jpet#186916 title page expression of atp-binding cassette...

JPET#186916

1

Title Page

Expression of ATP-Binding Cassette Membrane Transporters in Rodent and Human

Sertoli Cells: Relevance to the Permeability of Antiretroviral Therapy at the Blood-Testis

Barrieri

Kevin R. Robillard, Md. Tozammel Hoque and Reina Bendayan

Graduate Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University

of Toronto, 144 College Street, Toronto, ON, Canada, M5S 3M2. KRR, MTH, RB

JPET Fast Forward. Published on October 11, 2011 as DOI:10.1124/jpet.111.186916

Copyright 2011 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on October 11, 2011 as DOI: 10.1124/jpet.111.186916

at ASPE

T Journals on M

arch 2, 2020jpet.aspetjournals.org

Dow

nloaded from

http://jpet.aspetjournals.org/

JPET#186916

2

Running Title Page

Running Title: Expression of ABC Transporters in Sertoli Cells

Corresponding author – Dr. Reina Bendayan, Department of Pharmaceutical Sciences, Leslie

Dan Faculty of Pharmacy, University of Toronto, 144 College Street, Toronto, ON, M5S 3M2,

Canada - email: [email protected],

Phone (416) 946-7523

Fax (416) 978-8511

Text pages: 46

Number of Tables: 1

Number of Figures: 8

Number of References: 41

Number of Words: Abstract 250 words

Introduction 677 words

Discussion 1631 words


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

3

List of Non-standard abbreviations

ABC – ATP-binding cassette

BCECF - 2’7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein

Bcrp/BCRP – breast cancer resistance protein

BTB – blood-testis barrier

CSA - cyclosporin A

HAART – highly active antiretroviral therapy

HBSS – Hank’s balanced salt solution

HIV – human immunodeficiency virus

HSECs – human Sertoli cells

Mrp(s)/MRP(s) – multidrug resistance-associated protein(s)

P-gp – P-glycoprotein

R-6G – rhodamine-6G

TM4 – mouse Sertoli (TM4) cells

Mdr/MDR – multidrug resistance

Recommended Section: Metabolism, Transport and Pharmacogenomics


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

4

Abstract

The blood-testis barrier (BTB), primarily composed of Sertoli cells, is responsible for

protecting developing germ cells from xenobiotic exposure. ATP-binding cassette (ABC)

membrane-associated drug efflux transporters, P-glycoprotein (P-gp), breast cancer resistance

protein (BCRP) and the multidrug resistance-associated proteins (Mrps), have been shown to

restrict antiretroviral drug permeability at blood-tissue barriers such as the blood-brain barrier.

However, it remains unclear if these transporters are functional at the level of Sertoli cells and

can regulate anti-HIV drug permeability at the BTB. This study investigates the functional

expression of ABC transporters in a mouse Sertoli cell line system (TM4) and in primary

cultures of human Sertoli cells (HSECs). Expression of Mdr1b/MDR1/P-gp, Mrp1/MRP1,

Mrp4/MRP4 is confirmed by quantitative PCR and immunoblotting analysis in TM4 and

HSECs. Immunofluorescence studies reveal plasma localization of P-gp, Mrp1/MRP1 and

Mrp4/MRP4 in both cell systems. However, Bcrp expression and localization was only detected

in rodent cells. Accumulation of: i) rhodamine-6G (R-6G), a fluorescent P-gp substrate, ii) [3H]-

atazanavir, a HIV protease inhibitor and known P-gp substrate, iii) 2’7’-bis-(2-carboxyethyl)-5-

(and-6)carboxyfluorescein (BCECF), a fluorescent Mrp substrate, and iv) [3H]-mitoxantrone, a

BCRP substrate, by TM4 monolayer cells in the presence of established inhibitors demonstrate

that these transporters are functional. In addition, several anti-HIV drugs significantly enhance

the accumulation of: R-6G, [3H]-atazanavir, BCECF and [3H]-mitoxantrone by TM4 cells. This

study provides the first evidence of ABC transporters expression and activity in Sertoli cells and

suggests that these transporters could play an important role in restricting antiretroviral drug

permeability at the BTB.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

5

Introduction

The blood-testis barrier (BTB), primarily composed of Sertoli cells provides structural

and protective support to developing germ cells (Su, et al., 2011). These cells are epithelial in

origin and form tight-junction complexes near the basement membrane which physically divides

the seminiferous epithelium into luminal (apical) and basolateral compartments. This allows the

development of post-meiotic spermatids to occur in a specialized microenvironment within the

seminiferous tubules. In addition to acting as a physical barrier, Sertoli cells also contribute to

the formation of an immunological barrier by preventing the production of anti-sperm antibodies

towards developing sperm as well as by preventing peripheral immune cells from entering the

seminiferous tubule microenvironment (Su, et al., 2011).

Despite the use of highly-active antiretroviral therapy (HAART), the testes remain a

reservoir of HIV-infection (Dahl, et al., 2010). The most recent guidelines for antiretroviral

therapy of HIV-infected, treatment-naive patients, recommends the administration of a protease,

integrase or non-nucleoside reverse transcriptase inhibitor in combination with two nucleoside

reverse transcriptase inhibitors (Panel on Antiretroviral Guidelines for Adults and Adolescents,

2011). Data from clinical studies have suggested that one potential contributing factor to the

formation of a HIV viral reservoir in testes is the low concentration of antiretroviral drugs

reaching the seminal fluid in HIV-infected men (Cruciani, et al., 2006;Ghosn, et al.,

2004;Pereira, et al., 2002;van Leeuwen, et al., 2007;van Praag, et al., 2001). We propose that the

reduced concentrations of antiretroviral drugs in seminal fluid could, in part, be due to the

expression of ATP-binding cassette (ABC) membrane-associated drug efflux transporters such as

P-glycoprotein (P-gp), the multidrug resistance-associated proteins (Mrps) and the breast cancer

resistance protein (Bcrp) in Sertoli cells. These transporters are known to actively efflux several


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

6

xenobiotics from cellular targets and significantly contribute to multi-drug resistance (Kis, et al.,

2010a).

P-gp, a membrane bound protein encoded by the multidrug resistance (MDR) gene, has

two known isoforms in humans (MDR1 and MDR2) and three isoforms in rodents (mdr1a,

mdr1b and mdr2). MDR1 and mdr1a/b have been shown to participate in the MDR phenomenon,

whereas MDR2 and mdr2 are primarily involved in phosphatidylcholine transport within the

liver (Kis, et al., 2010a). P-gp is expressed in many tissues such as the brain (Bendayan, et al.,

2006), and is capable of extruding a large number of pharmacological agents including several

antiretroviral drugs such as protease inhibitors (Zastre, et al., 2009) and nucleoside reverse

transcriptase inhibitors (Kis, et al., 2010a).

Two well-studied ABC transporters of the MRP family that have demonstrated

involvement in MDR phenomenon are Mrp1 and Mrp4 (Dallas, et al., 2004b;Meaden, et al.,

2002). Mrp1 is ubitiquitously expressed in many tissues including testes, microglia, astrocytes,

kidney and liver epithelia (Haimeur, et al., 2004). Mrp1 preferentially transports anionic

compounds and their corresponding glutathione, glucuronide and sulfate based-conjugates

(Haimeur, et al., 2004;Kis, et al., 2010a). Other drugs known to be substrates for Mrp1 include

the HIV protease inhibitors such as saquinavir (Kis, et al., 2010a). In contrast, Mrp4 has a

different substrate specificity and is capable of transporting cyclic nucleotides (cyclic adenosine

and guanosine monophosphate), sulfate and glucuronide-conjugated steroids and the

prostaglandins E1 and E2 (Ritter, et al., 2005). Mrp4 has also been shown to transport several

nucleoside reverse transcriptase inhibitors such zidovudine, adefovir and tenofovir (Kis, et al.,

2010a). Mrp4 expression has been identified in the kidney, brain and testis (Ritter, et al., 2005).

The membrane drug efflux transporter, Bcrp, has similar yet more restricted substrate


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

7

specificity compared to P-gp. It is capable of transporting several compounds including

sulphated-estrogens, folic acid conjugates, chlorophyll-derived phototoxins, as well as

chemotherapeutic drugs such as mitoxantrone and camptothecins (Lee, et al., 2007). In addition,

HIV-nucleoside reverse transcriptase inhibitors such as zidovudine are substrates for this

transporter (Kis, et al., 2010a). Bcrp expression has been confirmed in many tissues such as brain

and testis (Lee, et al., 2007;Su, et al., 2011).

The objective of this study is to investigate the functional expression of ABC drug efflux

transporters i.e., P-gp, Mrp1, Mrp4 and Bcrp in rodent and human Sertoli cells and their potential

role in limiting the permeability of antiretroviral drugs at the BTB.

