journal pre-proof - cell...journal pre-proof doi: 10.1016/j.chom.2020.04.017 this is a of an...
TRANSCRIPT
Journal pre-proof DOI: 10.1016/j.chom.2020.04.017
This is a PDF file of an accepted peer-reviewed article but is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2020 The Author(s).
1
Heightened innate immune responses in the respiratory tract of COVID-19 1
patients 2
Zhuo Zhou1,2,14, Lili Ren2,3,14, Li Zhang4,14, Jiaxin Zhong4,5,14, Yan Xiao2,14, Zhilong Jia6, 3
Li Guo2, Jing Yang4,5, Chun Wang4,5, Shuai Jiang4, Donghong Yang7, Guoliang Zhang8, 4
Hongru Li9, Fuhui Chen10, Yu Xu7, Mingwei Chen11, Zhancheng Gao7, Jian Yang2, Jie 5
Dong2, Bo Liu2, Xiannian Zhang12, Weidong Wang6, Kunlun He6, Qi Jin2, Mingkun 6
Li4,13,2*, Jianwei Wang2,3,15* 7
1. Biomedical Pioneering Innovation Center, Beijing Advanced Innovation Center 8
for Genomics, Peking University Genome Editing Research Center, School of 9
Life Sciences, Peking University, Beijing 100871, China 10
2. National Health Commission of the People’s Republic of China Key Laboratory 11
of Systems Biology of Pathogens and Christophe Mérieux Laboratory, Institute of 12
Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union 13
Medical College, Beijing 100730, China 14
3. Key Laboratory of Respiratory Disease Pathogenomics, Chinese Academy of 15
Medical Sciences & Peking Union Medical College, Beijing, 100730, China 16
4. Beijing Institute of Genomics, Chinese Academy of Sciences, and China National 17
Center for Bioinformation, Beijing, 100101, China 18
5. University of Chinese Academy of Sciences, Beijing 100049, China 19
6. Key Laboratory of Biomedical Engineering and Translational Medicine, Ministry 20
of Industry and Information Technology, Beijing Key Laboratory for Precision 21
Medicine of Chronic Heart Failure, Chinese PLA General Hospital, Beijing, 22
100853, China 23
7. Department of Respiratory and Critical Care Medicine, Peking University 24
People's Hospital, Beijing 100044, China 25
8. National Clinical Research Center for Infectious Diseases, Guangdong Key 26
Laboratory for Emerging Infectious Diseases, Shenzhen Third People's Hospital, 27
Southern University of Science and Technology, Shenzhen 518112, China 28
Manuscript
2
9. Fujian Provincial Hospital, Fujian 350000, China 29
10. Department of respiratory, the Second Affiliated Hospital of Harbin Medical 30
University, Harbin, 150001, China 31
11. Department of Respiratory and Critical Care Medicine, the First Affiliated 32
Hospital of Xi'an Jiaotong University, Shaanxi Province 710061, China 33
12. School of Basic Medical Sciences, Beijing Advanced Innovation Center for 34
Human Brain Protection, Capital Medical University, Beijing 100069, China 35
13. Center for Excellence in Animal Evolution and Genetics, Chinese Academy of 36
Sciences, Kunming, 650223, China 37
14These authors contributed equally 38
15Lead Contact 39
* Correspondence: E-mail: [email protected] (J. W), [email protected] (M. L) 40
41
SUMMARY 42
The outbreaks of 2019 novel coronavirus disease (COVID-19) caused by SARS-CoV-43
2 infection has posed a severe threat to global public health. It is unclear how the human 44
immune system responds to this infection. Here, we used metatranscriptomic 45
sequencing to profile immune signatures in the bronchoalveolar lavage fluid of eight 46
COVID-19 cases. The expression of proinflammatory genes, especially chemokines, 47
was markedly elevated in COVID-19 cases compared to community-acquired 48
pneumonia patients and healthy controls, suggesting that SARS-CoV-2 infection causes 49
hypercytokinemia. Compared to SARS-CoV, which is thought to induce inadequate 50
interferon (IFN) responses, SARS-CoV-2 robustly triggered expression of numerous 51
IFN-inducible genes (ISGs). These ISGs exhibit immunopathogenic potential, with 52
overrepresentation of genes involved in inflammation. The transcriptome data was also 53
used to estimate immune cell populations, revealing increases in activated dendritic 54
cells and neutrophils. Collectively, these host responses to SARS-CoV-2 infection 55
3
could further our understanding of disease pathogenesis and point towards antiviral 56
strategies. 57
INTRODUCTION 58
The COVID-19 outbreak caused by SARS-CoV-2 infection (Lu et al., 2020; Ren et al., 59
2020; Zhou et al., 2020; Zhu et al., 2020) has been declared as a global pandemic. 60
Typical clinical symptoms of COVID-19 are fever, cough, myalgia, and shortness of 61
breath (Huang et al., 2020; Wang et al., 2020). Severe cases often developed acute lung 62
injury, or the fatal form, acute respiratory distress syndrome (ARDS) (Chen et al., 2020; 63
Huang et al., 2020; Wang et al., 2020). To date, no specific antiviral treatment is 64
available for COVID-19. 65
The infection of certain respiratory viruses often resulted in a robust inflammatory 66
response (de Jong et al., 2006; Huang et al., 2005). This immune dysregulation, termed 67
as hypercytokinemia or “cytokine storm”, is often associated with detrimental 68
outcomes, such as ARDS (de Jong et al., 2006). To date, it remains elusive how 69
pathogen infections disrupt the host immune homeostasis and stimulate a hyperactive 70
proinflammatory response. A proposed model suggested that viral evasion of the innate 71
immune response plays a critical role (D'Elia et al., 2013): the virus can effectively 72
blind the immune system, causing an inadequate or delayed response; this immune 73
escape gives rise to the unrestrained virus replication, which eventually results in a 74
hyperactivated proinflammatory response. 75
Type-I IFN (IFN-I) response plays a critical role in combating virus infection mainly 76
by inducing the expression of interferon-stimulated genes (ISGs) that exert antiviral 77
functions (Samuel, 2001). Meanwhile, viruses have developed strategies to counteract 78
IFNs. For example, SARS-CoV can efficiently suppress IFN induction and antagonize 79
IFN’s effect by harnessing its structural and non-structural proteins (de Wit et al., 2016). 80
SARS-CoV infection failed to induce competent IFN response in cultured cells 81
(Cheung et al., 2005; Spiegel and Weber, 2006; Ziegler et al., 2005) and SARS patients 82
(Reghunathan et al., 2005). The inadequate IFN response may account for the 83
4
progressive increase of viral load in SARS patients, the concomitant hypercytokinemia, 84
and the ultimate fatal outcomes. 85
Clinical study on COVID-19 suggested the hypercytokinemia in severe cases (Huang 86
et al., 2020). However, a more comprehensive investigation of the host immune 87
response is needed. Here, we collected the bronchoalveolar lavage fluid (BALF) of 88
eight COVID-19 patients, 146 community-acquired pneumonia patients, and 20 healthy 89
controls, followed by metatranscriptome sequencing and functional analysis. The 90
molecular signatures of the host response, especially the innate immune response to 91
SARS-CoV-2 infection, were explicitly depicted, showing distinct patterns from those 92
seen in SARS and pneumonia caused by other pathogens. 93
94
RESULTS 95
Sample collection, metatranscriptome sequencing, differential expression gene 96
analysis, 97
BALFs were obtained from laboratory-confirmed COVID-19 patients (SARS2) (n = 8), 98
community-acquired pneumonia patients (CAP) (n = 146), and healthy controls without 99
known respiratory diseases (Healthy) (n = 20). The demographic and clinical 100
characteristics of the cohorts were detailed in Table S1. By metatranscriptome 101
sequencing, more than 20 million reads were generated for each BALF sample from 102
SARS2, CAP, and Healthy. Among them, 56% of the reads could be mapped to the 103
human genome and were used for further analysis. As metatranscriptome data enabled 104
us to capture the transcriptionally active microbes, we further classified CAP into two 105
categories: Virus-like CAP (determined by at least 100 viral reads and 10-fold higher 106
than those in the negative controls) and Non-viral CAP. The read counts for SARS-107
CoV-2 in each COVID-19 case were listed in Table S2. 108
5
Differentially expressed genes (DEGs) were then identified by comparing pneumonia 109
