JOURNAL OF BACTERIOLOGY, Mar. 2004, p. 1869–1878 Vol. 186, No. 60021-9193/04/$08.00�0 DOI: 10.1128/JB.186.6.1869–1878.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Isolation and Characterization of �-Ketoacyl–Acyl Carrier ProteinReductase (fabG) Mutants of Escherichia coli and Salmonella

enterica Serovar TyphimuriumChiou-Yan Lai1 and John E. Cronan1,2*

Departments of Microbiology1 and Biochemistry,2 University of Illinois, Urbana, Illinois 61801

Received 30 September 2003/Accepted 26 November 2003

FabG, �-ketoacyl–acyl carrier protein (ACP) reductase, performs the NADPH-dependent reduction of�-ketoacyl–ACP substrates to �-hydroxyacyl–ACP products, the first reductive step in the elongation cycle offatty acid biosynthesis. We report the first documented fabG mutants and their characterization. By chemicalmutagenesis followed by a tritium suicide procedure, we obtained three conditionally lethal temperature-sensitive fabG mutants. The Escherichia coli [fabG (Ts)] mutant contains two point mutations: A154T andE233K. The �-ketoacyl–ACP reductase activity of this mutant was extremely thermolabile, and the rate of fattyacid synthesis measured in vivo was inhibited upon shift to the nonpermissive temperature. Moreover,synthesis of the acyl-ACP intermediates of the pathway was inhibited upon shift of mutant cultures to thenonpermissive temperature, indicating blockage of the synthetic cycle. Similar results were observed for invitro fatty acid synthesis. Complementation analysis revealed that only the E233K mutation was required togive the temperature-sensitive growth phenotype. In the two Salmonella enterica serovar Typhimurium fabG(Ts)mutants one strain had a single point mutation, S224F, whereas the second strain contained two mutations(M125I and A223T). All of the altered residues of the FabG mutant proteins are located on or near the twofoldaxes of symmetry at the dimer interfaces in this homotetrameric protein, suggesting that the quaternarystructures of the mutant FabG proteins may be disrupted at the nonpermissive temperature.

�-Ketoacyl–acyl carrier protein (ACP) reductase catalyzesthe first of the two reduction steps in the elongation cycle offatty acid synthesis (1, 16, 29, 30, 38, 41). In the type II fattyacid synthetic pathway the intermediates are covalently linkedby a thioester bond to the prosthetic group of ACP (22, 32). InEscherichia coli the elongation cycle begins with a Claisencondensation reaction catalyzed by one of the three �-keto-acyl–ACP synthases (FabB, FabF, or FabH) that adds twocarbons to the Cn acyl chain of an acyl-ACP. The resultingCn�2 �-ketoacyl–ACP is reduced by the NADPH-dependent�-ketoacyl–ACP reductase to yield a �-hydroxyacyl–ACPwhich is then dehydrated by a �-hydroxyacyl–ACP dehydrase(either FabA or FabZ) to produce enoyl-ACP. Finally, anNADH-dependent enoyl-ACP reductase (FabI) reduces enoyl-ACP to give a Cn�2 acyl-ACP, the substrate for the next elon-gation cycle. Elongation ceases when the acyl-ACP attains thechain length required for acylation of phospholipid or lipid Aprecursors (22, 32).

Rawlings and Cronan (30) isolated a cluster of fatty acidsynthetic genes from E. coli genomic DNA and found that acentrally located and highly expressed gene within the clusterhad a high degree of sequence identity to several acetoacetylcoenzyme A (CoA) reductases. This gene was proposed toencode a �-ketoacyl–ACP reductase and was called fabG.Heath and Rock (15) then demonstrated that FabG had thepredicted enzyme activity and was active on chain lengths fromC4 to C14 in a reconstituted in vitro fatty acid synthetic system.

Zhang and Cronan (41) by an indirect transcriptional analysisshowed that fabG is essential for the growth of E. coli, but thestrains constructed were not appropriate for physiologicalstudies. Strains with fabG mutations suitable for physiologicalstudies are needed since FabG is a member of a very largefamily of enzymes, the short-chain alcohol dehydrogenase/re-ductase (SDR) family (29, 30). SDR enzymes carry out a widevariety of reduction and dehydrogenase reactions using NADHor NADPH. Therefore, annotation of fabG genes can be prob-lematical and various annotators of the E. coli and other bac-terial genomes have assigned �-ketoacyl–ACP reductase activ-ity to open reading frames that seem unlikely to posses thisenzyme activity. Moreover, other bacteria contain enzymes inaddition to FabG that have �-ketoacyl–ACP reductase activity.These enzymes are thought to play important roles in othersynthetic pathways. For example, the Pseudomonas aeruginosarhlG gene encodes an NADPH-dependent �-ketoacyl–ACPreductase that is involved in the synthesis of rhamnolipids andpoly-�-hydroxyalkanoates (8). The NodG nodulation proteinof Rhizobium sp. N33 has �-ketoacyl–ACP reductase activity invitro (21). A further complication is that FabG provides pre-cursors for medium-chain-length poly-�-hydroxyalkanoate bio-synthesis (27, 31) and 3-oxo-homoserine lactone synthesis (17).

Therefore, it would seem advantageous to have strains avail-able in which putative fabG genes can be tested for activity infatty acid synthesis. For example in Lactococcus lactis subsp.lactis, two fabG homologues were reported (6). Therefore,suitable strains to test putative fabG genes by genetic comple-mentation are needed. Although a putative P. aeruginosafabG(Ts) mutant was utilized in investigations of 3-oxohomo-serine lactone synthesis (17), this strain was obtained fromanother laboratory and no validating genetic, physiological, or

* Corresponding author. Mailing address: Department of Microbi-ology, University of Illinois, B103 Chemical and Life Sciences Labo-ratory, 601 S. Goodwin Ave., Urbana, IL 61801. Phone: (217) 333-7919. Fax: (217) 244-6697. E-mail: j-cronan@life.uiuc.edu.

1869

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

enzymological data have been published. Moreover, the mu-tant was isolated from a pathogenic strain, which would limitits distribution and use. The fabG(Ts) mutants isolated in thepresent work should serve as the means to test functions ofgenes from this and other organisms in order to validate thephysiological relevance of the annotations. Such validationwould be valuable not only for bacteria and plants but also instudies of several protozoa that cause diseases such as malaria,toxoplasmosis, and sleeping sickness. These organisms retainan essential type II fatty acid synthetic pathway thought to bedescended from an algal symbiont (39). For these reasons andin order to more definitely establish the role of fabG in type IIfatty acid biosynthesis, we have isolated and characterized tem-perature-sensitive fabG mutants of E. coli and Salmonella en-terica serovar Typhimurium. Our data indicate that FabG isresponsible for all �-ketoacyl–ACP reduction in the fatty acidsynthetic pathway. Moreover, analyses of the fatty acid syn-thetic intermediates that accumulated in the absence of FabGactivity verified the mutant phenotype.

MATERIALS AND METHODS

Bacterial strains and plasmids. The bacterial strains and plasmids used in thisstudy are listed in Table 1. All E. coli strains were derivatives of E. coli K-12, andall S. enterica serovar Typhimurium strains were derivatives of strain LT2. StrainSJ16 was used as the wild-type E. coli strain in the ACP labeling experiments.Strain CL33 was constructed by transduction of strain CAG12147 with a phageP1 lysate grown on strain AB1623 with selection for nicotinic acid auxotrophsfollowed by screening for a glutamate requirement. Strain CL35 was obtained byP1 transduction of strain CL33 with a lysate grown on strain MR52 with selectionfor kanamycin resistance. Strain CL36 was constructed by P1 transduction ofstrain CL35 with a lysate grown on strain TL225 with selection for resistance toboth tetracycline and kanamycin. Strain CL50 was obtained by P1 transductionof strain MG1655 with a P1 lysate grown on CL36 with selection for tetracyclineand kanamycin resistance. Strains CL115, CL104, and CL116 were obtained byP1 transduction of strains MG1655, CL37, and JP1111, respectively, with a lysategrown on strain NRD1 followed by selection for chloramphenicol resistance. AfabF deletion mutant of S. enterica LT2, strain CL54, was obtained through �Red gene-mediated gene replacement (10). The PCR products containing akanamycin cassette flanked by the FLP recognition target (FRT) sites weregenerated by amplification from pKD4 (10) using primers SalF-N (5�- GGACTGGGCATGTTGTCTCCTGTCGGCAATACCGTGTAGGCTGGAGCTGCTTCG) and SalF-C (5�-GGAGTTGCACAGAGCGTACTCCAGATCGCTGACCCATATGAATATCCTCCTTAG). These primers contained 34 bp at their 5�ends homologous to the ends of fabF and 20 3�-end base pairs homologous tosequences in pKD4. Strain CL55 was constructed by transduction of wild-typestrain LT2 with P22 grown on strain CL54 with selection for kanamycin resis-tance. Strain MST3543 contains a locked-in Mud-P22 inserted at min 25(purB1879::MudP) of the linkage map oriented such that DNA packaging pro-ceeds in the counterclockwise direction (5). Strain CL61 was derived by phageP22 transduction of strain MST3543 with a lysate grown on strain CL55 withselection for kanamycin resistance.

