international student biotechnology congress

3rd

International Student Biotechnology Congress

In the name of God

3rd


rd

International Student Biotechnology

Congress

May 6-8th

2013, Allameh-Amini Hall,

University of Tehran

3isbc.ir

3

3rd


Organizers:

University of Tehran, Student Scientific Society of Biotechnology

Alzahra University, Student Scientific Society of Biotechnology

Committee Members:

Chair: Prof. Parviz Norouzi

Director: Ramin Fazel

Executive Chair: Fatemeh Gheidari

Scientific Chair: Dr. Mahdi Rahaie

Financial Manager: Pejman Shirazian

Public Relations Manager: Amir Banaei Esfahani

3rd


Sponsors:

University of Tehran

Alzahra University

Cinnagen Company

Ministry of Science, Research and Technology

National Institute of Genetic Engineering and Biotechnology

Aryogen Biopharma

Institute for Research in Fundamental Sciences (IPM)

Sinaclon Company

Faculty of New Sciences and Technologies, University of Tehran

Stem Cell Technology Research Center

Biotechnology Development Council

3rd


Conference Welcome Note

Research and investigation is one of the most important criteria of a society's

scientific development. An academic development is followed by an appropriate

training, actuating academic achievements, maintaining the youth capability,

sharpness and eagerness to aim a goal in research which makes modern societies

have young acumen involved in research fields. Most of worthwhile discoveries

and inventions are the fruit of youth age or have its roots in it.

I am honored to welcome you all to the "The 3rd

International Student

Biotechnology Congress" which is held by Student Scientific Society of

Biotechnology at University of Tehran and Alzahra University. This conference

is a worthy action which can encourages students and researchers to enter

researching fields. To meet all the conditions and facilities needed for this

academic investigative conference, the responsible panel particularly the director

Mr.Ramin Fazel, executive chair Ms.Fatemeh Gheidari, scientific chair Dr.Mahdi

Rahaie and public relations manager Mr.Amir Banaei Esfahani did lots of efforts

and I would like to appreciate them due to their feasible attempts.

Best regards,

Parviz Norouzi

Chairman of the 3rd

International Student Biotechnology Congress.

3rd


Director Remarks

Reaching welfare, wealth and manufacturing is the main goal of all countries in

today's world. In this area, third world countries have sufficed with using natural

and nether resources. These countries are endeavoring to aim the target by

extracting these resources. On the other hand, circumspect countries have imitated

using developed technology instead of prospecting exhaustible resources. Using

these High-Tech fields such as Biotechnology, Nanotechnology and IT is the most

important device to actualize the concept of Earning money from science .

Unfortunately in our country, the first have been dominated up to now and have

been sustained from this point of view; therefore its the duty of scientists and

researchers to actuate the second view and propel people and government toward

it. Considering this point the Scientific Student Society of Biotechnology at

Univarsity of Tehran and Alzahra University are on the verge of holding

The 3rd

International Student Biotechnology Congress and are going to step

forward in making a progress in national level hoping it could gain such an aim.

Best Regards,

Ramin Fazel

Director of the 3rd


3rd


Scientific Committee Members:

Dr. Mehdi Alavi

Dr. Sedigheh Asad

Dr. Kayhan Azadmanesh

Dr. Valiollah Babaeipour

Dr. Behnaz Bakhshandeh

Dr. Mohammad Barshan Tashnizi

Dr. Shahin Bonakdar

Dr. Mehdi Dastgheib

Dr. Elahe Elahi

Dr. Jamshid Fouladi

Dr. Naser Ghaemi

Dr. Zahra Hajihassan

Dr. Monir Hosseinzadeh

Dr. Hamidreza Javadi

Dr. Mahbube Kabiri

Dr. Vahid Khalaj

Dr. Ali Mohammad Latifi

Dr. Sayed-Amir Marashi

Dr. Faramarz Mehrnejad

Dr. Mohammad MirDerikvand

Dr. Javad Mohammadnejad

Dr. Vahid Niknam

Dr. Ali Hossein Rezayan

Dr. Mehdi Sadeghi

Dr. Gholam reza Salehi

Dr. Sorush Sardari

Dr. Ehsan Seyedjafari

Dr. Zarvan Shahrzad

Dr. Meisam Tabatabaei

Dr. Ladan Teimoori-Toolabi

Dr. Masoud Tohidfar

Dr. Bagher Yakhchali

Dr. Mahboubeh Zarabi

3rd


Executive Committee:

Hamideh Abbasi

Motahareh Agha Molaei

Hossein Akhoondi

Khadijeh Alishah

Mosab Asadi

Saba Asili

Saba Aslani

Farnoosh Azarian

Amin Azimi

Parizad Babaei

Soraya Bahari

Behnaz Bakhshandeh

Zeinab Bakhshi

Niloofar Dadkhah

Mohsen Dehghani

Ali Delavari

Samaneh Farajzadeh

Sudeh Farani

Sadaf Farsinejad

Armin Fazel

Hamideh Fouladiha

Tahereh Ghasemi

Zohreh Gheisary

Azadeh Hadadian Pour

Mahdieh Hadi

Samereh Hamedani

Raheleh Hamrahi

Sahar Hedayati Khah

Mahshid Heidary

Zhaleh Hosseini

Saeedeh Hosseinian

Mohadeseh Jamal Khan

Ali Karimi

Negin Katal

Narjes Kazemi

Arash Keshavarzi

Afrooz Khalili

Alireza Majd

3rd


Yasaman Mian Mahaleh

Reihaneh Mir Hasani

Pouria Mirzavand

Azam Moosavi

Fatemeh Motamedi

Negin Motamedi

Mohammad Motealehi

Atena Mozafari

Narjes Nakhaei

Maryam Navaeian

Paria Pirasteh

Mohebat Pour Majidian

Amir Hossein Saadati

Zeinab Sadri

Mohammad Reza Sadrzadeh

Marzieh Sahebi

Mohammad Hasan Samiee Aref

Mohammad Reza Sarshar

Sajad Sarvari

Pejman Shirazian

Fatemeh Siahvashi

Salma Sohrabi

Sana Pour Tabatabaei

Andisheh Talaei

Meisam Yousefi

Roya Yousefi

Rafooneh Zafari

Mohammad Zim

3rd


Responsibility for materials published in this collection is

solely with the authors. Be in printed in this series does

not indicate that the content where approved by the

scientific committee of the congress.

3rd International Student Biotechnology Congress

1

Contents Oral Presentation Abstracts ............................................................................................................. 12

Medical Biotechnology ................................................................................................................ 12

Human Papillomavirus Type 16- E7 DNA Vaccine: Mutation in the RB binding site of E7 gene

Enhances Specic Cytotoxic T-Lymphocyte Induction and Antitumor Activity........................... 12

Recombinant 36kDa outer membrane protein (Omp2b) of Brucella abortus Elicited Strong

Cytokine Responses in BALB/c mice ......................................................................................... 13

DHPLC-mutation scanning of the breast cancer predisposing gene BRCA2 in breast cancer

patients from the south of Iran ................................................................................................ 14

Expression of the TrkC gene and a novel long non-coding RNA located in the gene in different

cancerous cell lines .................................................................................................................. 15

Cautiously view point on the effect of essential oils as therapeutic materials for

neurodegenerative diseases .................................................................................................... 16

Preparation of EGF Receptor-Targeted Polyplexes for breast cancer therapy ........................... 17

Relationship between TNF-a(-308) and LT-a(+252) polymorphisms and acute lymphoblastic

leukemia in Northwest of Iran.................................................................................................. 18

Inhibition of oncogenic activity of WWP1 on breast cancer cell line with synthetic microRNA .. 19

Transcription-mediated Isothermal Amplification for Rapid Identification of Lishmania major

using Sequence-based Primers................................................................................................. 20

The Differentiation of Mesenchymal Stem Cells into lnsulin-producing Cells through

