jurnal virus makanan

8/3/2019 Jurnal Virus Makanan

1/9

Original Articles

Antisense Oligonucleotides Targeting Abhydrolase DomainContaining 2 Block Human Hepatitis B Virus Propagation

Xiaoran Ding, Jing Yang, and Shengqi Wang

Hepatitis B virus (HBV) infection is a major health concern worldwide and only a minority of treated patientsdevelop a sustained protective response following a short course of therapy, and most patients require pro-longed treatment to suppress viral replication. However, several recent reports showed that inhibition of certainhost cell proteins prevented viral infection, specifically the human abhydrolase domain containing 2 (ABHD2)has been confirmed by our previous study to be upregulated in HepG2.2.15 cells but downregulated by lami-vudine. These observations suggested that ABHD2 was important for HBV propagation and could be a target of

novel anti-HBV drugs. To assess the importance of ABHD2 to the HBV infection process, antisense oligonu-cleotides (ASODNs) were used to downregulate ABHD2 expression in HepG2.2.15 cells. From 5 ASODNScandidates tested, AB3 significantly downregulated ABHD2 mRNA and protein expression levels. Further, AB3significantly reduced HBV DNA, hepatitis B surface antigen, and hepatitis B e antigen protein expressionlevels in cell medium without affecting cell viability. These results suggest that downregulation of ABHD2 usingASODNs blocked HBV replication and expression without affecting host cell physiology. Further, data dem-onstrated an essential role of ABHD2 in HBV propagation, suggesting it can serve as a novel target for anti-HBVdrug development.

Introduction

Hepatitis B virus (HBV) infectionis a major worldwide

public health problem. Globally,>350 million people areinfected with HBV, and in some infected individuals thedisease develops into liver cirrhosis and hepatocellular car-cinoma (Nassal, 2008; Reyes-del Valle et al., 2009). CurrentHBV antiviral therapies include alpha-interferon or lami-vudinebased therapies; however, the long-term efficacy ofthese treatments is disappointing because of the low sero-conversion rates and the development of drug-resistant HBVmutants (Papatheodoridis et al., 2002; Lai et al., 2003; Raptiet al., 2007). The lack of therapeutic options highlight the ur-gent need for developing more-effective antiviral therapiesthat can reduce or eliminate viral infections completely withdiminished side effects.

Human abhydrolase domain containing 2 (ABHD2), ana/b hydrolase protein family member, possesses hydratasecatalytic activity (Holmquist, 2000). ABHD family geneswere identified during a gene screen of human emphyse-matous tissues (Edgar and Polak, 2002) and ABHD2 wasdemonstrated to play a critical role in maintaining lungstructural integrity by affecting lung homeostasis (Jin et al.,2009). It was later demonstrated that ABHD2 was involvedin smooth muscle cell migration and in neointimal thick-

ening of vascular smooth muscle cells (Miyata et al., 2005).However, no reports to date have described the relationshipbetween HBV infection and ABHD2. Previous studies fromour laboratory demonstrated that ABHD2 expression wasupregulated in HepG2.2.15 cells but downregulated by la-mivudine (Ding et al., 2008); however, as up- or down-regulated genes may play different roles in facilitating viralreplication, pathogenesis, or cellular responses associatedwith viral clearance, it was unclear what role upregulationof ABHD2 might play in the context of controlling viralreplication. In this study, antisense oligonucleotides(ASODNs) were used to down-regulate ABHD2 expressionas a means of assessing whether ABHD2 was essential toHBV propagation and whether ABHD2 can be used as atarget for anti-HBV drugs.

Materials and Methods

Design and synthesis of ASODN

The entire ABHD2 mRNA sequence (GenBank accessionnumber: NM 007011) was chosen as a potential target se-quence. The secondary mRNA structure was predicted usingthe MFOLD Web server (Zuker, 2003). Five regions withstructural motifs deemed favorable for ASODN binding werechosen as targets (Patzel et al., 1999). Using a BLAST search,

Beijing Institute of Radiation Medicine, Beijing, Peoples Republic of China.