The plasmid constructions together with the primers used in their construc-tions are described in Table 1. DNA sequencing of both strands of the relevantfab genes of plasmids pCL38, pCL46, and pCL25 and the fabG gene of plasmidpCL27 was performed by the Genetic Engineering Facility, University of Illinoisat Urbana-Champaign, with Taq DNA polymerase cycle sequencing on an Ap-plied Biosystems 373 DNA sequencer, using the M13/pUC forward (�20) andreverse (�24) sequencing primers. These plasmids were transformed into thetemperature-sensitive mutant strains in order to identify fab gene mutations bycomplementation. The primers used for PCR amplifications were synthesized bythe Genetic Engineering Facility, University of Illinois at Urbana-Champaign.

Culture media and growth conditions. Culture media used were rich broth(RB) medium (12), Luria-Bertani (LB) medium (11), minimal salts medium E(25), and M9 minimal salts (25) supplemented as indicated. Green plates (11)were used for testing of phage sensitivity against the c2 mutant phage P22-H5.Kanamycin (50 �g/ml), tetracycline (12 �g/ml), ampicillin (100 �g/ml), chloram-phenicol (20 �g/ml), isopropyl-�-D-thiogalactopyranoside (IPTG) (1 mM), andEGTA (10 mM) were added as required to the final concentrations given.

Mutagenesis. Nitrosoguanidine mutagenesis was conducted as described byMiller (26). The cells were treated with 50 �g of nitrosoguanidine/ml at 37°C forvarious times, and a dose at which about 30% of the cells retained colony-forming ability was chosen. For hydroxylamine mutagenesis a Mud-P22 lysatefrom strain CL61 (purB1879::MudP fabF::Kan) was prepared by induction withmitomycin C (40). For mutagenesis a Mud-P22 lysate (0.2 ml) was mixed with 0.4ml of 0.5 M phosphate–EDTA buffer, 0.8 ml of 1 M hydroxylamine, 0.02 ml of1 M MgSO4, and 0.6 ml of sterile water in a final volume of 2 ml at 37°C withoutshaking (11). Since phage Mud-P22 cannot form plaques (35), a P22 lysate grownon CL55 was used to assay the efficiency of mutagenesis. The treated lysates weretitered on strain LT2 following various periods of hydroxylamine treatment.When mutagenesis reached 0.1% survival, samples were centrifuged in a micro-centrifuge for 30 min at 4°C to pellet the phage. The phage pellet was handledand stored at 4°C as described by Maloy (23) and used to transduce MST725(gltA), with selection for kanamycin resistance in the presence of 10 mM EGTA.The resulting transductants were pooled and subjected to tritium suicide selec-tions.

Tritium suicide selections. Tritium suicide selections were performed accord-ing to Harder et al. (13). Briefly, a 2-ml culture of mutagenized E. coli cells wasgrown at 30°C to a density of approximately 2 � 107 cells/ml in minimal mediumE supplemented with 1 mM potassium acetate, 0.4% glycerol, 0.1% vitamin-freeCasamino Acids (Difco), 10 mM monosodium glutamate, 2 mM proline, and0.001% thiamine. The culture was then incubated at 42°C for 20 min, centri-fuged, and washed, and the cells were suspended in minimal medium E. Half ofthis culture was supplemented with 0.5 mM sodium acetate, 0.5 mM sodium[3H]acetate (specific activity, 10 Ci/mmol), 0.4% glycerol, 1% vitamin-freeCasamino Acids, 10 mM monosodium glutamate, 2 mM proline, 20 mM glu-tamine, 0.4% sodium succinate, and 0.001% thiamine. The other portion of theculture contained the above ingredients except that 0.5 mM nonradioactivesodium acetate replaced the radioactive acetate. Both cultures were incubated at42°C for 4 h, centrifuged, and washed three times with cold M9 medium. Thecells were then suspended in 1 ml of minimal medium E and stored at 4°C. Aftervarious periods of storage, samples were removed, serially diluted, and plated forsurviving cells at 30°C on RB plates. When tritium suicide killing reached 0.1%survivors, the colonies formed from the surviving cells were tested for growth at30 and 42°C on RB plates. Colonies that grew at 30 but not at 42°C were streakedon RB plates supplemented with oleate and palmitate to detect strains thatrequired fatty acids for growth at 37°C. Phage P1 lysates were grown on thestrains requiring fatty acids and used to transduce strain MG1655 with selectionfor resistance to both tetracycline and kanamycin (the antibiotic markers wereinserted at opposite ends of the fab cluster). The resulting transductants, pos-sessing the temperature-sensitive phenotype, were transformed with plasmidspCL38, pCL46, and pCL25, which contain the fabH, fabD, and fabG genes,respectively, to determine in which genes the mutations were located. Mutantsdefective in any of these genes were then PCR amplified with correspondingprimers, and the PCR product was sequenced to identify the mutations. StrainCL37, defective in the fabG gene, was isolated through this procedure. StrainCL47 was constructed by transduction of strain MG1655 with P1 grown on thefabG(Ts) strain CL37 with selection for kanamycin resistance followed by screen-ing for tetracycline sensitivity, whereas strain CL48 was constructed by transduc-tion of strain CL47 [fabG(Ts)] with phage P1 grown on strain SJ16 with selectionfor tetracycline resistance.

Pools of the S. enterica transductants resulting from transduction with hydrox-ylamine-mutagenized phage stocks were grown in minimal medium E supple-mented with 1 mM potassium acetate, 0.4% glycerol, 0.1% vitamin-freeCasamino Acids, 10 mM monosodium glutamate, 2 mM proline, 0.2% sodiumbutyrate, 0.1 mM tryptophan, and 0.001% thiamine at 30°C. When the density ofthe culture reached 2 � 107 cells/ml, the culture was shifted to 42°C for 20 minand centrifuged, and the pellet washed in minimal medium E. The cells werethen resuspended in minimal medium E and divided into two equal portions.One portion was supplemented with 0.5 mM sodium acetate, 0.5 mM sodium[3H]acetate (specific activity, 10 Ci/mmol), 0.4% glycerol, 1% vitamin-freeCasamino Acids, 10 mM monosodium glutamate, 2 mM proline, 20 mM glu-tamine, 0.4% sodium succinate, 0.2% sodium butyrate, 0.1 mM tryptophan, and0.001% thiamine. The other portion of the culture was supplemented with sameingredients as described above except that 1 mM nonradioactive sodium acetatewas substituted for the radioactive compound. Both cultures were grown at 42°Cfor 4 h and then treated as described above. Strains having a temperature-sensitive phenotype were grown, and then a phage P22 lysate was prepared andused to transduce strain LT2 to kanamycin resistance. The resulting tempera-ture-sensitive transductant colonies were tested for phage sensitivity by cross-streaking against the clear c2 mutant phage P22-H5 on green plates (23). Phage-sensitive strains were then transformed with plasmids pCL38, pCL46, and

1870 LAI AND CRONAN J. BACTERIOL.

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Relevant characteristics Source or reference

E. coli K-12SJ16 metB1 relA1 gyrA216 panD2 zad-220::Tn10 19CAG12147 nadA57::Tn10 of MG1655 34MG1655 Wild type Lab collectionAB1623 F� thi gltA ara lac gal xyl mtl Strr tsx tfr 3MR52 F� �lacU169 araD139 metE thi gyrA rpsL fabF::Kan 30TL225 zce-727::Tn10 20NRD1 panD::Cat N. De LayJP1111 fabI(Ts) CGSCa