Transduction of a Lentivirus Containing IPF-1 Gene.................................................................. 22

Crocetin attenuates spatial learning dysfunction and brain damage after chronic cerebral

hypoperfusion in rats ............................................................................................................... 23

Cytotoxic and Apoptotic Activity of Scrophularia amplexicaulis in MCF-7 Human Breast Cancer

Cells ......................................................................................................................................... 24

RNA-binding protein Rbm47 binds to Nanog in mouse embryonic stem cells ........................... 25

Codon optimization, cloning and expression of single-chain variable fragment (scFv) antibody

against CD22 in PichiaPastoris and optimization of Expression conditions ................................ 26

Agricultural Biotechnology ........................................................................................................... 27

dabb1 ........................................................... 27

Transgenic expression and recovery of biologically active recombinant human insulin from

Arabidopsis thaliana seeds ....................................................................................................... 28


2

Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in

Bread Wheat ........................................................................................................................... 30

Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in

Bread Wheat ........................................................................................................................... 31

...................................... 32

Subcellular targeting of transiently expressed GFP using a plant virus based expression system

in planta .................................................................................................................................. 33

Genetic diversity of dwarfing Apples (Malusdomestica) of Iran AFLP markers .......................... 34

Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici

blotch of wheat ....................................................................................................................... 35

SUF4 CLF ...................................................... 37

cDNA PR10 (zea mays) ................................................................. 38

Microbial and Industrial Biotechnology ........................................................................................ 39

Nitrate reductase purification from a moderately halophilic microorganism, Salinicoccus

iraniensis ................................................................................................................................. 39

Comparison and Optimization of Expression of a Chimeric-Truncated t-PA by Pichia pastoris

Strains: GS115 and KM71 ......................................................................................................... 40

Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas

syringae pv. syringae using Loop and Bumper Primers ............................................................. 42

.............................. 43

Design and construction of the expression cassette for producing the Epithermal growth factor

with the ability of connecting to the collagen ........................................................................... 44

Wastewater Algae: A Potential Candidate for Biodiesel Production .......................................... 45

Effects of agitation on enhancement of bacterial cellulose production..................................... 46

Effect of Different Carbon Sources on Activity of Biocatalyst in Biocathode Microbial Fuel Cells

(BMFCs) ................................................................................................................................... 47

A novel method for optimization of biomass lipid extraction.................................................... 48

Molecular Biotechnology ............................................................................................................. 49

In-cell western analysis, a new method of evaluating cellular protein expression and cell toxicity

assays ...................................................................................................................................... 49

Preparation of recombinant single domain antibody against epidermal growth factor receptor

................................................................................................................................................ 50

ADSCs/ESCs Co-culture: a novel approach to increase the proliferation of ADSCs ..................... 51

A novel cold-inducible expression system for Bacillus subtilis 1A772 ........................................ 52


3

Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas

syringae pv. syringae using Loop and Bumper Primers ............................................................. 53

Probing the binding sites of Fediamsar and bovine serum albumin ........................................ 54

The benefits of lanthanide cofactors for the characterization and application of RNA-ligating

deoxyribozymes ....................................................................................................................... 55

Investigating the Effects of Interactions between Histidin and Other Amino acids on

Thermostability of Methylglyoxal synthase from Thermus sp.GH5 ........................................... 56

Cell-Mediated Responses Elicited by Immunization of BALB/c Mice with Recombinant

Eukaryotic Vector, pVAX1 Harboring omp28 of Brucella abortus, and Recombinant Omp28 as

booster .................................................................................................................................... 57

Nono-Biotechnology .................................................................................................................... 59

phage Nanobioparticle expressing Apoptin suppress only human breast carcinoma tumor

growth in vivo .......................................................................................................................... 59

Synthesis of Nanobody- Dendrimer Conjugates for Targeted Breast Cancer therapy ................ 60

Dendrosome-based delivery of siRNA against GFP gene in CHO-cell ......................................... 61

PLGA Nanoparticles Containing a Combination of Recombinant 31kda Surface Protein and

Detoxified Lipopolysaccharide of Brucella abortus Significantly Stimulated a Protective

Response in BALB/C Mice ........................................................................................................ 62

Design a hydrogen peroxide biosensor by use of catalase and modified electrode with

magnesium oxide nanoparticles ............................................................................................... 64

An assessment of CH50 activity in mice (Mus msuculus ) treated with silver nanoparticles during

skin wound healing .................................................................................................................. 65

Cell supports of GNP-chitosan nanocomposite/hyaluronic acid and chondroitin sulphate

systems. cell adhesion and proliferation study ......................................................................... 66

Blood Lead level measurement using two biosensors pGL3-luc/pbr and pGL3-luc/cad ............. 68

Evaluation of ESAT-6 and CFP-10 proteins expression of Mycobacterium bovis at RNA level and

evokes cellular immunity in mice with proliferation lymphocyte method ................................. 69

Bioinformatics ............................................................................................................................. 71

Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its

Structure ................................................................................................................................. 71

From microarray data to gene expression pattern, network and protein analysis in Mus

musculus under Helicobacter pylori infection .......................................................................... 72

Preparing Draft Genome-Scale Metabolic Network of Bacillus licheniformis based on the

Reconstructed Metabolic Network of Bacillus subtilis .............................................................. 73

Poster Presentation Abstracts ......................................................................................................... 74


4

Medical Biotechnology ................................................................................................................ 74

Investigation of mouse embryonic stem cells proliferation on surface modified of aligned and

random nanofibrous PCL scaffolds ........................................................................................... 74

Stem Cells and Gene Therapy for Cartilage and Bone Repair .................................................... 76

Immunogenicity Prediction of the Chimeric Protein Consists of Shiga and Cholera Toxins B-

Subunits Using Bioinformatics approaches ............................................................................... 77

Immune Response to Combination of Recombinant Ag85B and Ag85C of Mycobacterium

tuberculosis in C57BL/6 Mice ................................................................................................... 79

Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells

in presence of Dimethyl sulfoxide ............................................................................................ 80

Homozygosity mapping in an Iranian pedigree affected with muscular dystrophy limb girdle

(LGMD) reveals linkage to 2p12-14 and 10q25-26 chromosomes ............................................. 81

Targeting of the signal transducer Smo links microRNA-326 to the oncogenic Hedgehog

pathway in drug resistant CD34+ CML stem/progenitor cells ................................................... 82

..................................................................................... 83

The suitable purification method for investigation on Alpha-synuclein involved in Parkinson

disease .................................................................................................................................... 84

MicroRNA Profiling as a New Approachfor Early Detection of Breast Cancer ............................ 85

Investigating the different combinations of five monoclonal antibodies in ELISA development to

detect 26kDa antigen of H. Pylori ............................................................................................. 86

Inhibition of survivin restores the sensitivity of breast cancer cells to docetaxel and vinblastine

................................................................................................................................................ 87

Approaches to detect matrix metalloproteinases (MMPs) as disease biomarkers ..................... 88

mRNA and microRNA Transferring by Microvesicles ................................................................. 89

EGFR expressing tumor model establishment to evaluate the efficacy of mimotope vaccine .... 90

Genotype Analysis of CCR5-59353-C/T Using PCR Allele Specific Amplification in Iranian normal

population ............................................................................................................................... 91

Recombinant Omp19 combined with detoxified LPS Elicited Protective Immunity against

Brucella melitensis infection in BALB/c Mice ............................................................................ 92

Linkage of a locus for autosomal recessive familial spastic paraplegia to chromosome 8q24 .... 93

Comparing specific genes expression in differentiated and undifferentiated cells derived BMSCs

during BMP-4 and 4mT SMF treatments .................................................................................. 94

Generation of a pLEX-lamp-darpins chimeric lentiviral vector for expression of DARPins in

exosomes surface for breast cancer gene therapy.................................................................... 95

