kirino et al, supplement, page 6 of 16 · 36 -grarg, 51 grgra, 67 grg, 83 arg, 96 grgrg, 113-grg,...

s u p p l e m e n ta ry i n f o r m at i o n

www.nature.com/naturecellbiology 1

DOI: 10.1038/ncb1872

Figure S1 Immunofluorescence with 17.8 anti-Mili monoclonal antibody of mouse testis. Mouse testis sections stained with 17.8 anti-Mili monoclonal

antibody (green) and counterstained with DAPI (blue). Arrow shows a chromatoid body; scale bar = 10µm

Kirino et al, Supplement, page 6 of 16

© 2009 Macmillan Publishers Limited. All rights reserved.


2 www.nature.com/naturecellbiology

Figure S2 piRNPs do not associate with spliceosomes or the hnRNP or SMN complexes. Immunoprecipitations were performed from mouse testis with the following antibodies: Nonimmune mouse serum “NMS” (negative control); Y12 antibody “Y12”; anti-trimethylguanosine “TMG”, which recognizes the trimethylated small nuclear RNAs (snRNAs) and immunoprecipitates spliceosomal snRNPs; “4F4”, an anti-hnRNP C antibody that immunoprcipitate hnRNP complexes; and anti-SMN complex antibodies: “2B1”, anti-SMN; “12H12” anti-Gemin3; “10G11”, anti-Gemin5. RNA was isolated from the immunoprecipitates or from mouse testis total RNA,

dephosphorylated with calf intestinal phosphatase to remove 5'-phosphates and was then either 5’-end labeled with [γ-32P] ATP and T4 PNK or 3’-end labeled by [32P] pCp and T4 RNA ligase. Labeled RNA was resolved by electrophoresis on 15% denaturing polyacrylamide gels. Lane marked “M” contains 32P-labeled pBR322/MspI digest as size marker; nucleotide sizes are indicated on the left. piRNAs are not visible in the 3'-end-labeled Y12 lane in this exposure because the 3'-termini of piRNAs are 2'-O-methylated and they are poor substrates for T4 RNA ligase 9. 3’-end labeled snRNAs are present in the Y12 and TMG immunoprecipitates.





Figure S3 Y12 immunoprecipitates piRNAs but not miRNAs. Northern blots with indicated probes of total RNA from mouse testis or RNA from indicated immunoprecipitates





Figure S4 Dendrogram of mouse, Xenopus and Drosophila Piwi family proteins. Accession numbers of protein and translated ESTs used to construct the phylogenetic tree: Miwi: BAA93705; Mili: BAA93706; Miwi2: NP_808573;

DmPiwi: AAD08705; DmAub: CAA64320 and DmAgo3: ABO26294. IDs of EST sequences from Xenopus tropicalis Gurdon EST database are Xiwi: Xt6.1-CAAO5145.3.5; Xili: Xt6.1-CAAN4954.5.5 and Xiwi2: Xt6.1-CAAM16059.3.5.





Figure S5 mRNA levels of Piwi, Aub and Ago3 are not altered in csul ovaries. mRNAs of Drosophila Piwi, Aub and Ago3 proteins from wild-type, heterozygous “+/-” or homozygous “-/-” csul ovaries were analyzed by qRT-PCR. The average ratios relative to wild-type from five independent experiments are shown; n=3 and s.d. shown





Figure S6 Full scans for indicated figures


Supplementary Figure 6

Full scans for indicated figures


Supplementary Tables Supplementary Table 1 Peptide sequences obtained from mass spectrometry of proteins from immunoprecipitations of mouse testis Y12 immunoprecipitation Protein Amino acid number Peptide

Miwi 54-62 GMVVGATSK

744-748 RVNAR

749-756 FFAQSGGR

Mili 116-130 SSLPDPSVLAAGDSK

626-633 IAGPIGMR

17.8 (anti-Mili) immunoprecipitation Protein Amino acid number Peptide

Mili 51-64 KPEDSSPPLQPVQK

116-130 SSLPDPSVLAAGDSK

131-140 LAEASVGWSR

219-230 GTPQSLGLNLIK

283-290 LQQVVELK

294-303 KTDDAEISIK

537-549 ISQNETASNELTR

618-625 ELVNMLEK

626-633 IAGPIGMR

653-663 TIQSLLGVEGK

822-833 TVANYEIPQLQK


Supplementary Table 2 Putative sDMA motifs (GRG, ARG/GRA) present within animal Piwi proteins and plant Ago proteins; numbers refer to amino acid positions.