CL33 gltA of MG1655 This workCL35 gltA fabF::Kan of MG1655 This workCL36 gltA fabF::Kan zce-727::Tn10 of MG1655 This workCL37 fabG(Ts) fabF::Kan zce-727::Tn10 of MG1655 This workCL48 fabG(Ts) panD2 zad-220::Tn10 of MG1655 This workCL50 fabF::Kan zce-727::Tn10 of MG1655 This workCL62 CL37/pCL33 This workCL104 fabG(Ts) panD::Cat of MG1655 This workCL115 panD::Cat of MG1655 This workCL116 fabI(Ts) panD::cat of MG1655 This workCL118 CL37/pCL79 This workCL119 CL37/pCL80 This work

S. enterica serovar TyphimuriumMST3543 purB 1879::MudP 5, 40; via S. MaloyMST725 gltA3 ara-7 S. MaloyCL55 fabF::Kan of LT2 This workCL61 fabF::Kan of MST3543 This workCL65 fabG(Ts) fabF::Kan of LT2 This workCL67 fabD(Ts) fabF::Kan of LT2 This workCL95 fabG(Ts) fabF::Kan of LT2 This work

PlasmidspCL25 Insertion of the 900-bp fabG PCR product of the E. coli chromosome (amplified with

primers G15F and G12R)b into pCR2.1; encodes wild-type FabGThis work

pCL27 Insertion of the 900-bp fabG PCR product of CL37 chromosomal DNA (amplifiedwith primers G15F and G12R) into pCR2.1; encodes E233K/A154T FabG

This work

pCL30 Insertion of the 686-bp XbaI-EcoNI fragment of pCL27 into pCL25 cut with the sameenzymes; encodes A154T FabG

This work

pCL31 Insertion of the 686-bp XbaI-EcoNI fragment of pCL25 into pCL27 cut with the sameenzymes; encodes E233K FabG

This work

pCL32 Insertion of the 993-bp BamHI-XbaI fabG fragment of pCL25 into pBR322 cut withBamHI and NheI; fabG is transcribed from ptet

This work

pCL33 Insertion of the 984-bp NsiI-BamHI fabG fragment of pCL27 into pHSG576 cut withPstI and BamHI; fabG is transcribed from plac; encodes E233K/A154T FabG

This work

pCL34 Insertion of the 993-bp BamHI-XbaI fabG fragment of pCL30 into pBR322 cut withBamHI and NheI; fabG is transcribed from ptet; encodes A154T FabG

This work

pCL35 Insertion of the 993-bp BamHI-XbaI fabG fragment of pCL31 into pBR322 cut withBamHI and NheI; fabG is transcribed from ptet; encodes E233K FabG

This work

pCL38 Insertion of the 1,010-bp fabH PCR product of the S. enterica chromosome (amplifiedwith primers SalH-N and SalH-C)c into pCR2.1

This work

pCL45 Insertion of the 1.1-kb BamHI-XbaI fabH fragment of pCL38 into pBR322 cut withBamHI and NheI; fabH is transcribed from ptet

This work

pCL46 Insertion of the 1-kb fabD PCR product of the S enterica chromosome (amplified withprimers SalD-N and SalD-C)d into pCR2.1

This work

pCL50 Insertion of the 1-kb BamHI-XbaI fabD fragment of pCL46 into pBR322 cut withBamHI and NheI; fabD is transcribed from ptet

This work

pCL79 Insertion of the 984-bp NsiI-BamHI fabG fragment of pCL30 into pHSG576 cut withPstI and BamHI; fabG is transcribed from plac; encodes A154T FabG

This work

pCL80 Insertion of the 984-bp NsiI-BamHI fabG fragment of pCL31 into pHSG576 cut withPstI and BamHI; fabG is transcribed from plac; encodes E233K FabG

This work

pHSG576 lacZ, pSC101 origin, chloramphenicol resistant 37pCR2.1 lacZ, �rop pBR322 origin InvitrogenpBR322 Tetracycline and ampicillin resistant 4

a Coli Genetic Stock Center, Yale University, New Haven, Conn.b The primer sequences were as follows: G15F, 5�-GCGCTCGAGCTTTAAAAGAG; G12R, 5�-AACTAAATCCCGGCAGGTCT.c The primer sequences were as follows: SalH-N, 5�-CCGAAAAGTGACTGAGCGTA; SalH-C, 5�-ACAAATGCAAATTGCGTCAT.d The primer sequences were as follows: SalD-N, 5�-CGCGCTGATTCGTTTCTAGT; SalD-C, 5�-CGCAATCTTTCCTTCAAAGC.

VOL. 186, 2004 E. COLI AND S. ENTERICA fabG MUTANTS 1871

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

pCL25, which contain the fabH, fabD, and fabG genes, respectively, to determinein which gene each mutation was located. Mutants defective in any of these geneswere then amplified by PCR with corresponding primers, and the PCR productswere sequenced to identify the mutations.

Preparation of cell extracts. The in vitro fatty acid synthesis extracts wereprepared as described by Heath and Rock (14). Strains SJ16 (panD) and CL48[panD fabG(Ts)] were cultured in 500 ml of LB medium and grown to late logphase. The cultures were centrifuged, and the cells were resuspended in 5 ml oflysis buffer (0.1 M sodium phosphate [pH 7.0], 5 mM 2-mercaptoethanol, 1 mMEDTA) and lysed in a French pressure cell at 18,000 lb/in2. The lysate wascentrifuged in a JA-20 rotor at 16,000 rpm at 4°C for 1 h to remove cell debris.Ammonium sulfate was added to the supernatant to 45% of saturation, and theprecipitated protein was removed by centrifugation for 30 min at 10,000 rpm.Additional ammonium sulfate was added to the supernatant to 80% of satura-tion, and the precipitated protein was collected by centrifugation. The proteinpellet was dissolved in 2 ml of lysis buffer and dialyzed for 5 h at 4°C against 2liters of the same buffer. Protein concentrations were determined by the Brad-ford assay (7) with bovine serum albumin as the standard.

In vitro fatty acid synthesis assay. The fatty acid synthesis assay was per-formed according to the method of Jackowski and Rock (18). The assay mixturescontained 0.1 M LiCl, 0.1 M sodium phosphate, pH 7.0, 1 mM 2-mercaptoetha-nol, 50 �M acetyl-CoA, 0.175 mM NADH, 0.149 mM NADPH, 54 �M ACP, and30 �g of protein extract from either strain SJ16 or strain CL48 [panD fabG(Ts)]in a final volume of 40 �l. Cerulenin, when present, was added to a finalconcentration of 1 mM. The reaction mixtures were incubated for 5 min at roomtemperature to allow cerulenin to inactivate FabB and FabF, and then 45 �M[2-14C]malonyl-CoA (specific activity, 55 mCi/mmol) was added to initiate thereaction followed by incubation at 37°C for 10 min. The reactions were stoppedby placing the tubes in an ice slush. Samples (40 �l) of the assay mixtures weremixed with gel loading buffer and analyzed by conformationally sensitive gelelectrophoresis on 15% polyacrylamide gels containing 2.5 M urea for approxi-mately 3 h at 4°C (28). The gels were fixed, soaked in Enlightning (DuPont),dried, and exposed to X-ray film.

Analysis of fatty acid synthesis in vivo with [1-14C]acetate. The rate of fattyacid synthesis in the E. coli strains CL50 (wild type) and CL37 [fabG(Ts)] at 42°Cwas analyzed by labeling of lipids with sodium [1-14C]acetate (specific activity, 55mCi/mmol). The two strains were grown to a density of 107 cells/ml in LBmedium and then shifted to 42°C for 10 min. Then 2 ml of each culture wasremoved at various times after the shift and labeled with 2 �Ci of sodium[1-14C]acetate for 5 min before addition of 3 ml of methanol-chloroform (2:1,vol/vol) followed by shaking for 1 hour at 30°C. The organic and aqueous phaseswere separated by addition of 2 ml each of water and chloroform. The mixturewas then vortexed and centrifuged. The upper aqueous layer was discarded, andthe lower organic layer was washed twice with an equal volume of 2 M KCl. Aftera final wash with an equal volume of water, the solvent was evaporated under astream of nitrogen. Analtech Silica Gel G plates were activated by heating at80°C overnight. The phospholipids were suspended in a small volume of chlo-roform-methanol (2:1, vol/vol) and applied to thin-layer chromatography plateswhich were developed with a mobile phase of chloroform, methanol, and aceticacid (65:25:8, vol/vol/vol). The plates were dried and exposed to a MolecularDynamics PhosphorImager screen for quantitation.

