interaction of nuclear factors with multiple sites in the somatic

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 264, No. 24, Issue of August 25, pp. 14361-14368,1989 0 1989 by The American Society for Biochemistry and Molecular Biology. Inc. Printed in U.S.A.

Interaction of Nuclear Factors with Multiple Sites in the Somatic Cytochrome c Promoter CHARACTERIZATION OF UPSTREAM NRF-1, ATF, AND INTRON Sp l RECOGNITION SEQUENCES*

(Received for publication, May 1, 1989)

Mark J. Evans$ and Richard C. Scarpullas From the Department of Molecular Biology, Northwestern University Medical School, Chicago, Illinois 6061 1

The rat somatic cytochrome c promoter is resolved into a mosaic of cis-acting upstream and intron elements required for maximal activity. Mutations in each diminished cytochrome c promoter activity and eliminated the specific binding of cognate nuclear factors. Among these is the recognition sequence for a nuclear factor designated NRF-1 (nuclear respiratory factor 1) also found in the upstream regions of several other nuclear genes whose products function in the mito- chondria. The NRF-1 site was tightly coupled to a second functionally independent element (region I), and together these sites constitute a major determinant of cytochrome c expression. In addition to these novel sequence elements, the promoter also contained recognition sites for the common transcriptional activators ATF and Spl. A potent promoter element within the first intron consisted of two adjacent S p l binding sites. Point mutations in the first site eliminated the promoter activity of the element as well as Spl binding to both sites. An ATF recognition sequence in the upstream promoter was identical to an authentic cyclic AMP (CAMP) responsive element in stimulating promoter activity and in conferring a cAMP response upon a heterologous promoter. These promoter elements and their cognate nuclear factors likely contribute to the housekeeping function of cytochrome c and to the coordinate modulation of respiratory gene expression according to cellular energy demands.

The mitochondrial respiratory apparatus is the product of both nuclear and mitochondrial genomes. The nuclear genome, however, specifies the majority of respiratory proteins (reviewed in Refs. 1 and 2). Much of what is known about the coordinate regulation of nuclear respiratory gene expression comes from the study of the yeast Saccharomyces cerevisiae. In this facultative anaerobe physiological modulators of respiratory metabolism such as glucose, heme, and oxygen me- diate the transcriptional control of nuclear genes through specific cis- and trans-acting elements (3-8). Upstream acti- vation sites in the yeast cytochrome c genes have the prop-

* This work was supported by United States Public Health Service Grant GM32525 from the National Institutes of Health and by Research Grant 1-1128 from the March of Dimes Birth Defects Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section

erties of transcriptional enhancers and are the targets of multiple regulatory factors (9).

By contrast to yeast, little is known about the regulation of nuclear respiratory genes from any multicellular organism. Nevertheless, several observations suggest that in mammalian systems these genes are under both metabolic and develop- mental control. Coordinate expression of several proteins of the electron transport chain has been observed in response to various metabolic and physiological signals (10). Tissue-specific isoforms, that may provide alternative catalytic proper- ties or regulatory capabilities, have been described for cytochrome c ( l l ) , a number of cytochrome oxidase subunits (12), and the ADP/ATP translocase (13). In addition, expression of the somatic cytochrome c gene is under the control of thyroid hormones (14) which have well documented effects upon respiratory metabolism (15). Some nuclear-encoded mitochondrial genes may also be growth regulated. The mRNA levels for the ADP/ATP translocase increase when quiescent cells are stimulated by serum or purified growth factors in keeping with the increased energy demands of rapidly prolif- erating cells (16). The molecular mechanisms governing these isolated examples of regulated expression have not been ex- plored. Physiological effector molecules and the transcriptional regulatory elements that coordinate the expression of nuclear respiratory genes remain to be identified.

To investigate the regulation of this family of genes at the transcriptional level we have characterized rat (17) and human (18) cytochrome c genes. Maximal expression of the rat gene in transfected kidney cells depends upon at least three distinct promoter regions (19). Here we describe the interaction of protein factors with specific promoter sites upstream and within the first intron. One of these nuclear factors (NRF- 1)’ appears specific to the control of nuclear respiratory genes and may thereby provide a mechanism for coordinating the activities of nuclear and mitochondrial genetic systems.