Methods

Materials

[3H]-Mitoxantrone (12.7 Ci/mmol) and [3H]-Atazanavir (3 Ci/mmol) were purchased

from Moravek Biochemicals Inc. (Brea, California, USA). PSC833 was a generous gift from

Novartis Pharma (Basel, Switzerland). K0143 and MK571 were purchased from Tocris

Biosciences (Ellisville, Missouri, USA). GF120918, elacridar, was a generous gift from

GlaxoSmithKline Inc. (Mississauga, Ontario, Canada). Unlabeled antiretroviral drugs were

obtained through the National Institutes of Health, AIDS Research and Reference Reagent

Program (Bethesda, Maryland, USA). ABI high capacity reverse transcriptase cDNA kit was

purchased from Applied Biosystems (Foster City, California, USA). PerfeCTa SYBR green

Fastmix was obtained from Quanta Biosciences Inc. (Gaithersburg, Maryland, USA). The anti-P-

gp antibody, C219, was purchased from I.D. Labs Inc. (London, ON, Canada). The anti-Mrp1,


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

8

Mrpr1, and the anti-Mrp4, M4I-80, antibodies were purchased from Kamiya Biomedical

Company (Seattle, Washington, USA). The rat anti-Bcrp, BXP-53, antibody and mouse anti-

GATA-4 antibody (6H10) were obtained from Abcam Inc. (Boston, Massachusetts, USA). The

monoclonal mouse anti-MDR1 (D11) and rabbit polyclonal anti-Na+/K+ ATPase-α (H-300)

antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, California, USA). The

goat anti-mouse horseradish peroxidase-conjugated secondary antibody was purchased through

Jackson ImmunoResearch Inc. (West Grove, Pennsylvania, USA). The anti-actin, AC40,

antibody, the mouse anti-rat horseradish peroxidase-conjugated secondary antibody, and

rhodamine-6G (R-6G) as well as all other standard laboratory chemicals were purchased through

Sigma-Aldrich Canada (St. Louis, Missouri, USA). Vectorshield hard mounting media with 4’,6

diamidino-2-phenylindole (DAPI) was obtained from Vector Labs Inc. (Burlingame, California,

USA). Tissue cell culture reagents for cell culture systems, as well as 2′,7′-bis-(2-carboxyethyl)-

5-(and-6)-carboxyfluorescein (BCECF) free acid, BCECF-AM, Alexafluor-488 and Alexafluor-

594-conjugated secondary antibodies were purchased from Invitrogen Inc. (Carlsbad, California,

USA). Versene (200 mg/ml), 0.25% trypsin/EDTA, trypsin neutralizing solution was purchased

from Lonza Inc. (Walkersville, Maryland, USA).

Cell Culture

All the cell culture systems were grown and maintained at 37 °C humidified 5% CO2 /

95% air with fresh media replaced every 2 to 3 days. Cells were sub-cultured with 0.25%

Tryspin / EDTA upon reaching 80 – 90 % confluence, unless stated.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

9

Mouse Sertoli (TM4) Cell Line

The continuous mouse Sertoli (TM4) cell-line was obtained from the American Tissue

Culture Collection (Manassas, Virginia, USA). TM4 cells are non-tumorgenic and originate from

primary cultures of Sertoli cell-enriched preparations from 11-13 day old BALB/c strain mice

(Mather, 1980). All cell culture flasks and multi-well dishes were pre-coated with rat-tail

collagen type-1 (100 µg/ml) prior to cell plating in order to enhance cell adherence. Cells were

cultured and maintained in 1:1 (v/v) mix of Dulbecco’s modified Eagle’s media and Ham’s F12

nutrient mix containing 5 % horse serum, 2.5 % fetal bovine serum, 100 U/ml penicillin and 100

µg/ml streptomycin until reaching a state of confluence of 80 – 90 %.

Primary Cultures of Human Sertoli Cells

Primary cultures of human Sertoli cells (HSECs) were purchased from Lonza Inc.

(Walkersville, Maryland, USA). Cells were cultured according to manufacturer’s instructions

using Sertoli cell basal medium supplemented with Sertoli cell growth medium supplement and

fetal bovine serum (12.5 %). Cells were sub-cultured using Versene (200 mg/ml) and 0.25%

trypsin/EDTA, and were neutralized using trypsin neutralizing solution. Cells were plated at

approximately 4000 – 5000 cells / cm2.

Human Cervical Carcinoma Cell Line overexpressing MRP1

The human cervical carcinoma cell line stably transfected with human MRP1 cDNA

(HeLa-MRP1) was kindly provided by Dr. Susan Cole (Queen’s University, Kingston, ON,

Canada). Cells were cultured and maintained in Dulbecco’s Modified Eagle’s Medium (4 mM L-

glutamine, 25 mM glucose) supplemented with G418 (400 µg/ml), 10 % fetal bovine serum

(10%), penicillin (100 U/ml) and streptomycin (100 µg/ml).


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

10

Human Breast Cancer Cell Line overexpressing MDR1

The human breast cancer cell line MDA435/LCC6 stably transfected with human MDR1

cDNA (MDA-MDR1) was kindly provided by Dr. Robert Clarke from Georgetown University

(Washington, DC, USA) and were cultured in alpha minimum essential medium supplemented

with fetal bovine serum (10%), penicillin (100 U/ml) and streptomycin (100 µg/ml).

Embryonic Kidney Cell Line overexpressing MRP4

The human embryonic kidney cell line stably transfected with human MRP4 cDNA

(HEK-MRP4) was kindly provided by Dr. Piet Borst (Netherlands Cancer Institute, Amsterdam,

Netherlands). Cells were maintained in Dulbecco’s modified Eagle’s medium (Glutamax)

supplemented with fetal bovine serum (5%), penicillin (100 U/ml) and streptomycin (100

µg/ml).

Human Breast Cancer Cell Line overexpressing BCRP

The human breast cancer cell line MCF7-MX100 cell line was a generous gift from Dr.

Susan Bates (Bethesda, Maryland, USA). The cells were cultured and maintained in RPMI 1640

media supplemented with fetal bovine serum (10%), L-glutamine (1%), penicillin (100 U/ml),

streptomycin (100 µg/ml ) and mitoxantrone (100 nM).

Cell Morphology

For electron microscopy, TM4 cells or HSECs were fixed in 1% (v/v) glutaraldehyde in

phosphate buffer (0.1M, pH 7.2) for 2 hours at 4 °C and post-fixed with 1% (v/v) osmium

tetroxide in phosphate buffer for 1 hour at 4 °C. Fixed cells were then dehydrated in graded

ethanol and embedded in Epon. Ultrathin sections (80 nm) of Epon-embedded material were cut

and mounted on Paralodion-carbon-coated nickel grids. The sections were stained with uranyl


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

11

acetate and lead citrate and view with a Philips 410 transmission electron microscope (FEI

Systems Canada, St. Laurent, Quebec, Canada).

Total RNA extraction, cDNA Synthesis and Quantitative Real-time Polymerase Chain

Reaction (qPCR)

Total RNA was extracted from TM4 cells or HSECs using TRIzol reagent (Invitrogen)

according to manufacturer’s instructions. The concentration (absorbance at 260 nm) and purity

(absorbance 260 nm / absorbance 280 nm ratio) of RNA samples were assessed using Beckman

Coulter DU Series 700 UV/Vis Scanning Spectrophotometer (Mississauga, Ontario, Canada).

Isolated total RNA was subjected to DNAse I digestion (0.1 U/ml) to remove genomic DNA.

Reverse transcription was then performed with DNase-treated total RNA (2 µg) in a final

reaction volume of 40 µl using an ABI high capacity reverse transcription cDNA kit according to

manufacturer’s instructions (Applied Biosystems, Foster City, California, USA). All sample

reactions were incubated at 25 °C for 10 minutes, followed by 37 °C for 120 minutes and then 85

°C for 5 minutes using Mastercycler EP Realplex 2S thermal cycler (Eppendorf Canada,

Mississauga, Ontario, Canada).

The expression of genes encoding ABC transporters (abcb1a, abcb1b, abcc1, abcc4, and

abcg2), and peptidylprolyl isomerase B (cyclophilin B) were analyzed by qPCR on Mastercycler

EP Realplex 2S thermal cycler using SYBR green fluorescence detection. The 10 µl final

reaction mixtures contained 1.25 µl of diluted cDNA, 5 µl of PerfeCTa SYBR green Fastmix,

0.6 µl of 1.25 µM of each primer (final concentration of each primer 150 nM), and 2.55 µl of

nuclease-free water. Specific primers were designed using Primer Express 3 (Applied

Biosystems, Foster City, California, USA) and were on exon-exon junctions to avoid any


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

12

potential amplification of genomic DNA. The specificity of each reaction was assessed by

melting curve analysis to ensure the presence of only a single amplification product. Validated

primer sequences are shown in Table 1. Results for qPCR are presented as relative mRNA

abundance ± S.E.M. of each gene of interest normalized to the housekeeping gene cyclophilin B

using the comparative CT method, where ΔCT is equal to CT sample minus the CT Cyclophilin B and

relative mRNA abundance is equal to 2-ΔCT. The experimental variability observed in the mRNA

expression of the genes of interest and the housekeeping gene cyclophilin B between TM4 cell

passages as well as between sets of primary cultures of HSECs is < 5%.

Immunoblot Analysis

Western blot analysis was performed as described previously by our laboratory (Kis, et

al., 2010b;Ronaldson, et al., 2010;Zastre, et al., 2009) with minor modifications. In brief, cells

were harvested in lysis buffer containing 10 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 0.1 mM

EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 1 % Nonidet P-40 and 0.1

% protease inhibitor cocktail. The samples were sonicated on ice for 10 seconds and then

centrifuged for 10 minutes at 20,000 x g and 4 °C, and the supernatants were isolated as whole

cell lysates. The protein content of the lysates was determined using a BioRad protein assay kit.