OLIGONUCLEOTIDESVolume 21, Number 2, 2011 Mary Ann Liebert, Inc.DOI: 10.1089/oli.2011.0280

77


2/9

the ASODNs targeting these regions were determined to bespecific and did not appear to inhibit the expression of otherproteins (Table 1). All ASODNs were synthesized on anABI8909 nucleic acid synthesis system and purified byOligonucleotide Purification Cartridge (OPC) (Perkin-Elmer,Foster City, CA), and ASOD lengths were verified by gelelectrophoresis. As ASODs containing phosphorothioate arenuclease resistant (Cohen, 1993; Uhlmann et al., 1999), all

ASODNs generated were chemically modified with phos-phorothioate by substituting the oxygen molecules of thephosphate backbone with sulfur.

Cell culture and transfection

HepG2.2.15 cells (clonal cells derived from HepG2 cellstransfected with a plasmid containing more than full-lengthHBV DNA) that secrete hepatitis B virions (Sells et al., 1987,1988) were kindly provided by the Beijing Medical Universityand were originally provided by the Mount Sinai MedicalCenter, New York. HepG2.2.15 cells were cultured in minimalessential medium (Invitrogen, Carlsbad, CA) supplementedwith 10% fetal bovine serum (Gibco, Grand Island, NY),380mg/mL antibiotic G-418 sulfate (Promega, Madison, WI),l-glutamine (2 mm), and amicaxin sulfate (200U/L). Fortransient transfection experiments, HepG2.2.15 cells wereplated at 1.5105 cells per 35-mm well andgrown to 50%70%confluence. Cells were then transfected with ASOs in thepresence of lipofectin (1mg/mL lipofectin and 0.1 mM oligo-nucleotide; Invitrogen) according to the manufacturers pro-tocol. After cell incubation with respective ASODNs for 6hours, the media were replaced and cultures were incubatedfor 72 hours. Cell culture media were collected and examinedfor the presence of hepatitis B surface antigen (HBsAg), hep-atitis B e antigen (HBeAg), and HBV DNA. Total cellularRNA and protein were extracted for determining the level ofABHD2 mRNA and protein.

Detection of ABHD2 mRNA by semiquantitative

reverse transcriptionpolymerase chain reaction

Seventy-two hours posttranscription, total cellular RNAwas extracted from HepG2.2.15 cells using TRIzol Reagent(Invitrogen) according to the manufacturers instructions. Thequality of the purified RNA was assessed using formaldehydeagarose gels. Reverse transcriptionpolymerase chain reac-tion (RT-PCR) was performed as previously described (Yanget al., 2005). Briefly, cDNA templates were synthesized from1 mg total RNA using SuperScript II reverse transcriptase(Invitrogen) and an oligo(dT) primer. The PCR was per-formed in a 20 mL reaction volume under the following con-ditions: 5 minutes at 948C followed by 27 cycles of 948C for

20s,608Cfor20s,and728C for 20s, with a final incubation for5 minutes at 728C. PCR products were then subjected toelectrophoresis on a 2.0% agarose gel, bands visualized byethidium bromide staining, and respective band intensitiesmeasured by scanning the gel with Gel Doc 1000 (Bio-Rad,Hercules, CA). PCR products were quantified by densitome-try and normalized with respect to glyceraldehyde 3-pho-phate dehydrogenase (GAPDH) as an internal control. The

forward (fp) and reverse (rp) primers used were ABHD2-fp(50-GCCCCACCTGACCTCTACT-30), ABHD2-rp (50-AACGAAAGTGCGGATGTATT-30), GAPDH-fp (50-ACCACAGTCCATGCCATCAC-30), and GAPDH-rp (50-TCCACCACCCTGTTGCTGTA-30).

