die between E8.5-9.5 due to impaired hematopoietic and ECs and the lack of a vasculature (Shalaby 1995). VEGFR-2 is the main activator of Raf/Mek/Erk (Takahashi et al. 1992, Takahashi, Ueno & Shibuya 1999) and PI3K- protein kinase B (Akt) pathways, causing EC growth, proliferation, migration, survival and adhesion (Ferrara, Gerber & LeCouter 2003, Kerbel 2008). VEGFR-2 is also a very important regulator of vascular permeability (Shibuya, Claesson-Welsh 2006). Anti-VEGFR-2 antibody has been shown to inhibit primary and metastatic tumor growth in mice, highlighting the major role of VEGFR-2 in tumor angiogenesis (Hicklin, Ellis 2005).

VEGFR-3 (or Flt-4) is similar to VEGFR-1 and -2. It binds the lymphangiogenic VEGF-C and VEGF-D as well as their processed forms and thus is important in vascular development, since KO’s are lethal after E9.5 due to reduced and disorganized EC and remodeling of blood vessels (Dumont et al. 1998). VEGFR-3 is expressed at embryonic primary plexus (Kukk et al. 1996) and later in the lymphatic vessels and endothelium (Kaipainen et al. 1995, Dumont et al. 1998, Pajusola et al. 1992). VEGFR-3 is intensely expressed in heart, kidney and lungs (Kukk et al. 1996) and in vascular ECs during active angiogenesis (Tammela et al. 2008). Overall the expression of VEGFRs is very dynamic. Soluble VEGFR-3 expression leads to the regression of new lymphatic capillaries (Makinen 2001, Karpanen 2006). However, VEGFR-3 antibodies or the VEGFC/D trap affect only new lymphatic vessels, indicating that mature lymphatic vessels are not dependent on VEGFR-3 signalling (Karpanen 2006, Pytowski 2005). VEGFR-3 can also enhance the effects of VEGFR-2 or sustain angiogenesis when VEGFR-2 is inhibited (Tammela et al. 2008).

Nrp-1 and -2 are glycoproteins acting as co-receptors for VEGF. Nrp-1 forms a complex with VEGFR-2, enhancing the binding affinity of VEGF-A164 in mouse (Becker et al. 2005, Xu et al. 2011). Nrp-1 is expressed in arterial cells and takes part in vascular development and angiogenesis (Herzog et al. 2001, Lee et al. 2002) as well as neuronal development (Kawasaki et al. 1999). Nrp-1 null mice have defects in embryonic vascular remodeling and large vessel development (Kawasaki et al. 1999), whereas Nrp2 is mostly expressed in venous cells. It is needed for small lymphatic vessel and capillary formation (Yuan et al. 2002, Herzog et al. 2001). VEGF-B stimulates myocardial angiogenesis and arteriogenesis via Nrp-1 (Lahteenvuo 2009). Blocking of Nrp-1 enhances the effect of bevacizumab in tumor models by reducing the affinity of VEGF for ECs (Pan et al. 2007). The blockade of Nrp-2 inhibits tumoral metastases (Caunt et al. 2008).

11

2.2.3 Other vascular growth factors PDGF-A, -B, -C, and –D are secreted by ECs and SMCs and they recruit mural cells (Lindahl et al. 1997a, Lindahl et al. 1997b). PDGFs are required for co-migration and proliferation of supporting cells of the vasculature (Hellstrom et al. 1999). PDGF-B takes part in maturation, remodeling and stabilization of blood vasculature (Jain 2003). PDGF-BB secreted by ECs recruit pericytes and this stabilizes blood vessels. PDGF-BB binds to heparin sulphate proteoglycans in the ECM (Lindblom et al. 2003). PDGF-B KO-mice are embryonic lethal due to microvascular aneurysms and the lack of pericytes (Hellstrom et al. 2001). Recombinant PDGF-C mobilizes endothelial progenitor cells during ischemia and improves revascularization in ischemic limbs and heart. PDGF-C also induces bone marrow cell differentiation into ECs and SMCs. (Li et al. 2005) However, overexpression of PDGF-C and –D leads to cardiac fibrosis and heart failure (Korpisalo et al. 2008a).

HIF-1α and HIF-2α are transcription factors regulated by hypoxic conditions. They adapt tissue responses to low oxygen tension (Semenza 1999) regulating the expression of genes related to angiogenesis, erythropoiesis, glycolysis and other pathways (Gopfert et al. 1996, Ebert et al. 1996, Takagi, King & Aiello 1998, Forsythe et al. 1996). Hif-1a can activate the migration of endothelial precursors via VEGF induction (Semenza 1999).

The FGF-family consists of 23 members that bind to four tyrosine kinase receptors, which are involved in mediating multiple functions. FGF-1 and -2 are intracellular proteins that function during embryonic vascular formation, however not as a critical factor (Miller et al. 2000). FGF-4 and -5 are secreted proteins which partly function by inducing the VEGF expression in vascular ECs (Rissanen et al. 2003a, Giordano et al. 1996). FGFs are also involved in physiological angiogenesis as well as in tumors (Gille 2001). Antibodies binding FGFs have prevented glioblastoma growth in mice (Ferrara et al. 1992, Takahashi et al. 1991). FGFR-1 activation stimulates EC proliferation, migration and tubule formation (Basilico, Moscatelli 1992). However, FGFs are not involved in neovessel development (Hatva et al. 1995).

Ang1-4 are a family of growth factors that are ligands for Tie1 and -2 receptors (Valenzuela et al. 1999, Davis et al. 1996, Maisonpierre et al. 1997). However, the role of angiopoietins in angiogenesis is somewhat controversial. Under certain conditions, Ang1 functions as a proangiogenic factor by stabilizing blood vessels and protecting them from leakage. Ang1 blocks the redistribution of vascular endothelial cadherin by inhibiting Sarcoma (Src), a tyrosine kinase proto oncogene (Gavard, Patel & Gutkind 2008). Ang2 has a diverse role depending on the environment and the presence of other growth factors, promoting or regressing vessel growth (Maisonpierre et al. 1997, Holash, Wiegand & Yancopoulos 1999). Ang3 and Ang4 can also act context dependently, inhibiting or inducing Tie2 phosphorylation. However, their biological role is unclear (Valenzuela et al. 1999, Lee et al. 2004).

2.3 DISEASES ASSOCIATED WITH VEGFS

Angiogenesis is triggered by hypoxic stimulus in physiological as well as pathological conditions such as ischemia or tumors (Moreno, Purushothaman & Purushothaman 2012). VEGFs are the best characterized angiogenic molecules and used in clinical therapy (Table 1) (Ylä-Herttuala 2007).

12

Table 1. VEGF associated conditions Ligand Receptor Biological function Clinical

manifestation VEGF-A VEGF-A165 VEGF-A145

VEGFR-1, VEGF-R2 Nrp-1, Nrp-2 Nrp-2

Vasculogenesis, angiogenesis, vascular homeostasis and permeability, recruitment of BMD cells

↑Diabetic retinopathy, ↓PAD, ↓CAD

PlGF PlGF152

VEGFR-1 Nrp-1, Nrp-2

Angiogenesis, monocyte migration, recruitment of BMD cells, VEGF-A upregulation

↓Pre-eclampsia ↑ Myeloid leukemia

VEGF-B VEGF-R1, Nrp-1 Angiogenesis, recruitment of BMD cells

↑Type 2 diabetes, ↓Hypertrophic cardiomyopathy

VEGF-C VEGF-R2, VEGF-R3, Nrp-2

Lymphatic development, lymphangiogenesis, angiogenesis

↑Lymphatic metastasis, ↓CAD

VEGF-D VEGF-R2, VEGF-R3 Angiogenesis, lymphangiogenesis ↑Tumors, ↑Lymphatic metastases

BMD = Bone marrow derived, PAD = Peripheral arterial disease, CAD = Coronary arterial disease, ↑↓ High/low expression associating with the disease

2.3.1 Atherosclerosis Atherosclerosis is an inflammatory state of the arterial wall. Chronic inflammation leads to complex lesions that grow towards the arterial lumen and obstruct the blood flow (Libby 2012). The intima grows thicker, thus decreasing the oxygen supply and the inflammatory state consumes more oxygen. This leads to hypoxia that triggers transcriptional processes mediated mainly by HIF-1a, finally leading to upregulation of angiogenic factors (Sluimer, Daemen 2009). The lesions may rupture and form a thrombus, which blocks the circulation completely, causing myocardial infarction, stroke or acute lower limb ischemia. The hypoxic areas in the lesion are characterized by macrophage infiltration and thrombus formation (Sluimer et al. 2008).

2.3.2 Cancer Angiogenesis is a crucial factor in tumor growth, progression and metastasis (Kerbel 2008). When a tumor grows large enough, the central cells do not have adequate amounts of nutrients and oxygen inducing hypoxia in the tumor. This stimulates the production of HIFs, VEGFs, PDGF and NOS, which are upregulated in tumors growing and remodeling the blood and lymphatic vasculature (North, Moenner & Bikfalvi 2005). Tumor vasculature and structure are distinct from normal vessels; leaky, twisted and immature (Hiratsuka 2011). VEGF-A is over-expressed in many types of tumors; colorectal cancer, non-small cell lung cancer and renal cell cancer (Ferrara 2005). VEGF-A may also inhibit anti-tumoral immune response. Since it can stimulate the formation of tumoral blood vessels, VEGF-A promotes tumor growth. VEGF-A also promotes tumor invasiveness by upregulating MMPs (Munaut et al. 2003) In addition, VEGF-B expression is increased in many tumor types (Hanrahan et al. 2003, Gunningham et al. 2001) and the extent of the upregularion correlates with disease stage, vascular invasion, microvascular density and patient survival in

13

different carcinomas (Eggert et al. 2000, Kanda et al. 2008, Mylona et al. 2007, Shintani et al. 2004). VEGF-C and -D induce lymphatic vessel growth and promote tumoral metastasis to lymph nodes (Karnezis et al. 2012, Stacker et al. 2001). VEGF-C also promotes intralymphatic tumor growth (Karpanen 2001), whereas the downregulation of VEGF-C expression inhibits tumor growth and metastasis (Khromova et al. 2011).

Anti-angiogenic factors could disable the oxygen and nutrient supply needed for tumor cells, inhibit sprouting and assembly of unstructured tumor vessels and diminish tumor growth and metastasis. This could restrain the growth of certain tumors. VEGF-A is expressed widely in malignant tumors and is considered to be the most important angiogenic factor. Antibodies targeting VEGF-A or its receptors prevent tumor growth in mice and tumor xenografts (Carmeliet, Jain 2011, Kim et al. 2002, Inai et al. 2004, Zhu et al. 2009). On the contrary, some studies have shown conflicting results via induction of hypoxia and alternate angiogenic pathways. Some studies show that the reduction of tumor vasculature increases tumor metabolism and metastases (Paez-Ribes et al. 2009). Stabile vessels supported by pericytes are resistant to anti-VEGF-A therapy (Erber et al. 2004). Clinical trials have shown only a transient increase in survival of patients with solid tumors treated with antibodies, bevacizumab alone or as part of combination therapy (Sandler et al. 2006, Miller et al. 2007, Presta et al. 1997, Hurwitz et al. 2004). The effect of antiangiogenesis is dependent on the drug dosage and timing of the treatment (Tugues et al. 2011). These findings indicate that the growth of tumors is a complex event with ECs, oxygen and nutrients playing a central role, but other regulatory factors are involved as well.

2.3.3 Lymphatic disorders Abnormal lymphatic development or damage to the lymphatic vessels causes lymphedema, which is a progressive and non-curable disease. The excess interstitial fluid induces inflammatory reactions, causing fibrosis, accumulation of adipose tissue and impaired immune responses and wound healing (Rockson 2001, Warren et al. 2007). Lymphedemas are classified as primary (congenital) or secondary, and can be induced by surgery, trauma, radiotherapy or a parasitic infection. Primary lymphedemas are caused by genetic mutations in crucial lymphatic factors, such as VEGFR-3 (Evans et al. 1999, Connell et al. 2009) and forkhead box protein (FOX) C2 (Fang et al. 2000, Mangion et al. 1999, Brice et al. 2002). In addition, other genes are involved and the outcome in patients is variable. Most lymphedemas worldwide are classified as secondary and are caused by several types of external factors. The most common type is lymphatic filariasis caused a parasitic infection in the lymphatic vessels. The inflammation promotes the production of VEGFs, which eventually leads to hyperplasia and obstruction of lymphatic vessels (Melrose 2002, Pfarr et al. 2009). In the industrialized countries, cancer treatments are the major cause for secondary lymphedema. Tumors frequently form metastases into lymph nodes, which require surgical removal and radiotherapy. This operation may cause problems with the lymphatic flow (Warren et al. 2007).

2.3.4 Disease models Different disease models have been created to study ischemic conditions and tumor angiogenesis and they have been proved to be good tools in clarifying the mechanisms of pathological angiogenesis and studying anti- and pro-angiogenic

14

treatments. In the hindlimb ischemia (HLI) model (Kholova et al. 2007) the femoral artery is usually ligated to induce ischemia in the skeletal muscles. This model makes it possible to study neovascularization and proangiogenic treatments. The method is relatively easy to perform in mice and is reproducible. After the ligation of the artery, new collateral vessels are formed and there is induction of sprouting angiogenesis (Korpisalo et al. 2008b, Koponen et al. 2007). This can be visualized with a variety of methods, including immunohistochemistry or different in vivo imaging methods. The mouse retinal vasculature is also a good model with which to study human retinopathy of prematurity or diabetic retinopathy, that are common complications of diabetes (Kinnunen, Yla-Herttuala 2012, Viita et al. 2009).

2.4 GENERATION OF GENE MODIFIED ANIMALS

2.4.1 Traditional ways of creating transgenic and knockout animals TG, KO and KD methods are now recognized as a valuable research tool in biology. Basically two different approaches can be used to acquire genetically modified animals, either increasing or decreasing gene expression. Genetic material can be delivered via ESCs or into different stage embryos. Plasmids and naked DNA (deoxyribonucleic acid) have been used in gene transfer, however, they proved to be inefficient in vivo. The material can be complementary DNA (cDNA) expressing a desired gene or alternatively, a small RNA that inhibits the expression of the target gene.

In traditional DNA microinjection (MI), a gene construct is injected into the pronucleus of a fertilized oocyte. This was the first effective method devised in mammals (Gordon, Ruddle 1981). The introduced DNA can either cause overexpression of the desired genes or it can silence it. The DNA is introduced randomly into the host genome and the wanted product may not be expressed at all. The fertilized oocyte is transferred into a recipient pseudopregnant female. This method can be applied to a wide variety of species, such as rodents, pigs and avians (Gordon et al. 1980).

In embryonic stem cell (ESC) -mediated gene transfer, the desired DNA sequence is inserted by homologous recombination into ESCs. These cells are incorporated into a blastocyst embryo, finally leading to the birth of a chimeric animal. This is a good method for achieving gene inactivation working especially well in mice (Gordon, Ruddle 1981).

The techniques mentioned above are relatively inefficient, since the probability for obtaining live TG animals is very low. Viruses have been modified for use in gene delivery in an attempt to improve efficiency (Somia, Verma 2000). Retroviruses allow proviral integration into the genome of a host animal (Hofmann et al. 2003). This is an efficient method and requires less oocytes in comparison to most other methods.

2.4.2 Transgenesis, knockout and knockdown methods based on lentiviral gene transfer Lentiviruses (LV) offer some advantages over retroviruses, such as a capacity to transduce quiescent cells. The LV can be injected into the pronucleus of an oocyte, or with a less invasive method into the perivitelline space (Huusko et al. 2008, Tiscornia

15

et al. 2004). The commonly used methods for creating TG, KD and KO animals are listed in Table 2.

The LVs used in transgenesis are usually third-generation self-inactivating (SIN) vectors, to prevent viral replication (Miyoshi et al. 1998, Zufferey et al. 1998). The promoter is chosen according to the study needs; tissue specificity, strength or regulatability. In order to create TG mice, LV containing the desired gene is delivered into perivitelline space of a fertilized oocyte (Huusko et al. 2008). Several of these oocytes are transferred into the oviducts of recipient females. This MI method is demanding and the equipment is expensive. In comparison to other methods, the perivitelline injection (PI) -technique is gentle on the embryos and the integration happens at the one-cell stage, creating non-mosaic animals. However, a high viral titer is needed for the PI-method. The founder mice are analyzed for transgene positivity.

The gene silencing technique involves RNAi, with RNA polymerase III (polIII) promoters human U6 small nuclear promoter (U6) and human H1 (H1) most often being used to express the shRNA. They are very strong ubiquitous promoters and easily fit into expression cassettes and they have been shown to silence gene expression over the long-term in mice (Makinen et al. 2006, Raoul et al. 2005). The first described LV-KD mice was an H1-driven silencing of green fluorescence protein (GFP) expression (Tiscornia et al. 2003). In addition, the U6 promoter has been effectively used to silence CD8 (cluster of differentiation 8) (Rubinson et al. 2003). The shRNA cassette can be inserted into the multiple cloning site (MCS), upstream of the marker gene, or the lentiviral 3’-LTR (long-terminal repeat). Nevertheless, the generation of KD mice with RNA polymerase III (polIII) promoters has proved to be challenging (Carmell et al. 2003, Xia et al. 2006) due to the strong and ubiquitous nature of the promoters. A strong expression of the shRNA may lead to micro RNA (miRNA)-pathway saturation and disturbance in endogenous miRNA function (Grimm et al. 2006). Furthermore, non-specific silencing and inflammatory reactions may occur (Bridge et al. 2003). Regulatable polIII promoters have also been used in attempts to resolve the saturation problem. This has been done with Cre-loxP (bacteriophage P1 Cre recombinase and Lox sequence) systems (Ventura et al. 2004) and with a drug inducible mechanism (Szulc et al. 2006). Recently, polII promoters that mimic the endogenous miRNA structure have been used as a more natural silencing method. The shRNA is expressed as a long pre-miRNA (Zeng, Cai & Cullen 2005) allowing the use of more flexible, controllable and tissue-specific polII promoters (Lee et al. 2004).