In vitro anti HIV-1 testing of (2, 3-diaryl-1, 3-thiazolidin-4-one) derivatives against HIV-1 ......... 96


5

The response of human breast cancer cells to the non-thermal atmospheric pressure plasma . 97

.......................................................... 98

The role of p-glycoprotein in resistance of lung cancer............................................................. 99

Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP

Technique .............................................................................................................................. 101

2- ....................................... 103

Enzybiotics and their applications in medicine ....................................................................... 104

......................................... 105

Adapting SyberGold and Loop-mediated Isothermal Amplification for Rapid Molecular

Detection of Human Influenza Virus ....................................................................................... 105

MicroRNA mediated knockdown of STAT3 reduces breast cancer stem cells viability ............. 106

-2 " "

.............................................................................................................................................. 108

Recombinant TraQ of Brucella melitensis Elicited Potent IFN- and IL-12 Response in BALB/c

Mice ...................................................................................................................................... 109

Tri-block copolymer: An efficient membrane sealant recovers sever spinal cord injury .......... 111

The cytotoxic effects of the organophosphates chlorpyrifos on human lymphoid cells in vitro113

Induction of cardiac differentiation through overexpression of microRNA-1 in human-induced

pluripotent stem cells ............................................................................................................ 114

Diagnosis of Breast cancer with saliva samples: A review ....................................................... 115

RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy ................. 116

CagA EPIYA-C ................................... 117

Cyclin D1 expression in brain tissue of a murine model of alzheimers disease ....................... 118

.................................................................. 119

Cloning and Molecular Characterization of an Immunogenic LipL41 Protein of Leptospira

interrogans Serovar Icterohaemorrhagia ............................................................................... 120

Detection of Borna Disease Virus p24 RNA in peripheral blood cells of obese patients in Iran 121

Designing specific ARMS tetra-primers of C/T polymorphism in promoter region of F8 gene.. 122

Effect and mechanism of Sphingosin 1-Phosphate in malignant behavior of lymphocytic

leukemia and non-smallcell lung cancer cells ....................................................................... 123

Spermicidal activity of Arum maculatum L. on human sperm ................................................. 124

Investigation of genes expression in differentiated cells derived BMSCs during BMP-4

treatments with FTIR ............................................................................................................. 125

16141 rs NPY ......... 126


6

Pluripotency features in adipose tissue-derived stem cells ..................................................... 127

Agricultural Biotechnology ......................................................................................................... 128

Agrobacterium rhizogenes Mediated Induction of Recombinant Tobacco Hairy Roots Expressing

the Chimeric stxB-ctxB Gene .................................................................................................. 128

............................................................................... 130

(Iris spp.) ISSR ........................... 131

Iris .................................................................................. 132

Plantlet regeneration from hairy root cultures of Atropa belladonna Hamadan sp ................. 133

MTLD ................................................... 134

................................ 135

Molecular characterization and assessment inter and intra diversity of some prunus species In

Iran by AFLP marker ............................................................................................................... 136

(Solanum tuberosum L.)

................................................................................................................... 137

....................... 138

Tissue culture and somaclonal variation in M7 rootstock ..................................................... 139

Optimization of Cronobacteriocin DGH2 a bacteriocin inhibiting Xanthomonas axonopodis pv.

Citri ....................................................................................................................................... 140

Characterization of cronobacteriocin DGH2 an anticitrus canker disease bacteriocin ............. 141

Contamination of cattle slaughtered in the city KazerounE.coli O157: H7 in 2012 .................. 142

Construction of a genetic linkage map with SSR, AFLP and morphological markers to locate QTLs

controlling pathotype-specific powdery mildew resistance in diploid roses ............................ 143

Assessment Of Regeneration Of Stevia Rebaudiana By Seed .................................................. 144

Marker Assisted Selection for Overexpressed Bx7 Gene (Bx7OE) Effective in Bread Wheat

Quality ................................................................................................................................... 145

Validation and Identification GPC-B1 Gene Effective in High-Grain Protein Content in the Wheat

Cultivars and Advance lines.................................................................................................... 146

Identification and Distribution of the Photoperiod Insensitive Allele in Ppd-D1 locus in Wheat

.............................................................................................................................................. 147

Application of Allele-Specific Markers for Identification of Different Sources of 1AL/1RS and

1BL/1RS WheatRye Translocations in Wheat ........................................................................ 148

Allelic Variation at the Vernalization Genes Vrn-A1, Vrn-B1, Vrn-D1, and Vrn-B3 in Iranian

Wheat Cultivars and Their Association with Growth Habit ..................................................... 149

................................................ 150


7

Analysis of molecular methods for producing glyphosate resistance .................................... 151

Evaluation of allelic variation and assessment of quality of storage proteins in Iranian durum

wheats ................................................................................................................................... 152

PROLIFRATION OF MOHREKHOSH (ZHUMERIA MAJDAE Resh. f. & Wendelbo) BY SEED

GERMINATION AND CALLUS INDUCTION ............................................................................... 153

Proliferation of Mouhrekhosh(Zhumeria Majde Resh.f.& wendelbo) by seed germination and

callus induction ...................................................................................................................... 155

Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici

blotch of wheat ..................................................................................................................... 156

Identification of single nucleotide polymorphism in exon 26 of apoB gene in khazak breed

chickens ................................................................................................................................. 157

Prevalence of foot and mouth disease virus (FMDV) in carrier cow reffered to Khorasan Razavi

industrial abattoir by Realtime quantitative PCR (q-PCR) ........................................................ 158

............................... 159

(Glycyrhiza glabra) ................................................................................................................. 159

New techniques in development of transgenic animal technology ......................................... 160

Morphological investigation of hairy roots induced in Datura metel ...................................... 161

Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas

fluorescens) in increase growth parameters of maize ............................................................ 162

Divesity of iranian genotypes for seed storage proteins and storage proteins and

two_dimensional protein pattern in genotypes with high and low oleic acid .......................... 163

Transcripts pattern in bread wheat under drought stress ....................................................... 164

................................ 165

.......................................................................................................... 166

Investigation of callus induction, regeneration and BYMV virus elimination by meristem tip

culture in three cultivars of Gladiolus ..................................................................................... 167

Microbial and Industrial Biotechnology ...................................................................................... 168

Optimization of algal lipid extraction for biodiesel production (hexane) ................................. 168

............................................................................ 169

Cloning, Expression, Purification and in Silico Analysis of the Brucella Urease ........................ 170

Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells

in presence of Dimethyl sulfoxide .......................................................................................... 171

PCR ....................................................... 172


8

Optimization of amylase and protease co-produced by Bacillus licheniformis using economical

medium ................................................................................................................................. 173

Molecular detection of TEM-derived ESBLs and CTX-M gene in E. coli from fecal of canaries,

lovebirds and pigeons in regions of Iran ................................................................................. 174

Survey Pathogenicity of Listeria monocytogenes and Listeria Ivanovii isolated from silage in

mice ...................................................................................................................................... 175

Microbial bio-degradation of polyethylene ............................................................................ 177

Stable immobilization of Aspergillus niger phytase on perlite; activity and stability ................ 178

Multi Drug Resistance of Genomic Islands in Haemophilus influenza Isolated from Clinical

Isolates of Iran ....................................................................................................................... 179

Aspergillus Niger

Aspergillus Niger .......................................................................................... 180

......................................................................... 181

In vitro proteome analysis of an Iranian strain (NIGEB-088) of Xanthomonas citri subsp. Citri 182

Using microarray data to construct network and its analysis for kidney transplantation rejection

.............................................................................................................................................. 184

........................................................ 185

Isolation of a Native Bacillus cereus Amylase Producer from Hot spring of sabalan mountain 186

Comparison of expression of single chain variable fragment of anti human CD4 receptor

antibody fused to green fluorescent protein in two strains of Escherichia coli using flow

cytomerty .............................................................................................................................. 187