Assay of �-ketoacyl–ACP reductase activity. The spectrophotometric assay forreductase activity measures the rate of oxidation of NADPH at 340 nm (38). Theenzyme will accept CoA thioesters in place of the physiological ACP thioesters(38). All samples were assayed at room temperature. The reaction mixturescontained 0.1 M sodium phosphate, pH 7.0, 1 mM 2-mercaptoethanol, 239 �MNADPH, 58.7 �M acetoacetyl-CoA, 40 �l of crude extract protein, and wateradded to a final volume of 500 �l. Protein concentrations were measured fol-lowing the spectrophotometric assay since the FabG activities of strain CL48,CL62, and CL119 extracts decreased very quickly following extract preparation.The reaction was initiated by the addition of crude extract. The rate of NADPHoxidation prior to acetoacetyl-CoA addition served as a blank value and wassubtracted from the rate observed in the presence of acetoacetyl-CoA. Samplesof each crude extract were subjected to heat treatments and then placed on ice.The enzymatic activity of each sample was then measured by monitoring the rateof absorbance decrease at 340 nm. The rates of NADPH oxidation were calcu-lated from the change in absorbance, assuming 340 � 6.3 � 103 mol�1.

In vivo labeling of ACP pools. Labeling of ACP pools was performed asdescribed by Heath and Rock (14). E. coli strain CL48 [panD fabG(Ts)] wasgrown at 30°C to a density of 1 � 107 cells/ml in M9 medium containing 0.6 �M[�-3H]alanine (specific activity, 60 Ci/mmol), 0.4% glucose, 1% vitamin-freeCasamino Acids, 0.001% thiamine, and 0.005% methionine. The culture wasdivided into two portions. One half was shifted to 42°C and grown to a density of

1 � 108 cells/ml, at which time a portion of this culture was treated with cerulenin(1 mg/ml) for 10 min and the remaining untreated portion was harvested as acontrol. The other half was grown at 30°C to a density of 1 � 108 cells/ml, theculture was split, and one half was treated with 1 mg of cerulenin/ml as describedabove. Strain SJ16 (panD) was grown at 37°C to a density of 1 � 108 cells/ml, onehalf of the culture was treated with cerulenin, and the other half was incubatedat 37°C for 10 min. The cells were harvested by centrifugation and then lysed onice by the procedure described by Clewell and Helinski (9). The lysate wascentrifuged to sediment the DNA, and the supernatant fluid was fractionated ona 15% polyacrylamide gel containing 2.5 M urea at 4°C. The gels were thensubjected to fluorography.

Strains CL115 (panD::Cat), CL104 [panD::Cat fabG(Ts)], and CL116[panD::Cat fabI(Ts)] were inoculated to a density of 5 � 107 cells/ml in themedium given above and labeled with [�-3H]alanine (specific activity, 60 Ci/mmol). The cultures of strains CL104 and CL116 were labeled for 4 h at 30°C,whereas the strain CL116 culture was labeled at 37°C for 4 h. Half of the culturesof strains CL104 and CL116 were then shifted to 42°C for 1 h. All cultures werethen divided in half, and one half of each sample was treated with 1 mg ofcerulenin/ml for 10 min. The acyl-ACP species were then extracted and analyzedas described above.

RESULTS

Tritium suicide selection of fab mutants. [3H]acetate radia-tion suicide selection was previously used to isolate mutants ofE. coli having defects in fatty acid biosynthesis (13, 33). Theprinciple is that use of a strain defective in citrate synthase andthe proper growth medium confines radioactive acetate incor-poration almost exclusively to fatty acids. Cultures of mu-tagenized cells are exposed to [3H]acetate of very high specificactivity while growing at 42°C. Those cells having normal fattyacid synthesis accumulate [3H]acetate and are subsequentlykilled by radioactive disintegration during storage (presumablydue to oxidative damage caused by the � particles), whereasmutants blocked early in the fatty acid synthesis pathway fail toincorporate radioactive acetate and are recovered as survivingcells (13). Our tritium suicide selections of mutagenized E. colicultures showed about 6 log units of killing after 40 days ofexposure, and the extent of labeling was 1.47 dpm/cell. Fromthis selection, 93 temperature-sensitive colonies were isolated.Upon supplementation of the medium with saturated and un-saturated fatty acids, 37 colonies grew better at 37°C in thepresence of the fatty acid supplement. These “fatty acid reme-dial” strains failed to grow at 42°C with fatty acid supplemen-tation, indicating that at 37°C some residual synthesis of fattyacids remained that allowed synthesis of intermediates thatcannot be provided exogenously (2, 13, 36). These intermedi-ates are probably �-hydroxymyristoyl–ACP (13) and perhapsthe other short-chain acids required for lipid A biosynthesis(2). Phage P1 lysates were grown on all fatty acid remedialstrains and used to transduce strain MG1655 to tetracyclineand kanamycin resistance. Only one strain, strain CL37, had atemperature-sensitive phenotype and was identified as afabG(Ts) mutant by complementation with a fabG plasmid.

We attributed the meager results obtained with E. coli to thefact that we did not localize the mutagenesis to the fab clusterregion of the chromosome. We therefore turned to S. entericabecause this organism offers an excellent means to localizemutagenesis to a specific region of the chromosome. Localizedmutagenesis is based on a collection of chromosomal Mud-P22insertions (5, 40). Upon induction these prophages are unableto excise from the bacterial chromosome and phage DNAreplication generates a large fraction of phage particles that

1872 LAI AND CRONAN J. BACTERIOL.

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

carry chromosomal DNA segments. The chromosomal DNAsegments are progressively packaged for 150 to 250 kb to oneside of a given insertion (5, 40). Therefore, we constructed S.enterica strain CL61 (purB1879::MudP fabF::Kan). The Mud-P22 prophage of this strain is inserted into the purB gene andpackages in the direction of the fab gene cluster, which islocated only 50 kb from purB (24). Therefore, upon inductionwe expected that the phage particles of the resulting lysatesshould be rich in DNA segments that encode the fab genecluster and that the DNA segments of these particles should beeffectively mutagenized by hydroxylamine in vitro. The phageparticles were then treated with hydroxylamine to mutagenizethe packaged bacterial DNA and subsequently used to trans-duce strain MST725 (gltA) to kanamycin resistance. The re-sulting transductants were pooled and submitted to tritiumsuicide selections.

The S. enterica tritium suicide selections reached about 8 logunits of killing after 23 days of storage (data not shown), andthe extents of labeling were 1.85, 0.44l, and 0.25 dpm/cell.About 40 temperature-sensitive colonies were isolated, and 10colonies had a temperature-sensitive phenotype after trans-duction of the LT2 wild-type strain to kanamycin resistance.Compared to nitrosoguanidine mutagenesis of the whole E.coli chromosome, localized mutagenesis with hydroxylaminewas a more effective means to enrich for mutations within thefab gene cluster. Following transformation with plasmids con-taining fabH, fabD, or fabG, three S. enterica fatty acid syn-thetic mutants were identified: strains CL65 and CL95 hadmutations in fabG, whereas the mutation of strain CL67mapped in fabD.

Analysis of fatty acid synthesis in vivo. De novo fatty acidsynthesis of the wild-type E. coli strain CL50 and the E. colifabG(Ts) strain CL37 was assayed by incorporation of [14C]ac-etate into phospholipids. Cultures were grown to early logphase at 30°C and then shifted to 42°C. Samples of the cultureswere then taken and labeled with radioactive acetate to deter-mine the rates of fatty acid synthesis (see Materials and Meth-ods). As expected, mutant strain CL37 was defective in fattyacid synthesis (Fig. 1). After shift to the nonpermissive tem-perature, the rate of incorporation of [14C]acetate into lipids incultures of the fabG(Ts) strain, CL37, progressively decreased,whereas the wild-type strain, CL50, had a much higher rate ofsynthesis until the inhibition of synthesis by entry into station-ary phase (the mutant culture failed to reach a stationary-phase cell density).