EXPERIMENTAL PROCEDURES

Plasmid Construction-All RC4 promoter deletion mutants were derived from the vector pRC4CAT/-326 which is identical to the previously described vector pRC4CAT (19) except for the deletion of cytochrome c sequences upstream from -326. Linker insertion mutations at the AatII, SphI, or BssHII sites were constructed by converting 3’ or 5’ overhangs to blunt ends by treatment with T4 DNA polymerase or Klenow enzyme, respectively, followed by the addition of BamHI linkers. To construct clustered point mutations in the cytochrome c intron, an SphI-XbaI fragment containing cytochrome c sequences from -163 to +183 was cloned into M13, muta- genized by the method of Kunkel(20) using oligonucleotides contain-

1734 solely to indicate this fact. $ Supported by National Research Service Award Training Grant The abbreviations used are: NRF-1, nuclear respiratory factor 1;

GM08061 from the National Institutes of Health. RSV, Rous sarcoma virus; CRE, cAMP response element; VIP, vas- § To whom correspondence should be addressed. Tel.: 312-908- oactive intestinal peptide; CREB, cAMP response element binding

2946. protein.

14361

14362 Trans-activators of the Cytochrome c Gene in Animal Cells ing nucleotide mismatches, and recloned into the vector pRC4CAT. The plasmid pARSVCAT used in cAMP induction experiments was derived from the vector pRSVcat (21) and contains the Rous Sarcoma virus (RSV) strain SR-A promoter truncated at the EcoRI site 55 nucleotides upstream from the transcription initiation site and cloned into the polylinker region of the vector pGEM-4 blue. The RC4 ATF sequence from -281 to -256 was cloned into the EcoRI-Asp-718 sites upstream of this truncated RSV promoter (pARSVCAT+RC4ATF). This vector was compared to the positive control plasmid pVIP17CAT (22) containing the vasoactive intestinal peptide (VIP) cAMP response element (CRE) cloned upstream of this truncated RSV promoter. The RC4 -281/-256 oligonucleotide and a 27-base pair EcoRI fragment from pVIP17CAT containing the VIP CRE were individ- ually cloned in front of the RC4 promoter truncated at -215 to create the vectors pRC4CAT/-215+VIP and pRC4CAT/-215+RC4ATF. The 4xVIP element was constructed by ligating in tandem the 27- base pair EcoRI fragment from the vector pVIP17CAT. All deletion endpoints, site-directed mutations, and cloned oligonucleotide sequences were verified by sequence analysis. The human cytochrome c promoter sequences were determined on both strands by the dideoxy chain termination method (23).

Cell Culture and DNA Transfections-COS-1 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) bovine calf serum, penicillin (100 units/ml), and streptomycin (100 pglml). Cells seeded at a density of 2.0 X lo6 cells/lOO-mm dish were transfected the following day by the Capol method as described previously (19) except that a total of 20 pg of plasmid DNA was used per 100-mm plate. When less than 20 pg of test chloramphenicol acetyltransferase plasmid were assayed pGEM-4 blue plasmid was added up to 20 pg of total DNA. Forty-eight hours following transfection, cells from triplicate plates were harvested into 3 ml of phosphate- buffered saline. One-half of these pooled cells were used for preparation of cell lysates for chloramphenicol acetyltransferase assays and one-half were used for the preparation of low molecular weight DNA by the Hirt method (24) to normalize for transfection efficiency (25). Promoter activity values were the average of between two and seven separate transfections of three plates each. To measure cAMP induction of gene expression in transient assays, dishes were treated with forskolin (Sigma) to a final concentration of 10 p~ or ethanol vehicle following the glycerol shock.

RNA Isolation and Analysis-For analysis of forskolin stimulation of the endogenous cytochrome c gene, cells were plated as for transfection and stimulated by the addition of forskolin or ethanol vehicle the following day. At various times following this addition total RNA was prepared by the urea/LiCl method (26, 27). Equal amounts of RNA were analyzed for cytochrome c mRNA levels by RNase analysis (28) using an Sp6-generated anti-sense riboprobe containing part of the human cytochrome c large intron and second exon. The probe and 20 pg of RNA were hybridized for 12 h a t 45 "C in 40 mM piperazine-N,N'-bis(2-ethanesulfonic acid), pH 6.7, 0.4 M NaCI, 1 mM EDTA, 80% (v/v) formamide following a 5-min incubation at 85 "C. Following hybridization, 300 pl of 10 mM Tris, pH 7.5, 5 mM EDTA, 300 mM NaCl containing 15 pg/ml RNase A and 0.1 pg/ml RNase T1 was added. Following incubation at 15 "C for 1 h, the samples were treated with proteinase K followed by phenol/chloroform extraction and ethanol precipitation. Samples were electrophoresed on a 6% denaturing acrylamide gel.