Species Proteins Number of potential sDMAs

sDMA motifs

Hiwi 10 3-GRARARARGRARG, 48-GRGRQRG, 728-GRG

Hili 6 40-GRG, 46-GRG, 96-GRG, 101-GRG, 145-GRG, 157-GRA

Hiwi3 7 3-GRARTRARGRAR, 63-ARG H.sapiens

Hiwi4 3 3-GRAR, 9-ARG Miwi 10 3-GRARARARGRARG, 48-GRGRQRG, 729-GRG

Mili 7 38-GRA, 44-GRG, 94-GRG, 99-GRG, 143-GRG, 155-GRA, 162-GRG M.musculus

Miwi2 4 66-GRARVRARG Xiwi 9 3-GRARARARGRARG, 55-GRGRQRG Xili 5 12-GRG, 19-GRG, 63-GRAR, 82-GRG X.tropicalis Xiwi2 8 3-GRARARARGRARG, 45-GRGR Ziwi 8 3-GRARARSRGRGRG, 46-GRGR

D.rerio Zili 13 36-GRARG, 51-GRGRA, 67-GRG, 83-ARG, 96-GRGRG,

113-GRG, 174-GRG, 220-GRG, 227-GRA, 237-GRG Piwi 2 6-GRGR Aub 4 10-ARGRGRGR D.melanogaster Ago3 4 3-GRG, 67-GRGRAR

C.elegans Prg1 4 6-GRGRGRG, 416-ARG Schmidtea

mediterranea (Planaria)

Smedwi-3 6 8-GRGR, 99-GRGRG, 134-GRGRG

Ago1 9 29-GRG, 47-GRG, 58-GRGGRG, 82-GRGRG, 93-GRG, 100-GRG, 1014-ARG

Ago2 9 9-GRG, 13-GRGRGGRG, 42-GRGRG, 57-GRG, 78-GRG, 111-GRG

Ago3 23

9-GRG, 13-GRGRG, 23-GRG, 28-GRG, 32-GRGRG, 45-GRG, 51-GRG, 59-GRG, 64-GRG, 68-GRGRG, 78-GRG, 83-GRG, 89-GRG, 97-GRG, 102-GRGRG, 128-GRG, 232-GRG, 252-GRG, 1051-GRA

A.thaliana

Ago5 9 15-GRG, 44-GRG, 52-GRGRG, 59-GRG, 81-GRGRG, 152-GRG, 319-GRG


Supplementary Table 3 Peptides sequences obtained from mass spectrometry of proteins from Y12 immunoprecipitations of Xenopus laevis oocytes Protein Amino acid number Peptide

Xiwi 304-311 DFADAVTK

345-357 SDGSDISFVDYYR

406-419 NDFGVMRDLAVHTR

526-533 VAQQIGMR

598-611 TLSKPQTVLSVATK

651-661 SIAGFVASMNR

756-763 FFAHLGGR

Xili 49-59 VQQASDFSTER

751-758 MVVIVVQK



Supplementary Results

Xenopus laevis piRNA analysis

Lower bound estimates on the number of X. laevis piRNAs

Deep sequencing of the Y12-immunopurified piRNAs from X. laevis and analysis by the

Illumina-provided toolset resulted in two sets comprising 270,596 (testis) and 663,226 (oocyte)

respectively. Approximately 96.7% of the testis reads were sequenced 3 or fewer times whereas ~85.4%

were sequenced exactly once. Similar observations held for the oocyte reads: ~ 92.5% of them were

sequenced 3 or fewer times whereas ~78.4% were sequenced exactly once.

Our earlier experience with high-throughput sequencing data has shown that a considerable

fraction of the reads cannot be located exactly in the genome of origin. This could be due to modifications

of the RNAs that occur prior to their being sequenced, errors introduced by the sequencing process itself,

or both. Generally, we have found that many more of the reported reads can be located in the genome if

one permits “editing” (typically replacement of one nucleotide by another suffices) at a small fraction of

the reads’ positions: for reads of the length discussed here, 10% of the length represents a reasonable,

albeit perhaps conservative, estimate.

The ability to locate the sequenced reads on the studied genome, in the presence of errors, could

in principle permit us to estimate a lower bound on the number of reads that correspond to true piRNAs.