Whole cell lysates were incubated with Laemmli buffer (20 mM Tris-HCl, 2 mM EDTA, 2%

SDS, 20 % glycerol, 0.2 % bromophenol blue) and 10 % β-mercaptoethanol for 10 minutes at

room temperature. Proteins were separated on 10 % SDS-polyacrylamide gel and then

transferred onto polyvinylidene fluoride membrane. The membranes were blocked overnight in 5

% skim milk Tris-buffered saline containing 0.1% Tween-20 and incubated overnight with

primary antibody, mouse anti-P-gp (C219, 1:500 dilution), which recognizes an internal epitope


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

13

of human P-gp; rat anti-Mrp1 (Mrpr1, 1:500 dilution) which recognizes an internal epitope of

168 amino acids in the amino-terminal end of MRP1; rat anti-Mrp4 (M4-I80, 1:500 dilution)

which recognizes an epitope composed of amino acids 372-431 of MRP4; rat anti-Bcrp (BXP-

53, 1:100 dilution), recognizes epitope corresponding to amino acids 221-394 of human and

mouse Bcrp; mouse anti-GATA-4 (6H10, 1:500 dilution), which recognizes a fragment

corresponding to amino acids 27-211 of human and mouse GATA-4 or mouse anti-actin (AC40,

1:500), which recognizes an epitope on the carboxy-terminal end of actin. The blots were then

incubated with corresponding horseradish peroxidase-conjugated secondary anti-mouse (1:5,000

dilution) or anti-rat (1:10,000 dilution) antibodies. Signals were enhanced through the use of

chemiluminescence SuperSignal West Pico System (ThermoFisher Scientific, Massachusetts,

USA) and detected by exposure to x-ray film.

Immunofluorescence Analysis

To identify the cellular localization of ABC transporters P-gp, Mrp1, Mrp4 and Bcrp, we

performed immunofluorescence analysis. Samples were prepared by culturing TM4 cells or

HSECs on glass cover-slips at a cell density of approximately 5000 cells / cm2. The samples

were fixed in 100 % methanol and permeabilized with 0.1 % Triton-X100. Fixed cell samples

were then incubated with the mouse monoclonal anti-P-gp (D11, 1:50 dilution), which

recognizes amino acids 1040 – 1280 of human MDR1, rat anti-Bcrp (BXP-53, 1:50 dilution), rat

anti-Mrp1 (Mrpr1, 1:50 dilution) or rat anti-Mrp4 (MI4-80, 1:50 dilution) antibodies which

recognize both human and rodent proteins. Cells were also incubated with rabbit polyclonal anti-

Na+/K+ ATPase-α (H-300, 1:100 dilution) which recognizes the amino acids 551-880 of

Na+/K+- ATPase α1 of human and mouse origin. This enzyme was used as a marker of plasma


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

14

membrane localization. Fixed cells were then incubated with respective secondary antibodies

conjugated to Alexafluor-488 (excitation 495 nm / emission 519 nm) for Na+/K+ ATPase-α1 and

Alexafluor-594 (excitation 590 nm / emission 617 nm) for P-gp, Mrp1/MRP1, Mrp4/MRP4 and

Bcrp. Samples were mounted on glass slides with Vectorshield hardset mounting medium

containing 4',6-diamidino-2-phenylindole (DAPI) (excitation 358 nm / emission 386 nm) as a

marker of DNA. For negative controls, samples were incubated only with secondary antibody.

Cells were then visualized using a Plan C-Apochromat-63x/1.4 oil differential interference

contrast objective and Zeiss LSM 510 META NLO two-photon confocal laser-scanning

microscope (Carl-Zeiss AG, Oberkochen, Germany) equipped with argon (458 nm, 476 nm, 488

nm, 513 nm wavelengths), helium-neon (533 nm wavelength) and a tuneable Chameleon (720 –

930 nm wavelengths) laser lines.

Functional Studies

All uptake / accumulation experiments were performed using Hanks’ Balanced Salt

Solution (HBSS), containing 1.3 mM KCl, 0.44 mM KH2PO4, 138 mM NaCl, 0.34 mM Na2PO4

and 5.6 mM D-glucose, supplemented with 0.01% bovine serum albumin and 25 mM HEPES,

pH 7.4. Throughout this work, supplemented HBSS buffer is referred to as transport buffer. TM4

cell were plated at a cell density of 15,000 cells / cm2 for all functional studies.

The cellular accumulation of rhodamine-6G (R-6G), a rhodamine analogue and

fluorescent P-gp substrate (Zastre, et al., 2009), and 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-

carboxyfluorescein-AM (BCECF-AM), a cell permeable ester which is cleaved by intracellular

esterases to BCECF, a fluorescent Mrp1/MRP1 and Mrp4/MRP4 substrate, were determined by

fluorescent transport assay as described previously (Ronaldson, et al., 2010;Zastre, et al., 2009).


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

15

Briefly, TM4 cells were washed and pre-incubated at 37 °C for 15 minutes in transport buffer

alone (control), or transport buffer containing standard inhibitors of P-gp i.e., 1 µM PSC833, also

known as valspodar, a non-immunosuppressive cyclosporin A (CSA) analogue; 10 µM

GF120918, also known as elacridar, an acridonecarboxamide derivative and potent P-gp and

Bcrp inhibitor and 100 µM quinidine, an anti-arrhythmic agent, and 25 µM CSA. To test Mrps

function, we used the Mrps inhibitor, MK571, a leukotriene D4 analogue and cysteinyl

leukotriene-1 receptor antagonist or antiretroviral drugs were used. To initiate the assay, TM4

cells were incubated in transport buffer containing specific substrates for each of the respective

ABC transporters of interest: 1 µM R-6G, a substrate of P-gp, BCECF, a substrate of Mrp1 and

Mrp4, in the absence or presence of transport inhibitors noted above or antiretroviral drugs.

Since BCECF-AM is a known substrate of P-gp, all assays involving BCECF were performed in

the presence of the P-gp inhibitor PSC833 (1 µM). At the desired time interval, the reaction was

stopped by washing TM4 cells with ice-cold PBS. Cells were then dissolved in 1% Triton X-100

at 37 °C for 30 minutes. Cell associated fluorescence was measured at an excitation wavelength

of 525 nm and emission wavelength of 560 nm for R-6G or excitation wavelength of 505 nm and

emission wavelength of 560 nm for BCECF using a SpectraMax Gemini XPS fluorescent

spectrophotometer (Molecular Devices, Sunnyvale, California, USA). Cellular accumulation was

normalized to cellular protein content as determined by the Bradford colorimetric method using

bovine serum albumin as a standard.

The cellular accumulation of [3H]-mitoxantrone, a known substrate of Bcrp, or [3H]

atazanavir, a HIV protease inhibitor and P-gp substrate, was determined applying a radioactive

transport assay as described previously (Kis, et al., 2010b;Lee, et al., 2007). Briefly, to initiate

the assay, TM4 cells were incubated with transport buffer containing 1 µM atazanavir (3H


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

16

atazanavir - 0.1 µCi /ml), or 20 nM mitoxantrone [3H] mitoxantrone - 0.1 µCi /ml), in the

absence (control) or presence of transport inhibitors of P-gp (listed in the above paragraph) or

Bcrp, 5 µM K0143, a fumitremorgin C1 analog and potent BCRP inhibitor or 10 µM GF120918

(Ni, et al., 2010) or antiretroviral drugs. Since mitoxantrone is a substrate for P-gp, all assays

involving mitoxantrone accumulation were performed in the presence of 2 µM PSC833, a P-gp

inhibitor. At the desired time interval, the fluorescent substrate containing medium was aspirated

and TM4 cells were washed twice with ice-cold PBS and solubilised in 1% Triton X-100 at 37

°C for 30 minutes. The content of each well was collected, mixed with 3 ml of PicoFluor 40

scintillation fluid (PerkinElmer Life and Analytical Sciences, Waltham Massachusetts, USA),

and the total radioactivity was measured using a Beckman Coulter LS5600 liquid scintillation

counter (Fullerton, California, USA). Background accumulation was estimated by determining

the retention of radiolabeled compounds in the cells after a minimum (zero) time of exposure, by

removing the radiolabeled solution immediately after its addition into each well, followed by two

subsequent washes with ice-cold PBS and quantified using liquid scintillation counting. Total

radioactive cellular accumulation was normalized to the total cellular protein content as

determined by Bio-Rad DC Protein Assay, using bovine serum albumin as the standard.

For all the accumulation assays, data are reported as total accumulation of an established

substrate at steady-state in the absence or presence of known inhibitors or antiretroviral drugs..

To identify the appropriate time point for the accumulation assays in the absence or presence of

inhibitors or antiretroviral drugs, a time-dependent uptake study for each of the established

substrates, R-6G, atazanavir, BCECF and mitoxantrone was performed in TM4 cells. Due to the

limited availability of the primary cultures of human Sertoli cells and the fact that we can only

passage them once, functional assays in this cell system could not be performed.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

17

Data Analyses

All experiments were repeated a minimum of three times in cells pertaining to different

passages for the TM4 cell line system. Each data point within an individual experiment

represents data from triplicate trials. Results from time-dependent accumulation of each of the

substrates of interest are presented as mean ± standard error of the mean (SEM), and all

functional studies involving inhibitors or antiretroviral drugs are shown as % control ± SEM.