Deoxyribonuclease (DNase) I Footprinting-Nuclear extracts were prepared from either COS-1 or HeLa cells by the method of Dignam et al. (29) and protein concentrations determined by the Bradford assay (30) using bovine serum albumin as a standard. Fragments were prepared from the vector pRC4CAT/-326 or its deletion derivatives by digestion with either EagI (to label the coding strand) or XhoI (to label the noncoding strand) and 3' end-labeled with [CP~'P]~NTPS using Klenow enzyme. Following digestion with a second restriction enzyme the labeled fragments were purified on a polyacrylamide gel and electroeluted. Binding reactions contained approximately 10 fmol of labeled fragment in a 50-pl volume of 25 mM Tris, pH 7.9, 6.25 mM MgCI2, 1 mM EDTA, 1 mM dithiothreitol, 50 mM KCI, 2% (w/v) polyvinyl alcohol, 0.3 pg of sonicated calf thymus DNA, 10% (v/v) glycerol plus the indicated concentrations of nuclear extract. After incubation on ice for 15 min and at room temperature for 3 min, 50 pl of 10 mM MgC12, 5 mM CaC12, and the appropriate amount of DNase I (5 ng for reactions without extract, 200 ng for reactions with 25 pg of extract) were added. Reactions were terminated 1 min later by the addition of 125 pl of 200 mM NaCI, 20 mM EDTA, 1% (w/v) sodium dodecyl sulfate, 250 pg/ml Escherichia coli tRNA and extraction with 25:24:1 phenol:chloroform:isoamyl alcohol. Following

ethanol precipitation the samples were electrophoresed on denaturing urea acrylamide gels. The oligonucleotide containing the E4 promoter region -63/-37 used as a competitor has been previously described (31). For competition experiments purified complementary oligonucleotides were annealed as described (32) and added with labeled fragment to the binding reaction prior to the addition of extract.

Footprinting with purified bacterial-synthesized Spl (a gift from J. Kadonaga, University of California, San Diego) was performed using a fragment containing RC4 sequences between -127 and +183 that was 3' end-labeled on the coding strand. Binding reaction buffer included 12.5 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 7.9, 6.25 mM MgCI2, 0.5 mM dithiothreitol, 10% (v/v) glycerol, 0.05% Nonidet P-40, and 50 mM KCI. Samples were treated with DNase I as above.

Mobility Shift Assays-Annealed oligonucleotides were 3' end- labeled with Klenow enzyme. Following phenol-chloroform extraction the labeled oligonucleotides were purified by passage through two Sephadex G-25 spin columns. Binding reactions contained 25 mM Tris, pH 7.9,6.25 mM MgC12, 0.5 mM EDTA, 50 mM KCI, 10% (v/v) glycerol, 15 fmol of labeled oligonucleotide, 4 pg of sonicated calf thymus DNA, and 15 pg of COS-1 nuclear extract in a 25 pl volume. After incubation a t room temperature for 20 min, the samples were electrophoresed on a 5% polyacrylamide gel (acrylamide:bis, 581) in 45 mM Tris, 45 mM boric acid, 1 mM EDTA (0.5 X TBE) at 200 V for 90 min. Gels were then dried for autoradiography.

RESULTS

Binding of Nuclear Factors from COS-1 and HeLa Cells Is Required for Maximal Cytochrome c Promoter Activity-Pre- vious transfection analysis of the rat somatic cytochrome c gene (RC4) in COS-1 cells (19) revealed two upstream promoter regions located between -191 and -165 (region I) and -139 to -84 (region 11). To detect nuclear proteins that bind to specific sequences in the upstream promoter of RC4, nuclear extracts from both COS-l and HeLa cells were tested for their ability to protect end-labeled DNA promoter fragments (-326 to -66) from digestion with DNase I. Two distinct areas of nuclease protection (DNase I footprints), one between -278 and -259 and the other between -167 and -149, were detected using extracts prepared from either cell line (Fig. 1). For simplicity we designate the -278/-259 sequence as the ATF site because of its similarity to known recognition sites for the ATF transcriptional activator (31).