Analysis of the ABHD2 by western blot

Rabbit anti-human ABHD2 antibodies were prepared byprofessor Yanning Xue and their specificity was confirmed. Todetect cellular expression of ABHD2, HepG2.2.15 cells weretrypsinized after transfection and lysed with lysis buffer (0.5%deoxycholic acid sodium salt, 0.1% sodium dodecyl sulfate, 1%Nonidet P-40, and a protease inhibitor cocktail [Roche Mole-cular Biochemicals, Mannheim, Germany]). Equal amounts(50mg) of protein were run on a 10% sodium dodecyl sulfatepolyacrylamide gel electrophoresis and then transferred ontoHybondpolyvinylidene difluoride membranes (Amersham,Arlington Heights, IL). Blots were blocked in Tris-bufferedsaline (TBS) containing 5.0% nonfat dry milk, washed withTBS 0.2% Tween 20 (TBST), and then probed with rabbitanti-human ABHD2 antibodies or incubated with primarymouse anti-human actin (Pharmacia, Hong Kong, China) inTBS containing 2.5% nonfat dry milk at room temperature for1 hour. After washing with TBST, blots were probed with asecondary peroxidase-conjugated antibody in TBS containing2.5% nonfat dry milk at room temperature for 1 hour. Blotswere then washed and immunoreactive proteins were visual-ized on a autoradiogram using ECL Western blot detectionreagents (Santa Cruz Biotechnology, Santa Cruz, CA) andexposing blots to X-Omat BT Film (Kodak, Rochester, NY).Bands were quantified by densitometry using an ATTODensitograph (ATTO Corporation, Tokyo, Japan) normalizedagainst the b-actin internal control.

HBV DNA detection in cell culture medium by RT-PCR

To assess the effect of ASODNs on HBV DNA levels, HBVDNA concentrations in culture medium were determined byRT-PCR. Posttransfection, cell culture media were incubatedat 948C for 15 minutes. After centrifugation at 12,000 for 10minutes, supernatants were used as an RT-PCR template aspreviously described (He et al., 2001; Wang et al., 2002). The

Table 1. Antisense Oligonucleotide Sequences Targeting Abhydrolase Domain Containing 2 mRNA

0 0

1 AB1 12021221 20 CGTGCAGCCATAGGTGAACA2 AB2 11921211 20 TAGGTGAACATGCGTGGCGA3 AB3 26272646 20 TAAAATCCCCAGGCTCCTTC4 AB4 12071226 20 TCCCACGTGCAGCCATAGGT5 AB5 17071726 20 TTTCATGCACCAACGGATCG

ABHD2, abhydrolase domain containing 2.

78 DING, YANG, AND WANG


3/9

forward HBVDNA primer 50-GGAGTA TGG ATT CGC ACTCCT C-30 and the reverse primer 50-TTG TTG TTG TAG GGGACC TGC CT-30, in addition to the fluorescent probe 5 0-ACTTCC GGAAAC TAC TGT TAG ACG A-30 and the quenchingprobe 50-GTA GTT TCC GGA AGT-30, were utilized. PCRamplification and analysis were performed using the iCyclerreal-time PCR detector (Bio-Rad). Assays were repeated intriplicate and the average threshold cycle values were used to

determine HBV DNA concentrations. The inhibitory ratewas calculated using the follow formula: IR (%) ( control

tester)/ control100%, where control represents HBV DNAcopies in HepG2.2.15 cells and tester represents HBV DNAcopies in cells transfected with ASODNs.

HBsAg and HBeAg detection assays

To assess the effect of ASODNs on HBV protein levels,HBsAg and HBeAg concentrations in culture medium weredetermined using diagnostic HBsAg and HBeAg enzyme-linked immunosorbent assay kits (Sino-American Biotech-nology Co., Beijing, China) as described by the manufacturer.The inhibitory rates were calculated according to the follow-ing formula: inhibitory rate (%) control test/ con-trol100%. Assays were performed in triplicate and theaverage inhibitory rate expressed as the mean standarddeviation.