In vitro evaluation of co-aggregation effect of probiotic lactobacilli on mutans streptococci .. 188

Microbial diversity of culturable halophilic and halotolerant bacteria from Urmia Salt lake .... 190

........................................... 191

The Assessment of Substrate Preference of Microbial Biocatalysts in Biodesulfurization ........ 192

Suitable strategies for heterologous expression and purification of membrane proteins ........ 193

Effects of phosphate limitation on Saccharomyces cerevisiae gene expression pattern and its

expression network analysis .................................................................................................. 194

Antibacterial activity of methanol extract of the leaves and fruit of Chenopodium foliosum

(Moench) Asch against four strains of Gram-negative pathogenic bacteria ............................ 195

Molecular cloning of Fusion of GP96gene and Kinetoplastid membrane protein-11(KMP-11) of

Leishmania infantum in pET28a vector as a candidate for vaccine preparation against visceral

leishmaniasis ......................................................................................................................... 196

Design of a gene construct by Intein self-splicing properties in order to EGF protein expression

in E.coli .................................................................................................................................. 197


9

Antibacterial activity of Echium amoenum aqueous and ethanolic extracts............................ 198

Evaluation of Molecular Farming Industry in the Production of Recombinant ........................ 199

................... 200

: ........................................................... 201

Quantitative competitive PCR assay for detection of Lactobacillus acidophilus in probiotic

yogurts .................................................................................................................................. 202

Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas

fluorescens) in increase growth parameters of maize ............................................................ 203

Design and Construction of Rotary Biological Contactor (RBC) for enhancement of microbial

cellulose Production .............................................................................................................. 204

Production of truncated recombinant nmp22 protein reactive towards commercial antibody

and inducing immune system for polyclonal response ........................................................... 205

The effectiveness and enzyme potential of honey for inhinition of growth on Pseudomonas

aeruginosa, Staphylococcus aureus, Escherichia coli .............................................................. 206

Identification of GABA production by Lactobacillus casei and Lactobacillus parcasei and

characterization of their glutamate decarboxylase gene ........................................................ 207

Construction of an Eukaryotic Plasmid Encoding ESAT-6 gene of Mycobacterium Bovis as a

Candidate for DNA Vaccine .................................................................................................... 208

Developing of effective enzyme based biofuel cells ................................................................ 209

Molecular Biotechnology ........................................................................................................... 210

................................. 210

GFP M13 ................ 211

Analysis of intratype E6 variants of Human papillomavirus type 31, 52 and 58 in Indian HIV-

positive women with different cervical disease status: a pilot study ....................................... 212

Using a combination of mutations in photoprotein aequorin to application study .................. 213

Modification of Collagen- Chitosan Scaffold by PVA for Skin Tissue Engineering Application .. 214

Cloning and overexpression of miR-939 in HUH7 cell line ....................................................... 215

Efficient expression of laccase gene from Bacillus pumilus ..................................................... 216

The study of interaction between -Lactoglobulin with retinol at monomer and dimmer

conditions by circular dichroism ............................................................................................. 217

...................... 218

............................................................................. 219

Translational targeting of breast cancer cells using construct containing 5UTR of bFGF......... 221

BRCA1 ................ 222


10

Molecular aspects on the interaction of isatin-3-isonicotinylhydrazone to deoxyribonucleic acid

.............................................................................................................................................. 223

.............................................................................................................................................. 224

Isolation, Cloning and Expression Verification of the Mycobacterium Bovis CFP-10 Gene in

BALB/c mice........................................................................................................................... 225

Protein engineering of bacterial -xylosidase by Site-directed mutagenesis and expression in

Pichia pastoris........................................................................................................................ 226

Optimization of Genomic DNA Extraction of Mistletoe (Viscum album) .................................. 227

Pluripotency features in adipose tissue-derived stem cells ..................................................... 228

ND3 mitochondrial genes, a good candidate for DNA Barcoding ............................................ 229

Nono-Biotechnology .................................................................................................................. 230

Experimental Study of Nanoarchaeosomal Carrier for Paclitaxel on MCF-7 Cell Line............... 230

Application of siRNA nanoparticles in stem cells differentiation ............................................. 231

The investigation of Electron transfer mechanism of glucose oxidase at graphene and graphene

oxide electrode ...................................................................................................................... 232

The use of chitosan nanoparticles as new anticancer drug carrier system .............................. 233

Viral-mediated gene delivery against cancer metastasis......................................................... 234

Metal nanoparticle production assisted by -amylase............................................................ 235

Co-delivery of shRNA and DNA by a neutral phospholipid-based bilayer nanosystem ............. 236

Transcriptional targeting of breast cancer stem cells using anti-HER2 nanobody targeted

dendrimeric nanoparticles ..................................................................................................... 237

Spectroscopic studies of the interaction of a novel silver nanoparticles with bovine serum

albumin ................................................................................................................................. 239

Antibacterial properties of magnetic hydrogel nanocomposite based on salep- poly (acrylic acid)

.............................................................................................................................................. 240

Controlled release of defrasirox through magnetic hydrogel nanocomposite based on salep-

poly (acrylic acid) ................................................................................................................... 241

RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy ................. 242

Investigation of the effects of nanoparticles ZnO on the histopathological of lung rat ............ 243

( )

Monobromobimane ....................................................................................... 244

Fluorescence spectroscopic evaluation of Cu-diamsar-bovine serum albumin interactions .... 245


11

Study of the Forster resonance energy transfer between [Co (diNOsar)] Cl3 and bovine serum

albumin ................................................................................................................................. 246

Bioinformatics ........................................................................................................................... 247

(SNPs) (GWAS)

.............................................................................................................................................. 247

...... 248

Evaluating relationship in cytokines level, Fibromyalgia Impact Questionnaire and Body Mass

Index in women with Fibromyalgia Syndrome ........................................................................ 249

Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its

Structure ............................................................................................................................... 250

Prediction and modeling of Phytasethermostable structure based on bioinformatics tool ..... 251

Determination of Listeriolysin O protein structure using Homology Modeling ........................ 252

Using percolation theory for studying Studying the relationship between robustness against

mutations in metabolic networks and lifestyle of organisms .................................................. 253

Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP

Technique .............................................................................................................................. 254

cDNA ....... 255

Prediction of subnuclear location of proteins using Artificial Immune System ........................ 256

Analysis Some of the Features Bioinformatics CSN3 Gene in Dairy Cattle ............................... 257

The Study of Human Glucose-6 Phosphatase Protein Structure using Homology Modeling .... 258

In silico Search and Synthesis Design of 3- (phenyl) acrylonitrile Derivatives and Evaluation Anti-

inflammatory Properties with Marvin Sketch Software .......................................................... 260

Bioinformatics Study Of microRNAs To Identify Genes and Cellular Pathways Associated With

Medulloblastoma................................................................................................................... 261

The Identifying Of Diagnostic Markers In Prostate Cancer By The Use Of EST-SSRs ................. 262

General Biotechnology .............................................................................................................. 263

................................................................... 263

.................................................................................................... 264

........................................................................................... 265

.................................................................................. 266


12

Oral Presentation Abstracts

Medical Biotechnology

Human Papillomavirus Type 16- E7 DNA Vaccine: Mutation in the RB binding

site of E7 gene Enhances Specic Cytotoxic T-Lymphocyte Induction and

Antitumor Activity

Armina Alaghebandbahrami golestan university of medical science

Amir Ghaemi* golestan university of medical science

*: [email protected]

Introduction:Increasing evidences has suggest that infection with high-risk human papillomavirus

(HPVs) is closely associated with cervical cancer. The HPV16-E7 oncoprotein has been shown to be

continuously expressed in cervical carcinoma cells, therefore it is an attractive tumor-specic

antigen target for immunotherapy of patients with cervix dysplasia and cancer.For safety reasons,

we design and construct a modified the E7 gene with reduced oncogenecity (HPV-16 MUT E7).