16

Table 2. Commonly used methods for creating TG, KD and KO animals. Method Technique Effect Pros Cons

ESC Transfection, Electroporation, viral transduction, Homologous recombination

TG, KD, KO

Selection in cells, locus specific

Chimeras, restricted species, challenging cell culturing, random integration

PIE Microinjection, cytoplasmic injection

TG,KD Gentle for embryos, non-chimerism

Heterogenic founders, Damage to embryo

PI Microinjection TG,KD Gentle for embryos, non-chimerism

Technically demanding, expensive equipment, high viral titer

ZP Viral medium incubation

KD Technically easy Toxic to embryos, mosaic

ESC, Embryonic stem cells (Hogan et al. 1994, Pfeifer et al. 2002); PIE, Preimplantation embryos (Gordon et al. 1980, Haraguchi et al. 2004); PI, Zygote perivitelline injection (Huusko et al. 2008, Tiscornia et al. 2003); ZP, Zona-pellucida denuded embryos (Ikawa et al. 2003).

2.4.3 Gene silencing miRNA are noncoding RNA molecules found in mammals and many other eukaryotes. The precursor miRNAs have a hairpin structure that is processed into a mature form by a Dicer enzyme into 21-23 nucleotide double-stranded (ds) RNA molecules, small interfering RNA (siRNA). In this way one can regulate gene expression specifically through RNAi and related pathways (Hannon 2002, Pasquinelli, Ruvkun 2002, Meister, Tuschl 2004, Hannon, Rossi 2004). The siRNA interacts with RNA-induced silencing complex (RISC) and the sense strand is cleaved by Argonaute 2 (Ago2) (Matranga et al. 2005). The antisense strand guides RISC by sequence homology to the target messenger RNA (mRNA), which is degraded by Ago2, resulting in specific gene silencing (Geiss et al. 2001). A synthetic dsRNA similar to the processed siRNA can achieve a specific gene silencing in mammalian cells without inflammatory response (Elbashir et al. 2001). This finding has led to the widespread use of RNAi in genetic research.

RNAi is an effective tool for functional gene studies compared to the genetic KO method. RNAi is a conserved mechanism that is very sequence specific (Hannon, Rossi 2004). Synthetic siRNA or small hairpin (sh) RNA introduced by a vector can be used to induce the RNAi mechanism. In the shRNA method, an oligonucleotide containing the wanted siRNA sequence following a 9 nucleotide hairpin loop and a complement siRNA sequence is cloned into the vector of choice. When introduced into the cells, the shRNA is expressed and processed via the intracellular processing machinery into siRNA. Synthetic siRNA is quickly diluted and degraded, but the shRNA are produced in the cells and the silencing effect is long-lasting. Different viral vectors have been used to deliver shRNA to cells, and used for a variety of purposes. LVs have been preferred due to their integrative property which achieves long-term expression of shRNA and gene silencing. Viral vectors are effective in gene delivery, but they also have their disadvantages (Van den Haute et al. 2003). There has been some variance in the production of shRNA TG animal models due to

17

a variety of reasons; promoters, vectors, technical performance etc. shRNAs can cause either stable or transient gene silencing.

2.4.4 Viral vectors Viruses have a variety of properties that can be modified to accommodate the specific needs for gene transfer and therapeutic use (Table 3). If one wishes to use a virus as a vector, part of the viral genome is removed, such as structural proteins and enzymes. This strips the virus of its reproductive and infective capabilities. The necessary genetic elements are brought in the viral production step via helper constructs or packaging cell lines, which reduces the risk of generating replication competent viral vectors. The required elements for the desired gene expression are also added. Table 3. Commonly used vectors for gene transfer Vector Pros Cons

Lentivirus Long-term expression Transduction of dividing and quiescent cells Integrating Low immune response

Difficult to produce high-titer vectors Random integration

Adenovirus High capacity High-titer production Efficient transduction, also quiescent cells Wide tropism

Transient expression Immune and inflammatory responses

Adeno-associated virus

Long-term expression Integrating Serotype specific tropism Transduction of dividing and quiescent cells Low immune response

Low capacity Low-titer production Random integration

Retrovirus Easy production Long-term expression Integrating Low immune response

Transduces only dividing cells Random integration Low efficiency

Non-viral vectors Easy production Safety Non-pathogenic

Inefficient (cell entry, instability, degradation) Transient expression

Baculovirus Transduction of dividing and quiescent cells Large capacity Non-pathogenic No replication in mammalian cells

Transient expression Immune and inflammatory responses

Modified from (Rissanen, Yla-Herttuala 2007).

LVs belong to the retroviruses, with a diploid RNA genome inside the viral capsid. They bind to receptors on the cell surface and then the viral capsid with the genome fuses to the cell membrane gaining entry into the cell. Viral RNA is transcribed into ds provirus DNA with a reverse transcriptase enzyme. Provirus-DNA integrates into the host genome and replicates with the cell’s DNA (Panganiban, Fiore 1988, Varmus, Swanstrom 1985). The incubation time of LVs is long (lenti = slow). The infection is long-term and targets several organs. There are five different serotype groups; bovine immunodeficiency virus (BIV), horse, feline (FIV), sheep and primate (HIV 1-3, SRV-1, SIV). Once an individual is infected, the virus is present permanently. LVs integrate into the genome and are able to avoid

18

immune defense, and this makes possible their long-lasting effects (Park et al. 2000, Naldini et al. 1996a).

Vectors have been developed from all types of LVs, but HIV-1 derived have been the most extensively studied. Almost all of the viral sequences have been removed, leaving only essential parts. The transgene is cloned between the LTR-regions to allow it to integrate into the target cell genome. A Psi-sequence, which is immediately adjacent to the LTR, is needed for RNA packaging into viral particles. The viral envelope proteins (Env) are produced in packaging cells. LV vectors are produced with the help of a transfer plasmid including parts of the HIV provirus and three helper plasmids having Rev (regulating viral RNA export to nucleus), packaging construct and Env. These plasmids are transfected into packaging cells to produce the HIV vectors (Dull et al. 1998).

LVs transduce efficiently a variety of cells, including non-dividing cells (Naldini et al. 1996b, Trono 2000). They can be used in highly differentiated cells such as neurons and cardiomyocytes (Naldini et al. 1996b, Naldini 1998, Sakoda et al. 1999). Furthermore, they can even infect cells of the immune system. LVs are able to mutate rapidly if subjected to a host immune response. Integrating vectors may have harmful side-effects due to random integration (Springer et al. 1998). Regulated vector systems would be needed to maintain keep the transgene expression at an optimal level.

2.5 PHENOTYPE ANALYSIS OF GENE MODIFIED ANIMALS

Genetically modified animals are good models for studying human physiology and diseases. One can evaluate the function and the effect of a single gene in a living organism. However, one has to be aware of the effects of genetic background and variability in transgene integration. A transgene does not necessarily model a single disease, rather the effect is more widespread. Changes may affect metabolic pathways with no clear visible signs. In addition, there may be unexpected changes caused by gene modification that may be difficult to discern. Furthermore, most of the acquired diseases such as cardiovascular diseases or cancer are due to abnormal function of many different genes and environmental factors. These issues pose additional challenges to the research.

Gene modification is basically the addition, deletion or alteration of DNA, leading to a change in gene expression. The selection of the background strain is essential, since this will affect the outcome of the transgene effects and also of possible disease phenotypes (Linder 2001). Most inbred strains have been well characterized and changes in the phenotype are relatively easy to detect. For many genes a regulated system should be used in order to avoid lethality due to lack of or constant overexpression of an essential gene. These can be achieved with Cre-loxP or tetracycline-based transgene constructs. This allows the gene expression to be controlled in a time-dependent manner (Dull et al. 1998, Marumoto et al. 2009). The transgene may cause problems in viability or reproduction in a homozygous animal. Alternatively, the wanted phenotype may be visible only in the homozygous animal. In such cases, a breeding strategy should be considered in order to maintain the wanted phenotype (Murray, Parker 2005).

19

3 Aims of the study

The aim of this thesis was to assess the perivitelline injection (PI) as a method for creating TG mice. A secondary aim was to study the biological function of VEGF-D using TG and KO mice.

The specific aims of this thesis were: I To study the efficiency of the PI technique and lentiviral transgenesis. It was also

intended to assess the long-term effects of human VEGF-D expressed under a ubiquitous phosphoglycerate kinase (PGK) promoter.

II To study the effects of hVEGF-D overexpression targeted to endothelium by a mouse Tie1 promoter and to compare the effects of targeted VEGF-D expression to ubiquitous VEGF-D expression.

III To clarify the role and relevance of VEGF-D in vivo, by creating and characterizing mice with lentiviral RNAi-mediated gene silencing of VEGF-D.

20

21

4 Materials and methods

Materials and methods are briefly listed in the Tables 4-8 and Figure 3. More details are described in the original publications (I, II) and a manuscript (III).

4.1 VECTORS

The mature human VEGF-D (hVEGF-DΔNΔC) (Achen et al. 1998) was cloned under the ubiquitous human PGK promoter (Study 1) and an endothelial mouse Tie1 promoter (Study 2) with a lentiviral backbone. shRNA for mouse VEGF-D was cloned under the hU6 promoter for use in study III (Figure 3). The constructs were verified by sequencing analysis. The 293T cells were transfected with cloned plasmids to produce the viruses (Kaikkonen et al. 2009). Viruses were titered by lentiviral capsid protein p24 by enzyme-linked immunoassay (ELISA) and converted into transforming units (TU).

Figure 3. Lentiviral vectors used in PI. The vector backbone contains CMV, cytomegalovirus promoter; U5, 5’ LTR; Ψ, packaging signal; RRE, rev-responsive element; cPPT, central polypurine tract and dU3, deletion in the U3. The TG cassettes contain the human phosphoglycerate kinase (hPGK) promoter (Study I), truncated human VEGF-D (hVEGFDdNdC), woodchuck hepatitis virus pre response element (WPRE), endothelial mouse Tie1 (mTie1) promoter (Study II), human U6 (hU6) promoter (Study III), shRNA against mouse VEGF-D (shVEGFD) and truncated human nerve growth factor receptor (dNGFR) as a marker gene.

Titers of the concentrated LVs are shown in Table 4. The functionality of the viruses was confirmed after transduction and PIs were performed.

22

Table 4. Lentivirus constructs and their viral titers used in the studies Construct Titer 109 TU/ml

PGK-hVEGFD 1.90 Tie1-hVEGFD 1.20 hU6-shVEGFD 1.80

4.2 GENERATION OF TRANSGENIC AND KNOCKDOWN MICE

Female CD2F1 mice (9-12g, 3-5 weeks) were superovulated by administrating intraperitoneally PMSG (5 IU) hormone and 48h later hCG (5 IU) timed with the light cycle. The females were mated with a breeder male to fertilize the eggs. Oocytes were collected from the donor mice. The virus (50-200pL) was injected into the oocyte perivitelline space. The oocytes were grown to the 2-cell stage and transferred to a pseudopregnant CD2F1 mice. The LV-PI method was gentle on the embryo, and thus a high amount of embryos survived to a 2-cell-stage. Although the number of births was very low compared to other methods, it did achieve a high percentage of TG-positive offspring. The efficiency of the LV PI-technique is presented in Table 5. Pups were weaned at 3 weeks and genotyped by polymerase chain reaction (PCR) analysis. The primers used are listed in Table 6. Table 5. Effect of LV PI-transgenesis compared to traditional methods Method Injected

embryos Two-cell stage embryos

Transferred embryos

Births (% from transferred embryos)

Transgenic pups (% from Births)

PIa 635 601 507 19 (4%) 15 (79%)

PIb 622 509 463 160 (35%) 115 (72%)

ZP - - 330 71 (22%) 50 (70%)

ZCI 132 95 95 32 (34%) 24 (75%)

ESC 214 76 56 5 (9%) 1 (20%)

ZPI 257 175 175 20 (11%) 8 (40%)

PIa (mice used in studies I, II and III), Perivitelline injection into zygote (Huusko et al. 2008); PIb (Lois et al. 2002, Punzon et al. 2004, Yang et al. 2007); ZP, Zona pellucida-denuded two-cell stage embryos (Ikawa et al. 2003); ZCI, Zygote cytoplasmic injection (Yang et al. 2007); ESC, Embryonic stem cells (Hogan et al. 1994); ZPI, Zygote pronuclear injection (Gordon, Ruddle 1981). Table 6. DNA oligonucleotides used in genotyping Description Sequence Used in

hVEGF-D Fw TTGCCAGCTCTACCACCAG I, II hVEGF-D Rev TTCATTGCAACAGCCACCAC I, II hU6 Fw GAGGGCCTATTTCCCATGATT III WPRE Rev TCAGCAAACACAGTGCACACC III

23

4.3 TRANSGENE EXPRESSION

Transgene copy numbers were analyzed by Southern blot method from genomic DNA, which was extracted as described (Invitrogen) and digested with AflII (New England Biolabs, Inc) restriction endonuclease. Electrophoresis was used to separate the digested DNA, and it was transferred to a nitrocellulose membrane. Membrane was hybridized with 32P-CTP (cytidine triphosphate) labeled WPRE probe and developed on a film. Quantitative PCR (qPCR) with lentiviral titering kit (SystemBio, LV960B-1) was also used to determine the copy number in study III.

Transgene expression was analyzed from various tissues of the mice. Total RNA was isolated and reverse transcribed into cDNA. qPCR was used for mRNA expression analysis with Assay-on-demand gene expression products (Applied Biosystems) (Table 7). Expression levels were normalized against mouse β-actin control kit (Applied Biosystems).

Table 7. Gene expression assays Gene Taqman® gene expression assay

human VEGF-D ID: Hs01128659_m1 mouse VEGF-D ID: Mm00438963_m1

4.4 ISCHEMIA OPERATIONS

Mice were anesthetized with a Rompun-Ketalar mixture (10 mg/kg xylazine [Rompun], 80 mg/kg ketamine) and the superficial femoral artery was ligated (Kholova et al. 2007). The animals were sacrificed at 1, 2 and 3 week timepoints and their organs perfused with phosphate buffered saline (PBS) so that the relevant tissues could be collected for further analysis. The histological specimens were fixed in paraformaldehyde (PFA), processed and embedded in paraffin. Tissues were snap frozen in liquid nitrogen for DNA and RNA analyses.

4.5 HISTOLOGICAL ANALYSES

The major organs (heart, aorta, lungs, salivary glands, liver, spleen, pancreas, kidneys, testis/ovaries, small intestine, limb muscles, brain and skin) of genetically modified and control mice were sectioned (5 μm), stained with hematoxylin-eosin (HE) and analyzed for major phenotypic changes. A more detailed analysis was conducted by immunostaining with the antibodies listed in Table 8. Avidin biotin complex (ABC) Vectastain Elite staining kit (Vector Laboratories, Burlingame, CA) and diaminobenzene (DAB) (Invitrogen Zymed, San Francisco, CA) were used for immunohistochemistry. Transgene negative littermates were used as controls in the pathological analysis. In the HLI studies, blood and lymphatic capillary density was determined (Kholova et al. 2007) and tissues of intact mice were used as controls. Histological sections were analyzed using the Olympus AX-70 light microscope (Olympus) with AnalySIS Software (Soft Imaging Systems). Malignant and benign tumors were evaluated together with an experienced pathologist (IK).

24

Table 8. Primary antibodies used in immunohistochemical stainings

Antibody Specificity Dilution Supplier

human VEGF-D (AF289) Vascular endothelial growth factor D *

1:100 R&D Systems

mouse VEGF-D (AF469) Vascular endothelial growth factor D

1:50 R&D Systems

CD31 (550274) Endothelium 1:50 BD Biosciences Pharmingen

CD34 (HM1015) Endothelium 1:20 Hycult Biotechnology LYVE-1 (103-PA50AG) Lymphatic endothelium* 1:1000 ReliaTech VEGFR-2 (14-5821) Vascular endothelial growth factor

receptor 2 1:100 eBiosciences

VEGFR-3 (552857) Vascular endothelial growth factor receptor 3

1:50 BD Biosciences

CK (SC 81714) Cytokeratin 1:50 Santa Cruz CK7 (SC 25721) Cytokeratin 7 * 1:50 Santa Cruz Ki-67 (ab6524) Proliferating cells 1:200 Abcam Myeloperoxidase (MAB 3174)

Myeloid cells* 1:30 R&D Systems

Desmin (MA1-80003) Skeletal, cardiac and smooth muscle*

1:200 Fisher Scientific

CD3 (MAB 4841) T-lymphocytes** 1:50 R&D Systems CD45R/B220 (MAB 1217) B-lymphocytes 1:200 R&D Systems Vimentin (SC 7557) Vimentin/mesenchymal cells 1:50 Santa Cruz F4/80 (mcap497) Macrophages 1:25 Serotec

* The use of antigen retrieving citrate buffer, ** Trypsin digestion, hVEGF-D antibody was anti-human, all others were anti-mouse

4.6 PROTEIN EXPRESSION

Tissue lysates and serum samples were collected at the time of sacrifice. Tissue samples were homogenized in T-PER buffer (Pierce Chemical, Rockford, IL). Quantikine immunoassays (human VEGF-D and mouse VEGF-A; R & D Systems, Minneapolis, MN) were used to analyze the hVEGF-D and mVEGF-A protein concentrations from individual mouse samples.

4.7 CLINICAL CHEMISTRY

Serum samples were analyzed using standard clinical chemistry methods (Department of Clinical Chemistry, Kuopio University Hospital and Movet OY, Kuopio) to detect markers for lipid metabolism, liver and kidney function, and tissue damage.

25

4.8 STATISTICAL ANALYSES

Statistics were analyzed with Graph Pad Prism version 4.00 (Graph Pad Software, San Diego, CA). One-way analysis of variance (ANOVA) or unpaired, 2-tailed t-test was used with the analysis with 95% confidentiality for assessment of statistical significance (P < 0.05). The survival curve was analyzed with a nonparametric logrank test (P < 0.05).