Analysis of fatty acid synthesis in vitro. Cell extracts of thewild-type E. coli strain SJ16 and the fabG(Ts) E. coli strainCL48 were used to determine the role of FabG in the in vitroelongation cycle (Fig. 2). Fatty acid synthesis reactions con-taining acetyl-CoA, [2-14C]malonyl-CoA, NADPH, NADH,and ACP were conducted as described in Materials and Meth-ods. Identification of the acyl-ACP species was based on theirrelative electrophoretic migration rates (14). Extracts of thewild-type strain SJ16 incorporated [2-14C]malonyl-CoA intolong-chain acyl-ACPs (Fig. 2, lane 1), whereas extracts of strainCL48 [fabGs(Ts)] failed to assimilate radioactive malonyl-CoAinto the elongation cycle (Fig. 2, lane 3). In the presence ofcerulenin, an antibiotic that blocks all �-ketoacyl–ACP (KAS)I and KAS II activities but which has no effect on KAS IIIactivity (32), accumulation of acetyl-ACP (or malonyl-ACP)

and butyryl-ACP was seen in the wild-type extracts (Fig. 2). Itshould be noted that acetyl-ACP comigrates with holo-ACPand malonyl-ACP on 2.5 M urea gels (15). Extracts of strainCL48 failed to produce either long-chain acyl-ACPs or butyryl-ACP and accumulated only acetyl-ACP and/or malonyl-ACP(Fig. 2), indicating that the first elongation cycle was blockedand this blockage was due to the loss of FabG activity (notethat the �-ketobutyryl-ACP intermediate is unstable and islargely degraded during electrophoresis [14]). In the presenceof cerulenin the extracts of strain CL48 accumulated acetyl-ACP (or malonyl-ACP) and butyryl-ACP (Fig. 2), although thelevels of butyryl-ACP accumulation were much lower thanthose seen in extracts of the wild-type strain (Fig. 2). Theseresults indicate that residual FabG activity remained in thefabG(Ts) strain extracts. In summary, these data indicted thatFabG was required for the first cycle of fatty acid synthesis andwas the sole enzyme that performed reduction of �-ketoacyl–ACP species.

Composition of ACP pools in vivo. To characterize the roleof FabG in vivo, E. coli strains SJ16 (panD2) and CL48 [panD2fabG(Ts)] were grown with [�-3H]alanine to uniformly labelthe ACP pool and the products were fractionated by confor-mationally sensitive gel electrophoresis (see Materials andMethods). The ACP thioesters were identified on the gels byreference to the work of Heath and Rock (14). The composi-tion of the strain CL48 ACP pool at the permissive tempera-ture (30°C) was essentially identical to that of the wild-typestrain SJ16 (Fig. 3A). Acetyl-ACP and/or malonyl-ACP was amajor species, and some medium-chain and long-chain acyl-ACP species were also present. Addition of cerulenin to strainCL48 grown at 30°C resulted in modest accumulations of bu-tyryl-ACP and medium-chain acyl-ACPs and a decrease inlong-chain acyl-ACPs. Similar, although much greater, accu-mulations of these species were seen for the control strain SJ16upon cerulenin treatment (Fig. 3A). Upon temperature shift to42°C, the ACP pool composition of strain CL48 changed mark-

FIG. 1. Analysis of E. coli fatty acid synthesis in vivo. De novo fattyacid synthesis was measured by incorporation of [14C]acetate intophospholipids of the wild-type strain CL50 and the fabG(Ts) strainCL37 (see Materials and Methods). The squares denote the E. coliwild-type strain CL50, while the open circles represent the E. colifabG(Ts) strain CL37.

VOL. 186, 2004 E. COLI AND S. ENTERICA fabG MUTANTS 1873

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

edly. Butyryl-ACP and medium-chain acyl-ACPs disappeared,and long-chain acyl-ACPs were dramatically decreased (Fig.3A). These data were consistent with the distribution of prod-ucts observed in the fatty acid synthase assay in vitro (Fig. 2)and confirmed that the first cycle of fatty acid synthesis wasblocked in the fabG(Ts) mutant. Addition of cerulenin tostrain CL48 at 42°C did not lead to the altered pools seen instrain SJ16 because the strain CL48 fatty acid elongation cyclewas totally blocked under these conditions.

Heath and Rock (14) studied an E. coli strain with a tem-perature-sensitive lesion of the fabI gene, which encodes enoyl-ACP reductase. FabI is the enzyme responsible for the last stepof the elongation cycle in E. coli, and these workers reportedthat FabI was the sole enoyl-ACP reductase of this organism(14). Since our results indicated that FabG, like FabI, is solelyresponsible for an elongation cycle reaction, we predicted thatthe intracellular ACP pool compositions of the two mutantstrains should be similar at the nonpermissive temperature.Indeed, the compositions of the ACP pools of the two strainswere found to be very similar (Fig. 3B). At the permissivetemperature, both strains contained low levels of long-chainacyl-ACPs whereas cerulenin treatment caused the accumula-tion of butyryl-ACP in both strains (Fig. 3B). Upon shift of E.coli strains CL104 [fabG(Ts)] and CL116 [fabI(Ts)] to 42°C thelong-chain acyl-ACP levels decreased whereas the addition ofcerulenin resulted in only a slight increase in butyryl-ACPlevels (Fig. 3B). The main differences seen in the ACP pools ofthe two strains were that the fabG(Ts) strain CL104 synthe-sized lower levels of long-chain acyl-ACPs than did thefabI(Ts) strain CL116. This is readily attributed to the differ-ences in the stringency of the mutations. These data indicatethat fabG, like fabI, is essential for all fatty acid synthesis andhence cell viability.

Resolution of the mutations of the doubly mutant E. coli andS. enterica fabG temperature-sensitive mutants. Sequenceanalysis showed that E. coli strain CL37 contained two pointmutations within fabG, resulting in a protein having A154Tand G233K substitutions. Of the two S. enterica strains theFabG of strain CL65 had a single amino acid change, S224F,whereas the FabG of strain CL95 contained two mutations,M125I and A223T. The fabD of S. enterica strain CL67 alsocontained two missense mutations, P9L and A20V. To identifythe point mutations responsible for the fabG(Ts) phenotypesof strains CL37 and CL95, the two mutations of each of thefabG(Ts) double mutants were separated by inserting a DNAsegment containing one mutation into the wild-type gene invitro, thereby resulting in two mutant genes that each con-tained a single mutation. The constructed singly mutant geneswere then moved into the low-copy-number vector pHSG576under control of the vector plac promoter and tested forcomplementation of the fabG(Ts) phenotype of strain CL37.Upon glucose repression of expression from the lac promoter,plasmid pCL79, encoding the A154T FabG, complementedstrain CL37 to give growth at the nonpermissive temperaturewhereas pCL80, encoding the E233K FabG, failed to allowgrowth of strain CL37 at 42°C (data not shown). Also, asexpected plasmid pCL33, carrying both mutations, failed tocomplement strain CL37 at the nonpermissive temperature in

FIG. 2. Analysis of the ACP products of in vitro E. coli fatty acidsynthesis. Fatty acid synthesis assays were done as described in Mate-rials and Methods. Cerulenin (1 mM) was added to indicated reactionmixtures (�) to inhibit the activities of FabB and FabF. The reactionswere stopped after 10 min by cooling on ice, and the products werefractionated on 15% acrylamide gels containing 2.5 M urea followed byfluorography as described in Materials and Methods. Abbreviations:Ac-ACP, acetyl-ACP; Mal-ACP, malonyl-ACP. Lanes 1 and 2, extractsof the wild-type (WT) strain SJ16; lanes 3 and 4, extracts of thefabG(Ts) strain CL48. Cerulenin was added to the extracts in lanes 2and 4.