Cell proliferation and apoptosis assays

MTS assays for cell proliferation were performed using theCellTiter 96 Aqueous One solution cell proliferation assay kit(Promega). The assay for apoptosis detection was performedusing the Annexin V-FITC kit (Baosai, Beijing, China).

Statistical analysis

Data are expressed as mean standard deviation. Statis-tical analyses were performed using the Students -test (2-tailed) and one-way analysis of variance. All data represent atleast 2 independent experiments.

Results

The effect of ASODNs on ABHD2 expression

To determine whether ABHD2 affects HBV replication,ASODNs were used to downregulate ABHD2 expressionlevels in HepG2.2.15 cells. To test the efficacy of respectiveASODNs, their effect on ABHD2 mRNA and protein ex-pression levels were first examined by semiquantitative RT-PCR and western blot analyses. HepG2.2.15 cells treated withAB1, AB3, AB4, and AB5 had significantly downregulated(76.71%, 85.97%, 77.85%, and 50.79%, respectively) ABHD2mRNA expression levels (Fig. 1AC) and the ABHD2 proteinexpression levels were significantly diminished by 93.83%and 92.15%, respectively, following treatment with AB3 andAB5 (Fig. 2A, B). Based on these results, AB3 was selected foruse in subsequent experiments designed to examine ASODNeffects on protein expression and viral infections.

AB3-mediated downregulation of ABHD2 expression

is specific and dose dependent

To exclude nonspecific effects that may be conferred byAB3, 2 controls, SA3 (50-GAAGGAGCCTGGGGATTTTA-30)

FIG. 1. Expression of abhydrolase domain containing 2(ABHD2) mRNA in antisense oligonucleotide (ASODN)treated HepG2.2.15 cells. (A) HepG2.2.15 cells were eitheruntreated, treated with lipofectin only, or lipofectin treatedin the presence of 0.8 mM ASODNs for 3 days, at which timecells were harvested and ABHD3 mRNA levels were ana-lyzed by reverse transcriptionpolymerase chain reaction

(RT-PCR) and coamplified with glyceraldehyde 3-phophatedehydrogenase (GAPDH) mRNA (C, negative control; M,DNA markers). (B) HepG2.2.15 cells were either untreated,treated with lipofectin only, or lipofectin treated in thepresence of 0.8 mM AB3 for 3 days, at which time ells wereharvested and ABHD2 mRNA levels were analyzed by RT-PCR and coamplified with GAPDH mRNA (C, negativecontrol; LIP, lipofectin; M, DNA markers). (C) Quantificationof ABHD2 mRNA inhibition in treated cells. Each ABHD2PCR product was quantified and normalized againstGAPDH levels. Data are expressed as mean standard de-viation (SD) from 3 independent experiments, assuming thatABHD2:GAPDH mRNA levels in control cells were 100%.

SUPPRESSION OF HEPATITIS B VIRUS REPLICATION BY ABHD2 79


4/9

and RA3 (50-TCCCTCCAGTACACGTCTAA-30), were used.SA3 is directed against AB3 and used to determine the ef-

fect of phosphorothioate ODNs on cells. RA3 is a scrambled3 sequence used to test whether the AB3 sequencenonspecifically affects cell functions. These results showedthat treatment with 0.8mM SA3 or RA3 did not alterABHD2 mRNA or protein expression levels compared withcells treated with serial dilutions of AB3, demonstrating adose-dependent downregulation of ABHD2 mRNA andprotein levels (Figs. 35).

HBV replication is reduced

following treatment with AB3

To detect whether blocking HBV propagation was specific,HepG2.2.15 cells were treated, respectively, with 0.8 mM AB3,SA3, or RA3 and the levels of HBV DNA, HBsAg, and HBeAgsecreted into cell media were determined. These resultsdemonstrated that SA3 and RA3 did not affect HBV replica-tion in HepG2.2.15 cells (Fig. 6).