26

27

5 Results

5.1 GENERATION OF TG MICE AND VEGF-D EXPRESSION

hVEGF-D overexpressing mice and mVEGF-D KD mice were produced through LV transgenesis. The lentiviral constructs used in PI and comparison are listed in Table 9. In general, a high-percentage (91-100 %) of all injected embryos survived viral MI, but most of the transferred embryos died before birth. A significant proportion, 50-100 % of the born founders were TG positive. Southern blot and qPCR analyses were used to determine the transgene copy numbers. In study I, the studied mice had 1-10 copies of the transgene in the genome. In studies II and III, the copy number was between 1-5. The number of chromosomal integrations was analyzed in study I, and it was found that the provirus had mostly integrated into one chromosome. Two mice derived from the same founder had two integration sites. In all studies, the transgene was transmitted from one generation to the next. Table 9. Lentiviral PI

Construct Injected embryos

Two-cell stage embryos

Transferred embryos

Births Transgenic pups (% of births)

PGK-GFP 98 95 68 6 5 (83.3)

PGK-VEGF-D 145 132 114 4 4 (100)

Tie1-GFP 240 228 192 3 2 (66.7)

Tie1-VEGF-D 22 22 22 2 2 (100)

hU6-shVEGF-D 130 124 111 4 2 (50)

The TG mRNA expression levels varied between mice, as well as between tissues. However, certain tissues such as skeletal muscle and skin had the highest hVEGF-D expressions in all examined generations in studies I (Figure 4) and II with a similar trend being seen in the shVEGF-D mice. In study II, the TG was well expressed in the endothelium. The VEGF-D mRNA was detectable in all analyzed generations, however the expression levels did decline with advanced generations in study II (Figure 5). In study III the mVEGF-D expression levels were generally lower in KD-mice in comparison to controls (Figure 6).

28

Figure 4. Relative hVEGF-D mRNA expressions from the TG-mice in study I revealing the general pattern of TG expression in the different tissues. The same pattern was also observed in studies II (hVEGF-D) and III (mVEGF-D).

Figure 5. The hVEGF-D expression in the Tie1-hVEGFD TG mice. The average expression levels of tissues were grouped by generation. The levels were highest in founder mice and declined in later generations.

29

Figure 6. Relative expression levels of mVEGF-D mRNA by qPCR from KD mice (study III). The mVEGF-D expression levels of transgene negative littermate controls show a significantly higher expression compared to KD mice. *** p < 0.001, ** p < 0.005, * p < 0.05

The level of protein expression of hVEGF-D was measured from tissue lysates (Study I). The expression levels between different generations were similar. No hVEGF-D was detected in TG-negative mouse samples. In serum samples, the hVEGF-D protein concentration varied between 20-700 pg/mL (study I) and 120-160 pg/mL (study II). No mVEGF-D was detected with ELISA in shVEGF-D mice. Markers of lipid metabolism, liver and kidney function, and tissue damage were measured from serum of TG-positive and TG-negative mice (Table 10). Creatinine and glucose levels in study I were significantly lower than those assayed in studies II and III. The level of lactate dehydrogenase (LD) was lower in the TG positive mice in comparison to controls in all studies.

30

Table 10. Clinical chemistry

Marker Study I II III Ctrl

Cholesterol (mmol/L) 1.5 2.1 2.4 2.0 Triglyceride (mmol/L) 1.3 1.5 2.0 1.2 Creatinine (μmol/L) 10.9** 2,3 14.5 14.5 13.5 LD (U/mL) 1.2*1 1.2*1 1.0***1 1.7 Glucose (mmol/L) 6.1***2, **3 11.4 10.6 9.9 HDL (mmol/L) 1.2 ND 0.8 1.1 LDL (mmol/L) 0.15 ND 0.13 0.13 ASAT (U/mL) 0.47*1 ND 0.6 1.1 CK (U/mL) 11*1 ND 12 21 AFOS (U/L) ND 85 109 64

1) vs. Ctrl. 2) vs. II. 3) vs. III. 4) Study II vs. Ctrl. 5) Study III vs. Ctrl. LD = Lactate dehydrogenase HDL = high density lipoprotein, LDL = low density lipoprotein, ASAT = aspartate aminotransferase, CK = Creatinine kinase, AFOS = Alkaline phosphate. * (P < 0.05), ** (P < 0.005), *** (P < 0.001). In study II the endothelium of several tissues was found to be positive for hVEGF-D in the immunohistochemical assessment (Figure 7). CD31 antibody was used to visualize endothelial tissue. Kidney capillaries and glomerulus, skeletal muscle capillaries and endothelium, liver sinusoid endothelium, brain capillaries and skin exhibited an intense TG expression. The endothelium in several other tissues was also positive for the transgene. Lymphatic capillaries were detected with LYVE-1, but there were no differences between the TG mice and the controls.

Figure 7. Immunohistological stainings of TG mouse tissues in study II. hVEGF-D stainings of TG-negative littermate mice (a, e, i). hVEGF-D stainings of mTie1-hVEGF-D TG mice (b, f, j). CD31 endothelial staining of TG mice (c, g, k). Staining controls of TG mice without primary antibody (d, h, l). Bars 100μm. The hVEGF-D and CD31 stainings are from consecutive sections and with higher magnification insets to demonstrate the endothelial specificity of hVEGF-D

31

5.2 HINDLIMB ISCHEMIA MODEL

It was decided to study ischemia and tissue repair in relation to VEGF-D expression levels, due to the angiogenic properties of VEGF-D. Hind limb ischemia was induced in the F1 and F2 TG mice and TG-negative littermates in studies I, II and III. One, two and three weeks after the procedure, the tissues were collected and analyzed in order to evaluate the extent of damage and regeneration. The ubiquitously expressed hVEGF-D significantly reduced the damage area and enhanced tissue regeneration (Figure 8). Tissue damage and regeneration were also assessed by morphometrical techniques by measuring the active regeneration areas recovering from ischemia. Overall between 4-15 % of the total muscle areas in TG mice had been damaged, but in the TG-negative controls it was substantially higher, 35-89 %. The active regeneration areas were generally larger in the ischemic muscle of TG mice as compared with the TG-negative controls. In study II, the ischemia operation performed on F1 and F2 TG and negative control mice had no effect on muscle regeneration or on the hVEGF-D mRNA expression level. The capillary number of skeletal muscles was counted as a way of assessing the tissue regeneration capacity, but no significant differences were found between the studied groups.

hVEGF-D protein was detected with ELISA from liver and muscle extracts. Non-ischemic F0-F3 TG mice had hVEGF-D concentrations between 120-160 pg/ml (Study II). The mice with ischemia displayed elevated hVEGF-D protein levels in their skeletal muscles, however, this increase was not significantly different from the levels in unoperated TG-mice. The ELISA antibody used is specific for human VEGF-D and should not recognize the mouse protein.

The overexpression of hVEGF-D on vascularity was measured in intact skeletal muscle and myocardium by capillary staining (Figure 9). CD34 and CD31 antibodies were used to detect capillaries. Capillary density was increased in TG mice compared to TG-negative controls. No enhanced lymphangiogenesis was seen by LYVE-1 immunohistochemistry. A higher number of capillaries was detected in the intact hindlimb muscles and in myocardium in TG-positive mice compared to TG-negative controls.

32

Figure 8. Study I, Skeletal muscle 7 days after HLI. HE-stained musculus caput gastrocnemius. a) TG mice showing increased regeneration with eosinophilic cytoplasm and internalized nuclei. Bar 200 μm. b) TG-negative littermates showing a large necrotic area (*). Also early regeneration shown by small basophilic myocytes (#). Bar 200 μm.

Figure 9. Blood and lymphatic capillary density in VEGF-D overexpressing mice and negative controls shown by CD34, CD31, and LYVE-1 stainings, study I. (a) Skeletal muscle from a TG mouse showed increased capillary density compared to the control (b). As a comparison, the capillaries were stained with CD31 with similar results being seen (c and d). Lymphatic vessels were detected in the interstitium as well as in the venules and arterioles in TG mice (e) and negative controls (f) with LYVE-1. Bars in panels a-f = 100 μm. (g) Capillaries / myocyte of intact skeletal muscle of hVEGFD TG mice and the TG-negative controls. (h) Capillary density in myocardium of the hVEGF-D TG-positive and the TG-negative littermates. Error bars represent ± SD.

33

5.3 TUMOR FORMATION

The aging TG mice developed malignant tumors in study I; Eight tumors were detected, half of them being mammary adenocarcinomas. In addition, lung adenocarcinomas and skin carcinomas were found, but no lymphatic malignancies were detected. Mice produced with LV-transgenesis with the same vector backbone, but with a different transgene (GFP and hNrf2, nuclear factor-like 2) did not develop any tumors. The TG-negative littermates did not develop tumors during the follow up time. The mice were descendants of two founders, implying that the viral integration site was not the source of the tumors. Most of the mammary adenocarcinomas were poorly differentiated. One mouse had also metastases in the lungs. The hVEGF-D was expressed in the ductal surface of the tumor, not in the solid areas. Most tumors were actively angiogenic. Lung adenocarcinomas were differentiated and they displayed hVEGF-D expression in papillary and stroma of the papilla stalk. The anaplastic skin carcinoma showed evidence of angiogenesis and it was focally hVEGF-D positive. hVEGF-D mRNA was detected in all tumors. The mortality rates of TG mouse were increased due to these tumors (Figure 10).

The TG-mice in study II revealed the formation of benign and malignant tumors in all studied generations (F0-F5), whereas the TG-negative littermates did not form tumors during the 25 month follow-up. The mice had originated from two founders indicating that the TG itself, not the integration site, was causing the tumors. Malignant tumors were found widely in different organs (Table 11). The general tumor histology from mammary gland carcinoma and hepatocellular carcinomas are presented in Figure 11. Benign tumors were found in the liver. Other pathological changes were also detected, such as cellular proliferation in kidney and spleen, dilated sinuses in the liver and peliosis in liver and spleen. Several metastases were observed and although there were vascular changes, no vascular tumors were detected.

In study III a variety of tumor types also occurred not only in the KD mice, but also from in negative littermate controls. The tumors were benign tumors, malignant carcinomas and B-cell lymphomas. One anaplastic carcinoma displayed some necrosis and intratumoral angiogenesis, but no lymphangiogenesis. A benign skin angiolipoma showed CD31 positivity only in pre-existing vessels. In addition, some non-tumoral changes were found, such as ovarian haemorrhagic cysts and spleen hemosiderin deposits. Four KD mice had a staggering gait and generally were in poor condition, two were small in size and suffered difficulties in moving. The pathological findings are summarized in Table 12.

34

Figure 10. Mortality from tumors, Kaplan-Meyer curves showing the TG and KD mice survival in studies I, II and III as compared to negative littermate controls.

Figure 11. General tumor histology. a) Dedifferentiated mammary gland carcinoma, mainly solid areas with a few luminal formations. Bar 50 μm. b) Partially necrotic dedifferentiated hepatocellular carcinoma. Bar 200 μm.

35

Table 11. Histopathological characterization of tumors in study II Character of the pathological changes

Tissue/Organ Tumor type / Tissue change Generation

Malignant tumors Lung Adenocarcinoma F1, F3 Kidney

Dedifferentiated carcinoma, metastases in liver and pancreas

F3

Liver

Dedifferentiated hepatocellular carcinoma, metastases in lung

F4

Mammary gland Dedifferentiated adenocarcinoma, metastases widely

F4, F5

Lymph nodes Diffuse lymphoma, extranodally spread widely

F5

Benign tumors Liver Hepatoma (adenoma) F2, 2 x F3

Table 12. Pathological findings in study III Malignant tumors Age at death (months) Generation Small B-cell lymphoma 24 F2, F3 Skin carcinoma 10 F5 Hepatocellular carcinoma 17 F5 Uterine and lung adenocarcinomas (Ctrl) 20 F4, F5 Benign tumors Skin angiolipoma 10 F2 Non-tumoral pathology Staggering and poor health 11 - 24 3 x F1, F2 Stunted, size 1/3 of normal, difficulties in moving 0,5 - 4 2 x F1 Haemorrhagic cyst and peliosis in spleen 24 F3 Heart hypertrophy and calcification 24 F3 Liver steatosis 20 - 24 2 x F5 Focal spleen fibrosis 24 F5 Dilated blood vessels in kidney cortex 4 F5 Skin rashes, hairless spots (Ctrl) 7 F5 Heart hypertrophy (Ctrl) 19 F5 Reactive lymphoid hyperplasia (Ctrl) 16 - 18 F5 Reactive lymphoid hyperplasia (Ctrl) 18 F5 Edema and emphysema in lungs (Ctrl) 19 F5

36

37

6 Discussion

Before VEGFs can be used in clinical therapies, it is essential to achieve a more profound understanding for their physiological function as well as their pathological properties (Yla-Herttuala 2009). VEGF-D has been mainly linked to abnormal angiogenesis and lymphangiogenesis, and it is believed to be involved in several pathological changes, such as tumor formation. Adenoviral gene transfer of VEGF-D has induced angiogenesis as well as vascular enlargement and permeability (Rissanen et al. 2003b, Anisimov et al. 2009). However, evidence for these involvements were not found in the KO mice, i.e. VEGF-D KO mice did not exhibit any clear phenotypic pattern (Baldwin et al. 2005, Haiko et al. 2008). Mice with skin specific expression of the full-length VEGF-D exhibited hyperplastic lymphatic vessels in the skin, but no angiogenesis (Veikkola et al. 2001). The present TG mouse models with mature hVEGF-D did display angiogenic effects, enhanced muscle regeneration and tumor formation.

The lentiviral PI method was used to create TG mice. This technique proved to be efficient since the PI is able to bypass many of the flaws encountered with other traditional methods such as damage to the oocyte or inefficient transduction. In plasmid MI, the oocyte membrane is pierced in order to allow the transgene plasmid to gain access to the pronucleus. In an alternative LV-method, the zona pellucida protecting the oocyte is removed, which often damages the oocyte and results in a greater loss of embryos (Lois et al. 2002). The resulting mice are likely to be mosaic, since transduction is conducted at the two or four-cell stage (Singer et al. 2006). With direct microinjection, the transgene becomes integrated into every cell of the embryo, since transduction is conducted at the one-cell stage, producing genetically homogeneous animals. These founders are more likely to show the full phenotype due to gene KD or overexpression. This technique also achieves a good transgenesis rate and most embryos (85-100 %) survive in to the two-cell stage, whereas pronuclear (Gordon, Ruddle 1981) and cytoplasmic (Yang et al. 2007) injection methods have less (70 %) two-cell stage embryos. The LV PI-method produced a high number of TG founder animals, in all 79 % of the born pups were TG-positive. The KD method with RNAi is faster than the total KO mice, where both gene alleles have to be removed. It is also efficient even if there is only a single copy of the vector in the genome. Gene KD can be used with genes that are needed in embryonic development or otherwise essential.

It was decided to determine whether the LV-mediated TG overexpression would endure through consecutive generations and also to determine the long-term effects of the transgene. Therefore TG-mice from F0 to F5 generations were examined up to 2-years of age. In the PGK-hVEGFD mice the TG was integrated into a non-methylated site since expression was detected over the long term and up to the F5 generation. In the Tie1-hVEGFD mice, the TG was expressed widely in many tissues and the TG expression profile in tissues was similar to that found in study I. The similar hVEGFD mRNA expression levels may correlate with the gene function in different tissues. However, in the endothelial-specific model, the mRNA expression levels did decline in advancing generations, possibly due to site-specific methylation or to some other mechanism. However, the cause of this decline was not studied in

38

this thesis. In shVEGFD mice, the TG-copy numbers were low, approximately the same in all studied mice, so no correlation could be calculated between the copy number and VEGF-D expression or the pathological findings obtained. In general the KD mice bred poorly and the number of living KD pups was low. Some of the KD mice were small with a staggering gait and they had other neurological problems. This might be evidence of the importance of VEGF-D during embryonic development e.g. a low amount of VEGF-D may be harmful to the embryo with its deficiency being poorly compensated. Perhaps the high-copy number mice were aborted early and only the mice with low copy-numbers survived. The vector copy number and embryonic survival could correlate with functional VEGF-D protein levels, however, from the KD-mice VEGF-D protein was not detected with ELISA. Even low-copy numbers of the vector were adequate to silence the gene product to undetectable levels. Compensatory mechanisms may only partially substitute for the lack of VEGF-D. However, these results are partly in conflict with previous KO models that observed no major function for VEGF-D (Koch et al. 2009, Baldwin et al. 2005, Haiko et al. 2008). This may point to a different mechanism with the present model, such as saturation of RNAi machinery. The VEGF-D overexpressing mice developed normally, they were fertile and generally healthy. This suggests that the transgene did not have any major effect on the developing embryo.

LV constructs were used that produce the processed and functional form of hVEGF-D in TG-mice, not the full-length protein. The processed hVEGF-D binds almost exclusively to the angiogenic VEGFR-2, whereas the full-length and processed mVEGF-D binds to VEGFR-3 and thus promotes lymphangiogenesis (Achen et al. 1998, Baldwin 2001). In order to create a VEGF-D KD-mouse, an shRNA specific for both the full-length and processed forms of VEGF-D was used. These VEGF-D KD mice showed no effect on blood capillary density or regeneration after hindlimb ischemia. This supports the consept that VEGF-D in mice is mainly a lymphangiogenic growth factor. A study with VEGF-D KO-mice (Baldwin et al. 2005) revealed no major effects on lymphangiogenesis or angiogenesis. This was explained with the minor lymphangiogenic role of VEGF-D during embryonic development or compensatory mechanisms. Another VEGF-D KO study did detect reduced peritumoral lymphangiogenesis and metastasis (Koch et al. 2009) The KD mice in this study had diverse problems, which may be explained at least partly by the disturbance of RNAi machinery. Exogenous siRNAs can stimulate immune responses by interferon induction, reducing siRNA activity and evoking unwanted side effects (Fish, Kruithof 2004, Sledz et al. 2003).