transcriptomes with the healthy control transcriptomes (SARS2 versus Healthy 110
(SARS2-H), Virus-like CAP versus Healthy (Vir-H), and Non-viral CAP versus 111
Healthy (NonVir-H)). An adjusted p-value (q-value < 0.05) and fold change (FC) ratio 112
(|log2FC| ≥ 2) were used to determine the DEGs (Tables S3A-3C). The volcano plot 113
showed that the number of DEGs in SARS2-H was markedly higher than that in Vir-H 114
and NonVir-H, suggesting that SARS-CoV-2 infection strongly perturbed 115
transcriptome homeostasis of cells in the lung (Figure 1A). The principal component 116
analysis revealed that SARS2 formed distinct clusters, while Virus-like CAP, and Non-117
viral CAP clusters were more widely dispersed and overlapped (Figure 1B), showing 118
the disparate characteristics of DEGs in SARS2 from others. 119
We next collated genes whose expression is mostly regulated (|log2FC| ≥ 5) in SARS2-120
H (Figure S1A). Expression levels of proinflammatory cytokine and chemokine genes 121
(IL-1B, CXCL17, CXCL8, and CCL2), typical antiviral ISGs (IFIT and IFITM family 122
genes), and calgranulin genes that exert pleiotropic functions in inflammatory disorders 123
(S100A8, S100A9, and S100A12) were upregulated in SARS2 as compared to Healthy 124
(Figure S1A). Meanwhile, we observed marked upregulation of IL1RN and SOCS3 125
(Figure S1A), both of which encode cytokine signaling antagonists, suggesting that the 126
negative feedback loops were elicited. Genes involved in morphogenesis and migration 127
of immune cells (NCKAP1L, DOCK2, SPN, and DOCK10) were underexpressed 128
(Figure S1A). A host of DEGs was also observed when comparing CAPs to Healthy, 129
albeit with much lower fold changes (Figure S1A). 130
131
Global functional analyses 132
We then performed global functional analyses. For pathway analysis, we applied the 133
Ingenuity Pathway Analysis (IPA) and KEGG analyses on DEGs. In IPA, “Interferon 134
Signaling” ranked first in the upregulated pathways in SARS2 (z-score = 3.3, Figure 135
1C). This pathway is also upregulated, though to a lesser extent, in Virus-like CAP (z-136
score = 1), whereas not in the Non-viral CAP (Figure 1C), indicating robust IFN 137
6
response in SARS-CoV-2 infection. The pathways involved in the inflammatory 138
response in SARS2 was revealed by both analyses, with upregulated "Role of IL-17F 139
in Allergic Inflammatory Airway Diseases" (z-score = 3.0) and "Chemokine Signaling" 140
(z-score = 1.6) in IPA (Figure 1C), along with “Chemokine signaling pathway”, “IL-17 141
signaling pathway”, “TNF signaling pathway”, and “NF-κB signaling pathway” in 142
KEGG (q < 0.05, Figure S1B). Moreover, both IPA and KEGG analyses showed that 143
DEGs from SARS2-H were strongly and specifically enriched in mRNA translation-144
related categories, with up-regulated “EIF2 Signaling” (z-score = 3.3, Figure 1C) in IPA 145
and “Ribosome” (q < 0.05, Figure S1B) in KEGG. Intriguingly, several neuron 146
function-related pathways were specifically downregulated in SARS2 by IPA analysis, 147
including "CREB Signaling in Neurons" (z-score = -1.1), "Synaptogenesis Signaling 148
Pathway" (z-score = -1.4), and "Endocannabinoid Neuronal Synapse Pathway" (z-score 149
= -2.1, Figure 1C). This unexpected observation awaits further investigation. 150
151
Next, we build protein-protein interaction (PPI) networks with the upregulated DEGs 152
in SARS2 by STRING (Figures 1D and S2). A dominant network comprising several 153
subnetworks were generated using the confidence score of 0.9. Genes in the top two 154
enriched KEGG categories (Figure S1B), namely “Ribosome” and “Chemokine 155
signaling pathway”, formed two most densely connected subnetworks, which are 156
mainly composed of ribosomal proteins and chemokines, respectively (Figures 1D). 157
Overall, our global functional analysis revealed a highly responsive state against 158
noxious stimuli in COVID-19 cases, characterized by the potent defense responses and 159
hyperactive ribosome biogenesis. 160
161
Cytokine profiles 162
To understand the cytokine profile in BALF from the COVID-19 patients, we assigned 163
DEGs into seven categories of cytokine-related genes (Figure 2A). In categories of 164
“Chemokine” and “Receptor”, multiple genes were more remarkably upregulated in 165
7
SARS2 as compared to those in CAPs. Several genes were regulated in the “Interleukin” 166
and “Tumor necrosis factor” categories, and few were modulated in other categories 167
(Figure 2A). To examine potential cytokine expression dynamics, we aligned individual 168
cases according to the increasing days between sampling and symptom onset. 169
Expression levels of cytokine-related genes seem to decrease over time, with one 170
patient (C4) who eventually deceased being the outlier (Figure 2A). These observations 171
suggested that the exuberant inflammation in COVID-19 could be progressively 172
resolved, and unquenched inflammation may result in detrimental outcomes. 173
174
Chemokines are predominant among upregulated cytokine-related genes in SARS2 175
(Figure 2A). CXCL17 ranked first in the upregulated chemokines. CXCL17 176
upregulation is specific to SARS2 and is observed in all eight cases (Figure 2B), 177
suggesting a role of CXCL17 in COVID-19 pathogenesis. CXCL8, the archetypal 178
neutrophil chemoattractant, together with CXCL and CXCL2, are upregulated (Figure 179
2B). These chemokines are thought to be critical for recruiting neutrophils into the 180
flamed lung (Donnelly et al., 1993; Frevert et al., 1995; Miller et al., 1992). CXCR2, 181
the receptor for CXCL8, CXCL1, and CXCL2, is also markedly upregulated (Figure 2B). 182
Moreover, we observed the upregulation of CCL2 and CCL7, both of which are vital 183
for monocytes recruitment (Shi and Pamer, 2011) (Figure 2B). By presenting individual 184
cases in the heatmap, one case (C1) with ultra-high viral reads (Table S2) exhibited the 185
most pronounced chemokine upregulation (Figure 2B), suggesting that higher virus 186
replication resulted in a more robust proinflammatory response. Corroborating this, in 187
three cases (C1, C2, and C5) sampled at the same time after symptom onset (day 8), the 188
increases of viral load corresponded with the upregulations of critical chemokines, 189
including CXCL8, CCL2, CCL7, etc. (Figure 2B). Both CAPs showed less DEGs and 190
lower expression of cytokine genes as compared to SARS2 (Figure 2B). 191
192
IL1RN and ILB are interleukin genes significantly upregulated in SARS2 (Figure 2B), 193
and these upregulations are mirrored by elevated protein levels of IL-1Ra and IL-1β in 194
plasma of COVID-19 patients (Huang et al., 2020). Because IL-1β was recognized as 195
8
the key cytokine driving proinflammatory response in BALF from patients with ARDS 196
(Pugin et al., 1996), it is possible that the ratio of IL-1β to its inhibitor, IL-1Ra, may 197
correlate to inflammation intensity in COVID-19 patients; however, we did not observe 198
clear correlation in the current study (Figure 2B). 199
Signatures of IFN response 200
We then examined the IFN response in COVID-19 patients. By intersecting our data 201
with a list comprising 628 ISGs (Mostafavi et al., 2016), we found that SARS2 showed 202
more markedly elevated expression of ISGs as compared to CAPs, and the expression 203
seems decreased over time, again with the fatal case (C4) being the outlier (Figure 3A). 204
Eighty-three ISGs were significantly elevated in SARS2, suggesting the robust IFN 205
response (Table S4). ISGs known to exert direct antiviral activity were upregulated, 206
including IFIT and IFITM genes that exert broad-spectrum antiviral functions (IFIT1, 207
-2, -3, and IFITM1, -2, -3) and others (ISG15 and RSAD2) (Diamond and Farzan, 2013; 208
Helbig and Beard, 2014; Perng and Lenschow, 2018) (Figure 3B). Among those, 209
IFITMs have been shown to inhibit cellular entry of SARS-CoV and MERS-CoV 210
(Huang et al., 2011; Wrensch et al., 2014). Moreover, we observed the increased 211
expression of IFIH1, TANK, IRF7, and STAT1, which may further potentiate IFN 212