AB3 reduced HBV production in HepG2.2.15

cells in a dose-dependent manner

To determine whether ABHD2 inhibition could block HBVpropagation, HepG2.2.15 cells were treated with serial dilu-tions of AB3 and HBV DNA, HBsAg, and HBeAg were de-tected after 3 days (Fig. 7). These data demonstrated that AB3(0.8mM) inhibited HBV DNA, HBsAg, and HBeAg secretion

into culture supernatants (65.50%, 67.47%, and 53.04% inhi-bition, respectively) (Fig. 7), suggesting that AB3-mediatedinhibition of ABHD2 blocked HBV propagation in a dose-dependent manner.

Downregulation of ABHD2 does not affect cell viability

To examine the viability of HepG2.2.15 cells following AB3treatment, cell proliferation was assessed using the MTS assayin addition to screening for apoptosis. Treatment ofHepG2.2.15 cells with serial AB3 dilutions was not cytotoxic(determined by cellular proliferation rates) even at 6.25-foldhigher concentrations of AB3 (5mM, Fig. 8). Characterizationof apoptosis showed that treatment with 5 mM AB3 cells didnot induce apoptosis (data not shown), suggesting thatHepG2.2.15 cell function was not affected by AB3 treatmentover time at various concentrations.

Discussion

Although specific functions for ABHD2 have not been welldefined to date, the characteristic a/b hydrolase fold of theprotein family to which ABHD2 belongs sheds light on its

FIG. 2. ABHD2 protein expression in ASODN-treatedHepG2.2.15 cells. (A) HepG2.2.15 cells were either untreated,treated with lipofectin only, or lipofectin treated in thepresence of 0.8 mM ASODNs for 3 days, at which time cellswere harvested and ABHD2 expression was analyzed bywestern blot (C, negative control). (B) ABHD2 protein levelsin treated cells compared with control cells. ABHD2 proteinlevels were normalized to the b-actin protein levels, assum-ing that the ABHD2:b-actin protein levels in control cellswere 100%. Results are expressed as the mean SD of 2 in-dependent experiments.

FIG. 3. AB3 specifically downregulates ABHD2 mRNA.(A) Semiquantitative RT-PCR analysis of ABHD2 mRNA inHepG2.2.15 cells treated with either 0.8 mM AB3, SA3, or RA3(C, negative control; M, DNA markers). (B) ABHD2 mRNAlevels in treated cells compared with control cells. ABHD2mRNA levels were normalized to the level of GAPDHmRNA, assuming that the ABHD2:GAPDH mRNA levels in

control cellswere 100%. Expression rates were calculatedand expressed as the mean SD from 2 independent ex-periments.



5/9

potential function. The a/b hydrolase enzyme family is rap-idly becoming one of the largest groups of structurally relatedenzymes with diverse catalytic functions. Each of these family


6/9

levels in HepG2.2.15 cells. ASODNs are short, single-strandDNA sequences (1325 nucleotides) thought to hybridize tospecific mRNA sequences inducing target RNA degradationby RNase-H and/or by forming a stable DNA-RNA duplexand a special local structure, which might hinder RNase-Hcleavage activity that results in blocking protein translation(Dias and Stein, 2002; Scherer and Rossij, 2003; Coma et al.,2004). The data presented in this report showed that down-regulation of ABHD2 using AB3 significantly reduced HBVDNA, HBsAg, and HBeAg levels in HepG2.2.15 cell super-natants, suggesting that AB3-mediated ABHD2 suppressionblocked HBV DNA replication and HBV mRNA transcrip-tion, stability, or translation and reduced the export of HBeAg

and HBsAg. We therefore hypothesized that ABHD2 wasessential to HBV replication and that ABHD2 might thereforebe a potential target for anti-HBV drug development. In ourprevious work, the expression of ABHD2 was downregulated by lamivudine (Ding et al., 2008). However, several otherreports showed that lamivudine treatment did not reduce

