Introduction• How do we detect genes?1. Detecting phenotypic changes in the organism due to changes in the gene.2. Screening DNA sequences for ORFs with gene-like features or similarities

to genes already known.

• A mutation is a change in base sequence of a gene, or in the arrangement ofgenes on a chromosome (chromosome mutation, discussed more later).

• A mutation produces a new allele of the gene.

• The most common allele in a laboratory stock or wild population of anorganism is called the wild type allele; then a mutation produces a newmutant allele.

• A mutant is an individual carrying a mutant allele.

Wild type Drosophila on the left; each of the three mutants is in a different gene.

Some Kinds of Mutations

ACCATGA δTGAAACCATGA δTGAGACCATGADeletion δTATGTTCACCATGAATGTTACCATGAATGGACCATGAinsertionACGACCATGAAAGACCATGAAGGACCATGAbase pair substitution

ATGACCATGAwild type

• Changes of 1 bp (or a few contiguous bp) are called point mutations.• Also possible but much less frequent are substitutions of ≥ 2 bp at one

time.• Transposable elements cause insertions of 102 - 104 bp.

Mechanisms of Point Mutation (partial list)

1. Most are due to errors in DNA replication:

replication repairGATC --> GATC --> GATC or GGTCCTAG CCAG CTAG CCAG

Repair occurs during proofreading or later.

Slip-strand mispairing causes short repeats: NNNNNNAGCAGCAGC … NNNe.g. Huntington’s disease, (AGC)n, an in-frame repeat encoding poly(Glu). Theresulting polypeptide causes cell death in parts of the brain and dominantneurological problems. (N stands for nucleotide, i.e. any base.)

2. Some are due to spontaneous changes in bases, e.g. C --> deamination --> U

Mechanisms of Point Mutation (continued)

3. Some mutations are caused by mutagens

Chemical mutagens modify bases so they cause mispairing when replicated orare repaired incorrectly.

UV radiation links adjacent pyrimidines to form dimers, which may be repairedincorrectly.

Ionizing radiation induces single- or double-stranded breaks, chemicallymodifies bases, or cross-links bases; may be repaired incorrectly.

H. J. Muller

When and Where Mutations HappenMutations are stochastic events (unpredictable, random): we can never predict exactlywhen a mutation will occur or what kind of mutation will occur, but we can assign aprobability (frequency or mutation rate) to it.Most mutations happen during cell division, so we usually measure the rate in mutationsper cell division.

Measured mutation rate would be 7 mutations/31 cell divisions or 0.226 mutations/cell division(unrealistically high example!).

When and Where Mutations HappenIn eukaryotes, mutations that occur in the somatic cells (somatic mutations) are notinherited; mutations that occur any time in the germ line are inherited. We usually measurethe rate in mutations per gamete

somatic mutation

germ line mutationGerm line

Soma

Mutation RatesMutations are stochastic events (unpredictable, random): we can never predict exactly whena mutation will occur or what kind of mutation will occur. We can measure the rate atwhich a given kind of mutation will occur. The rate is the probability that it will occur in aunit of time. Orders of magnitude:

animals and plants10-6 - 10-4 muts per gene per gamete10-10 - 10-8 muts per bp per year (from evolution rates)10-9 muts/bp × year × 3 × 10 9 bp > 1 new mutation in each gamete (we are all mutants!)Drosophila: u = 8.4 × 10-9 muts/bp × year U = 1.2 detrimental mutations/2N genomebacteria10-10 - 10-6 muts per gene per cell division

How to write rates so they can be used in dimensional analysis:10-9 muts per bp per year10-9 muts/bp × yearNOT 10-9 muts/bp/yearbecause that is 10-9 muts × year /bp

Mutagenesis increases the rate (probability) but the mutations are still stochastic.

Mutation RatesA given mutagen increases the rate of some kinds of mutations but not others. In other

words, it biases the probabilities, like weighting a coin.e.g.

• Ionizing radiation induces (increases the probability of) chromosome breaks and hence oflarge-scale “chromosome mutations” or rearrangements such as deletions ortranslocations.

• Acridines induce deletion or insertion frameshifts.

• Ethyl methan sulfonate (EMS) induces chemical changes in bases, mainly changingguanine to O6-ethylguanine which mispairs, resulting in changing GC pairs to AT.

• 5-bromouracil (Bu) is an analogue of thymine and is most often incorporated into DNA inplace of thymine. It then pairs with G at the next replication, so that an AT pair isreplaced by a GC pair. Less commonly it causes a GC pair to be replaced by AT.

Modern genetic engineering can reduce or eliminate the stochasticity of mutation, allowingus to change a specific base in a specific gene in vitro, then put it back in the organism.Knockout mutations can be made in specific genes in vivo.