signaling (Figure 3B). 213
Other than antiviral, ISGs may exert diverse functions. We assigned these ISGs to five 214
previously established functional clusters (Mostafavi et al., 2016), including RNA 215
processing (C1 and C2), IFN regulation/antiviral function (C3), metabolic regulation 216
(C4), and inflammation regulation (C5) (Table S4). Surprisingly, ISGs are substantially 217
enriched in the cluster of C5 (29 out of 83) (Figure 3B), which mainly comprises 218
inflammation mediators or regulators. CCL2 and CXCL10, two IFN-inducible 219
chemokine genes found in C5 (Figure 3B), were also elevated in peripheral blood of 220
patients with SARS (Cameron et al., 2007). These results pointed to the 221
immunopathological role of IFN response in COVID-19 patients. Further, using a 222
curated ISG list from patient blood transcriptomes (Mostafavi et al., 2016) and data 223
from peripheral blood of SARS patients (Cameron et al., 2007; Reghunathan et al., 224
9
2005), we compared the ISG distributions in the five clusters between SARS-CoV-2 225
and other viruses. ISGs identified in infections of yellow fever virus (live attenuated 226
vaccine), HCV, EBV, and dengue virus were primarily assigned to C3 with less 227
involvement of C5, while SARS-CoV-2 exhibited overly high C5 distribution (Figure 228
3C, Table S4). Compared to other viruses, SARS-CoV infections induced much lesser 229
ISGs (Figure 3C, Table S4). Altogether, our results unveiled the unique signatures of 230
IFN response in SARS-CoV-2 infection. 231
232
Cell composition analyses 233
The compositions of BALF cells could reflect immune cell profiles in the affected lung 234
(Costabel and Guzman, 2001). Using the transcriptome data, we estimated immune cell 235
types and their proportions by CIBERSORT (Newman et al., 2015). Similar to findings 236
in BALF from healthy adults (Meyer et al., 2012), the BALF cell components in 237
Healthy were mainly macrophages and lymphocytes (Figure 4A). This result supported 238
the accuracy of the BALF cell sequencing and the effectiveness of our analytical 239
approach. Among innate immune cells, activated dendritic cells, activated mast cells, 240
and neutrophils were more abundant in viral pneumonia groups than those in Healthy 241
(Figure 4B). SARS2 showed a more pronounced increase in neutrophils than other 242
pneumonia (Figure 4B). Compared to innate immune cells, the composition of T cells 243
and B cells was less varied among pneumonia groups and Healthy (Figure S3A). A 244
recent study suggested that the neutrophil-to-lymphocyte (NLR) ratio was associated 245
with the disease severity of COVID-19 (Liu et al., 2020). Our analysis also showed a 246
significantly higher NLR in COVID-19 cases (Figure S3A). The highest NLR was 247
observed in the case with ultra-high viral reads and robust cytokine/ISG expression 248
(Figures S3B and S3C). 249
250
DISCUSSION 251
10
Many of the transcriptomic profiling studies have been conducted by using intermittent 252
samples such as peripheral blood (Chaussabel, 2015). However, some infections, such 253
as avian influenza or SARS, occur in the lower respiratory tract (Gu and Korteweg, 254
2007; van Riel et al., 2006), where the immune response was triggered and regulated. 255
Thus, blood transcriptome may not be optimal for profiling the immunopathological 256
features in those scenarios. In the current study, we sampled COVID-19 patients with 257
bronchoalveolar lavage (BAL), a method for retrieving cells and solutes from different 258
areas of the lung (Meyer et al., 2012). By sequencing and analyzing the BAL fluid cells 259
from eight COVID-19 patients and control cohorts, we obtained gene expression 260
profiles of both host and virus, which directly reflected the in situ host response against 261
SARS-CoV-2 infection. We thus provided a valuable opportunity to garner insights into 262
COVID-19 pathogenesis. 263
264
In COVID-19 patients, we observed the upregulation of a plethora of proinflammatory 265
cytokines, suggesting the pathogenic role of hypercytokinemia. The most salient feature 266
of the cytokine profile is the chemokine response, as seen from the elevated expression 267
of multiple chemokines and their receptors. Among those, various neutrophil 268
chemoattractants were upregulated. Consonant with this, the higher neutrophil amount 269
was observed in SARS2 by cell composition analysis. Also, chemoattractants for 270
monocytes and other immune cells were significantly upregulated. In patients with 271
ARDS, the alveolar spaces are occupied by the infiltrating neutrophils and monocytes 272
(Matute-Bello et al., 2008), suggesting the pathogenic role of those cells. Thus, our data 273
unraveled a possible chemokine-dominant hyperactive cytokine response in COVID-274
19 cases. 275
276
In contrast to SARS-CoV, SARS-CoV-2 triggered a robust IFN response, hallmarked 277
by the expression of numerous ISGs, including IFITMs shown to counteract SARS-278
CoV and MERS-CoV (Huang et al., 2011; Wrensch et al., 2014). This protective 279
potential of ISGs may account for the lower proportion of severe cases and the case-280
fatality rate in COVID-19 as compared to SARS (Wu and McGoogan, 2020). 281
11
Nevertheless, high SARS-CoV-2 loads were detected very early after symptom onset 282
(Zou et al., 2020), suggesting that the virus may have developed countermeasures 283
against the IFN system, such as delaying the IFN response by inhibiting innate immune 284
signaling. Moreover, although robust ISG induction was observed, we failed to detect 285
significant upregulation of IFNs. This discrepancy needs further investigation. 286
IFN-I could also be pathogenic. In the mouse model, depletion of IFN-/ receptor 287
protects mice from lethal infection of SARS-CoV (Channappanavar et al., 2016). 288
Moreover, delayed IFN- treatment failed to inhibit virus replication and aggravated 289
pulmonary inflammation in the mice infected with MERS-CoV (Channappanavar et al., 290
2019). These data suggested that the timing of IFN therapy against SARS and MERS 291
is critical. In the ISGs identified in COVID-19 cases, we found a subset of genes with 292
proinflammatory activities, which is relatively underrepresented in other viral 293
infections. These “proinflammatory ISGs” may assist the antiviral protection by 294
amplifying inflammatory signals to the environment. However, they could also be 295
deleterious in infections, especially when hypercytokinemia has already been triggered. 296
As IFN treatment has been adopted as an antiviral therapy against SARS-CoV-2 297
infection (ChiCTR2000029600), the timing and dose should be carefully considered. 298
299
ACKNOWLEDGMENTS 300
We thank Dr. Xue Yongbiao (China National Center for Bioinformation) and Dr. Wang 301
Jianbin (Tsinghua University, Beijing, China), Dr. Yanyi Huang (Peking University) for 302
technical assistance and helpful discussions. This work was supported by grants from 303
the National Major Science & Technology Project for Control and Prevention of Major 304
Infectious Diseases in China (2017ZX10204401, 2018ZX10301401, 305
2017ZX10103004, 2018ZX10305409), Innovation Fund for Medical Sciences (2016-306
I2M-1-014), National Natural Science Foundation of China (31670169, 31470267, 307
31701155), National Key Research and Development Program of China 308
(2017YFC0908403), Non-profit Central Research Institute Fund of Chinese Academy 309
of Medical Sciences (2019PT310029), the Open Project of Key Laboratory of Genomic 310
and Precision Medicine, Chinese Academy of Sciences, and Beijing Advanced 311
12
Innovation Center for Genomics (ICG). 312
313
AUTHOR CONTRIBUTIONS 314
Conceptualization, J.W., M. L., L. R., and Q. J.; Lab work, L.R., Y.X., L.G., and J.D.; 315
Data QC, J.Z., M.L., Jian Yang, and B.L.; High-throughput sequencing, X.Z.; 316
Transcriptomic analysis, Z.Z., L.Z., J.Z., Z.J., Jing Yang, C.W., S.J., W.W., and K.H.; 317
Clinical sample management, L.R., Y.X., D.Y., G.Z., H.L., F.C., Y.X., M.C., and Z.G.; 318
Writing - Original Draft, Z.Z., L.Z., J.Z., M.L., and J.W.; Writing - Review & Editing, 319