FIG. 3. Compositions of ACP pools of the wild-type and fabG(Ts)mutant E. coli strains. (A) Strain SJ16 (panD2) and CL48 [panD2fabG(Ts)] were grown at the indicated temperatures in the presence of0.6 �M [�-3H]alanine (specific activity, 60 Ci/mmol). At a density of108 cells/ml, the culture of SJ16 was divided, and a portion was treatedwith 1 mg of cerulenin/ml for 10 min. The CL48 culture was grown toa density of 107 cells/ml and split into two portions. One portion wasshifted to 42°C, and the remaining portion was grown at 30°C. At adensity of 108 cells/ml, each culture was divided and one portion wastreated with cerulenin for 10 min. ACP thioesters were extracted andresolved on a 15% acrylamide–2.5 M urea gel as indicated in Materialsand Methods. Lanes 1 and 2, wild-type (WT) strain SJ16; lanes 3 to 6,strain CL48 grown at the temperatures indicated. Cerulenin was addedto the extracts of the even-numbered lanes. (B) Strains CL104[panD::Cat fabG(Ts) ] and CL116 [panD::Cat fabI(Ts)] were inocu-lated to a density of 5 � 107 cells/ml. The cultures were labeled with 0.6�M [�-3H]alanine at the indicated temperature for 4 h. Half of theCL104 and CL116 cultures were then shifted to 42°C for 1 h. Allcultures were then split in half, and one half of each sample was treatedwith 1 mg of cerulenin/ml for 10 min. Acyl-ACP species were extractedand analyzed as described in Materials and Methods. Lanes 1 to 4,fabG(Ts) strain CL104; lanes 5 to 8, fabI(Ts) strain CL116. The strainswere grown at the temperatures indicated, and the cultures in theeven-numbered lanes were treated with cerulenin. Note that the cul-tures of strain CL104 grew more slowly than those of strain CL116 dueto the lower permissive growth temperature but were labeled for thesame time interval with [�-3H]alanine, resulting in a different celldensities and different quantities of ACP species.

1874 LAI AND CRONAN J. BACTERIOL.

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

the presence of glucose. However, upon IPTG induction, allthree plasmids restored the growth of strain CL37 at 42°C(data not shown). Therefore, it is clear that the E233K andE233K A154T proteins retain residual activity at the nonper-missive temperature since overexpression of these proteinsfrom the lac promoter (or from the pBR322 tet promoter in thecase of the E233K FabG) allowed growth.

In the case of S. enterica strain CL95 moving the mutantgene from the chromosome to a low-copy-number plasmidresulted in loss of the temperature-sensitive phenotype. Intro-duction of plasmid pCL72, which carries the doubly mutantgene in pHSG576, allowed growth of strain CL95 at 42°C evenwith glucose repression of the lac promoter, and thus theindividual mutations could not be tested (data not shown). Theobservation that complementation required less expression ofthe S. enterica strain CL95 fabG than of E. coli strain CL37fabG was consistent with the greater residual fatty acid syn-thetic activity of the former strain at 42°C (data not shown).

Thermolability of FabG activity in E. coli mutant cell ex-tracts. Since FabG utilizes NADPH to reduce �-ketoacyl–ACP, the enzyme activity can be assayed spectrophotometri-cally by measuring the rate of oxidation of NADPH at 340 nm(38). In our first experiments crude extracts of the E. coliwild-type strain SJ16 and the doubly mutant strain CL48 wereassayed for reductase activity after the extracts were heated atvarious temperatures followed by assay at room temperature(see Materials and Methods). The activity of E. coli strainCL48 extracts was completely lost after 5 min at 42°C, whereasthe extracts of strain SJ16 retained over half of the initialactivity (data not shown). In order to determine the individualcontributions of the two mutations of strain CL48 to enzymestability in vitro, we assayed extracts of E. coli strain CL48carrying each of the plac fabG plasmids described above.Crude extracts were subjected to heat treatment, and the en-zymatic activity of each sample was measured. The reductaseactivities of extracts of strains CL119 (encoding FabG E233K)and CL62 (encoding FabG E233K and A154T) were muchmore thermolabile than the activity of the wild-type strain,CL50 (Fig. 4), consistent with their temperature-sensitivegrowth phenotypes. Moreover, extracts containing either theE233K or E322K A154T enzyme lost FabG activity quickly atall temperatures and incubation times tested. It should benoted that unlike the wild-type extracts these mutant extractscould not be processed by ammonium sulfate precipitationsince this resulted in complete loss of the mutant enzymeactivity. The thermostabilities of reductase activities in extractsof strains encoding each of the single mutations were deter-mined. The E233K enzyme showed marked thermolability, butthe rates of inactivation observed were less than that of extractsof the double (E233K A154T) mutant. The thermolability ofthe A154T extract reductase activity was similar to that of thewild-type extract. These enzyme stability data are consistentwith the observation that extracts of CL48 could not incorpo-rate [2-14C]malonyl-CoA into acyl-ACP in vitro (Fig. 2, lane 3).

DISCUSSION

The isolation of fabG(Ts) mutants of E. coli and S. entericademonstrates that fabG is essential for growth and cell viabil-ity, thus confirming the transcriptional termination data of

Zhang and Cronan (41). Our data together with prior bio-chemical investigations indicate that FabG is the sole �-keto-acyl–ACP reductase in E. coli. Upon shift of strain CL48 to thenonpermissive temperature no long-chain acyl-ACP speciesare seen in cerulenin-treated cells, whereas under these con-ditions long-chain acyl-ACPs accumulate in the wild-typestrain and in strain CL48 at the permissive temperature (Fig.3). Cerulenin blocks synthesis of long-chain �-ketoacyl–ACPspecies, but any �-ketoacyl–ACPs present at the time of ceru-lenin addition will complete their synthetic cycle (i.e., the fattyacyl chains will become fully saturated) to give acyl-ACP spe-cies that are stable to gel electrophoresis. We attribute the lackof long-chain acyl-ACPs seen in extracts of cerulenin-treatedstrain CL48 cells to an inability to complete synthetic cycles;the nascent acyl-ACPs remain as �-ketoacyl–ACPs which aredegraded during electrophoresis (14). The inability to effi-ciently convert �-ketoacyl–ACPs to more stable forms alsoaccounts for the lower levels of long-chain acyl-ACPs seen inthe absence of cerulenin in strains CL48 and CL104 grown atthe nonpermissive temperature (Fig. 3). FabG activity is clearlyrequired for butyryl-ACP synthesis (Fig. 2 and 3), and thus webelieve that FabG is essential for all of the elongation cyclesrequired to synthesize long-chain fatty acids. This pictureagrees well with prior biochemical characterizations. Heathand Rock (14) reported that purified FabG carries out thereduction of �-ketoacyl–ACPs of all chain lengths during denovo fatty acid synthesis in a reconstructed E. coli in vitrosystem, whereas Toomey and Wakil (38) purified a single �-ke-toacyl–ACP reductase from E. coli cell extracts and showed theenzyme to be active with substrates of 2, 6, and 10 carbon

FIG. 4. Thermolability of FabG activities in E. coli cell extracts.Crude cell extracts were heated for various time intervals at 30 (�), 37(�), or 45°C (E) and then assayed for �-ketoacyl–ACP reductaseactivity (see Materials and Methods). (A) Crude extract of the wild-type E. coli strain CL50; (B) crude extract of strain CL62, encodingE233K/A154T FabG; (C) crude extract of strain CL118, expressingA154T FabG; (D) crude extract of strain CL119, expressing E233KFabG. The initial unheated activities (micromoles of NADPH perminute per milligram of protein) were 12.0, 7.4, 15.4, and 8.4 for theextracts of strains CL50, CL62, CL118, and CL119, respectively. Iden-tical experiments done with strains SJ16 and CL48 gave data verysimilar to those shown in panels A and B, respectively.

VOL. 186, 2004 E. COLI AND S. ENTERICA fabG MUTANTS 1875

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

FIG

.5.

Mod

elin

gof

the

Fab

G(T

s)m

utan

tpr

otei

ns.(

A)

Tet

ram

eric

stru

ctur

eof

Fab

G(2

9)w

ithth

em

onom

erch

ains

show

nin

diffe

rent

colo

rs.T

here

sidu

esin

volv

edin

the

A15

4T,E

233K

,and

S224

Fm

utat

ions

are

show

nas

balls

and

stic

ks.I

nea

chca

seth

est

ruct

ures

are

show

nin

pair

s(B

plus

C,D

plus

E,a

ndF

plus

G)

with

the

wild

-typ

eF

abG

stru

ctur

eto

the

left

and

the

mod

eled

mut

ant

stru

ctur

eto

the

righ

t.(B

and

C)

Con

sequ

ence

sof

the

E23

3Km

utat

ion.