Statistical analyses were performed using Graphpad InStat 3.0 software (Graphpad Software

Inc., San Diego, California, USA) and significance was assessed by two-tailed Student’s t test for

unpaired experimental values. A p-value of < 0.05 was considered statistically significant. The

non-linear fitting of data in time-dependent accumulation assays was performed applying

nonlinear regression least-square analysis using Graphpad Prism 5 (Graphpad Software Inc., San

Diego, California, USA).

Results

Cell Characterization - Morphology and Biochemical Markers

The morphology of the Sertoli cell line systems was examined using transmission

electron microscopy. Both TM4 cells (Figure 1A) and HSECs (Figure 1B) appeared to form

normal elongated epithelial-cell like monolayers with a defined large nuclei and plasma

membrane. We further examined the expression of GATA-4, a zinc finger containing

transcription factor known as a marker of Sertoli cells (Imai, et al., 2004). We detected GATA-4

at a band of approximately 46 kDa, a molecular weight previously reported for this marker, in

TM4 cells (Figure 1C - lane 1) and in primary cultures of HSECs (Figure 1C – lane 2). Rat fetal

heart tissue was used as a positive control of GATA-4 expression (Figure 1C – lane 3).


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

18

Relative ABC transporter mRNA expression in TM4 cells and HSECs

QPCR analysis was performed to investigate mRNA expression of several ABC drug

efflux transporters, Abcb1a (Mdr1a), Abcb1b (Mdr1b), ABCB1 (MDR1), Abcg2 (Bcrp),

ABCG2 (BCRP), Abcc1 (Mrp1), ABCC1 (MRP1), Abcc4 (Mrp4) and ABCC4 (MRP4). In

TM4 cells, we observed that Abcb1b (Mdr1b) mRNA expression (0.039 ± 0.007) was most

abundant when compared to cyclophilin B, the house-keeping gene, followed by the Mrps,

Abcc4 (Mrp4) (0.031 ± 0.005) and Abcc1 (Mrp1) (0.012 ± 0.004). Abcg2 (Bcrp) had the lowest

relative mRNA expression (0.003 ± 0.0005) and Abcb1a mRNA was below the threshold level

of detection (Figure 2A). In HSECs, mRNA expression of ABCC1 (0.60 ± 0.09) was the most

abundant compared to cyclophilin B, followed by ABCC4 (0.59 ± 0.06). Both ABCB1 (0.00072

± 0.0002) and ABCG2 (0.00089 ± 0.0006) had the lowest relative mRNA expression in the

human cells (Figure 2B).

Protein Expression of ABC transporters in TM4 cells and HSECs

We performed immunoblotting experiments to investigate protein expression of P-gp,

Mrp1/MRP1, Mrp4/MRP4 and Bcrp/BCRP in TM4 cells and HSECs. We detected P-gp protein

expression at approximately 170 kDa, a molecular size previously reported for P-gp, in both the

TM4 cells (Figure 3A – lanes 1 and 2) and in primary cultures of HSECs (Figure 3B – lane 1)

using the mouse monoclonal antibody C219, raised against an internal epitope of human P-gp. A

similar size band was detected in the P-gp over-expressing cell line MDA-MDR1 (Figures 3A –

lane 3 and 3B – lane 2) which served as our positive control.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

19

To investigate Mrp1/MRP1 protein expression, we used the rat monoclonal antibody

Mrpr1, raised against a bacterial fusion protein containing a segment of 168 amino acids of

human MRP1 located in the amino-proximal half of the protein. A band at approximately 190

kDa, a size previously reported for MRP1, in both TM4 cells (Figure 3C, lanes 1 and 2), primary

cultures of HSECs (Figure 3D – lane 1) and in the positive control, HeLa cells over-expressing

human MRP1, was detected (Figures 3C - lane 3 and 3D – lane 2). Mrp4/MRP4 protein

expression was determined using the rat monoclonal antibody, M4I-80, raised against a fusion

protein which contains the E. coli maltose binding protein and a fragment of the human MRP4

protein corresponding to amino acids 372 – 431. We detected a single band at approximately 180

kDa, a size previously reported for MRP4, in TM4 cells (Figure 3E - lanes 1 and 2) and primary

cultures of HSECs (Figure 3F, lane 1) as well as in HEK cells overexpressing human MRP4

cells, which served as the positive control (Figures 3E - lane 3 and 3F - lane 2).

Bcrp/BCRP expression in TM4 cells and in primary cultures of HSECs was investigated

using a rat monoclonal antibody, BXP-53, known to recognize an epitope corresponding to

amino acids 221-394 of mouse and human Bcrp/BCRP. We detected a single band at

approximately 76 kDa, a size previously reported for BCRP, in TM4 cells (Figure 3G - lane 1)

and in MCF7-MX100 cell line over-expressing human BCRP (Figures 3G - lane 2 and 3H -lane

2), which served as the positive control. We were unable to detect a band for BCRP in primary

cultures of human Sertoli cells (Figure 3H - lane 1).

Cellular localization of ABC transporters in Sertoli cells

The cellular localization of known ABC membrane-associated drug transporters in Sertoli

cells of mouse origin is currently not well documented. We therefore investigated the


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

20

localization of P-gp, Mrp1, Mrp4 and Bcrp by indirect immunofluorescence using specific

antibodies raised against each of the transporters of interest. TM4 and HSECs cells were fixed in

methanol and then stained with DAPI to visualize the DNA. In all immunofluorescence studies,

anti-Na+/K+ ATPase α1 antibody was used as a marker of the plasma membrane (Figure 4A-D,

Figure 5A-C).

We first examined P-gp localization using anti-P-gp (D11), a mouse monoclonal antibody

raised against amino acids 1040-1280 of human P-gp protein. In addition to human P-gp, this

antibody also recognizes P-gp protein of rodent origin. In the TM4 cells (Figure 4A) and HSECs

(Figure 5A), we detected P-gp predominately at the plasma membrane. Removal of the primary

antibody led to a total absence of fluorescence signal, suggesting the signal observed was

specific for P-gp (data not shown).

Similarly, we detected Mrp1 localization in TM4 cells (Figure 4B) and HSECs (Figure

5B) applying immunofluorescence using the rat monoclonal antibody Mrpr1, which recognizes

an internal epitope of human and rodent MRP1/Mrp1. A similar pattern of localization to that of

P-gp was observed, predominately at the plasma membrane. Fluorescence was not detected in

the TM4 cells in the absence of primary antibody, indicating the signal was specific for Mrp1

protein expression (data not shown).

We also examined the localization of Mrp4/MRP4 using MI-80 mouse monoclonal

antibody which recognizes an internal epitope of human and rodent MRP4/Mrp4. We detected

Mrp4 localization predominately at the plasma membrane in TM4 cells (Figure 4C) and HSECs

(Figure 5C). These signals were not detected in TM4 cells when the primary antibody was

removed, indicating that those signals observed were specific to Mrp4 expression (data not

shown).


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

21

We also investigated Bcrp protein localization applying indirect immunofluorescence

using the mouse monoclonal antibody BXP-53, which recognizes an internal epitope of rodent

and human Bcrp/BCRP. We were able to detect Bcrp predominately at the plasma membrane of

TM4 cells (Figure 4D). Cells incubated with secondary antibody alone did not exhibit a

fluorescence signal, indicating that the signals observed were specific for Bcrp (data not shown).

Since we did not detected expression of BCRP protein in HSECs (Figure 3H – lane 1), we did

not perform immunofluorescence localization studies in the human cell system.

Function of ABC Transporters in TM4 Cells

The time course of R-6G (Figure 6A), [3H]-atazanavir (Figure 6B) and BCECF (Figure

6C) at 37 °C showed increasing substrate uptake until a plateau was reached at approximately 60

minutes under control conditions. The time course for [3H]-mitoxantrone (Figure 6D) revealed

that a steady state was reached later at approximately 90 minutes in control conditions.

To investigate if P-gp was functional in TM4 cells, accumulation studies were conducted

using an established P-gp fluorescent substrate, R-6G. The accumulation of R-6G was

significantly increased in the presence of P-gp inhibitors: PSC833 (1 µM, 151 ± 5%),

cyclosporin A (25 µM, 130 ± 12%), quinidine (100 µM, 138 ± 7 %) and GF120918 (10 µM, 126

± 8%) compared to control (Figure 7A). To further characterize the potential involvement of P-

gp in the permeability of antiretroviral drugs, we performed an accumulation study using the

HIV protease inhibitor, atazanavir, a known substrate of P-gp (Kis, et al., 2010b). The

accumulation of [3H]-atazanavir was significantly enhanced in the presence of selective P-gp

inhibitors, PSC833 (1 µM, 132 ± 7%), cyclosporin A (25 µM, 123 ± 6%), quinidine (100 µM,

128 ± 8%) and GF120918 (10 µm, 124 ± 10%) compared to control (Figure 7B). Together these


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

22

data suggest that R-6G and atazanavir accumulation is regulated by a P-gp mediated efflux

process in the rodent Sertoli cell line system.