J.W., M.L., Z.Z., L.Z., and L.R. 320
321
DECLARATION OF INTERESTS 322
The authors declare no competing interests. 323
324
FIGURE LEGENDS 325
Figure 1. Analysis of DEGs in BALF of COVID-19 and CAP patients comparing 326
to healthy controls. (A) Volcano plot of DEGs comparing SARS2 versus Healthy 327
(SARS2-H), Virus-like CAP versus Healthy (Vir-H), and Non-viral CAP versus 328
Healthy (NonVir-H). The names of DEGs with the top 20 absolute FC are shown. (B) 329
PCA loading plot based on all DEGs. Autoscaling of data was performed. (C) 330
Functional enrichment analysis of DEGs with IPA. Asterisks (*) indicate q-values < 331
0.05 and z-score ≥ 1. (D) PPI network of up-regulated DEGs in SARS2 comparing to 332
Healthy. Each node represents a protein, and interactions with confidence score > 0.9 333
are presented. See also Figure S2. 334
335
Figure 2. Cytokine-related gene expressions in COVID-19 and CAP patients. (A) 336
Heatmap of 218 genes encoding cytokines and receptors. (B) Heatmap of DEGs 337
encoding cytokines and receptors. SARS2 samples (n = 8) were ordered by days after 338
symptom onset (DSO) in the right panel of A and B. Asterisks (*) indicate significant 339
DEGs (absolute log2FC ≥ 2, q-value < 0.05). Relative viral reads (calculated by the 340
ratio of SARS-CoV-2 reads to human reads) and the ratios of IL1B to IL1RN were 341
13
shown in (A) and (B). 342
343
Figure 3. Expression of ISGs in COVID-19 and CAP patients. (A) Heatmap of 628 344
ISGs. SARS2 samples (n = 8) were ordered by days after symptom onset (DSO) in the 345
right panel. (B) Heatmap of 83 up-regulated ISGs in SARS2 comparing to Healthy. 346
Asterisks (*) indicate significant DEGs (absolute log2FC ≥ 2, q-value < 0.05). (C) 347
Upregulated ISGs in SARS-CoV-2 infection identified in this study, as well as in SARS-348
CoV and other viral infections (see Table S4). In (B) and (C), ISGs were assigned into 349
five biclusters. 350
351
Figure 4. Composition of immune cells in BALF predicted from transcriptome 352
data. (A) The proportion of nine major immune cell types. (B) The proportion of 12 353
innate immunity-related cell subtypes. Asterisks represent significant differences 354
between groups (*q-value < 0.05, **q-value < 0.01, ***q-value < 0.001, Mann-355
Whitney test). See also Figure S3. 356
357
STAR METHODS 358
RESOURCE AVAILABILITY 359
Lead Contact 360
Further information and requests for resources and reagents should be directed to and 361
will be fulfilled by the Lead Contact, Jianwei Wang ([email protected]). 362
363
Materials Availability 364
This study did not generate new unique reagents. 365
366
Data and Code Availability 367
Reads mapped to human genome GRCh38 have been extracted from the raw 368
sequencing data and deposited in the Genome Warehouse in National Genomics Data 369
Center (National Genomics Data Center and Partners, 2020), under project number 370
PRJCA002273 that is publicly accessible at https://bigd.big.ac.cn/gsa. 371
14
EXPERIMENTAL MODEL AND SUBJECT DETAILS 372
BALF samples from eight laboratory-confirmed COVID-19 patients (SARS2) were 373
collected from hospitals in Wuhan in January 2020. BALFs from 146 community-374
acquired pneumonia patients (CAP) and 20 healthy controls from volunteers without 375
any known pulmonary diseases (Healthy) were collected from Peking University 376
People's Hospital, Shenzhen Third People's Hospital, Fujian Provincial Hospital, the 377
Second Affiliated Hospital of Harbin Medical University, and the First Affiliated 378
Hospital of Xi'an Jiaotong University between 2014 and 2018. CAP was diagnosed 379
following guidelines of the Infectious Diseases Society of America and the American 380
Thoracic Society (Mandell et al., 2007). The known respiratory pathogens in CAP 381
patients were screened by using FTD Respiratory pathogens kit (Fast Track Diagnostics, 382
Luxembourg). The study was approved by the Institutional Review Board of hospitals 383
where sampling was carried out. The data collection for the COVID-19 patients were 384
deemed by the National Health Commission of the People's Republic of China as the 385
contents of the public health outbreak investigation. 386
The written informed consent was obtained from all subjects before inclusion. Of the 387
COVID-19 cases, five were male and three were female. Of the CAP cases, 75 were 388
male and 54 were female. Eight COVID-19 cases had an average age of 49 years (range 389
40-61), and 112 CAP cases had an average of 56.4 years (range 22-91). The healthy 390
subjects were pre-screened, and 20 had no known respiratory diseases were included as 391
healthy control. Currently or potentially immunocompromised subjects with active 392
cancer, primary immunodeficiency disorders, HIV infection, or tuberculosis infection 393
were excluded from the study. Subjects with a recent medical record of taking 394
immunosuppressive medications were excluded from the study. The detailed 395
information of the subjects could be found in the demographic and clinical Table (Table 396
S1). 397
398
METHODS DETAILS 399
Sample Preparation and Sequencing 400
BALF samples were obtained during bronchoscopies done as part of clinical 401
15
management. In the biosafety level (BSL)-III laboratory, a 200 ul aliquot of each BALF 402
sample from COVID-19 patients were lysed in Trizol LS (Thermo Fisher Scientific, 403
Carlsbad, CA, USA), followed by RNA extraction using a Direct-zol RNA Miniprep 404
kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's instructions. 405
RNA extractions from other samples were conducted following the same protocol in 406
the BSL-II laboratory. 10 ul of purified RNA was used for cDNA generation and library 407
preparation using an Ovation Trio RNA-Seq Library Preparation Kit (NuGEN, CA, 408
USA) according to the manufacturer's instructions. Three samples, including two saline 409
solutions passing through the bronchoscope and one nuclease-free water, were included 410
as the negative controls. Metatranscriptome sequencing was performed on an Illumina 411
HiSeq 2500/4000 platform (Illumina, United Kingdom). 412
413
Data Processing and Analysis 414
Raw sequencing reads were quality controlled as previously described (Shen et al., 415
2020). Briefly, the FASTQ files were subjected to adapter trimming, low quality reads 416
removal, and short reads removal using Fastp 0.20.0 (Chen et al., 2018). All clean data 417
were mapped to the human genome GRCh38 using HISAT2 v2.1.0 (Kim et al., 2019) 418
with default parameters. Bam files were sorted by Samtools 1.9 (Li et al., 2009). 419
Gene counts were summarized using the featureCounts program (Liao et al., 2014) as 420
part of the Subread package release 2.0.0 (http://subread.sourceforge.net/). To identify 421
differentially expressed genes (DEGs) between two groups, genes that were present in 422
less than 50% of samples in both groups and genes with average counts per million 423
(CPM) lower than five in both groups were removed. Remained gene counts were then 424
normalized using the quantile method and the voom method. DEGs were determined 425
with the threshold adjusted p-value < 0.05 and absolute logged fold-change (Log2FC) 426
≥ 2 using the Bioconductor limma package v3.42.2 (Ritchie et al., 2015). In presenting 427
the individual case of SARS2, the fold change of each gene was calculated as the ratio 428
of normalized gene expression of each SARS2 individual to the mean expression of 429
Healthy. 430
For the functional enrichment of DEGs, Ingenuity Pathway Analysis (IPA, Ingenuity 431
16
Systems, Inc.) (Kramer et al., 2014) and Kyoto Encyclopedia of Genes and Genomes 432
(KEGG) pathway analysis (Kanehisa and Goto, 2000) were applied via IPA December 433
2019 release (v499329) and the Bioconductor clusterProfiler package v3.14.3 (Yu et al., 434
2012), respectively. Protein-protein interaction (PPI) networks of upregulated DEGs 435
were built using STRING v11 (Szklarczyk et al., 2019) with a confidence score 436
threshold of 0.9 and plotted with Cytoscape v3.7.1 (Shannon et al., 2003). 437