Material and Methods:The construct was synthesized and cloned in pEX cloning vector and its

accuracy was confirmed by sequencing. Then the construct was transformed to competent E.coli

Top10F and prepared in mini scale. After Subcloning in to pCDNA3 eukaryotic expression vector,

CHO cell line were transfected with vectors expressing MUTE7 and wild E7 and characterized by SDS

page and Western Blotting. Confirmed constructs were administrated in C57BL/6 tumor mice model

as therapeutic vaccines and different aspects of cellular immune response were evaluated. For this

purpose, MTT cell proliferation assay, LDH assay and cytokine assay were performed.

Results:The results showed that the genes of E7 wild and E7 MUT were successfully cloned and

expressed compared to negative control vector.

Immunization of mice with vaccine expressing the MUT E7 gene produced signicantly stronger E7-

specic cytotoxic T-lymphocyte response and better tumor suppression in mice than did a wild-type

E7 DNA vaccine expressing a stable E7 protein.

Conclusion: Our results suggests that MUT E7 may be useful for DNA immunization and

development of anti-cancer vaccines against HPV-16 mediated cancers.

Keywords: cervical cancer, human Papilloma virus,oncogenicity,DNA vaccines,mutation


13

Recombinant 36kDa outer membrane protein (Omp2b) of Brucella abortus

Elicited Strong Cytokine Responses in BALB/c mice

Sara Aryanfar * Islamic Azad University-Karaj branch

Nima Khoramabadi Islamic Azad University-Karaj branch

Haniyeh Aghababa Tarbiat Modares University

Majid Sohrabi Tarbiat Modares University

Nazanin Nazanin Islamic Azad University-Karaj branch


Introduction : Brucellosis is an important zoonotic disease which is globally prevalent. Prevention of

the disease in animals is based on attenuated vaccine strains which are highly pathogenic for human

hosts. Immunologic evaluation of Brucella antigens has a substantial role in vaccine investigations.

We report the production of recombinant 36kDa outer membrane protein Brucella abortus (Omp2b)

in E. coli host and evaluation of IFN-, IL-12 and IL-4 responses in mice which were immunized with

this protein.

Materials and methods omp2b gene was cloned in pET28a(+) and expression of protein performed

in E coli BL21(DE3). Recombinant Omp2b (rOmp2bpET28) was purified using nickel affinity

chromatography. 6-8 weeks old BALB/c mice were immunized with 20g rOmp2bpET28 formulated

in Freunds adjuvant, subcutaneously. Mice received a primary dose followed by two boosters with

12 days of interval. A week after last booster, mice were sacrificed and their spleen lymphocytes

were cultures; all cultures were subsequently stimulated with rOmp2bpET28. Production of IL-4, IL-

12 and IFN- was evaluated in lymphocyte cultures by ELISA

Results : Level of IL-4, IL-12 and IFN- were significantly higher in mice immunized with

rOmp2bpET28. Production of IFN- was higher than that of IL-4 and IFN-/IL-4 ratio suggested that a

cell-mediated response had been developed in mice receiving rOmp2bpET28.

Conclusion : rOmp2bpET28 strongly stimulated the development of immune responses in BALB/c

mice. The cellular-type response also makes it an appropriate antigen for further investigations of

brucella vaccines.

Keywords : Brucellosis, Brucella abortus, Omp2b


14

DHPLC-mutation scanning of the breast cancer predisposing gene BRCA2 in

breast cancer patients from the south of Iran

Safoora Deihimi Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences

Nasrollah Erfani Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences

Abdol Rasoul Talei Department of Surgery, Shiraz University of Medical Sciences

Abbas Ghaderi * Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences


Introduction : Germline mutations in Breast Cancer gene (BRCA2) confer an estimated cumulative

lifetime risk of breast cancer of 5684%. Furthermore, the cancer-founder effects of BRCA mutations

have been suggested to be race and ethnic population-specific. Previous investigations of our group

indicated no association of known founder mutations in BRCA genes (185delAG, 5382insC, 6174delT)

with familial breast cancer in Iranian populations. As a part of a larger project searching for BRCA

founder mutations in Iranians, we aimed in the present study to investigate germ-line mutations in

exon 11E of BRCA2 gene in females with familial breast cancer in south of Iran.

Materials and methods : DNA was extracted from peripheral blood samples of 70 affected women

with familial breast cancer, and 70 age-sex matched healthy subjects. Denaturing high performance

liquid chromatography (DHPLC) method, using Transgenomic WAVE 4500 system, was applied for

genetic pre-screening of BRCA1 gene in order to reduce the cost and time for the analysis of this

gene. Chromatograms analysis was performed with Navigator Software 2.2.0. Mutation positive

amplicons had to be subsequently sequenced by direct DNA sequencing using BigDye Terminator

chemistry and ABI 310 sequencer.

Results : A Novel point mutation was detected in exon 11E of BRCA2 gene of patients. The frequency

of G/T missence mutation (c.[5961G>T]) causing Glutamine 1987 with Histidine substitution was

12.9% of 70 breast cancer patients. The mutation was not detected in none of controls and all the

patient carriers were heterozygote for the mutation.

Conclusion : This study indicated identification of a novel mutation in exon 11E of BRCA2 gene,

suggesting appropriate target for further investigations as a founder mutation in Iranian population.

In this regard, utilizing a fast and reliable mutation pre-screening method like DHPLC can help to

accelerate mutations scanning in BRCA genes of carrier females.

Keywords : Breast Cancer, DHPLC, BRCA2 gene


15

Expression of the TrkC gene and a novel long non-coding RNA located in the

gene in different cancerous cell lines

Sadat Dokanehiifard Tarbiat modares university

Bahram* Mohammad Soltani Tarbiat modares university

Fahime Hosseini Tarbiat modares university

Hadi Najafi Tarbiat modares university

Seyad Ali Mousavizadeh Tarbiat modares university


Introduction : TrkC gene plays a critical role in proliferation, differentiation and survival of the

developing neurons. There is no data about the mechanisms of different roles of TrkC gene. There

are reports on Trk family expression in neoplasms as well, namely, the primitive neuroectodermal

tumors of childhood, and in adult astrocyticgliomas. TrkC expression is also reported in breast cancer

samples.

Materials and methods : In our previous study, a novel long non-coding RNA (N-lncRNA) located in

TrkC gene was identified. Here we examined 15 tumorcell lines (identified as glioma, lung,

hepatoma, cervix, breast and etc), for the expression of TrkC gene as well as N-lncRNA located in it.

Results : Result of our study revealed that TrkC gene and the N-lncRNA are differentially expressed in

these cell lines.

Keywords : TrkC, non-coding RNA, cancer


16

Cautiously view point on the effect of essential oils as therapeutic materials

for neurodegenerative diseases

Masoome Khalife National Institute of Genetic Engineering and Biotechnology

Farhang Aliakbari National Institute of Genetic Engineering and Biotechnology

Dina Morshedi* National Institute of Genetic Engineering and Biotechnology


Introduction: Neuronal death, mainly apoptosis, is the cause of the indication of many human

neurodegenerative diseases, such as Parkinsons and Alzheimers. Recognition of the mechanisms

which prevent or promote apoptosis in nerve cells come new manner for treating

neurodegenerative disorders. A major component of protein plaques in synucleinopathies, especially

Parkinsons disease is alpha-synuclein which its aggregation in dopaminergic cells promotes

apoptosis. Nowadays, preventing protein fibrillation might be one of the main options to treat

neurodegenerative diseases.

Materials and Methods: In the present study the effect of several essential oils including Myrtus

communis, Spearmint, Citrus sinensis, Citrus limon, Tarragon, Mentha pulegium, Thymus vulgaris

and Rosmarinus officinalis on the inhibition of alpha-synuclein fibril formation was investigated.