The mature form of VEGF-D is thought to be mainly angiogenic via VEGF-R2 (Baldwin 2001). In study I, an increased number of blood capillaries in skeletal muscle and myocardium was found, when comparing TG-positive and TG-negative littermates. In addition, regeneration after HLI was faster and injury areas smaller due to VEGF-D overexpression. These results are in line with previous findings (Rissanen et al. 2003b, Kholova et al. 2007). Acute inflammation in the ischemic tissue may promote the local expression of VEGFs. On the contrary, VEGF-D can reduce the inflammatory reaction by activating lymphatic vessels (Huggenberger et al. 2011). Study II did not detect any intense angiogenesis or muscle regeneration after HLI. This is probably because the VEGF-D is expressed only in the endothelium and the effective protein levels are much lower compared to those obtained in the ubiquitous model. The hVEGF-D protein level was slightly elevated in skeletal muscle after ischemia. The silencing of VEGF-D did not have any effect on blood

39

capillary density or regeneration after HLI. Therefore the role of VEGF-D in normal physiology remained somewhat unclear, however when overexpressed, it appeared to function as an angiogenic factor. The VEGF-D protein levels measured from tissue lysates were highest in study I (general overexpression), 4-7 times lower in study II (endothelial overexpression) and in study III (KD) the mVEGF-D protein was undetectable. The VEGF-D levels in the endothelium-specific model seemed to be too low to induce angiogenesis or to enhance ischemic recovery. This suggests that the expression of VEGF-D needs to be sufficiently high to exert a positive effect in ischemic tissues. In study II hVEGF-D and CD31 immunostainings were compared in an attempt to demonstrate the endothelial specificity of the Tie1 promoter. Different tissues were stained with hVEGF-D antibody for detection of the transgene, which was well expressed in the vascular endothelia of several tissues.

TG-mice developed tumors upon aging, however, the tumor profiles were different. The ubiquitously expressed VEGF-D promoted a high proportion of mammary gland adenocarcinomas, but also lung and skin carcinomas were detected. In humans, VEGF-D overexpression has been associated with breast cancer and metastases (Wang, Chen & Anderson 1998, Wang et al. 2012, Zhao et al. 2012), which supports our results and points to a pathogenic role for VEGF-D. The morphology of collecting lymphatic vessels is partly modulated by VEGF-D, promoting metastases. This can be reduced by anti-inflammatory drugs (Karnezis et al. 2012). Other blood- or lymphatic vessel malignancies were not detected in this study. There was angiogenesis within the tumors, but no lymphangiogenesis was found. The TG-mice in study II showed also benign and malignant tumors in various organ systems, however the tumor profile was different from thath observed in study I. This could be explained with the endothelial expression that guides the VEGF-D expression to different tissues compared to the ubiquitously expressed model. The mice in both studies originated from two founders implying that perhaps the TG itself, not the integration site, was responsible for the tumors. This mouse strain (CD2F1) does not form tumors spontaneously (Harlan Laboratories 2008), and therefore there has to be some other explanation. The TG or perhaps the LV itself could have a role in the tumorigenesis. However, in other LV-TG mice produced in our group, no early deaths or malignancies have been detected (unpublished). LVs are able to transduce several tissues in vivo, such as hematopoietic cells (Miyoshi et al. 1999), cardiomyocytes (Fleury et al. 2003) and neural cells (Naldini et al. 1996b). LV mediated gene expression is normally not silenced during embryonic development, which enables the use of LVs for the generation of TG animals (Pfeifer et al. 2002).

LV-mediated RNAi strategies to KD genes in vitro (Abbas-Terki et al. 2002, An et al. 2003) and in vivo (Tiscornia et al. 2003) have been described. The hU6 promoter efficiently expressed shRNA and thus achieved LV-mediated gene KD. The mVEGF-D mRNA and protein were downregulated, meaning that the silencing was done via the classical RNAi pathway. In addition, the immunohistological staining revealed that the mVEGFD was effectively silenced in different tissues. Most PolIII based promoters are efficient achieving a long-lasting silencing, as was shown in vitro (Makinen et al. 2006). However, the strong expression may saturate the RNAi pathway and lead to unwanted off-target effects. RNAi can also cause some toxic effects and activate interferon responses (Fish, Kruithof 2004, Sledz et al. 2003). U6 vectors trigger an intense interferon response as compared to other silencing vectors. This could be avoided with preserving the wild-type sequence around the

40

transcription start site (Pebernard, Iggo 2004) or with regulatable vectors. The present LV-RNAi system did not induce any detectable interferon response in vitro (Makinen et al. 2006). LV-mediated RNAi is an effective technique for achieving gene silencing in vivo. Recently, shRNAs have been efficiently used for gene silencing in vitro as well as in vivo mainly in tumor models, resulting in inhibition of tumor survival signals (Zuo et al. 2012, Ray et al. 2012, Zhong et al. 2011). However, in the future, models with regulatable constructs, such as Tet on/off must be considered.

The LV PI-method proved to be an efficient method for creating genetically modified mice. However, it is technically demanding, requires a high viral titer and the majority of the embryos die before birth. Study I showed that overexpressed VEGF-D significantly increased angiogenesis in skeletal muscles and myocardium, and improved muscle recovery from ischemic damage. In addition, tumor formation was increased, mostly mammary gland adenocarcinomas. With the right tools, VEGF-D overexpression could be used as a therapy for ischemic conditions, however, when expressed over the long-term, it may promote malignant transformation. Endothelially-targeted therapy could be very useful in the clinic for treating vascular diseases, but as shown in study II, the endothelially-targeted overexpression of VEGF-D did not improve tissue recovery from ischemic damage. However, the Tie1-promoter was able to efficiently target the expression to the endothelium. The shRNA-mediated KD of VEGF-D effectively silenced the target gene, proving the feasibility of this technique. However, the mice had a variety of phenotypes and the major problem might be the combination of a strong U6 promoter and an unregulatable vector. When combined with the latest sophisticated tools, shRNA can be viewed as a feasible method to downregulate genes in vivo.

41

7 Conclusions

The following conclusions were made based on the studies I The PGK-hVEGF-D TG mice showed a significantly increased angiogenesis in

skeletal muscles and myocardium, and less muscle damage after hindlimb ischemic injury when compared with the TG-negative controls. However, the incidence of tumor formation was significantly increased in the TG mice, especially the development of mammary gland adenocarcinomas.

II Endothelial expression of hVEGF-D revealed that targeted unregulated long-term

expression of hVEGF-D in endothelium increased tumor frequency and predisposed the animals to other pathological conditions. Therefore unregulated expression is hazardous and can reduce the life span of TG mice. Thus endothelially-targeted expression does not appear to be adequate for the treatment of ischemic tissues.

III Silencing of endogenous VEGF-D in mice caused the growth of a variety of

tumors and other malignancies, also in control mice. These results suggest that in addition to actual gene silencing, some other mechanism is disturbing the normal physiology, such as the RNAi system. The results presented in this thesis indicate that the perivitelline injection method used with lentiviruses is a feasible way of creating transgenic mice. Although technically demanding and laborious, it is an efficient method. In the clinic VEGF-D could be used in treatment of ischemic conditions, however, the approach must be made more sophisticated, targeted and controlled. In the future, the role of VEGFs in non-vascular cells needs to be clarified. In addition, a better understanding of endothelial function in vascular development and organogenesis could help explain the formation of several serious pathological conditions such as atherosclerosis and cancer.

42

43

8 References

Abbas-Terki, T., Blanco-Bose, W., Deglon, N., Pralong, W. & Aebischer, P. 2002, "Lentiviral-mediated RNA interference", Human Gene Therapy, vol. 13, no. 18, pp. 2197-2201.

Achen, M.G., Jeltsch, M., Kukk, E., Makinen, T., Vitali, A., Wilks, A.F., Alitalo, K. & Stacker, S.A. 1998, "Vascular endothelial growth factor D (VEGF-D) is a ligand for the tyrosine kinases VEGF receptor 2 (Flk1) and VEGF receptor 3 (Flt4)", Proceedings of the National Academy of Sciences of the United States of America, vol. 95, no. 2, pp. 548-553.

Adams, R.H. 2003, "Molecular control of arterial-venous blood vessel identity", Journal of anatomy, vol. 202, no. 1, pp. 105-112.

Adini, A., Kornaga, T., Firoozbakht, F. & Benjamin, L.E. 2002, "Placental growth factor is a survival factor for tumor endothelial cells and macrophages", Cancer research, vol. 62, no. 10, pp. 2749-2752.

An, D.S., Xie, Y., Mao, S.H., Morizono, K., Kung, S.K. & Chen, I.S. 2003, "Efficient lentiviral vectors for short hairpin RNA delivery into human cells", Human Gene Therapy, vol. 14, no. 12, pp. 1207-1212.

Ando, J. & Yamamoto, K. 2009, "Vascular mechanobiology: endothelial cell responses to fluid shear stress", Circulation journal : official journal of the Japanese Circulation Society, vol. 73, no. 11, pp. 1983-1992.

Anisimov, A., Alitalo, A., Korpisalo, P., Soronen, J., Kaijalainen, S., Leppanen, V.M., Jeltsch, M., Yla-Herttuala, S. & Alitalo, K. 2009, "Activated forms of VEGF-C and VEGF-D provide improved vascular function in skeletal muscle", Circulation research, vol. 104, no. 11, pp. 1302-1312.

Autiero, M., Luttun, A., Tjwa, M. & Carmeliet, P. 2003, "Placental growth factor and its receptor, vascular endothelial growth factor receptor-1: novel targets for stimulation of ischemic tissue revascularization and inhibition of angiogenic and inflammatory disorders", Journal of thrombosis and haemostasis : JTH, vol. 1, no. 7, pp. 1356-1370.

Avantaggiato, V., Orlandini, M., Acampora, D., Oliviero, S. & Simeone, A. 1998, "Embryonic expression pattern of the murine figf gene, a growth factor belonging to platelet-derived growth factor/vascular endothelial growth factor family", Mechanisms of development, vol. 73, no. 2, pp. 221-224.

44

Baldwin, M.E. 2001, "The specificity of receptor binding by vascular endothelial growth factor-D is different in mouse and man", Journal of Biological Chemistry, vol. 276, pp. 19166-19171.

Baldwin, M.E., Halford, M.M., Roufail, S., Williams, R.A., Hibbs, M.L., Grail, D., Kubo, H., Stacker, S.A. & Achen, M.G. 2005, "Vascular Endothelial Growth Factor D Is Dispensable for Development of the Lymphatic System", Molecular and cellular biology, vol. 25, no. 6, pp. 2441-2449.

Baldwin, M.E., Roufail, S., Halford, M.M., Alitalo, K., Stacker, S.A. & Achen, M.G. 2001, "Multiple Forms of Mouse Vascular Endothelial Growth Factor-D Are Generated by RNA Splicing and Proteolysis", Journal of Biological Chemistry, vol. 276, no. 47, pp. 44307-44314.

Banerjee, S. & Kaye, S.B. 2012, "Gynecological cancer: First-line bevacizumab for ovarian cancer--new standard of care?", Nature reviews.Clinical oncology, vol. 9, no. 4, pp. 194-196.

Barleon, B., Sozzani, S., Zhou, D., Weich, H.A., Mantovani, A. & Marme, D. 1996, "Migration of human monocytes in response to vascular endothelial growth factor (VEGF) is mediated via the VEGF receptor flt-1", Blood, vol. 87, no. 8, pp. 3336-3343.

Basilico, C. & Moscatelli, D. 1992, "The FGF family of growth factors and oncogenes", Advances in Cancer Research, vol. 59, pp. 115-165.

Bates, D.O., Catalano, P.J., Symonds, K.E., Varey, A.H., Ramani, P., O'Dwyer, P.J., Giantonio, B.J., Meropol, N.J., Benson, A.B. & Harper, S.J. 2012, "Association between VEGF Splice Isoforms and Progression-Free Survival in Metastatic Colorectal Cancer Patients Treated with Bevacizumab", Clinical cancer research : an official journal of the American Association for Cancer Research, .

Becker, P.M., Waltenberger, J., Yachechko, R., Mirzapoiazova, T., Sham, J.S., Lee, C.G., Elias, J.A. & Verin, A.D. 2005, "Neuropilin-1 regulates vascular endothelial growth factor-mediated endothelial permeability", Circulation research, vol. 96, no. 12, pp. 1257-1265.

Bellomo, D. 2000, "Mice lacking the vascular endothelial growth factor-B gene (Vegfb) have smaller hearts, dysfunctional coronary vasculature, and impaired recovery from cardiac ischemia", Circulation research, vol. 86, pp. E29-E35.

Bergers, G. & Song, S. 2005, "The role of pericytes in blood-vessel formation and maintenance", Neuro-oncology, vol. 7, no. 4, pp. 452-464.

Braghiroli, M.I., Sabbaga, J. & Hoff, P.M. 2012, "Bevacizumab: overview of the literature", Expert review of anticancer therapy, vol. 12, no. 5, pp. 567-580.

45

Brice, G., Mansour, S., Bell, R., Collin, J.R., Child, A.H., Brady, A.F., Sarfarazi, M., Burnand, K.G., Jeffery, S., Mortimer, P. & Murday, V.A. 2002, "Analysis of the phenotypic abnormalities in lymphoedema-distichiasis syndrome in 74 patients with FOXC2 mutations or linkage to 16q24", Journal of medical genetics, vol. 39, no. 7, pp. 478-483.

Bridge, A.J., Pebernard, S., Ducraux, A., Nicoulaz, A.L. & Iggo, R. 2003, "Induction of an interferon response by RNAi vectors in mammalian cells", Nature genetics, vol. 34, no. 3, pp. 263-264.

Buschmann, I.R., Hoefer, I.E., van Royen, N., Katzer, E., Braun-Dulleaus, R., Heil, M., Kostin, S., Bode, C. & Schaper, W. 2001, "GM-CSF: a strong arteriogenic factor acting by amplification of monocyte function", Atherosclerosis, vol. 159, no. 2, pp. 343-356.

Carmeliet, P. 1996, "Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele", Nature, vol. 380, pp. 435-439.

Carmeliet, P. & Jain, R.K. 2011, "Principles and mechanisms of vessel normalization for cancer and other angiogenic diseases", Nature reviews.Drug discovery, vol. 10, no. 6, pp. 417-427.

Carmeliet, P., Moons, L., Luttun, A., Vincenti, V., Compernolle, V., De Mol, M., Wu, Y., Bono, F., Devy, L., Beck, H., Scholz, D., Acker, T., DiPalma, T., Dewerchin, M., Noel, A., Stalmans, I., Barra, A., Blacher, S., Vandendriessche, T., Ponten, A., Eriksson, U., Plate, K.H., Foidart, J.M., Schaper, W., Charnock-Jones, D.S., Hicklin, D.J., Herbert, J.M., Collen, D. & Persico, M.G. 2001, "Synergism between vascular endothelial growth factor and placental growth factor contributes to angiogenesis and plasma extravasation in pathological conditions", Nature medicine, vol. 7, no. 5, pp. 575-583.

Carmell, M.A., Zhang, L., Conklin, D.S., Hannon, G.J. & Rosenquist, T.A. 2003, "Germline transmission of RNAi in mice", Nature structural biology, vol. 10, no. 2, pp. 91-92.

Caunt, M., Mak, J., Liang, W.C., Stawicki, S., Pan, Q., Tong, R.K., Kowalski, J., Ho, C., Reslan, H.B., Ross, J., Berry, L., Kasman, I., Zlot, C., Cheng, Z., Le Couter, J., Filvaroff, E.H., Plowman, G., Peale, F., French, D., Carano, R., Koch, A.W., Wu, Y., Watts, R.J., Tessier-Lavigne, M. & Bagri, A. 2008, "Blocking neuropilin-2 function inhibits tumor cell metastasis", Cancer cell, vol. 13, no. 4, pp. 331-342.

Chan-Ling, T., Page, M.P., Gardiner, T., Baxter, L., Rosinova, E. & Hughes, S. 2004, "Desmin ensheathment ratio as an indicator of vessel stability: evidence in normal development and in retinopathy of prematurity", The American journal of pathology, vol. 165, no. 4, pp. 1301-1313.

46

Chung, A.S. & Ferrara, N. 2011, "Developmental and pathological angiogenesis", Annual Review of Cell and Developmental Biology, vol. 27, pp. 563-584.

Connell, F.C., Ostergaard, P., Carver, C., Brice, G., Williams, N., Mansour, S., Mortimer, P.S., Jeffery, S. & Lymphoedema Consortium 2009, "Analysis of the coding regions of VEGFR3 and VEGFC in Milroy disease and other primary lymphoedemas", Human genetics, vol. 124, no. 6, pp. 625-631.

Coultas, L., Chawengsaksophak, K. & Rossant, J. 2005, "Endothelial cells and VEGF in vascular development", Nature, vol. 438, no. 7070, pp. 937-945.

Davis, S., Aldrich, T.H., Jones, P.F., Acheson, A., Compton, D.L., Jain, V., Ryan, T.E., Bruno, J., Radziejewski, C., Maisonpierre, P.C. & Yancopoulos, G.D. 1996, "Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning", Cell, vol. 87, no. 7, pp. 1161-1169.

De Spiegelaere, W., Casteleyn, C., Van den Broeck, W., Plendl, J., Bahramsoltani, M., Simoens, P., Djonov, V. & Cornillie, P. 2012, "Intussusceptive angiogenesis: a biologically relevant form of angiogenesis", Journal of vascular research, vol. 49, no. 5, pp. 390-404.

Dickson, M.C., Martin, J.S., Cousins, F.M., Kulkarni, A.B., Karlsson, S. & Akhurst, R.J. 1995, "Defective haematopoiesis and vasculogenesis in transforming growth factor-beta 1 knock out mice", Development (Cambridge, England), vol. 121, no. 6, pp. 1845-1854.

Djonov, V., Schmid, M., Tschanz, S.A. & Burri, P.H. 2000, "Intussusceptive angiogenesis: its role in embryonic vascular network formation", Circulation research, vol. 86, no. 3, pp. 286-292.

Dull, T., Zufferey, R., Kelly, M., Mandel, R.J., Nguyen, M., Trono, D. & Naldini, L. 1998, "A third-generation lentivirus vector with a conditional packaging system", Journal of virology, vol. 72, no. 11, pp. 8463-8471.

Dumont, D.J., Jussila, L., Taipale, J., Lymboussaki, A., Mustonen, T., Pajusola, K., Breitman, M. & Alitalo, K. 1998, "Cardiovascular Failure in Mouse Embryos Deficient in VEGF Receptor-3", Science, vol. 282, no. 5390, pp. 946-949.