To infer the composition of immune cells in BALF, raw gene counts were normalized 438
as transcripts per million (TPM) and processed using the CIBERSORT algorithm v1.06 439
(Newman et al., 2015) with the original CIBERSORT gene signature file LM22 and 440
100 permutations. Twenty-two immune cell subtypes were obtained and further 441
summarized into nine major immune cell types. Samples with p‐ value < 0.05, which 442
reflects the statistical significance of the deconvolution results across all cell subsets, 443
were included. 444
445
QUANTIFICATION AND STATISTICAL ANALYSIS 446
Fisher’s exact test was used for categorical variables, and the Mann-Whitney test was 447
used for continuous variables that do not follow a normal distribution. P-values from 448
multiple testing were adjusted (q-value) using the Benjamini-Hochberg false discovery 449
rate (FDR) with a significance level of 0.05 (Benjamini and Hochberg, 1995). 450
451
SUPPLEMENTAL EXCEL TABLE TITLE AND LEGENDS 452
Table S1. Demographic and clinical information, Related to Figure 1 and STAR 453
Methods 454
Demographic and clinical information of all subjects were shown. The criterion for 455
virus infection (Virus) is at least supported by 100 viral reads and should be 10 times 456
higher than the abundance in the negative control by sequencing. 457
458
Table S3. DEGs in BALF of COVID-19 and CAP patients comparing to healthy 459
controls, Related to Figure 1 460
17
DEGs identified by comparing SARS2 to Healthy (Table S3A), Virus-like CAP to 461
Healthy (Table S3B), and Non-viral CAP to Healthy (Table S3C) were presented. An 462
adjusted p-value (q-value < 0.05) and fold change (FC) ratio (|log2FC| ≥ 2) were used 463
to determine the DEGs. 464
465
Table S4. ISGs in SARS-CoV-2 and other viral infections, Related to Figure 3 466
ISGs identified in viral infections were assigned to five previously established 467
functional clusters, including RNA processing (C1 and C2), IFN regulation/antiviral 468
function (C3), metabolic regulation (C4), and inflammation regulation (C5). 469
470
REFERNECES 471
Benjamini, Y., and Hochberg, Y. (1995). Controlling the False Discovery Rate - a Practical and Powerful 472
Approach to Multiple Testing. J R Stat Soc B 57, 289-300. 473
Cameron, M.J., Ran, L., Xu, L., Danesh, A., Bermejo-Martin, J.F., Cameron, C.M., Muller, M.P., Gold, 474
W.L., Richardson, S.E., Poutanen, S.M., et al. (2007). Interferon-mediated immunopathological events 475
are associated with atypical innate and adaptive immune responses in patients with severe acute 476
respiratory syndrome. Journal of Virology 81, 8692-8706. 477
Channappanavar, R., Fehr, A.R., Vijay, R., Mack, M., Zhao, J., Meyerholz, D.K., and Perlman, S. (2016). 478
Dysregulated Type I Interferon and Inflammatory Monocyte-Macrophage Responses Cause Lethal 479
Pneumonia in SARS-CoV-Infected Mice. Cell Host Microbe 19, 181-193. 480
Channappanavar, R., Fehr, A.R., Zheng, J., Wohlford-Lenane, C., Abrahante, J.E., Mack, M., Sompallae, 481
R., McCray, P.B., Jr., Meyerholz, D.K., and Perlman, S. (2019). IFN-I response timing relative to virus 482
replication determines MERS coronavirus infection outcomes. J Clin Invest 130, 3625-3639. 483
Chaussabel, D. (2015). Assessment of immune status using blood transcriptomics and potential 484
implications for global health. Semin Immunol 27, 58-66. 485
Chen, N., Zhou, M., Dong, X., Qu, J., Gong, F., Han, Y., Qiu, Y., Wang, J., Liu, Y., Wei, Y., et al. (2020). 486
Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in 487
Wuhan, China: a descriptive study. Lancet 395, 507-513. 488
Chen, S., Zhou, Y., Chen, Y., and Gu, J. (2018). fastp: an ultra-fast all-in-one FASTQ preprocessor. 489
Bioinformatics 34, i884-i890. 490
Cheung, C.Y., Poon, L.L., Ng, I.H., Luk, W., Sia, S.F., Wu, M.H., Chan, K.H., Yuen, K.Y., Gordon, S., Guan, Y., 491
et al. (2005). Cytokine responses in severe acute respiratory syndrome coronavirus-infected 492
macrophages in vitro: possible relevance to pathogenesis. J Virol 79, 7819-7826. 493
Costabel, U., and Guzman, J. (2001). Bronchoalveolar lavage in interstitial lung disease. Curr Opin Pulm 494
Med 7, 255-261. 495
D'Elia, R.V., Harrison, K., Oyston, P.C., Lukaszewski, R.A., and Clark, G.C. (2013). Targeting the "cytokine 496
storm" for therapeutic benefit. Clin Vaccine Immunol 20, 319-327. 497
de Jong, M.D., Simmons, C.P., Thanh, T.T., Hien, V.M., Smith, G.J., Chau, T.N., Hoang, D.M., Chau, N.V., 498
Khanh, T.H., Dong, V.C., et al. (2006). Fatal outcome of human influenza A (H5N1) is associated with 499
18
high viral load and hypercytokinemia. Nat Med 12, 1203-1207. 500
de Wit, E., van Doremalen, N., Falzarano, D., and Munster, V.J. (2016). SARS and MERS: recent insights 501
into emerging coronaviruses. Nat Rev Microbiol 14, 523-534. 502
Diamond, M.S., and Farzan, M. (2013). The broad-spectrum antiviral functions of IFIT and IFITM 503
proteins. Nat Rev Immunol 13, 46-57. 504
Donnelly, S.C., Strieter, R.M., Kunkel, S.L., Walz, A., Robertson, C.R., Carter, D.C., Grant, I.S., Pollok, A.J., 505
and Haslett, C. (1993). Interleukin-8 and development of adult respiratory distress syndrome in at-risk 506
patient groups. Lancet 341, 643-647. 507
Frevert, C.W., Huang, S., Danaee, H., Paulauskis, J.D., and Kobzik, L. (1995). Functional characterization 508
of the rat chemokine KC and its importance in neutrophil recruitment in a rat model of pulmonary 509
inflammation. J Immunol 154, 335-344. 510
Gu, J., and Korteweg, C. (2007). Pathology and pathogenesis of severe acute respiratory syndrome. Am 511
J Pathol 170, 1136-1147. 512
Helbig, K.J., and Beard, M.R. (2014). The role of viperin in the innate antiviral response. J Mol Biol 426, 513
1210-1219. 514
Huang, C., Wang, Y., Li, X., Ren, L., Zhao, J., Hu, Y., Zhang, L., Fan, G., Xu, J., Gu, X., et al. (2020). Clinical 515
features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 395, 497-506. 516
Huang, I.C., Bailey, C.C., Weyer, J.L., Radoshitzky, S.R., Becker, M.M., Chiang, J.J., Brass, A.L., Ahmed, 517
A.A., Chi, X., Dong, L., et al. (2011). Distinct patterns of IFITM-mediated restriction of filoviruses, SARS 518
coronavirus, and influenza A virus. PLoS Pathog 7, e1001258. 519
Huang, K.J., Su, I.J., Theron, M., Wu, Y.C., Lai, S.K., Liu, C.C., and Lei, H.Y. (2005). An interferon-gamma-520
related cytokine storm in SARS patients. J Med Virol 75, 185-194. 521
Kanehisa, M., and Goto, S. (2000). KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 522
28, 27-30. 523
Kim, D., Paggi, J.M., Park, C., Bennett, C., and Salzberg, S.L. (2019). Graph-based genome alignment 524
and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol 37, 907-915. 525
Kramer, A., Green, J., Pollard, J., Jr., and Tugendreich, S. (2014). Causal analysis approaches in Ingenuity 526
Pathway Analysis. Bioinformatics 30, 523-530. 527
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., 528
and Genome Project Data Processing, S. (2009). The Sequence Alignment/Map format and SAMtools. 529
Bioinformatics 25, 2078-2079. 530
Liao, Y., Smyth, G.K., and Shi, W. (2014). featureCounts: an efficient general purpose program for 531
assigning sequence reads to genomic features. Bioinformatics 30, 923-930. 532
Liu, J., Liu, Y., Xiang, P., Pu, L., Xiong, H., Li, C., Zhang, M., Tan, J., Xu, Y., Song, R., et al. (2020). 533
Neutrophil-to-Lymphocyte Ratio Predicts Severe Illness Patients with 2019 Novel Coronavirus in the 534
Early Stage. 2020.2002.2010.20021584. 535
Lu, R., Zhao, X., Li, J., Niu, P., Yang, B., Wu, H., Wang, W., Song, H., Huang, B., Zhu, N., et al. (2020). 536
Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins 537
and receptor binding. Lancet 395, 565-574. 538
Mandell, L.A., Wunderink, R.G., Anzueto, A., Bartlett, J.G., Campbell, G.D., Dean, N.C., Dowell, S.F., File, 539
T.M., Jr., Musher, D.M., Niederman, M.S., et al. (2007). Infectious Diseases Society of 540
America/American Thoracic Society consensus guidelines on the management of community-acquired 541
pneumonia in adults. Clin Infect Dis 44 Suppl 2, S27-72. 542
Matute-Bello, G., Frevert, C.W., and Martin, T.R. (2008). Animal models of acute lung injury. Am J 543