HBV-specific RNAs that completely blocked HBV DNA rep-lication (Doong et al., 1991; Lai and Yuen, 2000). Additionalresearch will be required to identify the reasons for this dis-

crepancy.It is well known that phosphorothioate ASODNs are as-

sociated with nonspecific effects caused by the nonspecificcleavage of unintended targets (Woolf et al., 1992). For thisreason, the specificity of AB3 was also analyzed by RT-PCRand western blot. These results showed that the levels of b-actin protein and GAPDH mRNA were unaffected by AB3treatment; however, AB3 downregulated ABHD2 expressionin a dose-dependent manner. These data suggested that AB3-mediated downregulation of ABHD2 did not occur as a con-sequence of the downregulation of either mRNAs or proteinsynthesis of housekeeping genes. As phosphorothioate ODNs(SA3) did not affect HBV propagation (nor did a scrambledsequence of AB3) it suggested that the reduction of HBV DNA

levels were not the result of nonspecific effects of AB3 on cellfunction/physiology. Moreover, AB3 did not affectHepG2.2.15 cell proliferation or induce apoptosis even at highdoses (5 mM). These results suggested that reductions in HBVDNA levels were not caused by abnormalities to cell functionresulting from AB3 treatment.

The data presented in this report suggest that AB3 holdsthe potential of serving as a novel anti-HBV treatment.Current antiviral therapies for HBV include treatment withalpha-interferon or lamivudinebased therapies, but long-term resolution of disease using these approaches has beendisappointing because of low seroconversion rates and thedevelopment of drug-resistant viral mutants (Papatheodor-idis et al., 2002; Lai et al., 2003; Rapti et al., 2007). There-

fore, there is an urgent need to develop more-effectiveantiviral therapies that can reduce or eliminate viral infec-tions completely, with fewer side effects than those alreadyassociated with present treatment modalities. The use ofASODNs as antiviral agents has emerged as a powerfulnew approach for treating HBV infections (Wagner andFlanagan, 1997; Veal et al., 1998) and many ASODN drugsare now being widely developed. For instance, Vitravene(ISIS Pharmaceuticals, Carlsbad, CA) is an antisense drugcurrently used for the treatment of cytomegalovirus infec-tions, which has been already approved by the Food andDrug Administration (Marwick, 1998; Stix, 1998; Wacheck,

FIG. 6. Hepatitis B virus (HBV) DNA, hepatitis B e an-tigen (HBeAg), and hepatitis B surface antigen (HBsAg) ex-pression in HepG2.2.15 supernatants following treatmentwith either AB3, SA3, or RA3. Expression rates were calcu-lated and expressed as the mean SD from 3 independentexperiments, assuming that the expression levels of HBVDNA, HBsAg, and HBeAg in control cells were 100% (C,negative control).

FIG. 7. Reduction in HBV production by AB3 is dose de-pendent. HepG2.2.15 cells were treated with AB3 dilutionsfor 3 days. The inhibitory rates are expressed as themean SD from 3 independent experiments.

FIG. 8. Downregulation of AHBD2 does not affect cellviability. We assumed that the optical density (OD) value ofcontrol cells was 1. The OD ratios are expressed as mean SD from 3 independent experiments.



7/9

2006). In this report, reduction of HBV replication by AB3suggested that AB3 might be developed as a new drug forHBV therapy.

In conclusion, we identified ABHD2 as a new HBV infec-tion-related gene, and targeting ABHD2 with ASODNs blocked HBV propagation, denstrating that ABHD2 isessential to HBV replication and that it might therefore serveas a target for anti-HBV drug development.

Acknowledgments

This work was supported by a grant from the NationalNatural Science Foundation of China (30901825), a grantfrom The National Key Technologies R&D Program forNew Drugs (2009ZX09301-002 and 2009ZX09503-021), agrant from the National High Technology Research andDevelopment Program (863 Program) of China (2007AA02Z108), and grant from the Important National Scienceand Technology Specific Projects for Infectious Diseases(2008ZX10002-011).

Author Disclosure Statement

No competing financial interests exist.

References

BANERJEE, A.K. (1980). 50-Terminal cap structure in eucaryoticmessenger ribonucleic acids. Microbiol. Rev. 44, 175205.