Ebert, B.L., Gleadle, J.M., O'Rourke, J.F., Bartlett, S.M., Poulton, J. & Ratcliffe, P.J. 1996, "Isoenzyme-specific regulation of genes involved in energy metabolism by hypoxia: similarities with the regulation of erythropoietin", The Biochemical journal, vol. 313 ( Pt 3), no. Pt 3, pp. 809-814.

47

Eggert, A., Ikegaki, N., Kwiatkowski, J., Zhao, H., Brodeur, G.M. & Himelstein, B.P. 2000, "High-level expression of angiogenic factors is associated with advanced tumor stage in human neuroblastomas", Clinical cancer research : an official journal of the American Association for Cancer Research, vol. 6, no. 5, pp. 1900-1908.

Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. & Tuschl, T. 2001, "Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells", Nature, vol. 411, no. 6836, pp. 494-498.

Ellis, L.M. & Hicklin, D.J. 2008, "VEGF-targeted therapy: mechanisms of anti-tumour activity", Nature reviews.Cancer, vol. 8, no. 8, pp. 579-591.

Erber, R., Thurnher, A., Katsen, A.D., Groth, G., Kerger, H., Hammes, H.P., Menger, M.D., Ullrich, A. & Vajkoczy, P. 2004, "Combined inhibition of VEGF and PDGF signaling enforces tumor vessel regression by interfering with pericyte-mediated endothelial cell survival mechanisms", FASEB journal : official publication of the Federation of American Societies for Experimental Biology, vol. 18, no. 2, pp. 338-340.

Evans, A.L., Brice, G., Sotirova, V., Mortimer, P., Beninson, J., Burnand, K., Rosbotham, J., Child, A. & Sarfarazi, M. 1999, "Mapping of primary congenital lymphedema to the 5q35.3 region", American Journal of Human Genetics, vol. 64, no. 2, pp. 547-555.

Fan, F., Wey, J.S., McCarty, M.F., Belcheva, A., Liu, W., Bauer, T.W., Somcio, R.J., Wu, Y., Hooper, A., Hicklin, D.J. & Ellis, L.M. 2005, "Expression and function of vascular endothelial growth factor receptor-1 on human colorectal cancer cells", Oncogene, vol. 24, no. 16, pp. 2647-2653.

Fang, J., Dagenais, S.L., Erickson, R.P., Arlt, M.F., Glynn, M.W., Gorski, J.L., Seaver, L.H. & Glover, T.W. 2000, "Mutations in FOXC2 (MFH-1), a forkhead family transcription factor, are responsible for the hereditary lymphedema-distichiasis syndrome", American Journal of Human Genetics, vol. 67, no. 6, pp. 1382-1388.

Ferrara, N. 2005, "VEGF as a therapeutic target in cancer", Oncology, vol. 69 Suppl 3, pp. 11-16.

Ferrara, N. 1999, "Role of vascular endothelial growth factor in the regulation of angiogenesis", Kidney international, vol. 56, no. 3, pp. 794-814.

Ferrara, N. 1996, "Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene", Nature, vol. 380, pp. 439-442.

Ferrara, N. & Davis-Smyth, T. 1997, "The biology of vascular endothelial growth factor", Endocrine reviews, vol. 18, no. 1, pp. 4-25.

Ferrara, N., Gerber, H.P. & LeCouter, J. 2003, "The biology of VEGF and its receptors", Nature medicine, vol. 9, no. 6, pp. 669-676.

48

Ferrara, N., Houck, K., Jakeman, L. & Leung, D.W. 1992, "Molecular and biological properties of the vascular endothelial growth factor family of proteins", Endocrine reviews, vol. 13, no. 1, pp. 18-32.

Fish, R.J. & Kruithof, E.K. 2004, "Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors", BMC molecular biology, vol. 5, pp. 9.

Fleury, S., Simeoni, E., Zuppinger, C., Deglon, N., von Segesser, L.K., Kappenberger, L. & Vassalli, G. 2003, "Multiply attenuated, self-inactivating lentiviral vectors efficiently deliver and express genes for extended periods of time in adult rat cardiomyocytes in vivo", Circulation, vol. 107, no. 18, pp. 2375-2382.

Fong, G.H., Rossant, J., Gertsenstein, M. & Breitman, M.L. 1995, "Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium", Nature, vol. 376, no. 6535, pp. 66-70.

Fong, G.H., Zhang, L., Bryce, D.M. & Peng, J. 1999, "Increased hemangioblast commitment, not vascular disorganization, is the primary defect in flt-1 knock-out mice", Development (Cambridge, England), vol. 126, no. 13, pp. 3015-3025.

Forsythe, J.A., Jiang, B.H., Iyer, N.V., Agani, F., Leung, S.W., Koos, R.D. & Semenza, G.L. 1996, "Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1", Molecular and cellular biology, vol. 16, no. 9, pp. 4604-4613.

Gale, N.W. & Yancopoulos, G.D. 1999, "Growth factors acting via endothelial cell-specific receptor tyrosine kinases: VEGFs, angiopoietins, and ephrins in vascular development", Genes & development, vol. 13, no. 9, pp. 1055-1066.

Gavard, J., Patel, V. & Gutkind, J.S. 2008, "Angiopoietin-1 prevents VEGF-induced endothelial permeability by sequestering Src through mDia", Developmental cell, vol. 14, no. 1, pp. 25-36.

Geiss, G., Jin, G., Guo, J., Bumgarner, R., Katze, M.G. & Sen, G.C. 2001, "A comprehensive view of regulation of gene expression by double-stranded RNA-mediated cell signaling", The Journal of biological chemistry, vol. 276, no. 32, pp. 30178-30182.

Gerber, H.P., Malik, A.K., Solar, G.P., Sherman, D., Liang, X.H., Meng, G., Hong, K., Marsters, J.C. & Ferrara, N. 2002, "VEGF regulates haematopoietic stem cell survival by an internal autocrine loop mechanism", Nature, vol. 417, no. 6892, pp. 954-958.

49

Gigante, B., Tarsitano, M., Cimini, V., De Falco, S. & Persico, M.G. 2004, "Placenta growth factor is not required for exercise-induced angiogenesis", Angiogenesis, vol. 7, no. 3, pp. 277-284.

Gille, H. 2001, "Analysis of biological effects and signaling properties of Flt-1 (VEGFR-1) and KDR (VEGFR-2). A reassessment using novel receptor-specific vascular endothelial growth factor mutants", Journal of Biological Chemistry, vol. 276, pp. 3222-3230.

Giordano, F.J., Ping, P., McKirnan, M.D., Nozaki, S., DeMaria, A.N., Dillmann, W.H., Mathieu-Costello, O. & Hammond, H.K. 1996, "Intracoronary gene transfer of fibroblast growth factor-5 increases blood flow and contractile function in an ischemic region of the heart", Nature medicine, vol. 2, no. 5, pp. 534-539.

Gopfert, T., Gess, B., Eckardt, K.U. & Kurtz, A. 1996, "Hypoxia signalling in the control of erythropoietin gene expression in rat hepatocytes", Journal of cellular physiology, vol. 168, no. 2, pp. 354-361.

Gordon, J.W. & Ruddle, F.H. 1981, "Integration and stable germ line transmission of genes injected into mouse pronuclei", Science (New York, N.Y.), vol. 214, no. 4526, pp. 1244-1246.

Gordon, J.W., Scangos, G.A., Plotkin, D.J., Barbosa, J.A. & Ruddle, F.H. 1980, "Genetic transformation of mouse embryos by microinjection of purified DNA", Proceedings of the National Academy of Sciences of the United States of America, vol. 77, no. 12, pp. 7380-7384.

Grimm, D., Streetz, K.L., Jopling, C.L., Storm, T.A., Pandey, K., Davis, C.R., Marion, P., Salazar, F. & Kay, M.A. 2006, "Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways", Nature, vol. 441, no. 7092, pp. 537-541.

Grimmond, S., Lagercrantz, J., Drinkwater, C., Silins, G., Townson, S., Pollock, P., Gotley, D., Carson, E., Rakar, S., Nordenskjold, M., Ward, L., Hayward, N. & Weber, G. 1996, "Cloning and characterization of a novel human gene related to vascular endothelial growth factor", Genome research, vol. 6, no. 2, pp. 124-131.

Gunningham, S.P., Currie, M.J., Han, C., Robinson, B.A., Scott, P.A., Harris, A.L. & Fox, S.B. 2001, "VEGF-B expression in human primary breast cancers is associated with lymph node metastasis but not angiogenesis", The Journal of pathology, vol. 193, no. 3, pp. 325-332.

50

Hagberg, C.E., Mehlem, A., Falkevall, A., Muhl, L., Fam, B.C., Ortsater, H., Scotney, P., Nyqvist, D., Samen, E., Lu, L., Stone-Elander, S., Proietto, J., Andrikopoulos, S., Sjoholm, A., Nash, A. & Eriksson, U. 2012, "Targeting VEGF-B as a novel treatment for insulin resistance and type 2 diabetes", Nature, vol. 490, no. 7420, pp. 426-430.

Haiko, P., Makinen, T., Keskitalo, S., Taipale, J., Karkkainen, M.J., Baldwin, M.E., Stacker, S.A., Achen, M.G. & Alitalo, K. 2008, "Deletion of vascular endothelial growth factor C (VEGF-C) and VEGF-D is not equivalent to VEGF receptor 3 deletion in mouse embryos", Molecular and cellular biology, vol. 28, no. 15, pp. 4843-4850.

Hannon, G.J. 2002, "RNA interference", Nature, vol. 418, no. 6894, pp. 244-251.

Hannon, G.J. & Rossi, J.J. 2004, "Unlocking the potential of the human genome with RNA interference", Nature, vol. 431, no. 7006, pp. 371-378.

Hanrahan, V., Currie, M.J., Gunningham, S.P., Morrin, H.R., Scott, P.A., Robinson, B.A. & Fox, S.B. 2003, "The angiogenic switch for vascular endothelial growth factor (VEGF)-A, VEGF-B, VEGF-C, and VEGF-D in the adenoma-carcinoma sequence during colorectal cancer progression", The Journal of pathology, vol. 200, no. 2, pp. 183-194.

Haraguchi, S., Saga, Y., Naito, K., Inoue, H. & Seto, A. 2004, "Specific gene silencing in the pre-implantation stage mouse embryo by an siRNA expression vector system", Molecular reproduction and development, vol. 68, no. 1, pp. 17-24.

Harlan Laboratories 2008, CD2F1 Hybrid mice, data sheet, USA.

Hatva, E., Kaipainen, A., Mentula, P., Jaaskelainen, J., Paetau, A., Haltia, M. & Alitalo, K. 1995, "Expression of endothelial cell-specific receptor tyrosine kinases and growth factors in human brain tumors", The American journal of pathology, vol. 146, no. 2, pp. 368-378.

Hedman, M., Hartikainen, J., Syvanne, M., Stjernvall, J., Hedman, A., Kivela, A., Vanninen, E., Mussalo, H., Kauppila, E., Simula, S., Narvanen, O., Rantala, A., Peuhkurinen, K., Nieminen, M.S., Laakso, M. & Yla-Herttuala, S. 2003, "Safety and feasibility of catheter-based local intracoronary vascular endothelial growth factor gene transfer in the prevention of postangioplasty and in-stent restenosis and in the treatment of chronic myocardial ischemia: phase II results of the Kuopio Angiogenesis Trial (KAT)", Circulation, vol. 107, no. 21, pp. 2677-2683.

Hedman, M., Muona, K., Hedman, A., Kivela, A., Syvanne, M., Eranen, J., Rantala, A., Stjernvall, J., Nieminen, M.S., Hartikainen, J. & Yla-Herttuala, S. 2009, "Eight-year safety follow-up of coronary artery disease patients after local intracoronary VEGF gene transfer", Gene therapy, vol. 16, no. 5, pp. 629-634.

51

Heil, M., Ziegelhoeffer, T., Pipp, F., Kostin, S., Martin, S., Clauss, M. & Schaper, W. 2002, "Blood monocyte concentration is critical for enhancement of collateral artery growth", American journal of physiology.Heart and circulatory physiology, vol. 283, no. 6, pp. H2411-9.

Hellstrom, M., Gerhardt, H., Kalen, M., Li, X., Eriksson, U., Wolburg, H. & Betsholtz, C. 2001, "Lack of pericytes leads to endothelial hyperplasia and abnormal vascular morphogenesis", The Journal of cell biology, vol. 153, no. 3, pp. 543-553.

Hellstrom, M., Kalen, M., Lindahl, P., Abramsson, A. & Betsholtz, C. 1999, "Role of PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells and pericytes during embryonic blood vessel formation in the mouse", Development (Cambridge, England), vol. 126, no. 14, pp. 3047-3055.

Herzog, Y., Kalcheim, C., Kahane, N., Reshef, R. & Neufeld, G. 2001, "Differential expression of neuropilin-1 and neuropilin-2 in arteries and veins", Mechanisms of development, vol. 109, no. 1, pp. 115-119.

Hicklin, D.J. & Ellis, L.M. 2005, "Role of the vascular endothelial growth factor pathway in tumor growth and angiogenesis", Journal of clinical oncology : official journal of the American Society of Clinical Oncology, vol. 23, no. 5, pp. 1011-1027.

Hiratsuka, S. 2011, "Vasculogenensis, angiogenesis and special features of tumor blood vessels", Frontiers in bioscience : a journal and virtual library, vol. 16, pp. 1413-1427.

Hiratsuka, S., Nakao, K., Nakamura, K., Katsuki, M., Maru, Y. & Shibuya, M. 2005, "Membrane fixation of vascular endothelial growth factor receptor 1 ligand-binding domain is important for vasculogenesis and angiogenesis in mice", Molecular and cellular biology, vol. 25, no. 1, pp. 346-354.

Hirschi, K.K., Rohovsky, S.A. & D'Amore, P.A. 1998, "PDGF, TGF-beta, and heterotypic cell-cell interactions mediate endothelial cell-induced recruitment of 10T1/2 cells and their differentiation to a smooth muscle fate", The Journal of cell biology, vol. 141, no. 3, pp. 805-814.

Hofmann, A., Kessler, B., Ewerling, S., Weppert, M., Vogg, B., Ludwig, H., Stojkovic, M., Boelhauve, M., Brem, G., Wolf, E. & Pfeifer, A. 2003, "Efficient transgenesis in farm animals by lentiviral vectors", EMBO reports, vol. 4, no. 11, pp. 1054-1060.

Hogan, B., Beddington, R., Constantini, F. & Lacy, E. (eds) 1994, Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Plainview, New York.

52

Holash, J., Wiegand, S.J. & Yancopoulos, G.D. 1999, "New model of tumor angiogenesis: dynamic balance between vessel regression and growth mediated by angiopoietins and VEGF", Oncogene, vol. 18, no. 38, pp. 5356-5362.

Houck, K.A., Ferrara, N., Winer, J., Cachianes, G., Li, B. & Leung, D.W. 1991, "The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA", Molecular endocrinology (Baltimore, Md.), vol. 5, no. 12, pp. 1806-1814.

Huggenberger, R., Siddiqui, S.S., Brander, D., Ullmann, S., Zimmermann, K., Antsiferova, M., Werner, S., Alitalo, K. & Detmar, M. 2011, "An important role of lymphatic vessel activation in limiting acute inflammation", Blood, vol. 117, no. 17, pp. 4667-4678.

Hurwitz, H., Fehrenbacher, L., Novotny, W., Cartwright, T., Hainsworth, J., Heim, W., Berlin, J., Baron, A., Griffing, S., Holmgren, E., Ferrara, N., Fyfe, G., Rogers, B., Ross, R. & Kabbinavar, F. 2004, "Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer", The New England journal of medicine, vol. 350, no. 23, pp. 2335-2342.

Huusko, J., Makinen, P.I., Alhonen, L. & Yla-Herttuala, S. 2008, "Generation of transgenic and knockdown mice with lentiviral vectors and RNAi techniques" in RNAi, ed. M. Latterich, Taylor & Francis, New York, pp. 91-111.

Ikawa, M., Tanaka, N., Kao, W.W. & Verma, I.M. 2003, "Generation of transgenic mice using lentiviral vectors: a novel preclinical assessment of lentiviral vectors for gene therapy", Molecular therapy : the journal of the American Society of Gene Therapy, vol. 8, no. 4, pp. 666-673.

Inai, T., Mancuso, M., Hashizume, H., Baffert, F., Haskell, A., Baluk, P., Hu-Lowe, D.D., Shalinsky, D.R., Thurston, G., Yancopoulos, G.D. & McDonald, D.M. 2004, "Inhibition of vascular endothelial growth factor (VEGF) signaling in cancer causes loss of endothelial fenestrations, regression of tumor vessels, and appearance of basement membrane ghosts", The American journal of pathology, vol. 165, no. 1, pp. 35-52.

Ioannidou, S., Deinhardt, K., Miotla, J., Bradley, J., Cheung, E., Samuelsson, S., Ng, Y.S. & Shima, D.T. 2006, "An in vitro assay reveals a role for the diaphragm protein PV-1 in endothelial fenestra morphogenesis", Proceedings of the National Academy of Sciences of the United States of America, vol. 103, no. 45, pp. 16770-16775.

Ishida, A., Murray, J., Saito, Y., Kanthou, C., Benzakour, O., Shibuya, M. & Wijelath, E.S. 2001, "Expression of vascular endothelial growth factor receptors in smooth muscle cells", Journal of cellular physiology, vol. 188, no. 3, pp. 359-368.

53

Jain, R.K. 2003, "Molecular regulation of vessel maturation", Nature medicine, vol. 9, no. 6, pp. 685-693.

Jeltsch, M., Kaipainen, A., Joukov, V., Meng, X., Lakso, M., Rauvala, H., Swartz, M., Fukumura, D., Jain, R.K. & Alitalo, K. 1997, "Hyperplasia of Lymphatic Vessels in VEGF-C Transgenic Mice", Science, vol. 276, no. 5317, pp. 1423-1425.

Jinnin, M., Medici, D., Park, L., Limaye, N., Liu, Y., Boscolo, E., Bischoff, J., Vikkula, M., Boye, E. & Olsen, B.R. 2008, "Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma", Nature medicine, vol. 14, no. 11, pp. 1236-1246.