However, in the absence of a genome sequence for X. laevis, this is not possible. Instead, we opted for

clustering of the reported that relied on their nucleotide sequence. This clustering process proceeded as

follows:

the reads of the set under consideration (i.e. testis and oocyte, in turn) are sorted in order of

decreasing number of copies that were sequenced;

initially, all reads of the set at hand are labeled ‘unprocessed’

let R represent be the next ‘unprocessed’ read

form a new read-cluster and assign R to be the cluster’s “leader”

compare R with the next ‘unprocessed’ read r in the set under consideration:

o if r and R agree identically on at least X% of the positions of the shorter of the two reads,

then

label r as ‘processed’, and

assign r to the cluster led by R

otherwise, do nothing

continue until no more ‘unprocessed’ reads remain



Using this procedure, we clustered the testis and oocyte reads for two choices of X: 90%, 80%. A

value of X=90% is in our estimate more representative of the combined impact that RNA editing and/or

sequencing error introduce to the reported sequences. The other choice, i.e. 80%, was meant to examine

how the number of resulting clusters will change if one increases the permitted tolerance.

At X=90% the 270,596 testis reads generated 198,200 clusters of one or more members,

suggesting that the sequenced reads were generally distinct from one another. This observation is

supported by the fact that the much more tolerant threshold of 80% results in only a small decrease in the

number (165,383) of formed clusters. Repeating the above analysis for the 663,226 oocyte reads gives

rise to 370,167 clusters of one or more members at X=90% and 279,074 clusters at X=80%.

The four sets of clusters (testis at 80% and 90%, oocyte at 80% and 90%) as well as the two sets

of reads we obtained from the Illumina analyzer are available for download at

http://cbcsrv.watson.ibm.com/piwi_modification/. In this directory, one can find the following files:

xl_testis.txt.gz

[email protected]

[email protected]

xl_oocyte.txt.gz

[email protected]

[email protected]

All the files contain plain text and have been compressed using the “gzip” utility. The files testis.txt and

oocyte.txt contain the sequenced reads sorted according to their copy numbers. The four files containing

the read clusters conform to the following format: …

…

>> CLUSTER 92

**532 TCAGAGAAAAAGCAGGGGACCATGGAAC

458 TCAGAGAAAAAGCAGGGGACCATGGAAT

132 TCAGAGAAAAAGCAGGGGACCATGGATC

90 CAGAGAAAAAGCAGGGGACCATGGAACA

36 GTCAGAGAAAAAGCAGGGGACCATGGAA

27 TCAGAGAAAAAGCAGGGGACCATGGAAA

24 TCAGAGAAAAAGCAGGGGACCATGGTCG

21 CAGAGAAAAAGCAGGGGACCATGGAATC

…

…



The read that is marked with the “**” is the read leading the cluster, in this example

TCAGAGAAAAAGCAGGGGACCATGGAAC. The number preceding each read is the number of copies that were

obtained through high-throughput sequencing. Finally, the reads following the read-leader are the

cluster’s members.

Estimating the overlap of testis and oocyte piRNAs from X. laevis

We next attempted to estimate the overlap of the two sets of reads, testis and oocyte. In view of

the fact that the sequences at hand contain “errors” and in the absence of a genome on which we could

deposit the reads, this is not a straightforward question to answer.

One straightforward step would be to compare exact strings from the testis set with exact strings

from the oocyte set: doing so would underestimate the overlap, so one must treat the resulting number as

indicative of the degree of set overlap, and not representative. Considering the constraints of this

particular set of reads, we also carried out the following computation: we compared the reads from one set

to those of the other set allowing mismatches of at most Y% of the reads positions, with Y=5%, 10% and

20%.

When we compare the testis reads with the oocyte reads we find that at:

Y=0% 25,616 of 270,596 testis reads have counterparts in 25,616 of 663,226 oocyte reads



Y=20% 70,504 of 270,596 testis reads have counterparts in 133,714 of 663,226 oocyte reads.

The immediate conclusion from these comparisons is that the two sets of reads are largely

distinct, even at the rather tolerant threshold of 80%.

Evidence for a piRNA amplification ("ping-pong") loop

Analysis of the X. laevis piRNA reads showed that both the testis and oocyte collections, satisfy a

piRNA amplification (“ping-pong”) model.

Starting from the 5’ end and examining positions 1 through 10 inclusive of all 264,143 testis

piRNA reads reveals that there are only 150,294 unique 10-mers that span them. Of these 10-mers, 84,600

are found spanning these positions both as ‘sense’ (42,300) and as ‘antisense’ (42,300), and account for

more than 50% of all sequenced testis piRNA reads.

When we repeat this analysis for the oocyte collection, we find analogous results. Positions 1

through 10 inclusive from the 5’ end of all 659,831 oocyte piRNA reads are accounted for by 258,053

unique 10-mers only. Of these 10-mers, 206,894 are found spanning these positions both as ‘sense’



(103,447) and as ‘antisense’ (103,447), and account for nearly 2/3rds of all sequenced oocyte piRNA

reads.