Furthermore their cell cytotoxicity on the pc12 pheochromocytoma cells was assessed using MTT,

LDH, DNA fragmentation and anexin V methods

.

Results: The fibrillation of alpha-synuclein was monitored by the standard tests. Results indicated

that adding some of these essential oils to the samples could inhibit fibril formation of alpha-

synuclein significantly. On the other hand some of them did not change the fibrillation process and

some induced such process. For examining the prevention of apoptosis by adding these supplements

to fibrils, they exposure to dopaminergic pc12 cell line. Result showed that all essential oil had

destructive cytotoxicity effects even at low concentrations and it was a general phenomenon for

essential oils.

Conclusion: Results demonstrated that albeit some of the noted essential oils had potential to

prevent fibrillation but they were highly toxic for cell which may lead to apoptosis. Due to their well

inhibitory effect, essential oil must be fractioned and those fractions which can prevent fibrillation

with no toxicity on cell, are introduced for further study in neurodegenerative diseases medication.

Key words: Alpha-synuclein, Essential oils, Neurodegenerative diseases, Park


17

Preparation of EGF Receptor-Targeted Polyplexes for breast cancer therapy

Mosleh Mohamadi Rad Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran Hedayatollah Ghourchian Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran Davoud Ahmadvand * School of Allied Medical Sciences, Tehran University of Medical Sciences, Tehran, Iran


Introduction : Breast cancer is one of the problems threatening human health in the developed

countries. Today, advances in molecular techniques have influenced on the field of cancer

treatment. Among molecular methods, gene therapy and drug carrier nanoparticles are the most

prominent threatments. Gene therapy has considerable development in recent years. Successful

gene therapy depends on several factors; one of the most important is targeted delivery of

therapeutic genes into cancer cells without trauma to normal cells. Therefore, in this study we

decided to target the cancer cells at two levels: first, targetting at transcription level and second by

use of targeted nanocarriers with antibody against human epidermal growth factor receptor 2

(HER2) which is over-expressed in breast cancer cells. In this study, we decided to synthesis PAMAM

(Poly(amido amine))-PEG-Trastuzumab polyplexes containing a killer gene construct.

Materials and methods : G5 PAMAM dendrimers conjugated to PEG in different ratios and TNBS

assay was used for determination the number of PEG attached to each dendrimer molecule.

Thiolated Trastuzumab (a monoclonal anti-HER2 antibody) was conjugated to PAMAM/PEG.

Polyplexes (complexes of PAMAM and DNA) were generated at different N/P ratios. Particle size and

zeta-potential of polyplexes was measured by dynamic light scattering. These polymers were used to

deliver a killer gene under the control of a breast cancer specific promoter to HER2 expressing BT474

cell line and HER2 non-expressing MCF10A cell line as negative control. Transfection efficiency of

different denriplexes was determined using Real Time PCR assay.

Results : The conjugation of PEG and anti-HER2 antibody was confirmed by TNBS and ELLMAN assay.

Different Pegylation degree and N/P ratios affect the particle size and zeta-potential. The best

concentration ratio of the components (PEG and DNA constructs) was determined in order to

achieve the most efficient complexes for transfection. Real Time PCR results showed that PAMAM-

PEG-Trastuzumab has higher transfection efficiency than PAMAM alone.

Conclusion : Results of this study confirmed that Pegylation of dendrimers significantly reduced the

toxicity of PAMAM dendrimers and conjugation of PAMAM-PEG to trastuzumab antibody make

these polymers good candidates for targeted cancer gene therapy.

Keywords : Nanocarrier. PAMAM dendrimer, trastuzumab, genethrapy


18

Relationship between TNF-a(-308) and LT-a(+252) polymorphisms and acute

lymphoblastic leukemia in Northwest of Iran

Hajar Nasiri medical tabriz univercity

Safar Farajna* medical tabriz univercity

Azim Rezamand medical tabriz univercity

Amir Monfaredan medical tabriz univercity

Majid Farshdosti medical tabriz univercity

Fateme Skandari medical tabriz univercity

Leyla Sahebi medical tabriz univercity


Introduction : Acute Lymphoblastic Leukemia (ALL), the main subtype of lymphoid malignancy in

children overall, almost occurs in 2-5 years old. The etiology of disease is unclear but some

translocations and genetic variations are effective on occurrence and progress of this malignancy.

Previous studies have shown TNF-a (-308) and LT-a (+252) polymorphisms have relationship with

some diseases such as ALL, because these genetic polymorphisms lead to over expression and high

plasma level of them. This study investigate the association TNF-a (-308) and LT-a(+252)

polymorphisms between ALL patients and healthy individuals in northwest of Iran .

Materials and Methods DNA extracted from 5ml peripheral blood of 70 ALL patients and 130 healthy

population by chloroform salting-out method for RFLP-PCR. After conventional PCR, digestion with

NCOI as restriction Enzyme was done and acquired data was analyzed with SPSS ver.13

Results :The TNF-a mutant alleles (GA) in ALL and control are 11.1% to 88.9% respectively and we do

not have any TNF-a (AA) homozygote in ALL group. The meaningful association of TNF-a variant is

between ALL and control ( pvalue= 0.005). In contrast with TNF, we do not have any significant

difference of LT variant between 2 subjected groups (pvalue =0.616)

Conclusion :Our result shows in ALL and control group from northwest of Iran with Azari ethnicity;

the TNF-a variant allele has meaningful relationship between ALL and healthy people, although,

there is not any significant association of LT-a variant in 2 selected groups.

Keywords: ALL polymorphism, RFLP-PCR, TNF-a


19

Inhibition of oncogenic activity of WWP1 on breast cancer cell line with

synthetic microRNA

Fatemeh Nematpour Tarbiat Modares University

Mahdi Forozandeh * Tarbiat Modares University


Introduction

MicroRNAs (miRNA) are small RNAs that regulate gene expression. MiRNAs involve in numerous

processes such as proliferation, differentiation, apoptosis, etc. These functions support a role for

miRNAs in initiation and progression of malignancies. MiRNAs act as tumoursuppressor or oncogene,

these miRNAs named oncomirs and classified into two groups; 1-Tumoursuppressor oncomirs, which

downregulate expression of the oncogenes, 2-Oncogenic oncomirs, which downregulate expression

of the tumoursuppressors. We can use this model for regulation of target tumoursuppressor or

oncogene, so we designed and synthesized miRNA against one of the important oncogene in breast

cancer, WWP1 (WW domain containing E3 ubiquitin ligase1), which is overexpressed in breast

cancer. WWP1 promotes cell proliferation and regulates other proteins such as; TGF.B, P53, KLF2,

KLF5,ErbB2,andEGFR.

Material and Methods

MicroRNA was designed by Invitrogen RNAi Designer, and after synthesizing, miRNA gene was

ligated into a miR-155-based Block-iT Pol II miR RNAi Expression Vector (Invitrogen), and then

expression level of WWP1 in WWP1-miRNA-transfected breast tumor cells (MCF7) was measured

with Real-Time PCR. Furthermore cell proliferation was measured by cell counting and MTT assay.

Results

This synthetic miRNA reduced expression level of WWP1 up to 70% as compared with control cells

after 72 hours. Also cell counting and MTT assay showed 30% reduction in cell proliferation of MCF7

cells.

Conclusion

In this experiment we succeed to reduce expression of WWP1 in MCF7 cells via miRNA, which led to

inhibition of its function too. These data support that we can regulate expression of target gene via

miRNA. So this new tool has therapeutic potential for treatment of genetically disease such as

cancers.