1 2 3 4 5 6 7 8 91011121314

FIG. 1. DNase I footprinting of the rat somatic cytochrome c flanking DNA between -326 and -66. DNA fragments 3' end- labeled on the noncoding (lanes 1-7) or coding (lanes 8-14) strand were subjected to DNase I footprinting using 0.5, or 25 pg (indicated above each lane) of crude nuclear extract from either COS-1 or HeLa cells. For lanes 1-14, electrophoresis was performed using a 10% denaturing acrylamide gel. Lanes 1'-4' and 8'-I I ' contain the footprinting reactions identical to lanes 1-4 and 8-1 1 except that electrophoresis was carried out on a 5% denaturing gel. The G lanes contain Maxam-Gilbert G reactions of the labeled fragments. The brackets adjacent to the autoradiographs and the sequences enclose the region protected from DNase I digestion on each strand.

Trans-activators of the Cytochrome c Gene in Animal Cells 14363

Likewise we designate the -167/-149 sequence as the NRF- 1 (nuclear respiratory factor 1) recognition site because we observe similar sequences in the upstream regions of several other nuclear respiratory genes (see “Discussion”). Unlike the ATF site which was equally protected on both coding and noncoding strands, the NRF-1 site had a somewhat smaller footprint on the noncoding strand. Surprisingly, the ATF site was upstream from previously identified promoter regions and the NRF-1 site only partially overlapped with promoter region I (-191 to -165).

In part to identify functional promoter regions conserved between primates and rodents we recently isolated the human somatic cytochrome c gene (18). A comparison of human and rat 5”flanking regions (Fig. 2) reveals a high degree of overall sequence conservation along with several short stretches of absolute identity. For example a CCAAT box consensus sequence (referenced in Refs. 33 and 34) is perfectly conserved in promoter region I1 (-126 AGCCAAT -120) in the midst of otherwise weak conservation. A second conserved region I1 CCAAT box is also found in inverted orientation in the human sequence (-136/-132). The comparison also shows that the core sequences of both the ATF and NRF-1 site footprints are perfectly conserved. This conservation is particularly ev- ident with the ATF site which is located in a region of low similarity between the rat and human sequences. The phylo- genetic conservation of both sites is consistent with a functional role in controlling cytochrome c expression.

The failure to initially detect the contribution of ATF and NRF-1 sites to promoter activity by deletional analysis may have been a consequence of the assay conditions or the host cells used for transfection. For example, on high copy-number vectors the importance of cytochrome c promoter elements can be underestimated because of titration of the required trans-acting factors that interact with these elements (19). Transfection using high DNA concentrations may similarly minimize the effects of cis-acting mutations. Since the original promoter analysis was performed using 30 pg of transfected DNA, a series of deletion mutants that remove one or both of these sites was tested using either 0.5 or 20 pg of transfected DNA (Fig. 3A). When 20 pg of each construct was transfected into COS-1 cells, deletions removing the ATF site (-215), the NRF-1 site (-165/-139), or both (-215; -165/-139) were indistinguishable in their chloramphenicol acetyltransferase

. ITCTCCCGACAC) -250

. -215 . -200 A CG C A I---- G A A G A G GGGCCTGTCGTMGTGTCGGGCAAACGAGGCCTCTAGAGGAAGGGCGCCCTCTCGG ACA

I

I NRF-1 -100 II

GG G T T T CCG A T G C TGACATGCGGCTACGTCACGGCGCAGTGCCCGGCGCTGCCGCACGTCCGGCCGCGGGAGG

A G

I I G G G T

-50 C T T A A

GCAGMCMGTGTGGTTGCATTGACACCGGTACATAGGCGCGGGCCGGCGTGTCCTTGGG A

FIG. 2. Nucleotide sequence comparison of the rat and human somatic cytochrome e promoters. Nucleotide differences in the human 5”flanking region are shown above the rat sequence, with deletions indicated by dashes and insertions enclosed within parentheses. The start of transcription of the rat gene is defined as +l. The DNase I footprints at ATF and NRF-1 sites are underlined as are promoter regions I and 11.