To summarize, the majority of the piRNA reads in each of the two collections support the “ping-

pong” model of piRNA amplification in X. laevis. In order to facilitate further analyses by colleagues, we

have sub-selected and grouped those piRNA reads that support the model. In particular, we have created

two files, xl_ping_pong.testis.10.txt.gz and xl_ping_pong.oocyte.10.txt.gz that are available for

download at http://cbcsrv.watson.ibm.com/piwi_modification/. These two files contain plain text and

have been compressed using the “gzip” utility. Both files use the same format convention. File

xl_ping_pong.testis.10.txt.gz contains 42,300 groups of reads with each group being headed by a 10-mer

that is followed by two columns of piRNA reads: on the left column, we list those testis piRNA reads

where the 10-mer spans positions 1 through 10 as ‘sense’ whereas on the right column we list those reads

whose positions 1 through 10 contain the 10-mer as ‘antisense.’ An example such grouping is shown

next: the 10-mer and its reverse complement are shown underlined and in boldface. File

xl_ping_pong.oocyte.10.txt.gz contains analogous groupings but for oocyte piRNA reads (103,447

groupings in total). We expect that these two files will allow a practitioner to quickly identify relevant

groups of reads for his/her sequence of interest.

Example Grouping:

--------------------------------------------------------------------------

ACCAGACAAA

ACCAGACAAAGACCAAATGCTACAATCC TTTGTCTGGTTTTTGTAAAGGTGCAATA

ACCAGACAAAGAAATATACAGATATATA TTTGTCTGGTGAAGTGTTGCGATGGCTC

TTTGTCTGGTGAAGTGTTGCAATGGTCG

TTTGTCTGGTGAAGTGTTGCAATGGCTT

TTTGTCTGGTGAAGTGTTGCGATGGCTT

TTTGTCTGGTGAAGTGTTGCAATGGGTT

--------------------------------------------------------------------------

Reactivity of antibodies to sDMAs Although both Y12 and SYM11 antibodies recognize sDMAs, Y12 appears to have higher

affinity for Mili while SYM11 appears to have higher affinity for Miwi. This is likely due to the fact that

the epitopes that Y12 and SYM11 recognize differ in the configuration and spacing of GRG, ARG and

GRA triplets 1 2 3.



The weaker reactivity of SYM11 towards Piwi and Ago3 likely reflects the higher affinity of

SYM11 towards sDMAs that are found in tandem 2 3 and the levels of different Piwi proteins. Aub, which

reacts strongly with SYM11 contains four putative sDMAs in tandem whereas Piwi and Ago3 contain

two and three, respectively (Supplementary Table 2); and Ago3 is expressed in lower levels in

Drosophila ovaries than Aub or Piwi 4.

Supplementary Discussion

Piwi protein is essential for self-renewal and maintenance of germline stem cells in ovaries and

absence of the piwi gene leads to severe defects in oogenesis 5. Piwi is predominantly a nuclear protein

and associates with piRNAs that are antisense to transposons 4 6. In homozygous csul ovaries the Piwi

protein does not contain sDMAs and although Piwi protein levels are moderately reduced, oogenesis

proceeds normally, indicating that sDMA modification in Piwi proteins apparently is not required for

oogenesis. In contrast, loss of sDMAs of Ago3 and Aub in csul ovaries leads to severe reduction of the

Ago3 and Aub protein levels. Interestingly, both Ago3 and Aub are cytoplasmic proteins. Ago3 associates

with piRNAs that are in sense orientation to transposons, while Aub associates with piRNAs that are

antisense to transposons 4 6. The antisense piRNAs of Aub and Piwi target transposons for

endonucleolytic cleavage resulting in transposon degradation and the generation of antisense piRNAs

from the targeted transposons that are loaded to Ago3 protein 4 6. Ago3-bound sense piRNAs in turn may

target antisense strands of transposon-containing transcripts spawning new antisense piRNAs that are

loaded in Aub and Piwi proteins, leading to a piRNA generating cycle known as the ping-pong

amplification loop 6 4. How primary piRNAs are generated and the precise biogenesis of piRNAs remains

unknown. It is possible that sDMA modifications of Aub, Ago3 and Piwi proteins are required for

efficient biogenesis or amplification of piRNAs and the reduced amount of Aub, Ago3 and Piwi reflect a

reduction in piRNA production. Alternatively, sDMAs may be required to stabilize Piwi proteins. The

net effect of lack of sDMA modifications of Piwi proteins is reduction of the levels of piRNAs, especially

the ones that associate with Aub and Ago3 since Aub and Ago3 protein levels are drastically reduced, and

upregulation of transposon levels. Maternally inherited Aub is required for specification of germ cells in

the developing embryo 7 and maternally inherited piRNAs are important for suppressing transposons in

the germline of the developing embryo 8. A likely mechanism to account, at least in part, for the

grandchildless phenotype of csul mutants may thus be the reduction of maternally inherited Aub, and also

Ago3 and Piwi, and their bound piRNAs.