Phenotypic Effects of Mutations in Exons

Review code properties:• Degenerate• Triplet• Commaless• Start codon• Stop codon(s)

Phenotypic Effects of MutationsUseful terms for phenotypes of mutations:

Amorph = nullimorph = null = knockout mutations: mutant allele iscompletely inactive (not transcribed, or translated, or encodes inactiveprotein or RNA).e.g. white eye mutant in Drosophila melanogaster

Hypomorph: mutant allele has reduce activity (reduced rate oftranscription or translation, or encodes protein or RNA with reducedactivity).e.g. apricot eye allele of white gene in D. melanogaster

Neomorph = gain-of-function mutation: mutant allele has new activity(e.g. encodes protein or RNA with new enzymatic activity or turns onegene off and another one on or make a gene active in wrong tissue).e.g. Antennapedia in Drosophila

The “morph” terminology was devised by H. J. Muller, who used itmainly to refer to mutation effects inferred from phenotypic effects.

Consequences of Code PropertiesDegenerate

Consequences of Code Properties

• Degenerate, therefore in anexon of a protein codinggene there are two kinds ofpoint mutations:

Synonymous mutationschange a codon to asynonymous codon and donot change an amino acid

Nonsynonymous =missense mutationschange an amino acid

Consequences of Amino Acid ChangesSynonymous mutations do not change an amino acid.Therefore they usually have no effect on phenotype.

Nonsynonymous = missense mutations change anamino acid. The phenotypic effect depends on thenature of the change and the location in the protein:

Some changes have no effect on protein function,therefore no effect on phenotype.

Changes that are more likely to have an effect include:•Changing to amino acid with very different side chain(charge, hydrophobicity, etc.).•Change in active site or ligand binding site or siterequired for folding or joining with other polypeptides.•Changes on outside of molecule that affecthydrophobicity or charge of protein.

Hemoglobin. Heme in red, twoα and two β chains in differentcolors.

Phenotypic Effects of Mutations

• Triplet• Commaless

Phenotypic Effectsof Mutations

• Triplet• Commaless

Deletions of 1 or 2 bp are frameshift mutations.

Consequences:

CACCATGGTGCACCTGACTCCTGAG…CACUAAGCU

CACCATGGTGACCTGACTCCTGAG…CACUAAGCU

Met Val His Leu Thr Pro Glu His Term

− C

Met Val Thr Term

CACCATGGTGCCACCTGACTCCTGAG…CACUAAGCU+ C

Met Val Pro Pro Asp Ser Term

− CTCACCATGGTGCACCTGACTCGAG…CACUAAGCU

Met Val His Leu Thr Arg ? Leu Ser

Phenotypic Effectsof Mutations

Deletions of 1 or 2 bp in exons are frameshiftmutations.

Consequences:• Change of one or more amino acids; phenotype

depends on the amino acids and their location.• Premature termination.• Late termination.• Usually nullimorphs or hypomorphs.

CACCATGGTGCACCTGACTCCTGAG…CACUAAGCU

CACCATGGTGACCTGACTCCTGAG…CACUAAGCU

Met Val His Leu Thr Pro Glu His Term

− C

Met Val Thr Term (termination, or stop)

CACCATGGTGCCACCTGACTCCTGAG…CACUAAGCU+ C

Met Val Pro Pro Asp Ser Term

− CTCACCATGGTGCACCTGACTCGAG…CACUAAGCU

Met Val His Leu Thr Arg ? Leu? Ser?

Phenotypic Effects ofMutations in Exons

• Start codon• Stop codon

Phenotypic Effects ofMutations in Exons

Any change in start codon• Late start, first part of polypeptide missing.• Out-of-frame start.Likely result is polypeptide with no function(nullimorph) or abnormal function (hypomorph).

Change of stop codon to a sense codon• Polypeptide has extra segment at the end.Possible result is polypeptide with no function, reduced

function, or abnormal function (amorph, hypomorph, orneomorph).

Nonsense mutations change a sense codon for an aminoacid to a nonsense = stop codon.

• Shortened polypeptide which usually, but not always, hasreduced or no function.

Mutations Due to Transposable Elements

Transposable elements (TEs) are segments of DNA that can move from one locationto another in the genome, or have a copy made and moved to a new location.

Insertion of a TE in a gene can cause frameshifts or cause additional amino acids tobe added to a protein product. This usually results in a null mutation.

Insertion of TEs in controlling elements or between a gene and its controllingelements can cause major changes in transcription (no transcription or transcriptionat inappropriate times and/or places.

Transposable elements are more common in some organisms (e.g. Drosophilamelanogaster) than in others and can cause a major proportion of all visiblemutations.

Genes Encoding Enzymes and Auxotrophic MutantsSome genes code for enzymes.Many enzymes catalyze steps in biosynthetic pathways.Steps are sequential, enzymes act sequentially.Usually, 1 enzyme catalyzes 1 reaction or step in a pathway.