To assess if Mrps were active in TM4 cells, we examined the accumulation of BCECF-

AM, a cell permeable ester which is cleaved by intracellular esterases. The cleaved ester,

BCECF, is a fluorescent substrate of several Mrp isoforms including Mrp1 and Mrp4

(Ronaldson, et al., 2010). BCECF accumulation in TM4 cells was significantly enhanced in the

presence of increasing concentrations of the Mrp established inhibitor, MK571 (5 µM and 10

µM, 136 ± 3 % and 158 ± 4 %, respectively) compared to control (10 µM GF120918) (Figure

7C).

To determine if Bcrp was functional in TM4 cells, we investigated the accumulation of

mitoxantrone, a chemotherapeutic agent and substrate for Bcrp and P-gp. Mitoxantrone

accumulation was significantly increased in the presence of established Bcrp inhibitors, KO143

(5 µM, 136 ± 9 %) and GF120918 (10 µM, 127 ± 10 %) compared to control (2 µM PSC833)

(Figure 7D).

To investigate the potential role of ABC transporters, P-gp, Mrps and Bcrp, in the

disposition of antiretroviral drugs in vitro, we performed functional assays in TM4 cells in the

absence or presence of different classes of antiretroviral drugs. All drugs were used at clinically

relevant concentrations observed in plasma of HIV-infected individuals. Compared to control,

the accumulation of the P-gp fluorescent substrate R-6G (1 µM) was significantly enhanced in

the presence of HIV protease inhibitors, atazanavir (20 µM, 145 ± 10 %) and amprenavir (20

µM, 128 ± 14 %). Darunavir (20 µM), lopinavir (20 µM), saquinavir (20 µM) abacavir (10 µM),

tenofovir (5 µM), emtricitabine (20 µM), maraviroc (2 µM) and raltegravir (10 µM) had no

significant effect on the accumulation of R-6G in TM4 cells. Although efavirenz (50 µM) and


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

23

ritonavir (20 µM) appeared to decrease (56 ± 29 % and 67 ± 19 %, respectively) the

accumulation of R-6G in TM4 cells (Figure 8A), we identified that these compounds were

capable of quenching the R-6G fluorescence, leading to an ‘apparent’ decrease in R-6G

accumulation (data not shown).

To further understand the role of P-gp in antiretroviral drug transport in TM4 cells, we

also investigated the accumulation of the HIV protease inhibitor atazanavir in the presence or

absence of several antiretroviral drugs. All were used at clinically relevant concentrations

observed in plasma. The accumulation of atazanavir was significantly enhanced in the presence

of HIV protease inhibitors darunavir (20 µM, 154 ± 14%), lopinavir (20 µM, 136 ± 15%),

ritonavir (20 µM, 143 ± 10%) and saquinavir (20 µM, 146 ± 24%). In addition, the accumulation

of atazanavir was also significantly enhanced in the presence of the HIV nucleoside reverse

transcriptase inhibitor, tenofovir (5 µM, 157 ± 13%) and HIV non-nucleoside transcriptase

inhibitor, efavirenz (50 µM, 196 ± 23%). All the other antiretroviral drugs tested did not

significantly alter the accumulation of atazanavir by TM4 cells compared to control (Figure 8B).

The accumulation of the Mrp fluorescent substrate BCECF by TM4 cells was

significantly enhanced in the presence of the HIV protease inhibitor, ritonavir (20 µM, 136 ±

13%). Efavirenz was not tested, as it also quenched BCECF fluorescence similar to our findings

with R-6G (data not shown). All the other antiretroviral drugs tested did not significantly alter

the accumulation of BCECF compared to control (Figure 8C).

The accumulation of the Bcrp substrate mitoxantrone by TM4 cells was significantly

enhanced in the presence of the HIV protease inhibitors lopinavir (20 µM, 146 ± 14%),

saquinavir (20 µM, 132 ± 18%) and the non-nucleoside reverse transcriptase inhibitor efavirenz


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

24

(50 µM, 138 ± 12 %). All the other antiretroviral drugs tested did not significantly affect the

accumulation of mitoxantrone compared to control (Figure 8D).

Discussion

Although current antiretroviral therapy is very effective in suppressing viral replication in

plasma, it does not completely eradicate HIV infection from the host (Dahl, et al., 2010).

Clinical studies have reported very low concentrations of anti-HIV drugs in the brain and testes

(Cruciani, et al., 2006;Ghosn, et al., 2004;Pereira, et al., 2002;Taylor, et al., 1999;van Leeuwen,

et al., 2007;van Praag, et al., 2001). This, in part, has been attributed to the expression of ABC

drug efflux transporters at blood-tissue barriers such as the blood-brain barrier which can

actively extrude several drugs including antiretrovirals from the brain (Kis, et al., 2010a).

Reduced drug concentrations in either brain or testis could result in ineffective viral suppression

with the potential risk of anti-HIV-drug resistance and the formation of a HIV reservoir (Dahl, et

al., 2010). Although the functional expression of ABC membrane-associated transporters and its

role in antiretroviral drug transport at the blood-brain barrier and in brain parenchyma have been

investigated (Dallas, et al., 2004a;Ronaldson, et al., 2004) , to the best of our knowledge, the

activity of these transporters at the blood-testis barrier has not been explored.

In this study, we examined the expression of several drug efflux transporters in two

models of Sertoli cells: i) a mouse Sertoli (TM4) cell system which has previously been

characterized to maintain Sertoli cell properties in response to follicle stimulation hormone and

lack of response to luteinizing hormone (Mather, 1980) and ii) primary cultures of human Sertoli

cells (Chui, et al., 2011). To further characterize our cell models, we performed detailed

morphology studies using electron microscopy and further confirmed the expression of GATA-4,


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

25

a transcription factor and known Sertoli cell marker in both TM4 cells and primary cultures of

HSECs (Imai, et al., 2004).

In TM4 cells, we demonstrated for the first time mRNA and protein expression as well as

cellular localization of the major ABC membrane-associated drug efflux proteins i.e., P-gp,

Mrp1, Mrp4, and Bcrp. In particular, applying qPCR, we detected mRNA expression of Abcb1b,

Abcc1, and Abcc4 and Abcg2. Furthermore we observed P-gp, Mrp1, Mrp4 and Bcrp protein

expression and plasma membrane localization using western blot and immunofluorescence

analyses, respectively. Our laboratory has previously observed the localization of P-gp at the

plasma membrane and cytosol of rodent and human brain microvessel endothelial cells,

astrocytes and microglia applying immunogold cytochemistry and electron microscopy

(Bendayan, et al., 2002;Bendayan, et al., 2006). Our data are also in agreement with previous

findings reporting mRNA expression of several ABC transporters in isolated adult male

Sprague-Dawley rat Sertoli cells (Augustine, et al., 2008). In the primary cultures of human

Sertoli cells (HSECs), we confirmed for the first time, mRNA, protein expression and

localization of MDR1/P-gp, MRP1 and MRP4 applying qPCR, immunoblotting and

immunofluorescence confocal microscopy techniques. Interestingly, we were unable to detect

BCRP protein expression in this cell system and were only able to observe very low ABCG2

mRNA expression. A study by Melaine et al. reported Abcb1a/1b/ABCB1 gene expression in the

testes of human, rat, mouse and guinea pig confirming that at the mRNA level this transporter is

expressed in the testes of several mammalian species (Melaine, et al., 2002). Although no studies

have directly examined the cellular localization of these transporters in Sertoli cells, a few

immunohistochemical reports have described localization of P-gp and MRP1, in human normal


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

26

and tumor testicular tissue slices and in rat testes (Bart, et al., 2004;Su, et al., 2009). Similarly to

our findings, BCRP was not detected in these tissues.

To determine if P-gp retains function, we investigated the accumulation of R-6G and

atazanavir by TM4 monolayer cells in the presence of standard P-gp inhibitors, PSC833,

cyclosporin A, quinidine and GF120918. The accumulation of both P-gp substrates was

significantly enhanced in the presence of the inhibitors suggesting a P-gp mediated efflux is

involved in the overall transport of the two substrates by the Sertoli monolayer cells. Our data

are the first to demonstrate that the HIV-protease inhibitors, amprenavir and atazanavir can

significantly enhance R-6G accumulation by the TM4 cells. Furthermore we also demonstrated

that atazanavir accumulation is significantly enhanced by other HIV protease inhibitors:

darunavir, lopinavir, ritonavir and saquinavir as well as the nucleoside-reverse transcriptase

inhibitor tenofovir and the non-nucleoside reverse transcriptase inhibitor efavirenz by TM4 cells.

These results suggest that many of the anti-HIV drugs can inhibit P-gp mediated efflux of R-6G

and atazanavir by TM4 cells. A study by Storch et al., reported similar findings examining

calcein efflux, another established P-gp substrate, in the presence of tenofovir and efavirenz in

LLC-PK1 (porcine kidney epithelial cells) stably transfected with MDR1 (Storch, et al., 2007).