Supplementary Methods

Antibodies

To produce a monoclonal antibody against Mili, full-length GST-Mili protein was purified from

baculovirus infected Sf9 cells by using Glutathione Sepharose 4B resin (GE Healthcare–Amersham

Biosciences), and used as antigen to immunize mice. Injections, hybridoma production, screening, and

ascites production were done as described previously 10, resulting in the “17.8” anti-Mili antibody.

For western blotting and immunoprecipitation, the 17.8 anti-Mili, Y12, anti-Flag (Sigma), anti-

sDMA (SYM11; Millipore), anti-aDMA (ASYM24; Millipore), anti-TMG (Santa Cruz Biotech), anti-β-

tubulin (Developmental Studies Hybridoma Bank), anti-hnRNPC (4F4), anti-SMN (2B1), anti-Gemin3

(12H12) and anti-Gemin5 (10G11) were used. Monoclonal antibodies Y12, 2B1, 4F4, 2B1, 12H12 and

10G11 were gifts from G. Dreyfuss. Antibodies against the Drosophila Ago1, Aub, Piwi and Ago3 were

gifts from MC. Siomi and H. Siomi 4, 11, 12.

Western blots and immunoprecipitations

Cell lysates were prepared from mouse testis (Pel-Freez Biologicals), Xenopus laevis oocytes,

testis, liver or Drosophila ovaries in a lysis buffer (20 mM Tris-HCL pH 7.5, 200 mM NaCl, 2.5 mM

MgCl2, 0.5 % NP-40, 0.1 % Triton-X100 and complete EDTA-free protease inhibitors (Roche)). Western

blots were performed as previously described 13. 17.8 anti-Mili ascites was used at 1:500 dilution.

Immunoprecipitations were performed essentially as described 14 15 .For immunoprecipitation of Mili

proteins, 5 µl of 17.8 anti-Mili ascites was used with 20 µl of protein-G agarose (Invitrogen). For

immunoprecipitations of Flag-tagged proteins, anti-Flag M2 agarose (Sigma) was used.

RNA isolation, labeling and β-elimination

RNA isolation, labeling and β-elimination were performed as previously described9. Briefly,

RNA was isolated from tissues or immunoprecipitates using Trizol (Invitrogen) and treated with calf

intestinal phosphatase (CIP; New England Biolabs). The 5’-dephosphorylated RNAs were then subjected

either to 5’- end labeling using [γ-32P] ATP and T4 polynucleotide kinase (T4 PNK, New England

Biolabs), or 3’- end labeling using [32P]pCp (GE Healthcare) and T4 RNA Ligase (New England

Biolabs). The labeled RNAs were resolved by 15 % PAGE containing 7 M urea and were visualized by

storage phosphor autoradiography using a Storm 860 PhosphorImager and ImageQuant software (GE

Healthcare). Sodium periodate (NaIO4) reaction was performed by incubating RNA in 50 µl of 10 mM

NaIO4 at 0 °C for 40 min in the dark. Five µl of 1 M rhamnose was added to quench unreacted NaIO4 and

incubated at 0 °C for additional 30 min. β-elimination was then performed by adding 55 µl of 2 M Lys-



HCl (pH 8.5) followed by incubation at 45 °C for 90 min. The treated RNAs were collected by ethanol

precipitation and resolved by 15 % PAGE containing 7M Urea. A 5’-labeled 28 nt synthetic RNA with

mouse piR-3 sequence (5’ 32P-UGAGAGUGGCAUCUAAAUGUUUAGUGGU-OH 3’) was used for a

control.