The

salt

brid

gebe

twee

nE

233

and

H23

6�,i

ndic

ated

bya

dash

edre

dlin

ein

pane

lB,i

sm

issi

ngin

pane

lCdu

eto

the

E23

3Km

utat

ion.

(D)

Vie

wof

inte

ract

ions

arou

ndA

154

atth

eot

her

dim

erin

terf

ace

ofth

epr

otei

n.(E

)M

odel

edre

plac

emen

tofA

154

with

Thr

.The

5

helix

was

shor

tene

ddu

eto

the

form

atio

nof

ahy

drog

enbo

nd(d

ashe

dgr

een

line)

betw

een

Y15

1an

dT

154,

ther

eby

incr

easi

ngth

edi

stan

cebe

twee

n

5an

d

5�.

(Fan

dG

)S2

24F

mut

atio

n.Pa

nel

Fis

avi

ewof

the

dim

erin

terf

ace

inte

ract

ions

arou

ndSe

r22

4.Pa

nelG

sugg

ests

that

repl

acem

ent

ofSe

r22

4w

ithPh

eco

uld

dest

abili

zeth

est

acki

ngbe

twee

nPh

e22

1an

dPh

e22

1�du

eto

loss

ofhy

drog

enbo

ndin

gby

the

hydr

oxyl

grou

psof

Ser

224

and

Ser

224�

.Thi

sm

utat

ion

coul

dal

sodi

srup

thy

drog

enbo

ndin

gbe

twee

nSe

r22

4an

dG

lu22

6.

1876 LAI AND CRONAN J. BACTERIOL.

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

atoms. Since we began our FabG work the 2.6-A X-ray crystalstructure of E. coli FabG has been reported (29), and thus wewere provided with a framework to analyze the mutations weisolated. Strikingly, all of our mutations are located in or nearthe subunit interfaces of the FabG homotetramer.

The FabG monomer contains a typical Rossmann fold struc-ture, with a twisted, parallel � sheet composed of seven �strands flanked on both sides by eight helices (29). Theprotein exists as a tetramer with two types of dimerizationinterfaces (29). That is, the enzyme can be considered a dimerof dimers. One type of interface is located between helices4/5 and 4�/5� (the prime denotes the neighboring mono-mer of the tetramer), which build a helix bundle. These are thetop and bottom interfaces as seen in Fig. 5A. Each helix inter-acts with the same helix of the adjacent monomer. While the4-4� interactions are almost purely hydrophobic, the 5-5�interface relies on steric interactions. Helices 5 and 5� arecomprised of a string of alanine and glycine residues (A152,A153, A154, A156, G157, and G160) that sterically comple-ment one another. These residues form a hydrophobic anchorin the dimer interface which may be important in stabilizingthe FabG tetramer (Fig. 5D). The other type of interface (seenat the left and right interfaces of Fig. 5A) is positioned betweenstrands �7/�7�, helices 8/8�, and helices 6/7 and 6�/7�.

The FabG of E. coli strain CL37 contains two mutations,E233K and A154T. The E233K mutation maps to �-sheet 7which is involved in one of the dimerization interfaces withinthe tetramer, whereas the A154T mutation maps to helix 5 inthe other type of dimerization interface. Specific interactionsamong the side chains bridge the gap between the antiparallelstrands �7 and �7�. One of these interactions is a salt bridgebetween E233 of �7 and H236� of �7� (and vice versa) (Fig.5B). This interaction would be destroyed by the E233K muta-tion (Fig. 5C) of mutant CL37. Moreover, the introduced K233should repel H236�. E233 is also hydrogen bonded to H236�and T234 (Fig. 5B). One of these lost hydrogen bonds might becompensated for by a possible hydrogen bond formed betweenthe mutant lysine residue and T234� (Fig. 5C). The E233Kmutation of the FabG strain CL37 has much more severeeffects on the stability of the protein both in vitro and in vivothan does the second mutation, A154T. However, although theA154T protein supports growth and has at best a modest effecton the thermostability of FabG in vitro, it seems to act insynergy with the E233K mutation in the doubly mutant pro-tein. This follows from the finding that the reductase activity ofthe doubly mutant protein is more thermolabile than theE233K activity (Fig. 4). The A154T mutation would interruptthe sterically complementary surfaces of helices 5 and 5�and might also result in formation of a hydrogen bond betweenthe threonine hydroxyl and the carbonyl oxygen of tyrosine-151(Fig. 5E). This putative interaction is predicted to shorten thehelix and increase the distance between G157/G157� and A153/G160�, which normally form a hydrophobic core within theinterface. It therefore seems that destabilization of both of theinterfaces of FabG tetramers results in a greater loss of stabil-ity towards heating than is seen when only a single interface isdisturbed.

Since the FabGs of S. enterica and E. coli are 95% identical,we used the E. coli FabG structure to analyze the S224F mu-tation of S. enterica strain CL65. In the wild-type enzyme, S224

stabilizes F221 by hydrogen bonding to its carbonyl oxygen.F221 from �8 stacks with F221� from �8� of the opposingmonomer and is located on the interface twofold axis (Fig. 5F).Substitution of the large bulky hydrophobic phenylalanine sidechain in place of the small hydrophilic serine could well distortthe local conformation around F221 and prevent stacking ofF221 and F221� (Fig. 5G). The S224F mutation would addi-tionally disrupt the hydrogen bond formed between S224 andE226.

The S. enterica strain CL95 FabG contains two mutations,M125I and A223T. Interpretation of these mutations is lessstraightforward than those of the other strains. The M125Imutation is located close to the interface formed by the 4/5and 4�/5� four-helix bundle. Residues M122, M125, andM126 from 4 and M96� from the other monomer were pro-posed to form hydrophobic clusters stabilizing the dimer inter-face (29). Replacement of M125 with the bulkier branchedisoleucine side chain might affect the packing of helix 4 in theinterface. A223T, the second mutation of the strain CL95FabG, also resides adjacent to the dimer interface. The T223hydroxyl group could make hydrogen bonds with the carbonyloxygen atoms of Al220 and V219, leading to altered packing ofhelix 8, which in turn could pull F221 away from F221� anddestabilize the stacking of the side chains of these two residues,a crucial association of the dimer interface. Although we couldnot establish the relative importance of the two mutations inthe phenotype of strain CL95, it seems likely that the A223Tmutation plays a more important role in the destabilization ofthe FabG tetramer since the M125I substitution is a muchmore conservative change. Note that the action of mutations(such as E233K and S224F) within the interface that includes6/7 and 6�/7� could be more subtle than disruption of theFabG quaternary structure since this interface undergoes sig-nificant repositioning upon binding of the NADP� cofactorand the conformational changes that accompany cofactor bind-ing are thought to organize the active-site triad (29).

ACKNOWLEDGMENTS

We thank Allen C. Price for the suggestions concerning modeling ofthe fabG(Ts) mutations, S. Maloy for strains, and Charles O. Rock forinformative discussions.

This work was supported by NIH grant AI15650.

REFERENCES

1. Alberts, A. W., P. W. Majerus, B. Talamo, and P. R. Vagelos. 1964. Acyl-carrier protein. II. Intermediary reactions of fatty acid synthesis. Biochem-istry 3:1563–1571.

2. Anderson, M. S., and C. R. Raetz. 1987. Biosynthesis of lipid A precursors inEscherichia coli. A cytoplasmic acyltransferase that converts UDP-N-acetyl-glucosamine to UDP-3-O-(R-3-hydroxymyristoyl)-N-acetylglucosamine.J. Biol. Chem. 262:5159–5169.

3. Ashworth, J. M., H. L. Kornberg, and D. L. Nothmann. 1965. Location of thestructural gene for citrate synthase on the chromosome of Escherichia coliK12. J. Mol. Biol. 11:654–657.

4. Balbas, P., X. Soberon, F. Bolivar, and R. L. Rodriguez. 1988. The plasmid,pBR322. Bio/Technology 10:5–41.

5. Benson, N. R., and B. S. Goldman. 1992. Rapid mapping in Salmonellatyphimurium with Mud-P22 prophages. J. Bacteriol. 174:1673–1681.

6. Bolotin, A., P. Wincker, S. Mauger, O. Jaillon, K. Malarme, J. Weissenbach,S. D. Ehrlich, and A. Sorokin. 2001. The complete genome sequence of thelactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res.11:731–753.

7. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye bind-ing. Anal. Biochem. 72:248–254.

8. Campos-Garcia, J., A. D. Caro, R. Najera, R. M. Miller-Maier, R. A. Al-

VOL. 186, 2004 E. COLI AND S. ENTERICA fabG MUTANTS 1877

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Tahhan, and G. Soberon-Chavez. 1998. The Pseudomonas aeruginosa rhlGgene encodes an NADPH-dependent �-ketoacyl reductase which is specifi-cally involved in rhamnolipid synthesis. J. Bacteriol. 180:4442–4451.

9. Clewell, D. B., and D. R. Helinski. 1969. Supercoiled circular DNA-proteincomplex in Escherichia coli: purification and induced conversion to an opencircular DNA form. Proc. Natl. Acad. Sci. USA 62:1159–1166.

10. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad.Sci. USA 97:6640–6645.

11. Davis, R. W., D. Botstein, and J. R. Roth. 1980. Advanced bacterial genetics.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

12. Davis, T. N., E. D. Muller, and J. E. Cronan, Jr. 1982. The virion of thelipid-containing bacteriophage PR4. Virology 120:287–306.

13. Harder, M. E., I. R. Beacham, J. E. Cronan, Jr., K. Beacham, J. L. Honegger,and D. F. Silbert. 1972. Temperature-sensitive mutants of Escherichia colirequiring saturated and unsaturated fatty acids for growth: isolation andproperties. Proc. Natl. Acad. Sci. USA 69:3105–3109.

14. Heath, R. J., and C. O. Rock. 1995. Enoyl-acyl carrier protein reductase(fab1) plays a determinant role in completing cycles of fatty acid elongationin Escherichia coli. J. Biol. Chem. 270:26538–26542.

15. Heath, R. J., and C. O. Rock. 1996. Inhibition of �-ketoacyl-acyl carrierprotein synthase III (FabH) by acyl-acyl carrier protein in Escherichia coli.J. Biol. Chem. 271:10996–11000.

16. Heath, R. J., and C. O. Rock. 1996. Roles of the FabA and FabZ �-hy-droxyacyl-acyl carrier protein dehydratases in Escherichia coli fatty acid bio-synthesis. J. Biol. Chem. 271:27795–27801.

17. Hoang, T. T., S. A. Sullivan, J. K. Cusick, and H. P. Schweizer. 2002.�-Ketoacyl acyl carrier protein reductase (FabG) activity of the fatty acidbiosynthetic pathway is a determining factor of 3-oxo-homoserine lactoneacyl chain lengths. Microbiology 148:3849–3856.

18. Jackowski, S., and C. O. Rock. 1987. Acetoacetyl-acyl carrier protein syn-thase, a potential regulator of fatty acid biosynthesis in bacteria. J. Biol.Chem. 262:7927–7931.

19. Jackowski, S., and C. O. Rock. 1981. Regulation of coenzyme A biosynthesis.J. Bacteriol. 148:926–932.

20. Larson, T. J., D. N. Ludtke, and R. M. Bell. 1984. sn-Glycerol-3-phosphateauxotrophy of plsB strains of Escherichia coli: evidence that a second muta-tion, plsX, is required. J. Bacteriol. 160:711–717.

21. Lopez-Lara, I. M., and O. Geiger. 2001. The nodulation protein NodG showsthe enzymatic activity of an 3-oxoacyl-acyl carrier protein reductase. Mol.Plant-Microbe Interact. 14:349–357.

22. Magnuson, K., S. Jackowski, C. O. Rock, and J. E. Cronan, Jr. 1993.Regulation of fatty acid biosynthesis in Escherichia coli. Microbiol. Rev.57:522–542.

23. Maloy, S. 1990. Experimental techniques in bacterial genetics. Jones andBartlett Publishers, Boston, Mass.

24. McClelland, M., K. E. Sanderson, J. Spieth, S. W. Clifton, P. Latreille, L.Courtney, S. Porwollik, J. Ali, M. Dante, F. Du, S. Hou, D. Layman, S.Leonard, C. Nguyen, K. Scott, A. Holmes, N. Grewal, E. Mulvaney, E. Ryan,H. Sun, L. Florea, W. Miller, T. Stoneking, M. Nhan, R. Waterston, andR. K. Wilson. 2001. Complete genome sequence of Salmonella enterica se-rovar Typhimurium LT2. Nature 413:852–856.

25. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory Press, Cold Spring Harbor, N.Y.

26. Miller, J. H. 1992. A short course in bacterial genetics. Cold Spring HarborLaboratory Press, Cold Spring Harbor, N.Y.

27. Park, S. J., J. P. Park, and S. Y. Lee. 2002. Metabolic engineering ofEscherichia coli for the production of medium-chain-length polyhydroxyal-kanoates rich in specific monomers. FEMS Microbiol. Lett. 214:217–222.

28. Post-Beittenmiller, D., J. G. Jaworski, and J. B. Ohlrogge. 1991. In vivopools of free and acylated acyl carrier proteins in spinach. Evidence for sitesof regulation of fatty acid biosynthesis. J. Biol. Chem. 266:1858–1865.

29. Price, A. C., Y. M. Zhang, C. O. Rock, and S. W. White. 2001. Structure of�-ketoacyl-[acyl carrier protein] reductase from Escherichia coli: negativecooperativity and its structural basis. Biochemistry 40:12772–12781.

30. Rawlings, M., and J. E. Cronan, Jr. 1992. The gene encoding Escherichia coliacyl carrier protein lies within a cluster of fatty acid biosynthetic genes.J. Biol. Chem. 267:5751–5754.

31. Ren, Q., N. Sierro, B. Witholt, and B. Kessler. 2000. FabG, an NADPH-dependent 3-ketoacyl reductase of Pseudomonas aeruginosa, provides pre-cursors for medium-chain-length poly-3-hydroxyalkanoate biosynthesis inEscherichia coli. J. Bacteriol. 182:2978–2981.

32. Rock, C. O., and J. E. Cronan. 1996. Escherichia coli as a model for theregulation of dissociable (type II) fatty acid biosynthesis. Biochim. Biophys.Acta 1302:1–16.

33. Silbert, D. F., J. E. Cronan, Jr., I. R. Beacham, and M. E. Harder. 1974.Proceedings: genetic engineering of membrane lipid. Fed. Proc. 33:1725–1732.

34. Singer, M., T. A. Baker, G. Schnitzler, S. M. Deischel, M. Goel, W. Dove,K. J. Jaacks, A. D. Grossman, J. W. Erickson, and C. A. Gross. 1989. Acollection of strains containing genetically linked alternating antibiotic re-sistance elements for genetic mapping of Escherichia coli. Microbiol. Rev.53:1–24.

35. Smith, H. O. 1968. Defective phage formation by lysogens of integrationdeficient phage P22 mutants. Virology 34:203–223.

36. Spencer, A., E. Muller, J. E. Cronan, Jr., and T. A. Gross. 1977. relA genecontrol of the synthesis of lipid A fatty acyl moieties. J Bacteriol 130:114–117.

37. Takeshita, S., M. Sato, M. Toba, W. Masahashi, and T. Hashimoto-Gotoh.1987. High-copy-number and low-copy-number plasmid vectors for lacZ-complementation and chloramphenicol- or kanamycin-resistance selection.Gene 61:63–74.

38. Toomey, R. E., and S. J. Wakil. 1966. Studies on the mechanism of fatty acidsynthesis. XV. Preparation and general properties of �-ketoacyl acyl carrierprotein reductase from Escherichia coli. Biochim. Biophys. Acta 116:189–197.

39. Wilson, R. J. 2002. Progress with parasite plastids. J. Mol. Biol. 319:257–274.40. Youderian, P., P. Sugiono, K. L. Brewer, N. P. Higgins, and T. Elliott. 1988.

Packaging specific segments of the Salmonella chromosome with locked-inMud-P22 prophages. Genetics 118:581–592.

41. Zhang, Y., and J. E. Cronan, Jr. 1998. Transcriptional analysis of essentialgenes of the Escherichia coli fatty acid biosynthesis gene cluster by functionalreplacement with the analogous Salmonella typhimurium gene cluster. JBacteriol 180:3295–3303.

1878 LAI AND CRONAN J. BACTERIOL.

on May 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from