Joukov, V., Pajusola, K., Kaipainen, A., Chilov, D., Lahtinen, I., Kukk, E., Saksela, O., Kalkkinen, N. & Alitalo, K. 1996, "A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases", The EMBO journal, vol. 15, no. 7, pp. 1751.

Jurisic, G. & Detmar, M. 2009, "Lymphatic endothelium in health and disease", Cell and tissue research, vol. 335, no. 1, pp. 97-108.

Kaikkonen, M.U., Lesch, H.P., Pikkarainen, J., Raty, J.K., Vuorio, T., Huhtala, T., Taavitsainen, M., Laitinen, T., Tuunanen, P., Grohn, O., Narvanen, A., Airenne, K.J. & Yla-Herttuala, S. 2009, "(Strept)avidin-displaying lentiviruses as versatile tools for targeting and dual imaging of gene delivery", Gene therapy, vol. 16, no. 7, pp. 894-904.

Kaipainen, A., Korhonen, J., Mustonen, T., van Hinsbergh, V., Fang, G., Dumont, D., Breitman, M. & Alitalo, K. 1995, "Expression of the Fms-Like Tyrosine Kinase 4 Gene Becomes Restricted to Lymphatic Endothelium During Development", PNAS, vol. 92, no. 8, pp. 3566-3570.

Kamihata, H., Matsubara, H., Nishiue, T., Fujiyama, S., Amano, K., Iba, O., Imada, T. & Iwasaka, T. 2002, "Improvement of collateral perfusion and regional function by implantation of peripheral blood mononuclear cells into ischemic hibernating myocardium", Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 22, no. 11, pp. 1804-1810.

Kanda, M., Nomoto, S., Nishikawa, Y., Sugimoto, H., Kanazumi, N., Takeda, S. & Nakao, A. 2008, "Correlations of the expression of vascular endothelial growth factor B and its isoforms in hepatocellular carcinoma with clinico-pathological parameters", Journal of surgical oncology, vol. 98, no. 3, pp. 190-196.

54

Karkkainen, M.J., Haiko, P., Sainio, K., Partanen, J., Taipale, J., Petrova, T.V., Jeltsch, M., Jackson, D.G., Talikka, M., Rauvala, H., Betsholtz, C. & Alitalo, K. 2004, "Vascular endothelial growth factor C is required for sprouting of the first lymphatic vessels from embryonic veins", Nature immunology, vol. 5, no. 1, pp. 74-80.

Karkkainen, M.J., Saaristo, A., Jussila, L., Karila, K.A., Lawrence, E.C., Pajusola, K., Bueler, H., Eichmann, A., Kauppinen, R., Kettunen, M.I., Yla-Herttuala, S., Finegold, D.N., Ferrell, R.E. & Alitalo, K. 2001, "A model for gene therapy of human hereditary lymphedema", PNAS, vol. 98, no. 22, pp. 12677-12682.

Karnezis, T., Shayan, R., Caesar, C., Roufail, S., Harris, N.C., Ardipradja, K., Zhang, Y.F., Williams, S.P., Farnsworth, R.H. & Chai, M.G. 2012, "VEGF-D Promotes Tumor Metastasis by Regulating Prostaglandins Produced by the Collecting Lymphatic Endothelium", Cancer Cell, vol. 21, no. 2, pp. 181-195.

Karpanen, T. 2006, "Lymphangiogenic growth factor responsiveness is modulated by postnatal lymphatic vessel maturation", American Journal of Pathology, vol. 169, pp. 708-718.

Karpanen, T. 2001, "Vascular endothelial growth factor C promotes tumor lymphangiogenesis and intralymphatic tumor growth", Cancer research, vol. 61, pp. 1786-1790.

Kawasaki, T., Kitsukawa, T., Bekku, Y., Matsuda, Y., Sanbo, M., Yagi, T. & Fujisawa, H. 1999, "A requirement for neuropilin-1 in embryonic vessel formation", Development (Cambridge, England), vol. 126, no. 21, pp. 4895-4902.

Kerbel, R.S. 2008, "Tumor angiogenesis", The New England journal of medicine, vol. 358, no. 19, pp. 2039-2049.

Kholova, I., Koota, S., Kaskenpaa, N., Leppanen, P., Narvainen, J., Kavec, M., Rissanen, T.T., Hazes, T., Korpisalo, P., Grohn, O. & Yla-Herttuala, S. 2007, "Adenovirus-mediated gene transfer of human vascular endothelial growth factor-d induces transient angiogenic effects in mouse hind limb muscle", Human Gene Therapy, vol. 18, no. 3, pp. 232-244.

Khromova, N., Kopnin, P., Rybko, V. & Kopnin, B. 2011, "Downregulation of VEGF-C expression in lung and colon cancer cells decelerates tumor growth and inhibits metastasis via multiple mechanisms", Oncogene, .

Kim, E.S., Serur, A., Huang, J., Manley, C.A., McCrudden, K.W., Frischer, J.S., Soffer, S.Z., Ring, L., New, T., Zabski, S., Rudge, J.S., Holash, J., Yancopoulos, G.D., Kandel, J.J. & Yamashiro, D.J. 2002, "Potent VEGF blockade causes regression of coopted vessels in a model of neuroblastoma", Proceedings of the National Academy of Sciences of the United States of America, vol. 99, no. 17, pp. 11399-11404.

55

Kinnunen, K. & Yla-Herttuala, S. 2012, "Gene therapy in age related macular degeneration and hereditary macular disorders", Frontiers in bioscience (Elite edition), vol. 4, pp. 2546-2557.

Koch, M., Dettori, D., Van Nuffelen, A., Souffreau, J., Marconcini, L., Wallays, G., Moons, L., Bruyere, F., Oliviero, S., Noel, A., Foidart, J.M., Carmeliet, P. & Dewerchin, M. 2009, "VEGF-D deficiency in mice does not affect embryonic or postnatal lymphangiogenesis but reduces lymphatic metastasis", The Journal of pathology, vol. 219, no. 3, pp. 356-364.

Koponen, J.K., Kekarainen, T., E Heinonen, S., Laitinen, A., Nystedt, J., Laine, J. & Yla-Herttuala, S. 2007, "Umbilical cord blood-derived progenitor cells enhance muscle regeneration in mouse hindlimb ischemia model", Molecular therapy : the journal of the American Society of Gene Therapy, vol. 15, no. 12, pp. 2172-2177.

Korpisalo, P., Karvinen, H., Rissanen, T.T., Kilpijoki, J., Marjomaki, V., Baluk, P., McDonald, D.M., Cao, Y., Eriksson, U., Alitalo, K. & Yla-Herttuala, S. 2008a, "Vascular endothelial growth factor-A and platelet-derived growth factor-B combination gene therapy prolongs angiogenic effects via recruitment of interstitial mononuclear cells and paracrine effects rather than improved pericyte coverage of angiogenic vessels", Circulation research, vol. 103, no. 10, pp. 1092-1099.

Korpisalo, P., Rissanen, T.T., Bengtsson, T., Liimatainen, T., Laidinen, S., Karvinen, H., Markkanen, J.E., Grohn, O.H. & Yla-Herttuala, S. 2008b, "Therapeutic angiogenesis with placental growth factor improves exercise tolerance of ischaemic rabbit hindlimbs", Cardiovascular research, vol. 80, no. 2, pp. 263-270.

Korpisalo, P. & Yla-Herttuala, S. 2010, "Stimulation of functional vessel growth by gene therapy", Integrative biology : quantitative biosciences from nano to macro, vol. 2, no. 2-3, pp. 102-112.

Kukk, E., Lymboussaki, A., Taira, S., Kaipainen, A., Jeltsch, M., Joukov, V. & Alitalo, K. 1996, "VEGF-C receptor binding and pattern of expression with VEGFR-3 suggests a role in lymphatic vascular development", Development (Cambridge, England), vol. 122, no. 12, pp. 3829-3837.

Lahteenvuo, J.E. 2009, "Vascular endothelial growth factor-B induces myocardium-specific angiogenesis and arteriogenesis via vascular endothelial growth factor receptor-1- and neuropilin receptor-1-dependent mechanisms", Circulation, vol. 119, pp. 845-856.

Lambrechts, D., Claes, B., Delmar, P., Reumers, J., Mazzone, M., Yesilyurt, B.T., Devlieger, R., Verslype, C., Tejpar, S., Wildiers, H., de Haas, S., Carmeliet, P., Scherer, S.J. & Van Cutsem, E. 2012, "VEGF pathway genetic variants as biomarkers of treatment outcome with bevacizumab: an analysis of data from

56

the AViTA and AVOREN randomised trials", The lancet oncology, vol. 13, no. 7, pp. 724-733.

Lawson, N.D., Scheer, N., Pham, V.N., Kim, C.H., Chitnis, A.B., Campos-Ortega, J.A. & Weinstein, B.M. 2001, "Notch signaling is required for arterial-venous differentiation during embryonic vascular development", Development (Cambridge, England), vol. 128, no. 19, pp. 3675-3683.

LeCouter, J. 2003, "The biology of VEGF and its receptors", Nature medicine, vol. 9, no. 6, pp. 669-76.

LeCouter, J., Kowalski, J., Foster, J., Hass, P., Zhang, Z., Dillard-Telm, L., Frantz, G., Rangell, L., DeGuzman, L., Keller, G.A., Peale, F., Gurney, A., Hillan, K.J. & Ferrara, N. 2001, "Identification of an angiogenic mitogen selective for endocrine gland endothelium", Nature, vol. 412, no. 6850, pp. 877-884.

Lee, H.J., Cho, C.H., Hwang, S.J., Choi, H.H., Kim, K.T., Ahn, S.Y., Kim, J.H., Oh, J.L., Lee, G.M. & Koh, G.Y. 2004, "Biological characterization of angiopoietin-3 and angiopoietin-4", FASEB journal : official publication of the Federation of American Societies for Experimental Biology, vol. 18, no. 11, pp. 1200-1208.

Lee, P., Goishi, K., Davidson, A.J., Mannix, R., Zon, L. & Klagsbrun, M. 2002, "Neuropilin-1 is required for vascular development and is a mediator of VEGF-dependent angiogenesis in zebrafish", Proceedings of the National Academy of Sciences of the United States of America, vol. 99, no. 16, pp. 10470-10475.

Lee, Y., Kim, M., Han, J., Yeom, K.H., Lee, S., Baek, S.H. & Kim, V.N. 2004, "MicroRNA genes are transcribed by RNA polymerase II", The EMBO journal, vol. 23, no. 20, pp. 4051-4060.

Li, X. 2008, "Reevaluation of the role of VEGF-B suggests a restricted role in the revascularization of the ischemic myocardium", Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 28, pp. 1614-1620.

Li, X., Tjwa, M., Moons, L., Fons, P., Noel, A., Ny, A., Zhou, J.M., Lennartsson, J., Li, H., Luttun, A., Ponten, A., Devy, L., Bouche, A., Oh, H., Manderveld, A., Blacher, S., Communi, D., Savi, P., Bono, F., Dewerchin, M., Foidart, J.M., Autiero, M., Herbert, J.M., Collen, D., Heldin, C.H., Eriksson, U. & Carmeliet, P. 2005, "Revascularization of ischemic tissues by PDGF-CC via effects on endothelial cells and their progenitors", The Journal of clinical investigation, vol. 115, no. 1, pp. 118-127.

Libby, P. 2012, "Inflammation in atherosclerosis", Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 32, no. 9, pp. 2045-2051.

57

Lin, E.Y., Li, J.F., Gnatovskiy, L., Deng, Y., Zhu, L., Grzesik, D.A., Qian, H., Xue, X.N. & Pollard, J.W. 2006, "Macrophages regulate the angiogenic switch in a mouse model of breast cancer", Cancer research, vol. 66, no. 23, pp. 11238-11246.

Lindahl, P., Hellstrom, M., Kalen, M. & Betsholtz, C. 1998, "Endothelial-perivascular cell signaling in vascular development: lessons from knockout mice", Current opinion in lipidology, vol. 9, no. 5, pp. 407-411.

Lindahl, P., Johansson, B.R., Leveen, P. & Betsholtz, C. 1997a, "Pericyte loss and microaneurysm formation in PDGF-B-deficient mice", Science (New York, N.Y.), vol. 277, no. 5323, pp. 242-245.

Lindahl, P., Karlsson, L., Hellstrom, M., Gebre-Medhin, S., Willetts, K., Heath, J.K. & Betsholtz, C. 1997b, "Alveogenesis failure in PDGF-A-deficient mice is coupled to lack of distal spreading of alveolar smooth muscle cell progenitors during lung development", Development (Cambridge, England), vol. 124, no. 20, pp. 3943-3953.

Linder, C.C. 2001, "The influence of genetic background on spontaneous and genetically engineered mouse models of complex diseases", Lab animal, vol. 30, no. 5, pp. 34-39.

Lobov, I.B., Renard, R.A., Papadopoulos, N., Gale, N.W., Thurston, G., Yancopoulos, G.D. & Wiegand, S.J. 2007, "Delta-like ligand 4 (Dll4) is induced by VEGF as a negative regulator of angiogenic sprouting", Proceedings of the National Academy of Sciences of the United States of America, vol. 104, no. 9, pp. 3219-3224.

Lohela, M., Saaristo, A., Veikkola, T. & Alitalo, K. 2003, "Lymphangiogenic growth factors, receptors and therapies", Thrombosis and haemostasis, vol. 90, no. 2, pp. 167-184.

Lois, C., Hong, E.J., Pease, S., Brown, E.J. & Baltimore, D. 2002, "Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors", Science (New York, N.Y.), vol. 295, no. 5556, pp. 868-872.

Lund, A.W. & Swartz, M.A. 2010, "Role of lymphatic vessels in tumor immunity: passive conduits or active participants?", Journal of mammary gland biology and neoplasia, vol. 15, no. 3, pp. 341-352.

Luttun, A., Tjwa, M., Moons, L., Wu, Y., Angelillo-Scherrer, A., Liao, F., Nagy, J.A., Hooper, A., Priller, J., De Klerck, B., Compernolle, V., Daci, E., Bohlen, P., Dewerchin, M., Herbert, J.M., Fava, R., Matthys, P., Carmeliet, G., Collen, D., Dvorak, H.F., Hicklin, D.J. & Carmeliet, P. 2002, "Revascularization of ischemic tissues by PlGF treatment, and inhibition of tumor angiogenesis, arthritis and atherosclerosis by anti-Flt1", Nature medicine, vol. 8, no. 8, pp. 831-840.

58

Lyden, D., Hattori, K., Dias, S., Costa, C., Blaikie, P., Butros, L., Chadburn, A., Heissig, B., Marks, W., Witte, L., Wu, Y., Hicklin, D., Zhu, Z., Hackett, N.R., Crystal, R.G., Moore, M.A., Hajjar, K.A., Manova, K., Benezra, R. & Rafii, S. 2001, "Impaired recruitment of bone-marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesis and growth", Nature medicine, vol. 7, no. 11, pp. 1194-1201.

Maisonpierre, P.C., Suri, C., Jones, P.F., Bartunkova, S., Wiegand, S.J., Radziejewski, C., Compton, D., McClain, J., Aldrich, T.H., Papadopoulos, N., Daly, T.J., Davis, S., Sato, T.N. & Yancopoulos, G.D. 1997, "Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis", Science (New York, N.Y.), vol. 277, no. 5322, pp. 55-60.

Makanya, A.N., Hlushchuk, R. & Djonov, V.G. 2009, "Intussusceptive angiogenesis and its role in vascular morphogenesis, patterning, and remodeling", Angiogenesis, vol. 12, no. 2, pp. 113-123.

Makinen, K., Manninen, H., Hedman, M., Matsi, P., Mussalo, H., Alhava, E. & Yla-Herttuala, S. 2002, "Increased vascularity detected by digital subtraction angiography after VEGF gene transfer to human lower limb artery: a randomized, placebo-controlled, double-blinded phase II study", Molecular therapy : the journal of the American Society of Gene Therapy, vol. 6, no. 1, pp. 127-133.

Makinen, P.I., Koponen, J.K., Karkkainen, A.M., Malm, T.M., Pulkkinen, K.H., Koistinaho, J., Turunen, M.P. & Yla-Herttuala, S. 2006, "Stable RNA interference: comparison of U6 and H1 promoters in endothelial cells and in mouse brain", The journal of gene medicine, vol. 8, no. 4, pp. 433-441.

Makinen, T. 2001, "Inhibition of lymphangiogenesis with resulting lymphedema in transgenic mice expressing soluble VEGF receptor-3", Nature Med., vol. 7, pp. 199-205.

Makinen, T. 1999, "Differential binding of vascular endothelial growth factor B splice and proteolytic isoforms to neuropilin-1", Journal of Biological Chemistry, vol. 274, pp. 21217-21222.

Mangion, J., Rahman, N., Mansour, S., Brice, G., Rosbotham, J., Child, A.H., Murday, V.A., Mortimer, P.S., Barfoot, R., Sigurdsson, A., Edkins, S., Sarfarazi, M., Burnand, K., Evans, A.L., Nunan, T.O., Stratton, M.R. & Jeffery, S. 1999, "A gene for lymphedema-distichiasis maps to 16q24.3", American Journal of Human Genetics, vol. 65, no. 2, pp. 427-432.

Markkanen, J.E., Rissanen, T.T., Kivela, A. & Yla-Herttuala, S. 2005, "Growth factor-induced therapeutic angiogenesis and arteriogenesis in the heart--gene therapy", Cardiovascular research, vol. 65, no. 3, pp. 656-664.

59

Marumoto, T., Tashiro, A., Friedmann-Morvinski, D., Scadeng, M., Soda, Y., Gage, F.H. & Verma, I.M. 2009, "Development of a novel mouse glioma model using lentiviral vectors", Nature medicine, vol. 15, no. 1, pp. 110-116.

Matranga, C., Tomari, Y., Shin, C., Bartel, D.P. & Zamore, P.D. 2005, "Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes", Cell, vol. 123, no. 4, pp. 607-620.

McColl, B.K., Paavonen, K., Karnezis, T., Harris, N.C., Davydova, N., Rothacker, J., Nice, E.C., Harder, K.W., Roufail, S., Hibbs, M.L., Rogers, P.A.W., Alitalo, K., Stacker, S.A. & Achen, M.G. 2007, "Proprotein convertases promote processing of VEGF-D, a critical step for binding the angiogenic receptor VEGFR-2", FASEB J, vol. 21, no. 4, pp. 1088-1098.