CAT ACTIVITY RELATIVE

-320 1.00 1.00 - - 0.78 I.0E

0.44 1.12 - - 0.29 0.99

-105 -139

-215

-105 -139

Aa111-EamHl 0.64 -

I SphlgEwnHI 0.73 - I ’

I

0.23 - 1.10 - EssHII-EamHI

FIG. 3. Effects of mutations in ATF and NRF-1 sites on promoter activity and nuclear factor binding. A, the rat cytochrome c promoter is depicted schematically, including 5”flanking DNA (thin line), ATF and NRF-1 binding sites (open boxes), promoter regions I and I1 (underlined), and the first exon (filled box). Promoters containing deletions with the indicated endpoints or BarnHI linker insertions a t AatII, SphI, or BssHII sites were cloned into the chloramphenicol acetyltransferase (CAT) expression vector pRC4CAT. Either 20 pg of each chloramphenicol acetyltransferase vector or 0.5 pg of each chloramphenicol acetyltransferase vector plus 20 pg of pGEM-4 blue was transfected into COS-1 cells and analyzed for expression of chloramphenicol acetyltransferase activity. The chloramphenicol acetyltransferase activity produced by each vector was corrected for transfection efficiency by analysis of low molecular weight Hirt DNA and normalized to the value obtained with the promoter containing 326 nucleotides of upstream RC4 sequence. -, not determined. B, promoter fragments from the intact RC4 promoter (lanes 2 and 3 ) or from the mutated promoters containing a BarnHI linker insertion at the AatII site (lanes 4 and 5), the SphI site (lanes 6 and 7), both the AatII and SphI sites (lanes 8 and 9) , or the BssHII site (lanes 10 and 11) were 3’ end-labeled on the noncoding strand at position -326 and treated with DNase I in the absence (-) or presence (+) of 25 pg of COS-I nuclear extract. In the promoter containing the BarnHI linker inserted at the AatII site, the footprint at the NRF-1 site is shifted due to the presence of the extra linker sequences between the end-labeled position and the footprint. The G lane contains a Maxam-Gilbert G reaction of the intact promoter fragment.

activities from the wild-type promoter (-326). In contrast, when only 0.5 pg of DNA was used for transfection, a modest but significant reduction of chloramphenicol acetyltransferase activity was detected upon removal of either site alone. Dele- tion of both resulted in a nearly 4-fold reduction in chloramphenicol acetyltransferase activity compared to the wild-type promoter. Thus, the biological effects of deletion mutations removing ATF and NRF-1 sites are observed using low DNA concentrations for transfection.

To determine whether the level of promoter activity coin- cides with the specific interaction of nuclear proteins with these sites, a series of linker insertion mutations was constructed and assayed for both promoter function and nuclear factor binding (Fig. 3A). Disruption of either ATF or NRF-1 sites by insertion of a BamHI linker at the AatII or SphI restriction sites, respectively, diminished the promoter activity and abolished the DNase I footprints (Fig. 3B). Likewise, insertional disruption of both sites resulted in a more drastic reduction in promoter activity and the elimination of both footprints. A control construction with a BamHI insertion at the BssHII site downstream from the NRF-1 site had no effect upon either the promoter activity (Fig. 3A) or the DNase I footprint pattern (Fig. 3B). The activity values obtained with the linker insertion mutants were identical to those derived from the deletion mutants. Therefore, the specific interaction of nuclear factors with both ATF and NRF- 1 sites correlated with their biological activities.

The NRF-1 Site Is Functionally Distinct from Adjacent Promoter Region I-The close proximity of the NRF-1 site to the previously defined region I (-191/-165) and the inability

14364 Trans-activators of the Cytochrome c Gene in Animal Cells

to detect a nuclear factor binding to region I raised the possibility that its contribution to promoter activity may have resulted from indirect influences of NRF-1 binding. However, this interpretation is inconsistent with the observation that region I deletions substantially diminished promoter activity upon transfection a t high DNA concentrations (19) where the effects of NRF-1 site mutations are not observed. To delineate further the activity of region I from that of the NRF-1 site a series of deletions was assayed for promoter function (Fig. 4A). The 5’ deletion to -183 diminished activity relative to the full promoter because of removal of the ATF site. A deletion to -171 ends several nucleotides upstream from the NRF-1 footprint yet further diminished promoter activity, suggesting the 5’ boundary of a functional sequence was being affected. Deletions to -163 and -159 invading the 5’ end of the NRF-1 footprint further reduced activity. An internal mutation disrupting region I (/-326; -184/-163) lowered the level of activity, consistent with the 5’ deletion results yet did not disrupt the NRF-1 footprint (Fig. 4B). However, the footprint was slightly altered, extending to approximately -146 on the coding strand (compared to -149 with the intact promoter). A slightly larger deletion disrupting both region I and the NRF-1 site (/-326; -184/-158) had substantially less activity than the region I deletion alone confirming that NRF-1 stimulated the promoter containing the -183/-163 deletion. A small deletion of sequences distal to the NRF-1 site (/-326; -184/-171) had a somewhat larger effect than a similar small deletion proximal to this site (/-326; -171/ -163). Together these results support the existence of a distinct promoter element in region I with boundaries between -184 and -163.