Keywords: Breast cancer, Gen silencing, MicroRNA, WWP1


20

Transcription-mediated Isothermal Amplification for Rapid Identification of

Lishmania major using Sequence-based Primers

Alireza Niazi Golestan Univercity of medical univercity

Oghol Niaz Jorjani* Golestan Univercity of medical univercity

Hassan Nikbakht Golestan Univercity of medical univercity

Sareh Zhand** Golestan Univercity of medical univercity

Pooria Gill*** Golestan Univercity of medical univercity

*: [email protected] **: [email protected]

***: [email protected]

Introduction: Lishmania major is a flagellate protozoan parasite with a global expansion. This

parasite is caused cutaneous lishmaniasis in human and considered as fairly prevalent infectious

agent in the world. Employing advanced diagnostics for molecular identification of this

microorganism has a more sensitivity and specificity in comparison to the microscopic methods. PCR

is also introduced as one of the best known techniques for diagnosis of this parasite; however, the

method is not widely used due to its expensive equipments and the time requested. Main aim of this

research is diagnosis of L. major via employing an isothermal amplification technology so-called

transcription-mediated amplification (TMA) using sequence-based primers.

Materials and methods: Several specimens of cutaneous lishmaniasis were analyzed using TMA and

RT-PCR in parallel. Total RNA of the specimens were isolated and used in the both assays. Sequence

specific primers with T7 engineered promoter with hinge were used in the amplification process at

37 C for targeting L. major 18S rRNA. Dimethylsulfoxide enhanced T7 RNA Polymerase activity in the

reaction with optimized concentration. The RNA amplicons were produced in less than 90 minutes

and then identified via electrophoresed agaros gel after staining with SyberGold. RT-PCR assays were

also done to be compared with TMA.

Results: Specific 200-nt amplicons of RNAs were characterized in the gel electrophoregram in

comparison to RNA ladder. In addition, the TMA products could be identified with SyberGold

fluorescent emission while exposed with ~300 nm UV irradiation wavelength in the reaction

microtubes.

Conclusion: TMA technology could be applied for molecular diagnosis of L. major in parallel with the

culture, microscopy, and PCR. Using a fluorescent dye e.g. SyberGold in the reaction increases the

sensitivity of the method and provide a significant rapidity in molecular diagnosis of the pathogen.

Obtained results are also shown a comparable specificity and sensitivity between TMA and RT-PCR.

Keywords: L. major, TMA, 18S rRNA


21

Prediction of the genes involved in blood disorders during infection by

Influenza virus A (H1N1) 2009

Zahra Nurolah university of shahrekord

Esmaeil Ebrahimi* university of shiraz


Abstract: The influenza virus belongs to the Orthomyxoviridae family virus. In 2009, a kind of this

viruses appears in many areas of the word and leads to 18000 mortality. The symptoms of pandemic

influenza are very different in humans, Including: the neuronal disorders that specially happen in

children, Respiratory and blood disorders, that eventually lead to disability and death. In this study,

Using microarray analysis, some genes involved in blood disorders, which are caused by influenza

virus pandemic, was found. To do this end, microarray data of the effects of the tow mentioned

viruses, pandemic and seasonal viruse, on Canis lupus (host) were obtained from NCBI (GEO=

GSE17079). Then, the gene network of these genes was drawing. the results including one down

regulated genes and 14 up regulated genes, Considering that Pvalue


22

The Differentiation of Mesenchymal Stem Cells into lnsulin-producing Cells

through Transduction of a Lentivirus Containing IPF-1 Gene

Saman Rahmati Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran

Saman Setoodeh Stem Cell Department, Stem Cell Technology Research Centre , Tehran, Iran

Mahdi Hasanvand Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran

Mohsen Karimi-Arznani Molecular Medical Department, Pasteur Institute of Iran, Tehran, Iran

Mehdi Kadivar * Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran


Introduction: Mesenchymal stem cells, are multifunctional cells with the ability to change and

differentiate into different cell types such as Insulin-producing cells. Differentiation of mesenchymal

stem cells into insulin-producing cells can be done by genetic or environmental factors. One of the

most important factors which is involved in pancreas development and transcription of insulin gene

is PDX-1 Transcription Factor. The purpose of this study is the differentiation of mesenchymal stem

cells into insulin-producing cells.

Materials and Methods: The recombinant lentivirus (made in previous study) was transduced into

mesenchymal stem cells after being concentrated and titrated by ultracentrifugation and Flow

cytometry respectively. The expression of pancreatic cell-specific genes, including insulin and Glut-2

were assessed by RT-PCR in differentiated cells. The differentiated cells were then detected using

anti-C-peptide antibody in ELISA.

Results: The titration of viral particles was calculated in transducing unit per ml (TU/ml), in terms of

the number of cells at the time of transduction and the percentage of the number of GFP-positive

cells. Semi-quantitative RT-PCR results showed high expression of insulin and Glut-2. Quantitative

measurement of C-peptide by using anti-C-peptide indicated the existence of cells having C-peptide.

Conclusion: Regarding the results obtained from current study, mesenchymal stem cells are able to

differentiate into insulin-producing cells via IPF-1 genetic factors.

Keywords: Mesenchymal stem cells, IPF-1 gene,Lentivirus


23

Crocetin attenuates spatial learning dysfunction and brain damage after

chronic cerebral hypoperfusion in rats

Faezeh Tashakori Sabzevar* Mashhad university of medical science


Introduction : Cerebral hypoperfusion is a major cause of cognitive deficits and memory

impairment, in aging and in age-related neurological disorders .Alzheimer's disease (AD), vascular

dementia and post-stroke hypoperfusion are the most important disorders, especially in elderly

people after the age 65.The persistent decrease in cerebral blood flow is correlated with above

mentioned disorders and severity of cognitive impairment. Also, the reduced cerebral blood flow

(CBF) has been recently suggested as an important factor in progression of AD. Bilateral permanent

occlusion of the common carotid arteries (2-VO) of rats has been widely used as a suitable model to

investigate the chronic cerebral hypoperfusion.

Materials and methods : our process consist of: 1.Preparation of crocetin 2.Analysis of crocetin with

HPLC,TLC,spec 3.Animals (30 rats were divided into five groups: (1) sham-operated animals (non-

ischemic group) underwent the same surgical procedure without ligation of the common carotid

arteries (n=6); (2) control group received vehicle (n=6); treatment groups (group 3-5) received

crocetin 2, 4 and 8mg/ kg per day, respectively (n=6 in each group). 4.Surgery and experimental

procedure with 2VO 5.Behavioral experiments(Morris water maze 6.Pathology

Results : The results indicated that the escape latency time significantly decreased in crocetin

treated rats, in comparison with control animals. Also, the percentage of time spent and traveled

distance in target quadrant on final test trial day increased in crocetin 8 mg/kg group, compared to

control group, while no difference was observed between groups in swimming speed. All behavioral

results confirmed by histopathological analysis.

Conclusion : In conclusion, treatment with crocetin could effectively prevent neuropathological

alterations in hippocampus and thereby resulting in improvement of spatial learning memory in rats

after chronic cerebral hypoperfusion.

Keywords : Cerebral hypoperfusion, Crocetin, Morris water, maze, Saffron


24

Cytotoxic and Apoptotic Activity of Scrophularia amplexicaulis in MCF-7

Human Breast Cancer Cells

Samira Valiyari* Department of Medical Biotechnology, Pasteur Institute of Iran

Saeid Yaripour Department of Drug and Food Control, Faculty of Pharmacy, Tehran

University of Medical Sciences, Tehran, Iran.

Fateme Zare Shahneh Immunology Research Center, Tabriz University of Medical Sciences

Behzad Baradaran Immunology Research Center, Tabriz University of Medical Sciences

Abbas Delazar Drug Applied Research Center, Tabriz University of Medical Sciences


Introduction : Breast cancer is the most common cancer in women. Therefore, there is an urgent

need to identify and develop therapeutic strategies against this deadly disease. This study is the first

to investigate the cytotoxic and apoptotic effects of Scrophularia amplexicaulis in MCF-7 human

breast cancer cells

Materials and methods : Three extracts of Scrophularia amplexicaulis including the n-hexane,

dichloromethane and methanol extracts were examined. MTT and Trypan-blue assays were

performed in MCF-7 cells as well as control cell line MCF10A to analyze the cytotoxic activity of the

plant. Further, the apoptosis inducing action of extracts of the plant was evaluated using cell death

ELISA and TUNEL assay.