Northern blot analysis

Total RNA or RNA extracted from immunoprecipitates was resolved by 15 % PAGE containing

7 M urea, transferred to Hybond N+ membrane (GE Healthcare) and hybridized to 5’-end labeled probes,

antisense to mouse piR-1 (5’-AAAGCTATCTGAGCACCTGTGTTCATGTCA-3’) and miR-16 (5’-

CGCCAATATTTACGTGCTGCTA-3’), and Drosophila #1 roo antisense rasiRNA (5’-

TGGGCTCCGTTCATATCTTATG-3’), miR-8 (5’-GACATCTTTACCTGACAGTATTA-3’) and 2S

RNA (5’-TACAACCCTCAACCATATGTAGTCCAAGCA-3’) as described in 16.

Recombinant proteins and cDNA constructs

Recombinant Flag-Miwi and Flag-Mili (Figure 1e) and GST-Mili (used as immunogen to

generate anti-Mili monoclonal 17.8) were produced in baculovirus infected Sf9 cells. Briefly, for Flag-

Miwi, nucleotides 159 to 2744 of AB032604 were subcloned into the EcoRI/XbaI restriction sites of

pFASTBAC-FLAG(tev). For Flag-Mili, nucleotides 198 to 3113 of AB032605 were subcloned into the

EcoRI/XbaI restriction sites of pFASTBAC-FLAG(tev); all constructs were verified by sequencing.

Baculovirus transfer vectors were transformed into DH10Bac cells and recovered bacmid DNA was

screened by PCR with M13 sequencing primers for proper transposition of the transfer vector into the

baculovirus genome. Positive bacmid DNAs were transfected into Sf9 cells and passage 1 (P1) virus

stocks were recovered 96 hours post-transfection. A high-titer P2 virus stock was generated by infecting

Sf9 at an MOI of ~0.1, followed by incubation for 96-120 hours. For productions, 1 x 106 Sf9 cells/ml of

Sf900-II medium (Invitrogen) were infected with viruses for the Flag-Miwi and Flag-Mili proteins,

respectively, at an MOI of 1. Infected cells were harvested 48 hours post-infection and the recombinant

proteins were purified by immunoprecipitation using anti-Flag M2 agarose (Sigma).

The cDNAs for Flag-Miwi and Flag-Mili and Flag-Miwi truncations mutants (BC for 68-862aa of

Miwi and NP for 1-212aa) were gifts from S. Kuramochi-Miyagawa and T. Nakano 17. Full-length or

deletion mutants of Flag-Miwi (Figure 1f) were produced in 293T cells by vector transfection using

Lipofectamine 2000 (invitrogen).

Drosophila stocks



csul flies (csulRM: w–;csulRM50/CyO), were a gift from J. Anne 18 and a deletion that uncovers csul

(wa Nfa-g; Df(2R)Jp7, w–/CyO) was obtained from Bloomington Drosophila Stock Center (Indiana

University).

Xenopus laevis

Oocytes were isolated from ovaries and defolliculated as described in 19. Testis and liver tissues

were procured from euthanized animals.

piRNA sequencing

Y12-immunopurified X. laevis piRNAs from testis and oocytes were 5'-end labeled and gel

purified. Directional ligation of adapters and cDNA generation was performed using the small RNA

sample prep kit (Illumina). Deep sequencing was performed on an Illumina Genome Analyzer.

Quantitative RT-PCR analysis

Total RNA sample from Drosophila ovaries was first treated with RQ1 DNase (Promega). 0.2 µg

of DNase-treated total RNA was used to reverse transcribe target sequences using each gene-specific

reverse primer (described below) and SuperScript II reverse transcriptase (Invitrogen). The resulting

cDNA was analyzed by quantitative RT-PCR performed by LightCycler 480 instrument (Roche) using

LightCycler 480 SYBR Green I master (Roche). Relative steady-state mRNA levels were determined

from the threshold cycle for amplification using the 2-CT method 20. RP49 was used as a control. The

following primer pairs were used for the RT-PCR; Piwi, forward (5’-

TGGACAGCAGAACATCGTGTTTC-3’) and reverse (5’-AGTAGAGTTCGGAGTTCATGG-3’); Aub,

forward (5’-AGCGTGCAGTAATGGGTATGGT-3’) and reverse (5’-

CGCGAATGATTATGTTGTATCGC-3’). Ago3, forward (5’-CATGAAATCGACAGTGGCTTGGA-3’)

and reverse (5’-ATGTGTCTATAAGCCTAGCACGTC-3’); HeT-A, forward (5’-

CGCGCGGAACCCATCTTCAGA-3’) and reverse (5’-CGCCGCAGTCGTTTGGTGAGT-3’); Rp49,

forward (5’-CCGCTTCAAGGGACAGTATCTG-3’) and reverse (5’-ATCTCGCCGCAGTAAACGC-

3’).