Meister, G. & Tuschl, T. 2004, "Mechanisms of gene silencing by double-stranded RNA", Nature, vol. 431, no. 7006, pp. 343-349.

Melrose, W.D. 2002, "Lymphatic filariasis: new insights into an old disease", International journal for parasitology, vol. 32, no. 8, pp. 947-960.

Miller, D.L., Ortega, S., Bashayan, O., Basch, R. & Basilico, C. 2000, "Compensation by fibroblast growth factor 1 (FGF1) does not account for the mild phenotypic defects observed in FGF2 null mice", Molecular and cellular biology, vol. 20, no. 6, pp. 2260-2268.

Miller, K., Wang, M., Gralow, J., Dickler, M., Cobleigh, M., Perez, E.A., Shenkier, T., Cella, D. & Davidson, N.E. 2007, "Paclitaxel plus bevacizumab versus paclitaxel alone for metastatic breast cancer", The New England journal of medicine, vol. 357, no. 26, pp. 2666-2676.

Miyoshi, H., Blomer, U., Takahashi, M., Gage, F.H. & Verma, I.M. 1998, "Development of a self-inactivating lentivirus vector", Journal of virology, vol. 72, no. 10, pp. 8150-8157.

Miyoshi, H., Smith, K.A., Mosier, D.E., Verma, I.M. & Torbett, B.E. 1999, "Transduction of human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors", Science (New York, N.Y.), vol. 283, no. 5402, pp. 682-686.

Moreno, P.R., Purushothaman, M. & Purushothaman, K.R. 2012, "Plaque neovascularization: defense mechanisms, betrayal, or a war in progress", Annals of the New York Academy of Sciences, vol. 1254, pp. 7-17.

60

Munaut, C., Noel, A., Hougrand, O., Foidart, J.M., Boniver, J. & Deprez, M. 2003, "Vascular endothelial growth factor expression correlates with matrix metalloproteinases MT1-MMP, MMP-2 and MMP-9 in human glioblastomas", International journal of cancer.Journal international du cancer, vol. 106, no. 6, pp. 848-855.

Murakami, M., Zheng, Y., Hirashima, M., Suda, T., Morita, Y., Ooehara, J., Ema, H., Fong, G.H. & Shibuya, M. 2008, "VEGFR1 tyrosine kinase signaling promotes lymphangiogenesis as well as angiogenesis indirectly via macrophage recruitment", Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 28, no. 4, pp. 658-664.

Murray, K.A. & Parker, N.J. 2005, "Breeding genetically modified rodents: tips for tracking and troubleshooting reproductive performance", Lab animal, vol. 34, no. 4, pp. 36-41.

Mylona, E., Alexandrou, P., Giannopoulou, I., Liapis, G., Sofia, M., Keramopoulos, A. & Nakopoulou, L. 2007, "The prognostic value of vascular endothelial growth factors (VEGFs)-A and -B and their receptor, VEGFR-1, in invasive breast carcinoma", Gynecologic oncology, vol. 104, no. 3, pp. 557-563.

Naldini, L. 1998, "Lentiviruses as gene transfer agents for delivery to non-dividing cells", Current opinion in biotechnology, vol. 9, no. 5, pp. 457-463.

Naldini, L., Blomer, U., Gage, F.H., Trono, D. & Verma, I.M. 1996a, "Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector", Proceedings of the National Academy of Sciences of the United States of America, vol. 93, no. 21, pp. 11382-11388.

Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M. & Trono, D. 1996b, "In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector", Science (New York, N.Y.), vol. 272, no. 5259, pp. 263-267.

North, S., Moenner, M. & Bikfalvi, A. 2005, "Recent developments in the regulation of the angiogenic switch by cellular stress factors in tumors", Cancer letters, vol. 218, no. 1, pp. 1-14.

Olofsson, B. 1996, "Genomic organization of the mouse and human genes for vascular endothelial growth factor B (VEGF-B) and characterization of a second splice isoform", Journal of Biological Chemistry, vol. 271, pp. 19310-19317.

61

Olofsson, B., Pajusola, K., Kaipainen, A., von Euler, G., Joukov, V., Saksela, O., Orpana, A., Pettersson, R.F., Alitalo, K. & Eriksson, U. 1996, "Vascular endothelial growth factor B, a novel growth factor for endothelial cells", Proceedings of the National Academy of Sciences of the United States of America, vol. 93, no. 6, pp. 2576-2581.

Olofsson, B., Korpelainen, E., Pepper, M.S., Mandriota, S.J., Aase, K., Kumar, V., Gunji, Y., Jeltsch, M.M., Shibuya, M., Alitalo, K. & Eriksson, U. 1998, "Vascular endothelial growth factor B (VEGF-B) binds to VEGF receptor-1 and regulates plasminogen activator activity in endothelial cells", PNAS, vol. 95, no. 20, pp. 11709-11714.

Paez-Ribes, M., Allen, E., Hudock, J., Takeda, T., Okuyama, H., Vinals, F., Inoue, M., Bergers, G., Hanahan, D. & Casanovas, O. 2009, "Antiangiogenic therapy elicits malignant progression of tumors to increased local invasion and distant metastasis", Cancer cell, vol. 15, no. 3, pp. 220-231.

Pajusola, K., Aprelikova, O., Korhonen, J., Kaipainen, A., Pertovaara, L., Alitalo, R. & Alitalo, K. 1992, "FLT4 receptor tyrosine kinase contains seven immunoglobulin-like loops and is expressed in multiple human tissues and cell lines", Cancer research, vol. 52, no. 20, pp. 5738-5743.

Pan, Q., Chanthery, Y., Liang, W.C., Stawicki, S., Mak, J., Rathore, N., Tong, R.K., Kowalski, J., Yee, S.F., Pacheco, G., Ross, S., Cheng, Z., Le Couter, J., Plowman, G., Peale, F., Koch, A.W., Wu, Y., Bagri, A., Tessier-Lavigne, M. & Watts, R.J. 2007, "Blocking neuropilin-1 function has an additive effect with anti-VEGF to inhibit tumor growth", Cancer cell, vol. 11, no. 1, pp. 53-67.

Panganiban, A.T. & Fiore, D. 1988, "Ordered interstrand and intrastrand DNA transfer during reverse transcription", Science (New York, N.Y.), vol. 241, no. 4869, pp. 1064-1069.

Park, F., Ohashi, K., Chiu, W., Naldini, L. & Kay, M.A. 2000, "Efficient lentiviral transduction of liver requires cell cycling in vivo", Nature genetics, vol. 24, no. 1, pp. 49-52.

Pasquinelli, A.E. & Ruvkun, G. 2002, "Control of developmental timing by micrornas and their targets", Annual Review of Cell and Developmental Biology, vol. 18, pp. 495-513.

Pebernard, S. & Iggo, R.D. 2004, "Determinants of interferon-stimulated gene induction by RNAi vectors", Differentiation; research in biological diversity, vol. 72, no. 2-3, pp. 103-111.

Pfarr, K.M., Debrah, A.Y., Specht, S. & Hoerauf, A. 2009, "Filariasis and lymphoedema", Parasite immunology, vol. 31, no. 11, pp. 664-672.

62

Pfeifer, A., Ikawa, M., Dayn, Y. & Verma, I.M. 2002, "Transgenesis by lentiviral vectors: lack of gene silencing in mammalian embryonic stem cells and preimplantation embryos", Proceedings of the National Academy of Sciences of the United States of America, vol. 99, no. 4, pp. 2140-2145.

Pipp, F., Boehm, S., Cai, W.J., Adili, F., Ziegler, B., Karanovic, G., Ritter, R., Balzer, J., Scheler, C., Schaper, W. & Schmitz-Rixen, T. 2004, "Elevated fluid shear stress enhances postocclusive collateral artery growth and gene expression in the pig hind limb", Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 24, no. 9, pp. 1664-1668.

Pipp, F., Heil, M., Issbrucker, K., Ziegelhoeffer, T., Martin, S., van den Heuvel, J., Weich, H., Fernandez, B., Golomb, G., Carmeliet, P., Schaper, W. & Clauss, M. 2003, "VEGFR-1-selective VEGF homologue PlGF is arteriogenic: evidence for a monocyte-mediated mechanism", Circulation research, vol. 92, no. 4, pp. 378-385.

Presta, L.G., Chen, H., O'Connor, S.J., Chisholm, V., Meng, Y.G., Krummen, L., Winkler, M. & Ferrara, N. 1997, "Humanization of an anti-vascular endothelial growth factor monoclonal antibody for the therapy of solid tumors and other disorders", Cancer research, vol. 57, no. 20, pp. 4593-4599.

Pugh, C.W. & Ratcliffe, P.J. 2003, "Regulation of angiogenesis by hypoxia: role of the HIF system", Nature medicine, vol. 9, no. 6, pp. 677-684.

Punzon, I., Criado, L.M., Serrano, A., Serrano, F. & Bernad, A. 2004, "Highly efficient lentiviral-mediated human cytokine transgenesis on the NOD/scid background", Blood, vol. 103, no. 2, pp. 580-582.

Pytowski, B. 2005, "Complete and specific inhibition of adult lymphatic regeneration by a novel VEGFR-3 neutralizing antibody", Journal of the National Cancer Institute, vol. 97, pp. 14-21.

Rakic, J.M., Lambert, V., Devy, L., Luttun, A., Carmeliet, P., Claes, C., Nguyen, L., Foidart, J.M., Noel, A. & Munaut, C. 2003, "Placental growth factor, a member of the VEGF family, contributes to the development of choroidal neovascularization", Investigative ophthalmology & visual science, vol. 44, no. 7, pp. 3186-3193.

Raoul, C., Abbas-Terki, T., Bensadoun, J.C., Guillot, S., Haase, G., Szulc, J., Henderson, C.E. & Aebischer, P. 2005, "Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS", Nature medicine, vol. 11, no. 4, pp. 423-428.

Rapisarda, A. & Melillo, G. 2012, "Role of the VEGF/VEGFR axis in cancer biology and therapy", Advances in Cancer Research, vol. 114, pp. 237-267.

63

Ray, D.M., Myers, P.H., Painter, J.T., Hoenerhoff, M.J., Olden, K. & Roberts, J.D. 2012, "Inhibition of transforming growth factor-beta-activated kinase-1 blocks cancer cell adhesion, invasion, and metastasis", British journal of cancer, vol. 107, no. 1, pp. 129-136.

Resnick, N., Yahav, H., Shay-Salit, A., Shushy, M., Schubert, S., Zilberman, L.C. & Wofovitz, E. 2003, "Fluid shear stress and the vascular endothelium: for better and for worse", Progress in biophysics and molecular biology, vol. 81, no. 3, pp. 177-199.

Ribatti, D. 2008, "Transgenic mouse models of angiogenesis and lymphangiogenesis", International review of cell and molecular biology, vol. 266, pp. 1-35.

Ribatti, D. 2005, "The crucial role of vascular permeability factor/vascular endothelial growth factor in angiogenesis: a historical review", British journal of haematology, vol. 128, no. 3, pp. 303-309.

Riha, G.M., Lin, P.H., Lumsden, A.B., Yao, Q. & Chen, C. 2005, "Roles of hemodynamic forces in vascular cell differentiation", Annals of Biomedical Engineering, vol. 33, no. 6, pp. 772-779.

Risau, W. & Flamme, I. 1995, "Vasculogenesis", Annual Review of Cell and Developmental Biology, vol. 11, pp. 73-91.

Rissanen, T.T., Korpisalo, P., Markkanen, J.E., Liimatainen, T., Orden, M.R., Kholova, I., de Goede, A., Heikura, T., Grohn, O.H. & Yla-Herttuala, S. 2005, "Blood flow remodels growing vasculature during vascular endothelial growth factor gene therapy and determines between capillary arterialization and sprouting angiogenesis", Circulation, vol. 112, no. 25, pp. 3937-3946.

Rissanen, T.T., Markkanen, J.E., Arve, K., Rutanen, J., Kettunen, M.I., Vajanto, I., Jauhiainen, S., Cashion, L., Gruchala, M., Narvanen, O., Taipale, P., Kauppinen, R.A., Rubanyi, G.M. & Yla-Herttuala, S. 2003a, "Fibroblast growth factor 4 induces vascular permeability, angiogenesis and arteriogenesis in a rabbit hindlimb ischemia model", The FASEB journal : official publication of the Federation of American Societies for Experimental Biology, vol. 17, no. 1, pp. 100-102.

Rissanen, T.T., Markkanen, J.E., Gruchala, M., Heikura, T., Puranen, A., Kettunen, M.I., Kholova, I., Kauppinen, R.A., Achen, M.G., Stacker, S.A., Alitalo, K. & Yla-Herttuala, S. 2003b, "VEGF-D is the strongest angiogenic and lymphangiogenic effector among VEGFs delivered into skeletal muscle via adenoviruses", Circulation research, vol. 92, no. 10, pp. 1098-1106.

64

Rissanen, T.T. & Yla-Herttuala, S. 2007, "Current status of cardiovascular gene therapy", Molecular therapy : the journal of the American Society of Gene Therapy, vol. 15, no. 7, pp. 1233-1247.

Roberts, W.G. & Palade, G.E. 1995, "Increased microvascular permeability and endothelial fenestration induced by vascular endothelial growth factor", Journal of cell science, vol. 108 ( Pt 6), no. Pt 6, pp. 2369-2379.

Rockson, S.G. 2001, "Lymphedema", The American Journal of Medicine, vol. 110, no. 4, pp. 288-295.

Rossant, J. & Howard, L. 2002, "Signaling pathways in vascular development", Annual Review of Cell and Developmental Biology, vol. 18, pp. 541-573.

Rossari, J.R., Metzger-Filho, O., Paesmans, M., Saini, K.S., Gennari, A., de Azambuja, E. & Piccart-Gebhart, M. 2012, "Bevacizumab and Breast Cancer: A Meta-Analysis of First-Line Phase III Studies and a Critical Reappraisal of Available Evidence", Journal of oncology, vol. 2012, pp. 417673.

Rubinson, D.A., Dillon, C.P., Kwiatkowski, A.V., Sievers, C., Yang, L., Kopinja, J., Rooney, D.L., Zhang, M., Ihrig, M.M., McManus, M.T., Gertler, F.B., Scott, M.L. & Van Parijs, L. 2003, "A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference", Nature genetics, vol. 33, no. 3, pp. 401-406.

Rutanen, J., Leppanen, P., Tuomisto, T.T., Rissanen, T.T., Hiltunen, M.O., Vajanto, I., Niemi, M., Hakkinen, T., Karkola, K., Stacker, S.A., Achen, M.G., Alitalo, K. & Yla-Herttuala, S. 2003, "Vascular endothelial growth factor-D expression in human atherosclerotic lesions", Cardiovascular research, vol. 59, no. 4, pp. 971-979.

Rutanen, J., Rissanen, T.T., Markkanen, J.E., Gruchala, M., Silvennoinen, P., Kivela, A., Hedman, A., Hedman, M., Heikura, T., Orden, M.R., Stacker, S.A., Achen, M.G., Hartikainen, J. & Yla-Herttuala, S. 2004, "Adenoviral catheter-mediated intramyocardial gene transfer using the mature form of vascular endothelial growth factor-D induces transmural angiogenesis in porcine heart", Circulation, vol. 109, no. 8, pp. 1029-1035.

Rutanen, J., Turunen, A.M., Teittinen, M., Rissanen, T.T., Heikura, T., Koponen, J.K., Gruchala, M., Inkala, M., Jauhiainen, S., Hiltunen, M.O., Turunen, M.P., Stacker, S.A., Achen, M.G. & Yla-Herttuala, S. 2005, "Gene transfer using the mature form of VEGF-D reduces neointimal thickening through nitric oxide-dependent mechanism", Gene therapy, vol. 12, no. 12, pp. 980-987.

65

Sakoda, T., Kasahara, N., Hamamori, Y. & Kedes, L. 1999, "A high-titer lentiviral production system mediates efficient transduction of differentiated cells including beating cardiac myocytes", Journal of Molecular and Cellular Cardiology, vol. 31, no. 11, pp. 2037-2047.

Salvucci, O., Maric, D., Economopoulou, M., Sakakibara, S., Merlin, S., Follenzi, A. & Tosato, G. 2009, "EphrinB reverse signaling contributes to endothelial and mural cell assembly into vascular structures", Blood, vol. 114, no. 8, pp. 1707-1716.

Sandler, A., Gray, R., Perry, M.C., Brahmer, J., Schiller, J.H., Dowlati, A., Lilenbaum, R. & Johnson, D.H. 2006, "Paclitaxel-carboplatin alone or with bevacizumab for non-small-cell lung cancer", The New England journal of medicine, vol. 355, no. 24, pp. 2542-2550.

Scholz, D. & Schaper, W. 2005, "Preconditioning of arteriogenesis", Cardiovascular research, vol. 65, no. 2, pp. 513-523.

Semenza, G.L. 1999, "Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1", Annual Review of Cell and Developmental Biology, vol. 15, pp. 551-578.

Shalaby, F. 1995, "Failure of blood island formation and vasculogenesis in Flk-1-deficient mice", Nature, vol. 376, pp. 62-66.

Shibuya, M. 2006, "Vascular endothelial growth factor receptor-1 (VEGFR-1/Flt-1): a dual regulator for angiogenesis", Angiogenesis, vol. 9, no. 4, pp. 225-30; discussion 231.

Shibuya, M. & Claesson-Welsh, L. 2006, "Signal transduction by VEGF receptors in regulation of angiogenesis and lymphangiogenesis", Experimental cell research, vol. 312, no. 5, pp. 549-560.

Shibuya, M., Yamaguchi, S., Yamane, A., Ikeda, T., Tojo, A., Matsushime, H. & Sato, M. 1990, "Nucleotide sequence and expression of a novel human receptor-type tyrosine kinase gene (flt) closely related to the fms family", Oncogene, vol. 5, no. 4, pp. 519-524.