Previous in vitro studies investigating the role of P-gp in antiretroviral drug transport have shown

that HIV protease inhibitors serve as both substrates and inhibitors of this transporter in cell

culture systems including, Caco-2 and ABCB1-gene transfected porcine kidney LLC-PK1 cell

lines systems (Fujimoto, et al., 2009;Zastre, et al., 2009). Furthermore, an in vivo study using

Mdr1a(+/+) and Mdr1a(-/-) mice reported significantly higher brain concentrations (7-30 fold) of

the HIV protease inhibitors, indinavir, saquinavir and nelfinavir in Mdr1a(-/-) compared to wild-

type Mdr1a(+/+) mice, indicating a role for P-gp in HIV protease inhibitor permeability in the


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

27

brain (Kim, et al., 1998). Similarly, a study by Choo et al. in 2000, demonstrated that intravenous

administration of the HIV protease inhibitor [14C]-nelfinavir, in the presence of the selective P-

gp inhibitor LY-335979, increased brain and testes drug concentrations, 37-fold and 4-fold,

respectively, in wild-type mice (Choo, et al., 2000), further emphasizing the significance of P-gp

in ARV drug permeability at several sites.

Clinical studies investigating the permeability of antiretroviral drugs in the seminal fluid

of HIV positive patients have observed significantly reduced concentrations of efavirenz (Ghosn,

et al., 2004), amprenavir (Pereira, et al., 2002), ritonavir (Taylor, et al., 1999) and atazanavir

(van Leeuwen, et al., 2007) compared to drug concentrations present in plasma. In addition, a

study examining the in vivo distribution of [3H]-digoxin, an established P-gp substrate,

demonstrated an increase in digoxin concentration in Mdr1a(-/-) mice testes (593 ± 169 ng / g

tissue) compared to wild-type Mdr1a(+/+) mice testes (213 ± 83 ng / g tissue) (Schinkel, et al.,

1995). Together, our data in TM4 cells, combined with previous in vivo animal studies and

clinical observations in HIV positive men strongly suggest that P-gp plays a role in restricting

the permeability of several substrates including anti-HIV drugs at the BTB.

To examine the function of Mrps in TM4 cells, BCECF was chosen as Mrp substrate. To

confirm the Mrp substrate specificity of BCECF, we demonstrated that its accumulation by TM4

cells was significantly enhanced in the presence of MK571, a potent Mrp inhibitor (Leier, et al.,

1994). Our laboratory has previously demonstrated that MK571 is capable of inhibiting Mrp1-

mediated efflux of the anti-cancer drug vincristine and the HIV protease inhibitor, saquinavir in a

microglia cell-line, MLS9 (Dallas, et al., 2003;Dallas, et al., 2004a). In the present study, we

demonstrated that BCECF accumulation by TM4 cells was significantly enhanced in the

presence of the antiretroviral drug, ritonavir, suggesting that this drug transporter like P-gp can


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

28

regulate drug permeability in Sertoli cells. In the clinic, ritonavir is used as a “booster” to inhibit

cytochrome P450 mediated metabolism of other HIV protease inhibitors; however, its additional

ability to inhibit the efflux of other antiretroviral drugs by ABC drug efflux transporters such as

Mrp1 may also contribute to maintaining higher levels of antiretroviral drugs in HIV reservoirs

such as the BTB.

Results from the Bcrp functional studies in TM4 cells demonstrated that mitoxantrone

accumulation was significantly enhanced in the presence of the Bcrp inhibitors, K0143 and

GF120918 suggesting for the first time that the transporter is active in the Sertoli cell line

system. Our laboratory has previously reported that K0143 and GF120918 can inhibit the

BCRP-mediated efflux of mitoxantrone in MCF7-MX100, a breast cancer cell line which over-

expresses BCRP (Lee, et al., 2007). In addition, lopinavir, saquinavir and efavirenz significantly

enhanced the accumulation of mitoxantrone by TM4 cells. These data are in support with

previous findings by Weiss et al. reporting the inhibition of Bcrp-mediated efflux of

pheophorbide A, an established fluorescent BCRP substrate, in MDCKII-BCRP overexpressing

cells, by lopinavir (IC50 - 7.66 µM), saquinavir (IC50 - 27.4 µM) and efavirenz (IC50 – 20.6 µM)

(Weiss, et al., 2007). Furthermore, Gupta et al. demonstrated that ritonavir, saquinavir and

nelfinavir are inhibitors but not substrates of BCRP-mediated efflux of mitoxantrone in

HEK293-BCRP cells, a human embryonic kidney cell system stably transfected with BCRP

(Gupta, et al., 2004). To date, in vivo studies investigating the role of Bcrp have demonstrated an

enhanced accumulation of xenobiotic compounds such as mitoxantrone (chemotherapeutic),

erlotinib (chemotherapeutic) and flavopiridol (cyclin-dependent kinase inhibitor) in brain and

testes of Abcg2(-/-) knock-out mice when compared to wild-type Abcg2(+/+) mice (Enokizono,

et al., 2008;Kodaira, et al., 2010). Furthermore, Kodaira et al. observed that the Mdr1a(-/-),


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

29

Mdr1b(-/-) and Abcg2(-/-) triple knock-out mice exhibited a greater testicular concentration of

these substrates when compared to Mdr1a(-/-) and Mdr1b(-/-) or Abcg2(-/-) knockout mice alone

(Kodaira, et al., 2010). Together these data suggest a cooperative role of Bcrp and P-gp in

preventing xenobiotics from crossing the BTB and further support that P-gp and Bcrp could

contribute to restricting the permeability of antiretroviral drugs at this site.

Our current findings in TM4 and primary cultures of human Sertoli cells combined with

data from previous immunohistochemical and in vivo studies, suggest that ABC drug

transporters, P-gp, Mrps and Bcrp expressed in Sertoli cells play an important role in the

permeability of antiretroviral drugs at the BTB. In addition, this study provides insights in our

understanding of the mechanisms of drug transport in both rodent and human Sertoli cells and

contributes to the elucidation of the mechanisms by which these transporters could regulate the

ability of antiviral drugs to reach therapeutic concentrations within the genital tract of HIV-

infected men.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

30

Acknowledgements

The authors thank Dr. Moise Bendayan (University of Montreal, QC, Canada) for the

electron microscopy work and excellent advice on the design of the confocal

immunofluorescence studies.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

31

Authorship Contributions

Participated in research design: RB, KRR

Conducted research experiments: MTH, KRR

Contributed to Reagents or analytical tools: RB

Performed data analysis: MTH, KRR

Contributed to the writing of the manuscript: RB, MTH, KRR


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

32

References

Augustine L, Markelewicz R, Boekelheide K and Cherrington N (2008) Xenobiotic and

endobiotic transporter mRNA expression in the blood-testis barrier. Drug Metab Dispos 33:182-

189.

Bart J, Hollema H, Groen HJM, de Vries EGE, Hendrikse NH, Sleijfer DT, Wegman TD,

Vaalburg W and van der Graaf WTA (2004) The distribution of drug-efflux pumps, P-gp, BCRP,

MRP1 and MRP2 in the normal blood-testis barrier and in primary testicular tumours. European

Journal of Cancer 40:2064-2070.

Bendayan R, Lee G and Bendayan M (2002) Functional expression and localization of P-

glycoprotein at the blood brain barrier. Microsc Res Tech 57:365-380.

Bendayan R, Ronaldson PT, Gingras D and Bendayan M (2006) In situ localization of P-

glycoprotein (ABCB1) in human and rat brain. J Histochem Cytochem 54:1159-1167.

Choo EF, Leake B, Wandel C, Imamura H, Wood AJJ, Wilkinson GR and Kim RB (2000)

Pharmacological Inhibition of P-glycoprotein Transport Enhances the Distribution of HIV-1

Protease Inhibitors into Brain and Testes. Drug Metab Dispos 28:655-660.

Chui K, Trivedi A, Cheng CY, Cherbavaz DB, Dazin PF, Huynh AL, Mitchell JB, Rabinovich

GA, Noble-Haeusslein LJ and John CM (2011) Characterization and Functionality of

Proliferative Human Sertoli Cells. Cell Transplantation 20:619-635.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

33

Cruciani M, Liuzzi G, Chirianni A, Audagnotto S, Bonora S, Di BA, Sinicco A, Bassetti M and

Gatti G (2006) Penetration of didanosine in semen of HIV-1-infected men. J Antimicrob

Chemother 57:1244-1247.

Dahl V, Josefsson L and Palmer S (2010) HIV reservoirs, latency, and reactivation: Prospects for

eradication. Antiviral Research 85:286-294.

Dallas S, Ronaldson PT, Bendayan M and Bendayan R (2004a) Multidrug resistance protein 1-

mediated transport of saquinavir by microglia. Neuroreport 15:1183-1186.

Dallas S, Schlichter L and Bendayan R (2004b) Multidrug resistance protein (MRP) 4- and MRP

5-mediated efflux of 9-(2-phosphonylmethoxyethyl)adenine by microglia. J Pharmacol Exp Ther

309:1221-1229.

Dallas S, Zhu X, Baruchel S, Schlichter L and Bendayan R (2003) Functional expression of the

multidrug resistance protein 1 in microglia. J Pharmacol Exp Ther 307:282-290.

Enokizono J, Kusuhara H, Ose A, Schinkel AH and Sugiyama Y (2008) Quantitative

investigation of the role of breast cancer resistance protein (Bcrp/Abcg2) in limiting brain and

testis penetration of xenobiotic compounds. Drug Metab Dispos 36:995-1002.