Immunofluorescence and confocal microscopy

Drosophila ovaries were dissected from adult flies in Robb's buffer. Immunostainings were

performed using monoclonal antibodies against Aub (purified, at 1:500 dilution), Piwi (supernatant, neat)

and Ago3 (purified, at 1:250 dilution) 4, as primary antibodies, and Alexa 594-conjugated anti-mouse IgG

(Molecular Probe) as the secondary antibody. Briefly, ovarioles were disaggregated from the dissected



ovaries and fixed for 20 minutes in 4% Formaldehyde/PBS, washed extensively with PBST-5 (PBS +

0.5% Triton X-100), permeabilized and blocked for 2 hours in PBST-5 containing 5% goat serum and

incubated with primary antibody overnight in the cold room at appropriate dilution in PBST-5-B (PBS +

0.5% Triton X-100 + 0.2% Tween-20 + 1% BSA). After extensive washes with PBST-5, ovarioles were

incubated with secondary antibody diluted in PBST-5-B for 2 hours, followed by extensive washes with

PBST-5 and PBS containing 0.2% Tween-20 and mounted. All images were acquired with a Zeiss LSM

510META NLO confocal microscope and identical magnification and settings were used for the pictures

shown in the same panel. For Figure 4e the following specifications, settings and magnification were

used: Wave length : Red = 543nm (1mW power, 100% transmission), blue (Dapi)=740nm (1W power,

2.5% transmission). Objectives: Plan Apochromat 20X/0.8(NA, numerical Aperture). Scan Zoom :

1.0Stack size : X = 450µm, Y = 450µm. Pixel : 1024 X 1024. Pinhole : 49µm for Red, 1000µm for Dapi.

Amplifier Gain : Red = 1.0, Dapi = 1.0. Amplifier Offset: Red = -0.06, Dapi = -0.07 (cutoff background,

like a threshold). Detector Gain : Red = 751, Dapi = 786.

For immunofluorescence of mouse testis with 17.8 anti-Mili antibody, testis from 3-month-old

B6 mice were fixed in 4% paraformaldehyde for 18 hours. The tissue was embedded in paraffin, 5µm

sections were cut, deparaffinized and treated with 10 mM sodium citrate buffer pH 6.0 at 950 C for 10

minutes for antigen retrieval. 17.8 (anti-mili) ascites was used at 1:100 dilution with anti-mouse Alexa-

488 Fab fragments (Invitrogen) for detection; nuclei were stained with DAPI. Images were acquired with

a Zeiss LSM10-META Confocal Laser scanning microscope.

In situ hybridization

The steps for colorimetric in situ hybridization were as described in 21 but with the following

variations. A Locked Nucleic Acid (LNA)-modified probe was designed against XL-piR-3, a frequently

sequenced X. laevis oocyte piRNA (XL-piR-3: 5'- UAAGUAGAAGAGCACCAAUGUCAUGUCC). The

sequence of the LNA probe was: 5'- ggAcatgaCattggtgcTcttctActta -3'-DIG (capital letters: LNA-

modified nucleotides; DIG: digoxigenin) and was synthesized by IDT. Defolliculated oocytes were fixed

with 10% Neutral buffered formalin, paraffin embedded and sectioned at 5µm. Slides were deparaffinized

in three changes of fresh xylene, rehydrated in graded alcohols 10 min each (100%, 100%, 95%, 95%,

70% and 50%), followed by two washings for 5 min distilled water (ddH2O) and then treated with 10 mM

sodium citrate buffer pH 6.0 at 950 C for 10 minutes, in lieu of proteinase K digestion. The slides were

cooled for 30 min at room temperature (RT) and washed three times for 5 min each with ddH2O, once

with PBS and prehybridized with 4x SSC, 3% BSA buffer at 480 C. The hybridization buffer (4x SSC,

10% dextran sulfate) was pre-warmed at 480 C. Hybridization was performed in hybridization buffer



containing 5 pmol of probe at 480 C for 5 hours. Slides were washed in a solution containing 4x SSC, 0.1

% Tween-20 at 52oC for and then for 5 min with agitation in 2x SSC buffer at 52oC, 5 min in 1X SSC

buffer at at 52oC and another 5 min in PBS at RT. Slides were incubated at RT in 100 mM Tris pH 7.5,