Shima, D.T., Kuroki, M., Deutsch, U., Ng, Y.S., Adamis, A.P. & D'Amore, P.A. 1996, "The mouse gene for vascular endothelial growth factor. Genomic structure, definition of the transcriptional unit, and characterization of transcriptional and post-transcriptional regulatory sequences", The Journal of biological chemistry, vol. 271, no. 7, pp. 3877-3883.

Shintani, S., Li, C., Ishikawa, T., Mihara, M., Nakashiro, K. & Hamakawa, H. 2004, "Expression of vascular endothelial growth factor A, B, C, and D in oral squamous cell carcinoma", Oral oncology, vol. 40, no. 1, pp. 13-20.

66

Shutter, J.R., Scully, S., Fan, W., Richards, W.G., Kitajewski, J., Deblandre, G.A., Kintner, C.R. & Stark, K.L. 2000, "Dll4, a novel Notch ligand expressed in arterial endothelium", Genes & development, vol. 14, no. 11, pp. 1313-1318.

Singer, O., Tiscornia, G., Ikawa, M. & Verma, I.M. 2006, "Rapid generation of knockdown transgenic mice by silencing lentiviral vectors", Nature protocols, vol. 1, no. 1, pp. 286-292.

Sledz, C.A., Holko, M., de Veer, M.J., Silverman, R.H. & Williams, B.R. 2003, "Activation of the interferon system by short-interfering RNAs", Nature cell biology, vol. 5, no. 9, pp. 834-839.

Sluimer, J.C. & Daemen, M.J. 2009, "Novel concepts in atherogenesis: angiogenesis and hypoxia in atherosclerosis", The Journal of pathology, vol. 218, no. 1, pp. 7-29.

Sluimer, J.C., Gasc, J.M., van Wanroij, J.L., Kisters, N., Groeneweg, M., Sollewijn Gelpke, M.D., Cleutjens, J.P., van den Akker, L.H., Corvol, P., Wouters, B.G., Daemen, M.J. & Bijnens, A.P. 2008, "Hypoxia, hypoxia-inducible transcription factor, and macrophages in human atherosclerotic plaques are correlated with intraplaque angiogenesis", Journal of the American College of Cardiology, vol. 51, no. 13, pp. 1258-1265.

Somia, N. & Verma, I.M. 2000, "Gene therapy: trials and tribulations", Nature reviews.Genetics, vol. 1, no. 2, pp. 91-99.

Springer, M.L., Chen, A.S., Kraft, P.E., Bednarski, M. & Blau, H.M. 1998, "VEGF gene delivery to muscle: potential role for vasculogenesis in adults", Molecular cell, vol. 2, no. 5, pp. 549-558.

Stacker, S.A., Caesar, C., Baldwin, M.E., Thornton, G.E., Williams, R.A., Prevo, R., Jackson, D.G., Nishikawa, S., Kubo, H. & Achen, M.G. 2001, "VEGF-D promotes the metastatic spread of tumor cells via the lymphatics", Nature medicine, vol. 7, no. 2, pp. 186-191.

Stacker, S.A., Stenvers, K., Caesar, C., Vitali, A., Domagala, T., Nice, E., Roufail, S., Simpson, R.J., Moritz, R., Karpanen, T., Alitalo, K. & Achen, M.G. 1999, "Biosynthesis of Vascular Endothelial Growth Factor-D Involves Proteolytic Processing Which Generates Non-covalent Homodimers", Journal of Biological Chemistry, vol. 274, no. 45, pp. 32127-32136.

Stan, R.V., Kubitza, M. & Palade, G.E. 1999, "PV-1 is a component of the fenestral and stomatal diaphragms in fenestrated endothelia", Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 23, pp. 13203-13207.

Swift, M.R. & Weinstein, B.M. 2009, "Arterial-venous specification during development", Circulation research, vol. 104, no. 5, pp. 576-588.

67

Szulc, J., Wiznerowicz, M., Sauvain, M.O., Trono, D. & Aebischer, P. 2006, "A versatile tool for conditional gene expression and knockdown", Nature methods, vol. 3, no. 2, pp. 109-116.

Takagi, H., King, G.L. & Aiello, L.P. 1998, "Hypoxia upregulates glucose transport activity through an adenosine-mediated increase of GLUT1 expression in retinal capillary endothelial cells", Diabetes, vol. 47, no. 9, pp. 1480-1488.

Takahashi, H., Hattori, S., Iwamatsu, A., Takizawa, H. & Shibuya, M. 2004, "A novel snake venom vascular endothelial growth factor (VEGF) predominantly induces vascular permeability through preferential signaling via VEGF receptor-1", The Journal of biological chemistry, vol. 279, no. 44, pp. 46304-46314.

Takahashi, H. & Shibuya, M. 2005, "The vascular endothelial growth factor (VEGF)/VEGF receptor system and its role under physiological and pathological conditions", Clinical science (London, England : 1979), vol. 109, no. 3, pp. 227-241.

Takahashi, J.A., Fukumoto, M., Kozai, Y., Ito, N., Oda, Y., Kikuchi, H. & Hatanaka, M. 1991, "Inhibition of cell growth and tumorigenesis of human glioblastoma cells by a neutralizing antibody against human basic fibroblast growth factor", FEBS letters, vol. 288, no. 1-2, pp. 65-71.

Takahashi, S., Kawarabayasi, Y., Nakai, T., Sakai, J. & Yamamoto, T. 1992, "Rabbit very low density lipoprotein receptor: a low density lipoprotein receptor-like protein with distinct ligand specificity", Proceedings of the National Academy of Sciences of the United States of America, vol. 89, no. 19, pp. 9252-9256.

Takahashi, T., Ueno, H. & Shibuya, M. 1999, "VEGF activates protein kinase C-dependent, but Ras-independent Raf-MEK-MAP kinase pathway for DNA synthesis in primary endothelial cells", Oncogene, vol. 18, no. 13, pp. 2221-2230.

Tammela, T., Enholm, B., Alitalo, K. & Paavonen, K. 2005, "The biology of vascular endothelial growth factors", Cardiovascular research, vol. 65, pp. 550-563.

Tammela, T., Zarkada, G., Wallgard, E., Murtomaki, A., Suchting, S., Wirzenius, M., Waltari, M., Hellstrom, M., Schomber, T., Peltonen, R., Freitas, C., Duarte, A., Isoniemi, H., Laakkonen, P., Christofori, G., Yla-Herttuala, S., Shibuya, M., Pytowski, B., Eichmann, A., Betsholtz, C. & Alitalo, K. 2008, "Blocking VEGFR-3 suppresses angiogenic sprouting and vascular network formation", Nature, vol. 454, no. 7204, pp. 656-660.

Tarallo, V., Vesci, L., Capasso, O., Esposito, M.T., Riccioni, T., Pastore, L., Orlandi, A., Pisano, C. & De Falco, S. 2010, "A placental growth factor variant unable to recognize vascular endothelial growth factor (VEGF) receptor-1 inhibits VEGF-dependent tumor angiogenesis via heterodimerization", Cancer research, vol. 70, no. 5, pp. 1804-1813.

68

Terman, B.I., Carrion, M.E., Kovacs, E., Rasmussen, B.A., Eddy, R.L. & Shows, T.B. 1991, "Identification of a new endothelial cell growth factor receptor tyrosine kinase", Oncogene, vol. 6, no. 9, pp. 1677-1683.

Tischer, E., Mitchell, R., Hartman, T., Silva, M., Gospodarowicz, D., Fiddes, J.C. & Abraham, J.A. 1991, "The human gene for vascular endothelial growth factor. Multiple protein forms are encoded through alternative exon splicing", The Journal of biological chemistry, vol. 266, no. 18, pp. 11947-11954.

Tiscornia, G., Singer, O., Ikawa, M. & Verma, I.M. 2003, "A general method for gene knockdown in mice by using lentiviral vectors expressing small interfering RNA", Proceedings of the National Academy of Sciences of the United States of America, vol. 100, no. 4, pp. 1844-1848.

Tiscornia, G., Tergaonkar, V., Galimi, F. & Verma, I.M. 2004, "From The Cover: CRE recombinase-inducible RNA interference mediated by lentiviral vectors", PNAS, vol. 101, no. 19, pp. 7347-7351.

Torres-Vazquez, J., Kamei, M. & Weinstein, B.M. 2003, "Molecular distinction between arteries and veins", Cell and tissue research, vol. 314, no. 1, pp. 43-59.

Trono, D. 2000, "Lentiviral vectors: turning a deadly foe into a therapeutic agent", Gene therapy, vol. 7, no. 1, pp. 20-23.

Tugues, S., Koch, S., Gualandi, L., Li, X. & Claesson-Welsh, L. 2011, "Vascular endothelial growth factors and receptors: anti-angiogenic therapy in the treatment of cancer", Molecular aspects of medicine, vol. 32, no. 2, pp. 88-111.

Valenzuela, D.M., Griffiths, J.A., Rojas, J., Aldrich, T.H., Jones, P.F., Zhou, H., McClain, J., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Huang, T., Papadopoulos, N., Maisonpierre, P.C., Davis, S. & Yancopoulos, G.D. 1999, "Angiopoietins 3 and 4: diverging gene counterparts in mice and humans", Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 5, pp. 1904-1909.

Van den Haute, C., Eggermont, K., Nuttin, B., Debyser, Z. & Baekelandt, V. 2003, "Lentiviral vector-mediated delivery of short hairpin RNA results in persistent knockdown of gene expression in mouse brain", Human Gene Therapy, vol. 14, no. 18, pp. 1799-1807.

van Royen, N., Piek, J.J., Buschmann, I., Hoefer, I., Voskuil, M. & Schaper, W. 2001, "Stimulation of arteriogenesis; a new concept for the treatment of arterial occlusive disease", Cardiovascular research, vol. 49, no. 3, pp. 543-553.

69

Varmus, H. & Swanstrom, R. 1985, "Replication of retroviruses" in RNA Tumor Viruses, eds. R. Weiss, N. Teich, H. Varmus & J. Coffin, Cold Spring Harbor Laboratory Press, New York, pp. 75.

Veikkola, T., Jussila, L., Makinen, T., Karpanen, T., Jeltsch, M., Petrova, T.V., Kubo, H., Thurston, G., McDonald, D.M., Achen, M.G., Stacker, S.A. & Alitalo, K. 2001, "Signalling via vascular endothelial growth factor receptor-3 is sufficient for lymphangiogenesis in transgenic mice", The EMBO journal, vol. 20, no. 6, pp. 1223-1231.

Ventura, A., Meissner, A., Dillon, C.P., McManus, M., Sharp, P.A., Van Parijs, L., Jaenisch, R. & Jacks, T. 2004, "Cre-lox-regulated conditional RNA interference from transgenes", Proceedings of the National Academy of Sciences of the United States of America, vol. 101, no. 28, pp. 10380-10385.

Viita, H., Kinnunen, K., Eriksson, E., Lahteenvuo, J., Babu, M., Kalesnykas, G., Heikura, T., Laidinen, S., Takalo, T. & Yla-Herttuala, S. 2009, "Intravitreal adenoviral 15-lipoxygenase-1 gene transfer prevents vascular endothelial growth factor A-induced neovascularization in rabbit eyes", Human Gene Therapy, vol. 20, no. 12, pp. 1679-1686.

Wang, H.U., Chen, Z.F. & Anderson, D.J. 1998, "Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4", Cell, vol. 93, no. 5, pp. 741-753.

Wang, J., Guo, Y., Wang, B., Bi, J., Li, K., Liang, X., Chu, H. & Jiang, H. 2012, "Lymphatic microvessel density and vascular endothelial growth factor-C and -D as prognostic factors in breast cancer: a systematic review and meta-analysis of the literature", Molecular biology reports, vol. 39, no. 12, pp. 11153-11165.

Warren, A.G., Brorson, H., Borud, L.J. & Slavin, S.A. 2007, "Lymphedema: a comprehensive review", Annals of Plastic Surgery, vol. 59, no. 4, pp. 464-472.

Xia, X.G., Zhou, H., Samper, E., Melov, S. & Xu, Z. 2006, "Pol II-expressed shRNA knocks down Sod2 gene expression and causes phenotypes of the gene knockout in mice", PLoS genetics, vol. 2, no. 1, pp. e10.

Xu, D., Fuster, M.M., Lawrence, R. & Esko, J.D. 2011, "Heparan sulfate regulates VEGF165- and VEGF121-mediated vascular hyperpermeability", The Journal of biological chemistry, vol. 286, no. 1, pp. 737-745.

Yancopoulos, G.D., Klagsbrun, M. & Folkman, J. 1998, "Vasculogenesis, angiogenesis, and growth factors: ephrins enter the fray at the border", Cell, vol. 93, no. 5, pp. 661-664.

70

Yang, S.H., Agca, Y., Cheng, P.H., Yang, J.J., Agca, C. & Chan, A.W. 2007, "Enhanced transgenesis by intracytoplasmic injection of envelope-free lentivirus", Genesis (New York, N.Y.: 2000), vol. 45, no. 4, pp. 177-183.

Ylä-Herttuala, S. 2007, "Vascular Endothelial Growth Factors: Biology and Current Status of Clinical Applications in Cardiovascular Medicine", Journal of the American College of Cardiology, vol. 49, no. 10, pp. 1015-1026.

Yla-Herttuala, S. 2009, "Gene therapy with vascular endothelial growth factors", Biochemical Society transactions, vol. 37, no. Pt 6, pp. 1198-1200.

Yuan, L., Moyon, D., Pardanaud, L., Breant, C., Karkkainen, M.J., Alitalo, K. & Eichmann, A. 2002, "Abnormal lymphatic vessel development in neuropilin 2 mutant mice", Development (Cambridge, England), vol. 129, no. 20, pp. 4797-4806.

Zachary, I. & Gliki, G. 2001, "Signaling transduction mechanisms mediating biological actions of the vascular endothelial growth factor family", Cardiovascular research, vol. 49, no. 3, pp. 568-581.

Zeng, Y., Cai, X. & Cullen, B.R. 2005, "Use of RNA polymerase II to transcribe artificial microRNAs", Methods in enzymology, vol. 392, pp. 371-380.

Zhang, F., Tang, Z., Hou, X., Lennartsson, J., Li, Y., Koch, A.W., Scotney, P., Lee, C., Arjunan, P., Dong, L., Kumar, A., Rissanen, T.T., Wang, B., Nagai, N., Fons, P., Fariss, R., Zhang, Y., Wawrousek, E., Tansey, G., Raber, J., Fong, G.H., Ding, H., Greenberg, D.A., Becker, K.G., Herbert, J.M., Nash, A., Yla-Herttuala, S., Cao, Y., Watts, R.J. & Li, X. 2009, "VEGF-B is dispensable for blood vessel growth but critical for their survival, and VEGF-B targeting inhibits pathological angiogenesis", Proceedings of the National Academy of Sciences of the United States of America, vol. 106, no. 15, pp. 6152-6157.

Zhao, Y.C., Ni, X.J., Li, Y., Dai, M., Yuan, Z.X., Zhu, Y.Y. & Luo, C.Y. 2012, "Peritumoral lymphangiogenesis induced by vascular endothelial growth factor C and D promotes lymph node metastasis in breast cancer patients", World journal of surgical oncology, vol. 10, pp. 165-7819-10-165.

Zhong, M.A., Zhang, H., Qi, X.Y., Lu, A.G., You, T.G., Gao, W., Guo, X.L., Zhou, Z.Q., Yang, Y. & Wang, C.J. 2011, "ShRNA-mediated gene silencing of heat shock protein 70 inhibits human colon cancer growth", Molecular medicine reports, vol. 4, no. 5, pp. 805-810.

Zhou, M., Sutliff, R.L., Paul, R.J., Lorenz, J.N., Hoying, J.B., Haudenschild, C.C., Yin, M., Coffin, J.D., Kong, L., Kranias, E.G., Luo, W., Boivin, G.P., Duffy, J.J., Pawlowski, S.A. & Doetschman, T. 1998, "Fibroblast growth factor 2 control of vascular tone", Nature medicine, vol. 4, no. 2, pp. 201-207.

71

Zhu, A.X., Sahani, D.V., Duda, D.G., di Tomaso, E., Ancukiewicz, M., Catalano, O.A., Sindhwani, V., Blaszkowsky, L.S., Yoon, S.S., Lahdenranta, J., Bhargava, P., Meyerhardt, J., Clark, J.W., Kwak, E.L., Hezel, A.F., Miksad, R., Abrams, T.A., Enzinger, P.C., Fuchs, C.S., Ryan, D.P. & Jain, R.K. 2009, "Efficacy, safety, and potential biomarkers of sunitinib monotherapy in advanced hepatocellular carcinoma: a phase II study", Journal of clinical oncology : official journal of the American Society of Clinical Oncology, vol. 27, no. 18, pp. 3027-3035.

Zufferey, R., Dull, T., Mandel, R.J., Bukovsky, A., Quiroz, D., Naldini, L. & Trono, D. 1998, "Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery", Journal of virology, vol. 72, no. 12, pp. 9873-9880.

Zuo, K., Li, D., Pulli, B., Yu, F., Cai, H., Yuan, X., Zhang, X. & Lv, Z. 2012, "Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo", Biochemical and biophysical research communications, vol. 421, no. 2, pp. 396-402.

72

Publications of the University of Eastern Finland

Dissertations in Health Sciences

isbn 978-952-61-1026-4

Publications of the University of Eastern FinlandDissertations in Health Sciences

dissertatio

ns | 151 | A

ntti K

otim

aa | V

ascular En

dothelial G

rowth F

actor D - B

iology and F

unction in T

ransgenic an

d Kn

ockdown M

ice

Antti KotimaaVascular Endothelial

Growth Factor D Biology and Function in Transgenic and

Knockdown Mice

Antti Kotimaa

Vascular Endothelial Growth Factor DBiology and Function in Transgenic and

Knockdown Mice

Disturbances in the development

and function of blood- or lymphatic

vasculature are involved in many

diseases. Vascular endothelial

growth factors are central mediators

in vascular development. In this

thesis, a lentiviral perivitelline

transgenesis method was used

to study the role of VEGF-D in

cardiovascular diseases, ischemic

conditions and tumor formation. It

clarifies the function of VEGF-D in

angiogenesis and shows a potential

use as a treatment in tissue ischemia.

However, unregulated long-

term expression promoted tumor

formation.