19
Physiol Lung Cell Mol Physiol 295, L379-399. 544
Meyer, K.C., Raghu, G., Baughman, R.P., Brown, K.K., Costabel, U., du Bois, R.M., Drent, M., Haslam, 545
P.L., Kim, D.S., Nagai, S., et al. (2012). An official American Thoracic Society clinical practice guideline: 546
the clinical utility of bronchoalveolar lavage cellular analysis in interstitial lung disease. Am J Respir 547
Crit Care Med 185, 1004-1014. 548
Miller, E.J., Cohen, A.B., Nagao, S., Griffith, D., Maunder, R.J., Martin, T.R., Weiner-Kronish, J.P., 549
Sticherling, M., Christophers, E., and Matthay, M.A. (1992). Elevated levels of NAP-1/interleukin-8 are 550
present in the airspaces of patients with the adult respiratory distress syndrome and are associated 551
with increased mortality. Am Rev Respir Dis 146, 427-432. 552
Mostafavi, S., Yoshida, H., Moodley, D., LeBoite, H., Rothamel, K., Raj, T., Ye, C.J., Chevrier, N., Zhang, 553
S.Y., Feng, T., et al. (2016). Parsing the Interferon Transcriptional Network and Its Disease Associations. 554
Cell 164, 564-578. 555
National Genomics Data Center, M., and Partners (2020). Database Resources of the National 556
Genomics Data Center in 2020. Nucleic Acids Res 48, D24-D33. 557
Newman, A.M., Liu, C.L., Green, M.R., Gentles, A.J., Feng, W., Xu, Y., Hoang, C.D., Diehn, M., and 558
Alizadeh, A.A. (2015). Robust enumeration of cell subsets from tissue expression profiles. Nat 559
Methods 12, 453-457. 560
Perng, Y.C., and Lenschow, D.J. (2018). ISG15 in antiviral immunity and beyond. Nat Rev Microbiol 16, 561
423-439. 562
Pugin, J., Ricou, B., Steinberg, K.P., Suter, P.M., and Martin, T.R. (1996). Proinflammatory activity in 563
bronchoalveolar lavage fluids from patients with ARDS, a prominent role for interleukin-1. Am J Respir 564
Crit Care Med 153, 1850-1856. 565
Reghunathan, R., Jayapal, M., Hsu, L.Y., Chng, H.H., Tai, D., Leung, B.P., and Melendez, A.J. (2005). 566
Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome. 567
BMC Immunol 6, 2. 568
Ren, L.L., Wang, Y.M., Wu, Z.Q., Xiang, Z.C., Guo, L., Xu, T., Jiang, Y.Z., Xiong, Y., Li, Y.J., Li, X.W., et al. 569
(2020). Identification of a novel coronavirus causing severe pneumonia in human: a descriptive study. 570
Chin Med J (Engl). 571
Ritchie, M.E., Phipson, B., Wu, D., Hu, Y., Law, C.W., Shi, W., and Smyth, G.K. (2015). limma powers 572
differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43, e47. 573
Samuel, C.E. (2001). Antiviral actions of interferons. Clin Microbiol Rev 14, 778-809, table of contents. 574
Shannon, P., Markiel, A., Ozier, O., Baliga, N.S., Wang, J.T., Ramage, D., Amin, N., Schwikowski, B., and 575
Ideker, T. (2003). Cytoscape: a software environment for integrated models of biomolecular 576
interaction networks. Genome Res 13, 2498-2504. 577
Shen, Z., Xiao, Y., Kang, L., Ma, W., Shi, L., Zhang, L., Zhou, Z., Yang, J., Zhong, J., Yang, D., et al. (2020). 578
Genomic diversity of SARS-CoV-2 in Coronavirus Disease 2019 patients. Clin Infect Dis. 579
Shi, C., and Pamer, E.G. (2011). Monocyte recruitment during infection and inflammation. Nat Rev 580
Immunol 11, 762-774. 581
Spiegel, M., and Weber, F. (2006). Inhibition of cytokine gene expression and induction of chemokine 582
genes in non-lymphatic cells infected with SARS coronavirus. Virol J 3, 17. 583
Szklarczyk, D., Gable, A.L., Lyon, D., Junge, A., Wyder, S., Huerta-Cepas, J., Simonovic, M., Doncheva, 584
N.T., Morris, J.H., Bork, P., et al. (2019). STRING v11: protein-protein association networks with 585
increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic 586
Acids Res 47, D607-D613. 587
20
van Riel, D., Munster, V.J., de Wit, E., Rimmelzwaan, G.F., Fouchier, R.A., Osterhaus, A.D., and Kuiken, T. 588
(2006). H5N1 Virus Attachment to Lower Respiratory Tract. Science 312, 399. 589
Wang, D., Hu, B., Hu, C., Zhu, F., Liu, X., Zhang, J., Wang, B., Xiang, H., Cheng, Z., Xiong, Y., et al. (2020). 590
Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia 591
in Wuhan, China. JAMA. 592
Wrensch, F., Winkler, M., and Pohlmann, S. (2014). IFITM proteins inhibit entry driven by the MERS-593
coronavirus spike protein: evidence for cholesterol-independent mechanisms. Viruses 6, 3683-3698. 594
Wu, Z., and McGoogan, J.M. (2020). Characteristics of and Important Lessons From the Coronavirus 595
Disease 2019 (COVID-19) Outbreak in China: Summary of a Report of 72314 Cases From the Chinese 596
Center for Disease Control and Prevention. JAMA. 597
Yu, G., Wang, L.G., Han, Y., and He, Q.Y. (2012). clusterProfiler: an R package for comparing biological 598
themes among gene clusters. OMICS 16, 284-287. 599
Zhou, P., Yang, X.L., Wang, X.G., Hu, B., Zhang, L., Zhang, W., Si, H.R., Zhu, Y., Li, B., Huang, C.L., et al. 600
(2020). A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 601
Zhu, N., Zhang, D., Wang, W., Li, X., Yang, B., Song, J., Zhao, X., Huang, B., Shi, W., Lu, R., et al. (2020). A 602
Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J Med 382, 727-733. 603
Ziegler, T., Matikainen, S., Ronkko, E., Osterlund, P., Sillanpaa, M., Siren, J., Fagerlund, R., Immonen, 604
M., Melen, K., and Julkunen, I. (2005). Severe acute respiratory syndrome coronavirus fails to activate 605
cytokine-mediated innate immune responses in cultured human monocyte-derived dendritic cells. J 606
Virol 79, 13800-13805. 607
Zou, L., Ruan, F., Huang, M., Liang, L., Huang, H., Hong, Z., Yu, J., Kang, M., Song, Y., Xia, J., et al. (2020). 608
SARS-CoV-2 Viral Load in Upper Respiratory Specimens of Infected Patients. N Engl J Med. 609
KEY RESOURCES TABLE
The table highlights the genetically modified organisms and strains, cell lines, reagents, software, and source data essential to reproduce results presented in the manuscript. Depending on the nature of the study, this may include standard laboratory materials (i.e., food chow for metabolism studies), but the Table is not meant to be comprehensive list of all materials and resources used (e.g., essential chemicals such as SDS, sucrose, or standard culture media don’t need to be listed in the Table). Items in the Table must also be reported in the Method Details section within the context of their use. The number of primers and RNA sequences that may be listed in the Table is restricted to no more than ten each. If there are more than ten primers or RNA sequences to report, please provide this information as a supplementary document and reference this file (e.g., See Table S1 for XX) in the Key Resources Table.
Please note that ALL references cited in the Key Resources Table must be included in the References list. Please report the information as follows:
REAGENT or RESOURCE: Provide full descriptive name of the item so that it can be identified and linked with its description in the manuscript (e.g., provide version number for software, host source for antibody, strain name). In the Experimental Models section, please include all models used in the paper and describe each line/strain as: model organism: name used for strain/line in paper: genotype. (i.e., Mouse: OXTRfl/fl: B6.129(SJL)-Oxtrtm1.1Wsy/J). In the Biological Samples section, please list all samples obtained from commercial sources or biological repositories. Please note that software mentioned in the Methods Details or Data and Software Availability section needs to be also included in the table. See the sample Table at the end of this document for examples of how to report reagents.
SOURCE: Report the company, manufacturer, or individual that provided the item or where the item can obtained (e.g., stock center or repository). For materials distributed by Addgene, please cite the article describing the plasmid and include “Addgene” as part of the identifier. If an item is from another lab, please include the name of the principal investigator and a citation if it has been previously published. If the material is being reported for the first time in the current paper, please indicate as “this paper.” For software, please provide the company name if it is commercially available or cite the paper in which it has been initially described.