Results : The results showed that dichloromethane and methanol extracts significantly inhibited cell

growth and viability without inducing damage to MCF10A cells. Cell death ELISA and morphological

changes of cells in TUNEL assay showed that the induction of apoptosis was the main mechanism of

cell death.

Conclusion : Our results strongly suggest that this plant may contain potential bioactive

compound(s) for the treatment of breast cancer.

Keywords : Scrophularia amplexicaulis, cytotoxic, MCF-7 cells, apoptosis, anticancer, breast cancer


25

RNA-binding protein Rbm47 binds to Nanog in mouse embryonic stem cells

Meghdad Yeganeh University of Tehran

Farnaz Akbari Kamrani Tehran University of Medical Sciences

Nasser Ghaemi University of Tehran

Ehsan Seyedjafari * University of Tehran


Introduction : Embryonic stem cells (ES cells) are pluripotent cells capable for self-renewal and to

differentiate to all cell types. Finding the molecular mechanisms responsible for these unique

characteristics of ES cells is important. RNA-binding proteins play important roles in post-

transcriptional gene regulation by binding to specific mRNA targets. In this study, we investigated

the targets of RNA binding protein Rbm47 in mouse ES cells.

Materials and methods : To this aim, we overexpressed HA epitope-tagged Rbm47 in mouse ES cells,

and then RNA-binding protein immunoprecipitation (RIP) was performed. For the RNA co-

immunoprecipitated with Rbm47, we did RT-PCR for Oct4, Sox2, and Nanog, which are the main

pluripotency factors.

Results : RT-PCR results show that Rbm47 binds to Nanog transcript in mouse ES cells and

doesnt bind to Sox2 and Oct4 transcripts in these cells.

Conclusion : This finding can give rise to reveal molecular mechanisms underlying pluripotency and

stemness of ES cells and will be necessary for efficient application of these cells in regenerative

medicine and tissue engineering.

Keywords : Embryonic stem cell, RNA binding protein, Rbm47, RIP


26

Codon optimization, cloning and expression of single-chain variable fragment

(scFv) antibody against CD22 in PichiaPastoris and optimization of Expression

conditions

Najmeh Zarei Pasteur Institute of Iran, Biotechnology Research Center

VahidKhalaj* Pasteur Institute of Iran, Biotechnology Research Center

BehruzVaziry Pasteur Institute of Iran, Biotechnology Research Center


Abstracts : The methylotrophic yeast Pichiapastoris has become a highly popular expression host

system for the recombinant production of a wide variety of proteins such as antibody fragments.

Single chain variable fragments (scFv) have many advantages over whole antibodies for use in

antibody-targeted immunotherapy due to their small size. CD22, a B-cell specific surface molecule, is

known to be up regulated in Non-Hodgkin's Lymphoma and other types of B-cell Lymphomas. To

treat B-cell Lymphomas, multiple approaches including CD22 specific antibodies have been

developed.

In this project, the methylotrophic yeast Pichiapastoriswas used to produce an anti-CD22 single

chain variable fragment, with the intention of conjugation to a radioisotope for therapeutic use. The

scFv gene was designed and synthesized by choosing the P.pastorispreferred codons while keeping

the G+C content at relatively low level. The full length gene cloned in the yeast vector, pPICZ and

expressed in P.pastoris strain GS115.SDS-PAGE and western blotting analysis of culture medium

from methanol-induced expression yeast clones demonstrated that the scFv was secreted into the

culture medium. To improve scFv production we examined parameters such as time, pH, methanol

concentration and cell density. Under optimized conditions (culture medium pH: 6-6.5, methanol

concentaratin:1%, induction time: 72 h)the yield of soluble recombinant scFv was approximately 22

mg/L. The recombinant protein was purified to greater than 95% purity using Ni-NTA column

chromatography. Flow cytometry, immunohistochemistry, and western blotting revealed that the

purified scFv could bind strongly to the membrane of CD22-positive cells, Raji cells, but not to CD22-

negative cells, Jurkat cells. These results suggest that anti CD22 scFv produced in P. pastoris is active

and specific toward CD22-positive cells and has potential for use in CD22-targeted immuonotherpy.

ssergnoC ygolonhcetoiB tnedutS lanoitanretnI dr3

72

ygolonhcetoiB larutlucirgA

1bbad

*naihcnahA mahlE ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

ibaltaM afatsoM ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

inamaZazer dammahoM ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

ihcbaruoJ tamsE ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

imorhaJsadahgom arhaZ ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

[email protected]*

:

1bbaD .

.

fBAD. AND BATC anailaht.A :

)GTTACACGGCAGAAGAAGTATTCTCGAGC( rBAD )CACGAGCTGCTAACTTCTGTAAGATCTCG(

. IBCN 1caS 1abX

. 2.1TEJp . RCP

. negorcaM AND . )1002( llessuR &koorbmaS

AND. esreverdrawrof 1bbad :

. rBADfBAD RCP 1bbad

. 336 AND RCP

RocE RCP. 2.1TEJp

. . V

. 1bbad

.

1bbad :

.

1bbad :


28

Transgenic expression and recovery of biologically active recombinant human

insulin from Arabidopsis thaliana seeds

BehnazHosseini* Shahidbahonar university of Kerman

GholamrezaSharifiSirchi** Shahidbahonar university of Kerman

*[email protected]

**:[email protected]

Abstract: The increased incidence of diabetes, coupled with the introduction of alternative delivery

methods that rely on higher doses, is expected to result in a substantial escalation in the demand for

affordable insulin in the future. Limitations in the production capacity and economics will make it

difficult for current manufacturing technologies to meet this demand. We have developed a novel

expression and recovery technology for the economical manufacture of biopharmaceuticals from

oilseeds. The production of therapeutic proteins in plant seed augments alternative production

platforms such as microbial fermentation, cell-based systems, transgenic animals, and other

recombinant plant production systems to meet increasing demands for the existing biologics, drugs

under evaluation, and undiscovered therapeutics in the future. A very useful tool in these endeavors

is the plant model system Arabidopsis thaliana. As a proof of concept for this technology, we have

produced recombinant human insulin in the model plant species Arabidopsis thaliana. In

PlantaTransformatin by Agrobactrium is a new, simple and low cost method for plant

transformation. This method applies successfully in Arabidopsis taliana and great attempts are done

in applying this method in other speciecs. In this research, kind of Inplanta transformation method

(Floral dip) was used for transformation of Arabidopsis plant. Agrobacterium strain, C58 containing

pjawhol III having insulin gene was used in this investigation. In this method, in Floral dip infiltration

method flowering plant dipped in the Agrobactrium culture. Seeds From infltrated Arabidopsis plant

were planted in ortder to select transformants in media containig 50 and 30 myl Kanamycin.

Recombinant insulin from transgenic Arabidopsis seeds was matured in vitro using trypsin and

further characterized by mass spectral analysis. Using our technology, we have demonstrated that

insulin can be expressed and recovered as an active molecule at commercially relevant levels from

transgenic seeds.

A. thaliana plants were transformed with the plant binary expression vector pJawhol III. Plant

derived insulin accumulates to significant levels in transgenic seed (0.13% total seed protein) and

can be enzymatically treated in vitro to generate a product with a mass identical to that of the

predicted product, DesB(30)-insulin. The biological activity of this product in vivo and in vitro was

demonstrated using an insulin tolerance test in mice respectively. The study demonstrates

bioequivalence of purified insulin from Arabidopsis seeds when compared with commercial insulin

products in an animal model. "Demand for insulin will continue to grow as the incidence of diabetes

increases

international student biotechnology congress

Documents