Fujimoto H, Higuchi M, Watanabe H, Koh Y, Ghosh AK, Mitsuya H, Tanoue N, Hamada A and

Saito H (2009) P-Glycoprotein Mediates Efflux Transport of Darunavir in Human Intestinal


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

34

Caco-2 and ABCB1 Gene-Transfected Renal LLC-PK1 Cell Lines. Biological &

Pharmaceutical Bulletin 32:1588-1593.

Ghosn J, Chaix ML, Peytavin G, Rey E, Bresson JL, Goujard C, Katlama C, Viard JP, Treluyer

JM and Rouzioux C (2004) Penetration of enfuvirtide, tenofovir, efavirenz, and protease

inhibitors in the genital tract of HIV-1-infected men. AIDS 18:1958-1961.

Gupta A, Zhang Y, Unadkat JD and Mao Q (2004) HIV Protease Inhibitors Are Inhibitors but

Not Substrates of the Human Breast Cancer Resistance Protein (BCRP/ABCG2). J Pharmacol

Exp Ther 310:334-341.

Haimeur A, Conseil G, Deeley RG and Cole SP (2004) The MRP-related and BCRP/ABCG2

multidrug resistance proteins: biology, substrate specificity and regulation. Curr Drug Metab

5:21-53.

Imai T, Kawai Y, Tadokoro Y, Yamamoto M, Nishimune Y and Yomogida K (2004) In vivo and

in vitro constant expression of GATA-4 in mouse postnatal Sertoli cells. Molecular and Cellular

Endocrinology 214:107-115.

Kim RB, Fromm MF, Wandel C, Leake B, Wood AJ, Roden DM and Wilkinson GR (1998) The

drug transporter P-glycoprotein limits oral absorption and brain entry of HIV-1 protease

inhibitors. J Clin Invest 101:289-294.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

35

Kis O, Robillard K, Chan GNY and Bendayan R (2010a) The complexities of antiretroviral drug-

drug interactions: role of ABC and SLC transporters. Trends in Pharmacological Sciences

31:22-35.

Kis O, Zastre JA, Ramaswamy M and Bendayan R (2010b) pH Dependence of organic anion-

transporting polypeptide 2B1 in Caco-2 cells: Potential role in antiretroviral drug oral

bioavailability and drug-drug interactions. J Pharmacol Exp Ther 334:1009-1022.

Kodaira H, Kusuhara H, Ushiki J, Fuse E and Sugiyama Y (2010) Kinetic analysis of the

cooperation of P-Glycoprotein (P-gp/Abcb1) and breast cancer resistance protein (Bcrp/Abcg2)

in limiting the brain and testis penetration of erlotinib, flavopiridol, and mitoxantrone. J

Pharmacol Exp Ther 333:788-796.

Lee G, Babakhanian K, Ramaswamy M, Prat A, Wosik K and Bendayan R (2007) Expression of

the ATP-binding cassette membrane transporter, ABCG2, in human and rodent brain

microvessel endothelial and glial cell culture systems. Pharm Res 24:1262-1274.

Leier I, Jedlitschky G, Buchholz U, Cole SP, Deeley RG and Keppler D (1994) The MRP gene

encodes an ATP-dependent export pump for leukotriene C4 and structurally related conjugates. J

Biol Chem 269:27807-27810.

Mather JP (1980) Establishment and characterization of two distinct mouse testicular epithelial

cell lines. Biol Reprod 23:243-252.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

36

Meaden ER, Hoggard PG, Newton P, Tjia JF, Aldam D, Cornforth D, Lloyd J, Williams I, Back

DJ and Khoo SH (2002) P-glycoprotein and MRP1 expression and reduced ritonavir and

saquinavir accumulation in HIV-infected individuals. J Antimicrob Chemother 50:583-588.

Melaine N, Lienard MO, Dorval I, Le GC, Lejeune H and Jegou B (2002) Multidrug resistance

genes and P-glycoprotein in the testis of the rat, mouse, guinea pig, and human. Biol Reprod

67:1699-1707.

Ni Z, Bikadi Z, Rosenberg MF and Mao Q (2010) Structure and function of the human breast

cancer resistance protein (BCRP/ABCG2). Curr Drug Metab 11:603-617.

Panel on Antiretroviral Guidelines for Adults and Adolescents (2011) Guidelines for the Use of

Antiretroviral Agents in HIV-1 -Infected Adults and Adolescents, US Department of Health and

Human Services, Washington, DC, USA

Pereira AS, Smeaton LM, Gerber JG, Acosta EP, Snyder S, Fiscus SA, Tidwell RR, Gulick RM,

Murphy RL and Eron JJ, Jr. (2002) The pharmacokinetics of amprenavir, zidovudine, and

lamivudine in the genital tracts of men infected with human immunodeficiency virus type 1

(AIDS clinical trials group study 850). J Infect Dis 186:198-204.

Ritter CA, Jedlitschky G, Meyer zu SH, Grube M, Kock K and Kroemer HK (2005) Cellular

export of drugs and signaling molecules by the ATP-binding cassette transporters MRP4

(ABCC4) and MRP5 (ABCC5). Drug Metab Rev 37:253-278.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

37

Ronaldson PT, Lee G, Dallas S and Bendayan R (2004) Involvement of P-glycoprotein in the

transport of saquinavir and indinavir in rat brain microvessel endothelial and microglia cell lines.

Pharm Res 21:811-818.

Ronaldson PT, Ashraf T and Bendayan R (2010) Regulation of multidrug resistance protein 1 by

tumor necrosis factor alpha in cultured glial cells: Involvement of nuclear factor-κB and c-Jun N-

terminal kinase signaling pathways. Mol Pharmacol 77:644-659.

Schinkel AH, Wagenaar E, van DL, Mol CA and Borst P (1995) Absence of the mdr1a P-

Glycoprotein in mice affects tissue distribution and pharmacokinetics of dexamethasone,

digoxin, and cyclosporin A. J Clin Invest 96:1698-1705.

Storch CH, Theile D, Lindenmaier H, Haefeli WE and Weiss J (2007) Comparison of the

inhibitory activity of anti-HIV drugs on P-glycoprotein. Biochem Pharmacol 73:1573-1581.

Su L, Mruk DD, Lee WM and Cheng CY (2011) Drug transporters and blood-testis barrier

function. J Endocrinol 209:337-351.

Su L, Cheng CY and Mruk DD (2009) Drug transporter, P-glycoprotein (MDR1), is an

integrated component of the mammalian blood-testis barrier. The International Journal of

Biochemistry & Cell Biology 41:2578-2587.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

38

Taylor S, Back DJ, Workman J, Drake SM, White DJ, Choudhury B, Cane PA, Beards GM,

Halifax K and Pillay D (1999) Poor penetration of the male genital tract by HIV-1 protease

inhibitors. AIDS 13:859.

van Leeuwen E, Ter HR, van d, V, Repping S, Beijnen JH and Prins JM (2007) Penetration of

atazanavir in seminal plasma of men infected with human immunodeficiency virus type 1.

Antimicrob Agents Chemother 51:335-337.

van Praag RM, van Heeswijk RP, Jurriaans S, Lange JM, Hoetelmans RM and Prins JM (2001)

Penetration of the nucleoside analogue abacavir into the genital tract of men infected with human

immunodeficiency virus type 1. Clin Infect Dis 33:e91-e92.

Weiss J, Rose J, Storch CH, Ketabi-Kiyanvash N, Sauer A, Haefeli WE and Efferth T (2007)

Modulation of human BCRP (ABCG2) activity by anti-HIV drugs. J Antimicrob Chemother

59:238-245.

Zastre JA, Chan GNY, Ronaldson PT, Ramaswamy M, Couraud PO, Romero IA, Weksler BB,

Bendayan M and Bendayan R (2009) Up-regulation of P-glycoprotein by HIV protease inhibitors

in human brain microvessel endothelial cells. Journal of Neuroscience Research 87:1023-1036.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

39

Footnotes

(a) This work is supported by an operating grant from the Ontario HIV Treatment Network

(OHTN). Dr. R. Bendayan is a recipient of an OHTN Career Scientist Award. Mr. Kevin

Robillard has been awarded a graduate scholarship from the Ontario HIV Treatment

Network and the Ontario Graduate Scholarship in Sciences and Technology.

(b) This work was presented in part at the following meetings and conferences:

Robillard, K.R., Hoque Md. T. and Bendayan R. (April 2011) Functional Expression of

ABC transporters in human and rodent Sertoli Cells: Relevance to Antiretroviral

Therapy. Canadian HIV / AIDS Research Conference, Toronto, ON, Canada.

Robillard, K.R., Hoque, Md. T, and Bendayan R. (November 2010). Functional

Expression of ABC transporters at the mouse Blood-Testis Barrier: Relevance of

Antiretroviral Therapy. American Association of Pharmaceutical Scientists Annual

Meeting, New Orleans, Louisiana, USA.