To establish further the functional independence of these elements, synthetic oligomers containing region I, the NRF- 1 site or both were tested for their ability to stimulate the cytochrome c promoter deleted of sequences upstream from -66. An oligomer containing both region I and the NRF-1 site as defined by the above deletion analysis and footprinting (-187/-147) stimulated the -66 promoter nearly 450-fold (Fig. 5A). Oligomers containing only NRF-1 recognition sites

(-172/-147, -163/-151) were also able to stimulate the activity of the -66 promoter independently. The activities of the two NRF-1 oligomers were nearly identical confirming that a functional NRF-1 site resides between -163 and -151. Oligomers with their 5’ boundaries a t -187 but with different 3‘ boundaries (compare -187/-161 to -187/-166) both stimulated promoter activity over 30-fold confirming that region I contains a promoter site functionally distinct from the NRF- 1 site. The -187/-161 oligomer containing only region I failed to displace NRF-1 binding competitively (Fig. 5B). Those oligonucleotides with 5’ boundaries a t -179 (-179/-161, -179/-166) or a t -172 (-172/-161; -172/-166) were nearly inactive demonstrating a requirement for sequences between -187 and -179. Combined with the deletion analysis these results establish that region I contains a distinct promoter element between -184 and -166. The relative contributions of region I or NRF-1 sites to promoter activity remain the same regardless of whether the other is present.

In addition, in transfection experiments where the carrier plasmid DNA is replaced by an excess of plasmid having cloned tandem copies of the -172/-147 NRF-1 oligomer, chloramphenicol acetyltransferase activity is substantially reduced only in promoters with NRF-1 sites (Fig. 5A). This is consistent with the observation that the effects of NRF-1 site mutations were only detected upon transfection a t low DNA concentrations because of limiting amounts of factor. The ability to compete for NRF-1-dependent promoter activity in uiuo with an excess of NRF-1 sites in trans regardless of the presence of region I further confirms the independence of both sites. Therefore, the cytochrome c promoter between -183 and -151 contains two tightly linked but functionally independent cis-acting promoter elements.

The Cytochrome c Promoter Has a Functional Recognition Site for the ATF Transcriptional Activator-The 20-bp DNase I protected region between -278 and -259 contains the pal- indromic octamer sequence TGACGTCA in the center of the nuclear protein binding domain. This is a perfect match to the ATF transcription factor consensus sequence (35). To demonstrate that the DNase I footprint of the ATF site