IDENTIFIER: Include catalog numbers (entered in the column as “Cat#” followed by the number, e.g., Cat#3879S). Where available, please include unique entities such as RRIDs, Model Organism Database numbers, accession numbers, and PDB or CAS IDs. For antibodies, if applicable and available, please also include the lot number or clone identity. For software or data resources, please include the URL where the resource can be downloaded. Please ensure accuracy of the identifiers, as they are essential for generation of hyperlinks to external sources when available. Please see the Elsevier list of Data Repositories with automated bidirectional linking for details. When listing more than one identifier for the same item, use semicolons to separate them (e.g. Cat#3879S; RRID: AB_2255011). If an identifier is not available, please enter “N/A” in the column.
o A NOTE ABOUT RRIDs: We highly recommend using RRIDs as the identifier (in particular for antibodies and organisms, but also for software tools and databases). For more details on how to obtain or generate an RRID for existing or newly generated resources, please visit the RII or search for RRIDs.
Please use the empty table that follows to organize the information in the sections defined by the subheading, skipping sections not relevant to your study. Please do not add subheadings. To add a row, place the cursor at the end of the row above where you would like to add the row, just outside the right border of the table. Then press the ENTER key to add the row. Please delete empty rows. Each entry must be on a separate row; do not list multiple items in a single table cell. Please see the sample table at the end of this document for examples of how reagents should be cited.
Key Resource Table
TABLE FOR AUTHOR TO COMPLETE
Please upload the completed table as a separate document. Please do not add subheadings to the Key Resources Table. If you wish to make an entry that does not fall into one of the subheadings below, please contact your handling editor. (NOTE: For authors publishing in Current Biology, please note that references within the KRT should be in numbered style, rather than Harvard.)
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Bacterial and Virus Strains
Biological Samples
Human bronchoalveolar lavage fluid samples Peking University People's Hospital, Shenzhen Third People's Hospital, Fujian Provincial Hospital, the Second Affiliated Hospital of Harbin Medical University, the First Affiliated Hospital of Xi'an Jiaotong University, and hospitals in Wuhan
NA
Chemicals, Peptides, and Recombinant Proteins
Trizol LS Thermo Fisher Scientific
Cat#10296028
Critical Commercial Assays
Direct-zol RNA Miniprep Kit Zymo Research Cat#R2051
Trio RNA-Seq Library Preparation Kit NuGEN Cat#0357-32
Deposited Data
Reads mapped to human genome GRCh38 extracted from the raw sequencing data
This paper Genome Warehouse in National Genomics Data Center https://bigd.big.ac.cn/gsa; Project number: PRJCA002273
Experimental Models: Cell Lines
Experimental Models: Organisms/Strains
Oligonucleotides
Recombinant DNA
Software and Algorithms
HISAT2 v2.1.0 Kim et al., 2019 http://ccb.jhu.edu/software/hisat2/
FeatureCounts 2.0.0 Liao et al., 2014 http://subread.sourceforge.net/
Fastp 0.20.0 Chen et al., 2018 https://github.com/OpenGene/fastp
Quantile normalization (Bioconductor limma package v3.42.2)
Ritchie et al., 2015 https://bioconductor.org/packages/release/bioc/html/limma
Ingenuity Pathway Analysis, December 2019 release (v499329)
Kramer et al., 2014 https://digitalinsights.qiagen.com/
Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (Bioconductor clusterProfiler package v3.14.3)
Yu et al., 2012 https://bioconductor.org/packages/release/bioc/html/clusterProfiler
STRING v11 Szklarczyk et al., 2019 https://string-db.org
Cytoscape v3.7.1 Shannon et al., 2003 https://cytoscape.org
CIBERSORT algorithm v1.06 Newman et al., 2015 https://cibersort.stanford.edu/
Samtools 1.9 Li et al., 2009 http://samtools.sourceforge.net/
Other
TABLE WITH EXAMPLES FOR AUTHOR REFERENCE
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit monoclonal anti-Snail Cell Signaling Technology Cat#3879S; RRID: AB_2255011
Mouse monoclonal anti-Tubulin (clone DM1A) Sigma-Aldrich Cat#T9026; RRID: AB_477593
Rabbit polyclonal anti-BMAL1 This paper N/A
Bacterial and Virus Strains
pAAV-hSyn-DIO-hM3D(Gq)-mCherry Krashes et al., 2011 Addgene AAV5; 44361-AAV5
AAV5-EF1a-DIO-hChR2(H134R)-EYFP Hope Center Viral Vectors Core
N/A
Cowpox virus Brighton Red BEI Resources NR-88
Zika-SMGC-1, GENBANK: KX266255 Isolated from patient (Wang et al., 2016)
N/A
Staphylococcus aureus ATCC ATCC 29213
Streptococcus pyogenes: M1 serotype strain: strain SF370; M1 GAS
ATCC ATCC 700294
Biological Samples
Healthy adult BA9 brain tissue University of Maryland Brain & Tissue Bank; http://medschool.umaryland.edu/btbank/
Cat#UMB1455
Human hippocampal brain blocks New York Brain Bank http://nybb.hs.columbia.edu/
Patient-derived xenografts (PDX) Children's Oncology Group Cell Culture and Xenograft Repository
http://cogcell.org/
Chemicals, Peptides, and Recombinant Proteins
MK-2206 AKT inhibitor Selleck Chemicals S1078; CAS: 1032350-13-2
SB-505124 Sigma-Aldrich S4696; CAS: 694433-59-5 (free base)
Picrotoxin Sigma-Aldrich P1675; CAS: 124-87-8
Human TGF-β R&D 240-B; GenPept: P01137
Activated S6K1 Millipore Cat#14-486
GST-BMAL1 Novus Cat#H00000406-P01
Critical Commercial Assays
EasyTag EXPRESS 35S Protein Labeling Kit Perkin-Elmer NEG772014MC
CaspaseGlo 3/7 Promega G8090
TruSeq ChIP Sample Prep Kit Illumina IP-202-1012
Deposited Data
Raw and analyzed data This paper GEO: GSE63473
B-RAF RBD (apo) structure This paper PDB: 5J17
Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium
http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/
Nanog STILT inference This paper; Mendeley Data
http://dx.doi.org/10.17632/wx6s4mj7s8.2
Affinity-based mass spectrometry performed with 57 genes
This paper; and Mendeley Data
Table S8; http://dx.doi.org/10.17632/5hvpvspw82.1
Experimental Models: Cell Lines
Hamster: CHO cells ATCC CRL-11268
D. melanogaster: Cell line S2: S2-DRSC Laboratory of Norbert Perrimon
FlyBase: FBtc0000181
Human: Passage 40 H9 ES cells MSKCC stem cell core facility
N/A
Human: HUES 8 hESC line (NIH approval number NIHhESC-09-0021)
HSCI iPS Core hES Cell Line: HUES-8
Experimental Models: Organisms/Strains
C. elegans: Strain BC4011: srl-1(s2500) II; dpy-18(e364) III; unc-46(e177)rol-3(s1040) V.
Caenorhabditis Genetics Center
WB Strain: BC4011; WormBase: WBVar00241916
D. melanogaster: RNAi of Sxl: y[1] sc[*] v[1]; P{TRiP.HMS00609}attP2
Bloomington Drosophila Stock Center
BDSC:34393; FlyBase: FBtp0064874
S. cerevisiae: Strain background: W303 ATCC ATTC: 208353
Mouse: R6/2: B6CBA-Tg(HDexon1)62Gpb/3J The Jackson Laboratory JAX: 006494
Mouse: OXTRfl/fl: B6.129(SJL)-Oxtrtm1.1Wsy/J The Jackson Laboratory RRID: IMSR_JAX:008471
Zebrafish: Tg(Shha:GFP)t10: t10Tg Neumann and Nuesslein-Volhard, 2000
ZFIN: ZDB-GENO-060207-1
Arabidopsis: 35S::PIF4-YFP, BZR1-CFP Wang et al., 2012 N/A
Arabidopsis: JYB1021.2:
pS24(AT5G58010)::cS24:GFP(-G):NOS #1
NASC NASC ID: N70450
Oligonucleotides
siRNA targeting sequence: PIP5K I alpha #1: ACACAGUACUCAGUUGAUA
This paper N/A
Primers for XX, see Table SX This paper N/A
Primer: GFP/YFP/CFP Forward: GCACGACTTCTTCAAGTCCGCCATGCC
This paper N/A
Morpholino: MO-pax2a GGTCTGCTTTGCAGTGAATATCCAT
Gene Tools ZFIN: ZDB-MRPHLNO-061106-5
ACTB (hs01060665_g1) Life Technologies Cat#4331182
RNA sequence: hnRNPA1_ligand: UAGGGACUUAGGGUUCUCUCUAGGGACUUAGGGUUCUCUCUAGGGA
This paper
N/A
Recombinant DNA
pLVX-Tight-Puro (TetOn) Clonetech Cat#632162
Plasmid: GFP-Nito This paper N/A
cDNA GH111110 Drosophila Genomics Resource Center
DGRC:5666; FlyBase:FBcl0130415
AAV2/1-hsyn-GCaMP6- WPRE
Chen et al., 2013
N/A
Mouse raptor: pLKO mouse shRNA 1 raptor Thoreen et al., 2009 Addgene Plasmid #21339
Software and Algorithms
ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/
Bowtie2 Langmead and Salzberg, 2012
http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
Samtools Li et al., 2009 http://samtools.sourceforge.net/
Weighted Maximal Information Component Analysis v0.9
Rau et al., 2013 https://github.com/ChristophRau/wMICA
ICS algorithm This paper; Mendeley Data
http://dx.doi.org/10.17632/5hvpvspw82.1
Other
Sequence data, analyses, and resources related to the ultra-deep sequencing of the AML31 tumor, relapse, and matched normal.