COHEN, J.S. (1993). Oligonucleotide therapy. In: Antisense Re-search and Applications. S.T. Crooke and B. Lebleu, eds. (CRCPress, Boca Raton, FL), pp. 205221.

COMA, S., NOE, V., LAVARINO, C., ADAN, J., RIVAS, M.,LOPEZ-MATAS, M., PAGAN, R., MITJANS, F., VILARO, S.,PIULATS, J., and CIUDAD, C.J. (2004). Use of siRNAs andantisense oligonucleotides against survivin RNA to inhibitsteps leading to tumor angiogenesis. Oligonucleotides 4, 100113.

DIAS, N., and STEIN, C.A. (2002). Antisense oligonucleotides:basic concepts and mechanisms. Mol. Cancer Ther. 1, 347355.

DING, X.R., WANG, S.Q., et al. (2008). Whole genome expres-sion profiling of Hepatitis B virus transfected cell line revealsthe potential targets of anti-HBV drugs. Pharmacogenomics J.8, 6170.

DOONG, S.L., TSAI. C.H., SCHINAZI, R.F., et al. (1991). In-hibition of the replication of hepatitis B virus by 20,30-dideoxy-30-thiacytidine and related analogues. Proc. Natl.Acad. Sci. U. S. A. 88, 84958499.

EDGAR, A.J., and POLAK, J.M. (2002). Cloning and tissue dis-tribution of three murine a/b hydrolase fold protein cDNAs.Biochem. Biophys. Res. Commun. 292, 617625.

HE, Y.Y., WANG, S.Q., CHEN, S.H., et al. (2001). Construction

and clinical application of a new fluorescent quantitativepolymerase chain reaction technique for HBV detection. Chin.J. Hepatol. 9, 376377.

HOLMQUIST, M. (2000). Alpha/beta-hydrolase fold enzymes:structures, functions and mechanisms. Curr. Protein PeptideSci. 1, 209235.

JIN, S., ZHAO, G,. LI, Z., NISHIMOTO, Y., ISOHAMA, Y.,SHEN, J., ITO, T., TAKEYA, M., ARAKI, K., HE, P., andYAMAMURA, K. (2009). Age-related pulmonary emphy-sema in mice lacking alpha/beta hydrolase domaincontaining 2 gene. Biochem. Biophys. Res. Commun. 380,419424.

LAI, C.L., DIENSTAG, J., SCHIFF, E., LEUNG, N.W., AT-KINS, M., HUNT, C., BROWN, N., WOESSNER, M.,BOEHME, R., and CONDREAY, L. (2003). Prevalence andclinical correlates of YMDD variants during lamivudinetherapy for patients with chronic hepatitis B. Clin. Infect.Dis. 36, 687696.

LAI, C.L., and YUEN, M.F. (2000). Profound suppression ofhepatitis B virus replication with lamivudine. J. Med. Virol. 61,367373.

MARWICK, C. (1998). First antisense drug will treat CMV reti-nitis. JAMA 280, 871.

MIYATA, K., OIKE, Y., HOSHII, T., MAEKAWA, H., OGA-WA, H., SUDA, T., ARAKI, K., and YAMAMURA, K. (2005).Increase of smooth muscle cell migration and of intimalhyperplasia in mice lacking the a/b hydrolase domain con-taining 2 gene. Biochem. Biophys. Res. Commun. 329, 296304.

NASSAL, M. (2008). Hepatitis B viruses: reverse transcription adifferent way. Virus Res. 134, 235249.

PAPATHEODORIDIS, G.V., DIMOU, E., LARAS, A., PAPADI-MITROPOULOS, V., and HADZIYANNIS, S.J. (2002). Courseof virologic breakthroughs under long-term lamivudine inHBeAg-negative precore mutant HBV liver disease. Hepatol-

ogy 36, 219226.PATZEL, V., STEIDL, U., KRONENWETT, R., HAAS, R., and

SCZAKIEL, G. (1999). A theoretical approach to select effec-tive antisense oligodeoxyribonucleotides at high statisticalprobability. Nucleic Acids Res. 27, 43284334.