150 mM NaCl, 1% blocking reagent (Roche), 0.5% Triton and 1 mM Levamisole (to block endogenous

alkaline phosphatase) for 1 h. Fresh blocking buffer containing a 1/1000 dilution of anti-digoxigenin-

alkaline phosphatase Fab fragments (Roche) was applied overnight at 40 C. Slides were washed 4 times

for 10 min each in PBS/0.1 % Tween-20 (PBST) and washed 2 times for 10 min each in Staining solution

containing 10 mM Tris-HCl pH 9.0, 50 mM MgCl2, 100 mM NaCl, 0.1 % Tween-20, followed by

NBT/BCIP developing solution (10 ml Staining solution, 48 µl of 50 mg/ml NBT, 35 µl of 50 mg/ml

BCIP). Incubation in developing solution was usually complete by 2 hrs. Slides were rinsed in PBS,

ddH2O and were dehydrated by passing through a series of alcohols (50%, 75%, 95%, 100%, 100%) and

xylenes and coverslipped in PermaMount. Images were obtained using Leica LM LB2 microscope with a

digital camera Leica DFC-480.



Supplementary References 1. Brahms, H. et al. The C-terminal RG dipeptide repeats of the spliceosomal Sm proteins D1 and D3 contain

symmetrical dimethylarginines, which form a major B-cell epitope for anti-Sm autoantibodies. J Biol Chem 275, 17122-9 (2000).

2. Boisvert, F. M. et al. Symmetrical dimethylarginine methylation is required for the localization of SMN in Cajal bodies and pre-mRNA splicing. J Cell Biol 159, 957-69 (2002).

3. Boisvert, F. M., Cote, J., Boulanger, M. C. & Richard, S. A proteomic analysis of arginine-methylated protein complexes. Mol Cell Proteomics 2, 1319-30 (2003).

4. Gunawardane, L. S. et al. A slicer-mediated mechanism for repeat-associated siRNA 5' end formation in Drosophila. Science 315, 1587-90 (2007).

5. Cox, D. N. et al. A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev 12, 3715-27 (1998).

6. Brennecke, J. et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128, 1089-103 (2007).

7. Harris, A. N. & Macdonald, P. M. Aubergine encodes a Drosophila polar granule component required for pole cell formation and related to eIF2C. Development 128, 2823-32 (2001).

8. Brennecke, J. et al. An epigenetic role for maternally inherited piRNAs in transposon silencing. Science 322, 1387-92 (2008).

9. Kirino, Y. & Mourelatos, Z. Mouse Piwi-interacting RNAs are 2'-O-methylated at their 3' termini. Nat Struct Mol Biol 14, 347-8 (2007).

10. Choi, Y. D. & Dreyfuss, G. Monoclonal antibody characterization of the C proteins of heterogeneous nuclear ribonucleoprotein complexes in vertebrate cells. J Cell Biol 99, 1997-204 (1984).

11. Miyoshi, K., Tsukumo, H., Nagami, T., Siomi, H. & Siomi, M. C. Slicer function of Drosophila Argonautes and its involvement in RISC formation. Genes Dev 19, 2837-48 (2005).

12. Saito, K. et al. Specific association of Piwi with rasiRNAs derived from retrotransposon and heterochromatic regions in the Drosophila genome. Genes Dev 20, 2214-22 (2006).

13. Mourelatos, Z. et al. miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev 16, 720-8 (2002).

14. Kiriakidou, M., Nelson, P., Lamprinaki, S., Sharma, A. & Mourelatos, Z. Detection of microRNAs and assays to monitor microRNA activities in vivo and in vitro. Methods Mol Biol 309, 295-310 (2005).

15. Nelson, P. T. et al. A novel monoclonal antibody against human Argonaute proteins reveals unexpected characteristics of miRNAs in human blood cells. Rna 13, 1787-92 (2007).

16. Vagin, V. V. et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science 313, 320-4 (2006).

17. Kuramochi-Miyagawa, S. et al. Two mouse piwi-related genes: miwi and mili. Mech Dev 108, 121-33 (2001).

18. Anne, J., Ollo, R., Ephrussi, A. & Mechler, B. M. Arginine methyltransferase Capsuleen is essential for methylation of spliceosomal Sm proteins and germ cell formation in Drosophila. Development 134, 137-46 (2007).

19. Bossi, E., Fabbrini, M. S. & Ceriotti, A. Exogenous protein expression in Xenopus oocytes: basic procedures. Methods Mol Biol 375, 107-31 (2007).

20. Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-8 (2001).

21. Nelson, P. T. et al. RAKE and LNA-ISH reveal microRNA expression and localization in archival human brain. Rna 12, 187-91 (2006).


kirino et al, supplement, page 6 of 16 · 36 -grarg, 51 grgra, 67 grg, 83 arg, 96 grgrg, 113-grg,...

Documents