This paper http://aml31.genome.wustl.edu
Resource website for the AML31 publication
This paper https://github.com/chrisamiller/aml31SuppSite
FPR1
CXCL10CXCL8
CXCL2
CCL4
GPR183
C3AR1 P2RY12HCAR2
IL1B
HCAR3RPLP2
RPS27
MRPS10
RPS15A
RSRC1
EIF3H
RPL32
RPL7A
SRPRB
RIOK2
RPL37
EIF1AXRPL36AL
RPS25
RPS14
RPS4X
RPL30
RPS13
RPS18
RPS23
RPL13A
CCL20P2RY14
FFAR2
GNG5
ADM2
PROK2
ADM
GNG10
CCL8
OXTR
PTGFR
CCL2
ANXA1
CXCL6CXCL11
LPAR3
GNG12
CCL7
CCL3
CCR1
HEBP1CCL4L1
FPR3 CXCR2
CXCR1
CXCL1SRP54
RIOK3
GSPT1
RPS8
PNO1
RPL24
RPL28
NOB1
RPL31
RPL8
RPS27L
UPF3A
SEC11C
RPS9
RPL26RPL35A
Color LegendKEGG-hsa03010 RibosomeKEGG-hsa04062 Chemokine signaling pathway
NonVir-HVir-H
SARS2-H
C D
IPA Z-score
Interferon SignalingEIF2 SignalingRole of IL−17F in Allergic Inflammatory Airway DiseasesCholecystokinin/Gastrin−mediated SignalingCorticotropin Releasing Hormone SignalingB Cell Receptor SignalingOsteoarthritis Pathwayp53 SignalingFcγ RIIB Signaling in B LymphocytesChemokine SignalingGNRH SignalingAryl Hydrocarbon Receptor SignalingActivation of IRF by Cytosolic Pattern Recognition ReceptorsFcγ Receptor−mediated Phagocytosis in Macrophages and MonocytesProtein Kinase A SignalingHepatic Fibrosis Signaling PathwayRole of NFAT in Regulation of the Immune ResponseLeukocyte Extravasation SignalingCD28 Signaling in T Helper CellsCREB Signaling in NeuronsSynaptogenesis Signaling PathwayLXR/RXR ActivationEndocannabinoid Neuronal Synapse PathwayPPAR SignalingCalcium−induced T Lymphocyte ApoptosisGPCR−Mediated Nutrient Sensing in Enteroendocrine Cells
−3−2−10123
A B
−20
0
20
−25 0 25
PC1 (21%)
PC2
(6.3
%)
HealthySARS2
Non-viral CAP
Virus-like CAP
MSMB
FN1
WFDC2
SCD
S100A8
LRP1SERPINB3
CXCL17
IFIT1
GPNMB
SLC11A1
STATH
EHF
SPRR2A
MTRNR2L1
OLR1
MS4A14
IFITM3
MARCKS
0
2
4
6
8
−5 0 5
−log
10 (q
−val
ue)
Up 1014Down 739
OLR1
MSR1
SCD CXCL8
MS4A7
LYZ
MRC1
TFRC
MME
EML4
G0S2COLGALT1
SERPING1
GPRIN3 SLC11A1
FMNL2
VSIG4
SRRM2PECAM1
FN1
−5 0 5
Up 112Down 243
SCD
MRC1
OLR1MS4A7
MSR1
LYZ
SNTB1
SRRM2
HEATR5B
CD74
CHRDL1
DENND1C
GPNMBMS4A14
HLA−DQA1TFRC
EML4
SERPING1
−5 0 5
Up 113Down 223
Log2 (fold change)
SARS2-H Vir-H NonVir-H
Figure 1
A
NonVir-H Vir-H
SARS2-H C8 C7C1C2 C5 C6 C4C3
DSO14
4
ClusterInterleukinChemokineInterferonTumor necrosis factorColony−stimulating factorOther cytokinesReceptor
C8 C7 C1 C2 C5 C6 C4 C3
IL1RNIL1BIL4CXCL17CXCL8CCL2CXCL1CCL4CXCL10CXCL2CCL3CCL20CXCL6CCL7CXCL11CCL8CXCL16TNFSF10TNFSF13BTNFSF12OSMCCR1CXCR2IL5RACXCR1IFNGR2IL1R1OSMRIFNAR1IL1R2CSF3RIL17RAIL4RIL10RATNFRSF13C
B
NonVir-H Vir-H
SARS2-H
−6
0
6Log2FC
Relative viral reads101
10-2
IL1B/IL1RN1.2
0.2
Figure 2
B
SARS-CoV
-2
SARS-CoV
SARS-CoV
prec
risis
Yello
w Feve
rHCV
EBV
Dengu
e pred
ict
A
NonVir-H Vir-H SARS2-H
DSO
14 4 Cluster C1 RNA process C2 RNA process C3 IFN regulators−antiviral effectors
C4 Metabolic regulation C5 Inflammation
EIF4E3SELLNMIIRF2PCGF5NBNTMEM123TMEM60ANXA1PHACTR2AIDACAPZA2TMX1C1GALT1CIR1SSBARL5BELF1DENND1BNME7CD2APHBP1SMCHD1ARHGAP12ASCC3GPD2RNF138FOXN2TANKFMR1BET1RSBN1LIFIT1IFITM3IFITM2IFITM1IFIT2BAG1ISG15IFIH1TNFSF10RSAD2CASP4IFIT3CHMP5EPSTI1IRF7STAT1LYSMD2SAT1PSMB8
ZFP36PHACTR4CSRNP1MARCKSIL1RNCCL2CCR1NINJ1KLF6SAMSN1CXCL10CCRL2PLSCR1DAPP1CCL3SNX10C3AR1B4GALT5NAMPTSLAMF7TNFSF13BRGS1FPR3GADD45BRNF19BLYNFGL2GCH1OPTNADMP2RY14PMAIP1
C
−606
Log2FC
C8 C7 C1 C2 C5 C6 C4 C3
Relative viral reads
101 10-2
Figure 3
*
*
0.0
0.1
0.2
0.3NK cells resting
0.00
0.05
0.10
0.15
NK cells activated
0.0
0.1
0.2
0.3
0.4
0.5
Monocytes
****
0.0
0.2
0.4
0.6
0.8Macrophages M0
0.0
0.1
0.2
Macrophages M1***
0.0
0.2
0.4
0.6Macrophages M2
* * * *
0.0
0.1
0.2
0.3
0.4
Dendritic cells resting
****
* ***
0.00
0.05
0.10
0.15
0.20
Dendritic cells activated
*
**
0.00
0.05
0.10
0.15
0.20
Mast cells resting
* * *
0.0
0.2
0.4
0.6
Mast cells activated
0.00
0.05
0.10
0.15
0.20Eosinophils
** * *
0.0
0.2
0.4
0.6
0.8
NeutrophilsC
ell p
ropo
rtion
s
0.00
0.25
0.50
0.75
1.00
Healthy SARS2 Virus−like CAP Non-viral CAP
Cell typesB cells
Dendritic
Eosinophils
Macrophages
Mast cells
Monocyte
Neutrophils NK cellsT cells
A B
Averge cell proportions
Group Healthy SARS2 Virus-like CAP Non-viral CAP
Figure 4