Genes G1 G2 G3

Enzymes E1 E2 E3

A B C D

e.g. tryptophan biosynthesis in E. coli:

Text says 5 steps but don’t show the pathway.

Chorismic acid

Anthranilic acid

PRA

CDRP

InGP

Indole

L-Tryptophan

ASase trpE

PRTase trpD

InGPSase trpC

TSaseB trpB

TSaseA trpA

Notice that names of genes are italicized(or underliuned).

Genes Encoding Enzymes and Auxotrophic Mutants

Special classes of mutants especially useful with microorganisms:

Antibiotic-resistant

Auxotrophic: can’t make essential nutrient, must be supplied in culturemedium•Test for growth on minimal medium (MM) which has things wild typeneeds (energy, C, N sources; salts; etc.); only wild type (prototroph) grows,because it can make everything it needs from these simple ingredients.•Control is complete medium (CM) which has yeast extract, proteosepeptone, etc. that supply everything; all genotypes grow.

One Gene - One Enzyme Hypothesis: not quite right, but focused on ideathat genes have their phenotypic effects by encoding proteins.

Tryptophan AuxotrophsChorismic acid

Anthranilic acid

PRA

CDRP

InGP

Indole

L-Tryptophan

ASase trpE

PRTase trpD

InGPSase trpC

TSaseB trpB

TSaseA trpA

Grows OnCM MM MM+Trp MM+indole MM+InGP MM+CDRP

trp + + + + + + +trpA + - + - - -trpB + - + - - -trpC + - + + + -trpD + - + + + +trpE + - + + + +

Visible Phenotypes of Pathway Mutants

Drosophila melanogaster wild type has red eyes, which require a number ofpigments.Makes eye pigment xanthommatin from tryptophan.cinnabar (cn+) gene encodes kynurenine-3-hydroxylase.cinnabar (cn) mutant has cinnabar-colored eyes.

cinnabar

Phenotypic Effects of Mutations in Introns

Usually no effect unless mutation in splicing signal sequence --> failure to remove intronor splicing at incorrect site.

ATG GTG CAC … GCAGgttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagAcagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccacccttagGCTGCTGGTGATGGTGCAC … GCAGGCTGCTGG

ΔG No splicing, wrong amino acids up to a stop codon

ATG GTG CAC … GCA Ggt ggt atc aag gtt aca aga cag gtt taa gga gac

caa tag aaa ctg ggc atg tggagacagagaagactcttggg ttt ctg

ata ggc act gac tct ctc tgc cta ttg gtc tat ttt ccc acc ctt agG

CTG CTG GTG

Phenotypic Effects of Mutations in GenesEncoding Functional RNAs

rRNA genes

Complicated because rRNA genes present in hundreds or thousands of copies (tandemrepeats); mutation affects only one, in which case has little or no effect, but can spreadto all copies after many generations. The mechanism of spreading is unequal crossing-over and gene conversion, which we will discuss later in the course.

If it spreads, can have no effect, nonfunctional or subfunctional RNAs and ribosomes,no or reduced synthesis of all proteins encoded same genome. Often lethal or verydetrimental.

Phenotypic Effects of Mutations in GenesEncoding Functional RNAs

tRNA genes

Mutations in the anticodon, or in the region that is recognized by the aminoacyl tRNAsynthetase, can result in wrong amino acids being inserted at many sites in manyproteins.

Mutations and Gene Interactions

Control of gene expression involves interaction with the productsof other genes. (More detail in next section of lectures.)

• Sometimes, whether a gene is transcribed or not depends on whetheror not a protein produce of another gene binds to an upstreamcontrolling region.

• Mutations in controlling gene can modify presence/absence orabundance of product of controlled gene.

• There are many other ways in which products of different genesinteract.

• Consequence: change in expression of a gene may be due tomutation in gene itself, or in its control sequences, or in other genesthat interact with it.

• What appears to be a mutation in gene B could be a mutation in geneA if A encodes a protein that is required for transcription of B.

mRNA protein

Gene BGene A

Dominance

An important aspect of genetics is being able to relate the genotypewith respect to a particular gene to the phenotype.

Dominance: allele A1 is dominant to allele A2 if the heterozygoteA1/A2 has the same phenotype as the homozygote A1/A1.

Dominance of a mutant allele depends on the effects of themutation at the molecular level.e.g. a null alllele will be recessive to the wild type in a gene thatcodes for a product that is detected fairly directly.

You are invited to try to predict the phenotypes of heterozygotesfor various kinds of mutations.

Mutation Summary

Mutations can result from:• errors in DNA replication or repair• damage by chemical or radiation mutagens• movement of transposable elements

The effects of mutations depend on:• the kind of gene in which the occur• the function (or lack thereof) of the site within the gene• the nature of the mutation• interactions of the mutant gene or sequence with other genes