Robillard, K.R., Hoque, Md. T and Bendayan R. (November 2010). Functional

Expression of ABC transporters at the Blood-Testis Barrier: Relevance of Antiretroviral

Therapy. Ontario HIV Treatment Network Research Conference, Toronto, ON, Canada

Robillard, K.R. and Bendayan R. (July 2010). Functional Expression of ABC transporters

at the mouse Blood-Testis Barrier: Relevance of Antiretroviral Therapy. IUPHAR

WorldPharma, Copenhagen, Denmark.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

40

(c) Dr. Reina Bendayan, Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of Toronto, 144 College Street, Toronto, ON, M5S 3M2, Canada - email: [email protected]


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

41

Figures Legends

Figure 1

Morphology of mouse TM4 cells and primary cultures of human Sertoli cells using electron

microscopy. Transmission electron micrograph depicting the ultra structure of (A) TM4 cells and

(B) primary cultures of HSECs. Scale Bars represents 5 µm. (C) Western blot analysis of Sertoli

cell marker, GATA-4, a transcription factor (~46 kDa): Lane 1, TM4 cells (50 µg); Lane 2,

HSECs (50 µg) and Lane 3, rat fetal heart tissue (10 µg). Whole cell lysates/tissue proteins were

resolved on 10% SDS polyacrylamide gel. Blots were incubated with the primary mouse anti-

GATA-4 antibody (GATA-4, 1:500 dilution), followed by incubation with secondary HRP-

conjugated anti-mouse antibody (1:10,000 dilution). Data shown are from a representative

immunoblot of three independent experiments.

Figure 2

Relative mRNA expression of ABC transporters, Abcb1a (Mdr1a), Abcb1b (Mdr1b), ABCB1

(MDR1), Abcc1/ABCC1 (Mrp1/MRP1), Abcc4/ABCC4 (Mrp4/MRP4) and Abcg2/ABCG2

(Bcrp/BCRP) in (A) mouse Sertoli (TM4) cells and (B) primary cultures of HSECs using

quantitative real-time PCR. Results are shown as mean relative mRNA expression +/- S.E.M

relative to the house-keeping gene cyclophilin B from three different passages of TM4 cells and

two different sets of primary cultures of HSECs.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

42

Figure 3

Western blot analyses of ABC transporter proteins in mouse Sertoli (TM4) cells (A, C, E and G)

and primary cultures of HSECs (B, D, F and H). Whole cell lysates were resolved on 7% SDS

polyacrylamide gel and incubated with mouse anti-P-gp (C219), anti-actin (AC-40), rat anti-

Mrp1 (Mrp1r1), anti-Bcrp (BXP-53) and anti-Mrp4 (M4I-80) primary antibodies, followed by

incubation with respective secondary horseradish peroxidase-conjugated anti-mouse or anti-rat

antibodies. Actin was used as a loading control. (A) P-gp (~170 kDa) blot , Lane 1, TM4 cells

(25 µg); Lane 2, TM4 cells (50 µg); Lane 3, MDA-MDR1 (5 µg); (B) P-gp (~170 kDa) blot,

Lane 1, HSECs (50 µg); Lane 2, MDA-MDR1 (5 µg); (C) Mrp1 (~190 kDa) blot, Lane 1, TM4

cell (25 µg); Lane 2, TM4 cells (50 µg); Lane 3, HeLa-MRP1 (5 µg); (D) MRP1 (~190 kDa)

blot, Lane 1, HSECs (50 µg); Lane 2, HeLa-MRP1 (5 µg); (E) Mrp4 (~180 kDa) blot, Lane 1,

TM4 cells (25 µg); Lane 2, TM4 cells (50 µg); Lane 3, HEK-MRP4 (5 µg); (F) MRP4 (~ 180

kDa) blot, Lane 1 – HSECs (50 µg); Lane 2, HEK-MRP4 (5 ug); (G) Bcrp (~75 kDa) blot, Lane

1, TM4 cells (50 µg); Lane 2, MCF7-MX100 cells (5 µg) and (H) BCRP (~75 kDa) blot, Lane 1,

HSECs (50 µg); Lane 2, MCF7-MX100 cells (5 µg). Data shown are representative immunoblot

of three separate experiments.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

43

Figure 4

Immunocytochemical localization of ABC transporters in mouse Sertoli (TM4) cells. TM4 cells

were stained with DNA dye, DAPI (Blue) and examined by immunofluorescence using anti-P-gp

(D11, red) (A); anti-MRP1 (Mrpr1, red) (B); anti-MRP4 (MI4-80, red) (C) and anti-BCRP

(BXP-53, red) (D) monoclonal antibodies. Anti-Na+/K+ ATPase-α1 (H300, green) rabbit

polyclonal antibody was used as a marker of plasma membrane. Cells were stained with

Alexafluor-conjugated secondary antibodies 488/594 alone to verify the signal specificity of the

primary antibodies. The scale bars represent 20 µm.

Figure 5

Immunocytochemical localization of ABC transporters in primary cultures of human Sertoli cells

(HSECs). HSECs were stained with DNA dye, DAPI (Blue) and examined by

immunofluorescence using anti-P-gp (D11, red) (A); anti-MRP1 (Mrpr1, red) (B) and anti-

MRP4 (MI4-80, red) (C) monoclonal antibodies. Anti-Na+/K+ ATPase-α1 (H300, green) rabbit

polyclonal antibody was used as a marker of plasma membrane. Cells were stained with

Alexafluor-conjugated secondary antibodies 488/594 alone to verify the signal specificity of the

primary antibodies. The scale bars represent 20 µm.


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

44

Figure 6

Time profile of R-6G (1 µM) (A); atazanavir (1 µM) (B); BCECF (5 µM) (C), and mitoxantrone

(20 nM) (D) in TM4 cells. Uptake/accumulation of each of the substrates by the TM4 monolayer

cells was measured over time at 37 ºC. Results are expressed as mean ± S.E.M. of three separate

experiments.

Figure 7

Accumulation of R-6G (A); atazanavir (B); BCECF (C) and mitoxantrone (D) by TM4 cell

monolayers. Accumulation of 1 µM R-6G (1 hour) or 1 µM atazanavir (1 hour) or 5 µM BCECF

(1 hour) or 20 nM mitoxantrone (2 hours) in the absence or presence of selective inhibitors of

ABC transporters at 37 °C. All measurements involving BCECF were performed in the presence

of 10 µM GF120918 (P-gp and BCRP inhibitor) to eliminate any potential efflux of the pro-drug

ester BCECF-AM. Similarly, all measurements involving mitoxantrone were performed in the

presence of 2 µM PSC 833 (P-gp inhibitor) to eliminate any potential P-gp-mediated efflux of

mitoxantrone. Results are expressed as mean % control +/- SEM of three separate experiments

with each data point in an individual experiment representing triplicate measurements. Asterisks

represent data points that are significantly different from control (* p<0.05).


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

45

Figure 8

Accumulation of R-6G (A); atazanavir (B); BCECF (C) and mitoxantrone (D) by TM4 cell

monolayers. Accumulation of 1 µM R-6G (1 hour) or 1 µM atazanavir (1 hour) or 5 µM BCECF

(1 hour) or 20 nM mitoxantrone (2 hours) in the absence or presence of selective inhibitors of

ABC transporters or antiretroviral drugs at 37 °C. All measurements involving BCECF were

performed in the presence of 10 µM GF120918 (P-gp and BCRP inhibitor) to eliminate any

potential efflux of the pro-drug ester BCECF-AM. Similarly, all measurements involving

mitoxantrone were performed in the presence of 2 µM PSC 833 (P-gp inhibitor) to eliminate any

potential P-gp-mediated efflux of mitoxantrone. Results are expressed as mean % control +/-

SEM of three separate experiments. Asterisks represent data points that are significantly different

from control (* p<0.05).


at ASPE

T Journals on M


Dow

nloaded from


JPET#186916

46

Tables

Table 1: Specific qPCR forward (F) and reverse (R) primers

Gene Primer Sequence (5’- 3’) Accession #

ABCB1 F – TGCTCAGACAGGATGTGAGTT

R - AATTACAGCAAGCCTGGAACC NM_000927

Abcb1a F - CCAGCAGTCAGTGTGCTTACA

R - CATAAGTGGGAGCGCCAC NM_011076

Abcb1b F - TTGGCAAAGCCGGAGT

R - GTCAGTGAGCCAGTGCTGTTCTTAT NM_011075

ABCC1 F – AGCCCTTGATAGCCACGTG

R – GGGCTGCGGAAAGTCGT NM_004996

Abcc1 F - GGCATCTCAGCAACTCGTCTT

R – ATTAGCTTCCACGTCTCCTCCTT NM_008576

ABCC4 F – GGGTTACATTTCCTCCTCCA

R - GCTCAGGTTGCCTATGTGCT NM_005845

Abcc4 F - TTCTCCGAGGCCTCAATTTG

R – TGCGTGTTCTCTGCGTCTTG NM_001033336

ABCG2 F – GGCCTTGGGATACTTTGAATC

R – GAATCTCCATTAATGATGTCCA NM_004827

Abcg2 F - TGGCTGTCCTGGCTTCAGTAC

R – CCAAGAATTCATTATACTGCAA NM_011920

Cyclophilin B F – GGAGATGGCACAGGAGGAA

R – GCCCGTAGTGCTTCAGCTT

NM_0009642 (h)

NM_011149 (m)

(h) – human or (m) – mouse


at ASPE

T Journals on M


Dow

nloaded from



at ASPE

T Journals on M


Dow

nloaded from


jpet#186916 title page expression of atp-binding cassette...

Documents