RAPTI, I., DIMOU, E., MITSOULA, P., and HADZIYANNIS, S.J.(2007). Adding-on versus switching-to adefovir therapy inlamivudine-resistant HBeAg-negative chronic hepatitis B.Hepatology 45, 307313.

REYES-DEL VALLE, J., HODGE, G., MCCHESNEY, M.B., andCATTANEO, R. (2009). Protective anti-hepatitis B virus re-sponses in rhesus monkeys primed with a vectored measlesvirus and boosted with a single dose of hepatitis B surfaceantigen. J. Virol. 83, 90139017.

SCHERER, L.J., and ROSSIJ, J. (2003). Approaches for the se-

quence-specific knockdown of mRNA. Nat. Biotechnol. 21,14571465.

SELLS, M.A., CHEN, M.L., and ACS, G. (1987). Production ofhepatitis B virus particles in Hep G2 cells transfected withcloned hepatitis B virus DNA. Proc. Natl. Acad. Sci. U. S. A.84, 10051009.

SELLS, M.A., ZELENT, A.Z., SHVARTSMAN, M., and ACS, G.(1988). Replication hepatitis B virus in HepG2 cells that pro-duce infectious virions. J. Virol. 62, 28362844.

STIX, G. (1998). Shutting down a gene. Antisense drug winsapproval. Sci. Am. 279, 4650.

TURNER, M.A., YANG, X., YIN, D., KUCZERA, K., BORCH-ARDT, R.T., and HOWELL, P.L. (2000). Structure and functionof S-adenosylhomocysteine hydrolase. Cell Biochem. Biophys.

33, 101125.UHLMANN, E., PEYMAN, A., RYTE, A., SCHMIDT, A., andBUDDECKE, E. (1999). Use of minimal modified antisenseoligonucleotides for specific inhibition of gene expression.Methods Enzymol. 313, 268284.

VEAL, G.J., AGRAWAL, S., and BYRN, R.A. (1998). Sequence-specific RNase H cleavage of gag mRNA from HIV-1 infectedcells by an antisense oligonucleotide . Nucleic AcidsRes. 26, 56705675.

WACHECK, V. (2006). Oligonucleotide therapeuticsanemerging novel class of compounds. Wien. Med. Wochenschr.156, 481487.

SUPPRESSION OF HEPATITIS B VIRUS REPLICATION BY ABHD2 83


8/9

WAGNER, R.W., and FLANAGAN, W.M. (1997). Antisensetechnology and prospects for therapy of viral infections andcancer. Mol. Med. Today 3, 3138.

WANG, S.Q., WANG, X.H., CHEN, S.H., et al. (2002). A newfluorescent quantitative polymerase chain reaction technique.Anal. Biochem. 309, 206211.

WOOLF, T.M., MELTON, D.A., and JENNINGS, C.G. (1992).Specificity of antisense oligonucleotides . Proc. Natl.Acad. Sci. U. S. A. 89, 73057309.

YANG, J., BO, X.C., YAO, J., YANG, N.M., and WANG, S.Q.(2005). Differentially expressed cellular genes following HBV:potential targets of anti-HBV drugs? J. Viral Hepat. 12, 357363.

ZHANG, Z.-D., CHENG, J., ZHANG, S.-L., et al. (2003). Cloningand characterization of a human hepatocyte protein, car-

boxypeptidase N, which binds and activates core promoter ofhepatitis B virus. World Chin. J. Digestol. 11, 11311134.

ZUKER, M. (2003). Mfold web server for nucleic acid foldingand hybridization prediction. Nucleic Acids Res. 31, 34063415.

Address correspondence to:

[email protected]

[email protected]

Received for publication January 17, 2011; accepted afterrevision February 24, 2011.



9/9

Reproducedwithpermissionof thecopyrightowner. Further reproductionprohibitedwithoutpermission.

jurnal virus makanan

Documents