A REGIOW I YRF-1

P R W T E R -200 . -150 DELETION

1-326

1-183

1-171

1-163

1-159

1-326;-184/-158

1-326;-184/-163

1-326;-184/-171

1-326:-1711-163

M G G G C G C C C T C T C W . T A C M C C T A C U T ~ T A ~ C C C G C A l G G

M G G G C G C C C T C T C G G T A C M C C T A C U l G C T A G C C C G U l G C C T T G C T A G C G

CctcgsCOLCUCCTACUTCCTAGCCCGUTGCGCGCG~CCTTGCTAGCG

CctCOLOGCTAGCCCCWTCCCCGCCCICCTT~TAGCG

ctcgs~UTGCCCCCCUCCTTGCTAGCG

CCtcOLgGCGCGCGUCCTTGCTA~G

MGGGCGCCCTCTCGGT gGggtcOLccCGCGCGUCCTlGCTA~G

MGGGCGCCCTCTCGGT OGUTGCGCGCGCACCTTCCTAGCG

MCGCCCCCCTCTCGCT ggggtCglgCCTACCCCCCATGCGCGCGUCCTTGCTAGCG

MGGGCGCCCTCTCGGTACMCCTACUTG gGUTGCGCGCGUCCTTGCTAGCC

1 .oo

0.56

0.23

0.13

0.06

0.10

0.33

FIG. 4. Resolution of region I and the NRF-1 site by mutational analysis. A , the first line shows the sequence of the cytochrome c 5”flanking region from -200 to -140. The previously determined boundaries of promoter region I and NRF-1 site (see text) are ouerlined. The sequence of each promoter deletion is shown with nucleotide differences present in linker sequences indicated with lower case letters. Each promoter deletion (0.5 pg of plasmid DNA) was analyzed for expression of chloramphenicol acetyltransferase (CAT) activity following transfection as described in Fig. 3. B, DNA fragments containing RC4 sequences between -326 and -66 from either the intact promoter or the -184/-163 deletion promoter were 3’ end-labeled on the coding strand and treated with DNase I in the absence (-) or presence (+) of 25 pg of COS nuclear extract. G, Maxam-Gilbert G reactions from each fragment; 4, the position of the -184/-163 deletion.

Trans-activators of the Cytochrome c Gene in Animal Cells 14365

A REGlOU I

OLIGO- -200 NRF-1 . -150

CAT A C T I V I T Y

R E L A T I M B SmEmJAL

NUCLEOTIDE MGGGCGCCCTCTCCCTACMCCTACCATGCTAGCCCGCATICCGCGCGCACCTTGCTAGCG {-172/-1471 - $! -187/-14r -187/-161 -179/-161 -172I-161 -187/-166 -179/-166 - In/ -166 -172/-147 -163/-151

CGGTACMCCTACCATGCTAGCCCGCATGCICCGCGCACCTT CGGTACMCCTACCATGCTAGCCCGCA

CCTACCATGCTAGCCCGCA

TGCTAGCCCGW

CCCTACMCCTACCATGCTAGC CCTACCATGCTAGC

TGCTAGC

TGCTAGCCCGCATCCCCGCGCACCTT GgtgGCATGCGCGCGCA

440 33

1.0

0.8 1.4

36 3.0

9.4 2.9

7.4

1.0 - a7 21 B U N D

NO NO

21

2.8 2.3

2.3

FIG. 5. Stimulat ion of the t runcated cytochrome c promote r by cloned region I and NRF-1 site oligonucleotides. A, synthetic oligonucleotides containing the indicated regions of the rat cytochrome c promoter (lower case letters denoting nucleotide changes) were cloned upstream of the RC4 promoter truncated a t position /-66 and assayed by transfection analysis using 0.5 pg of plasmid DNA with either 20 pg of pGEM-4 blue (-) or a plasmid containing four tandem RC4 NRF-1 oligonucleotides (-172/-147) used as carrier DNA. The chloramphenicol acetyltransferase (CAT) activity produced by the vector pRC4CAT/-66 lacking an inserted oligonucleotide was defined as 1.0 in each case. B, double-stranded DNA oligomer containing RC4 sequences between -172 and -147 was 3' end-labeled, incubated with no extract (-) or 15 pg of COS-1 nuclear extract (lanes 2 4 , and electrophoresed on a 5% acrylamide gel. Competitor oligonucleotides were added to binding reactions a t a 100-fold molar excess.

FIG. 6. Competit ion footprinting of t h e A T F site using an adenovirus ATF binding s i t e as a competitor. A DNA fragment containing the rat cytochrome c promoter from -326 to -66 was 3' end-labeled a t position -326 on the noncoding strand and treated with DNase I in the absence (lane 2) or presence (lanes 3-7) of 25 pg of COS nuclear extract. 20- and 100-fold molar excesses of oligonucleotides containing either RC4 sequences from -281 to -256 or adenovirus E4 sequences from -63 to -37 were included in the binding reaction as indicated above each lane.

resulted from ATF binding, a synthetic oligonucleotide duplex containing an authentic ATF site from the adenovirus 5 E4 promoter (-63 to -37) was compared to a synthetic oligomer from the RC4 ATF site (-281 to -256) in a competition assay. The only sequence common to both competitor molecules was the ATF consensus. Both oligonucleotides were efficient com- petitors of nuclear factor binding to the ATF site of the cytochrome c promoter (Fig. 6).

ATF has recently been suggested to be identical to the cAMP response element binding protein (CREB) which mediates cAMP stimulation of gene expression (36). To determine whether the somatic cytochrome c gene is stimulated by cAMP in COS-1 cells, total RNA was prepared a t various

1 2 4 a 12 24 36 48 a s E 2 """"

- + - + - + - + - + - + - + - + , n

432

108

FIG. 7. Effect of forskolin treatment on cytochrome c mRNA levels in COS-1 cells. COS-1 cells were treated with 10 pM forskolin (+) or ethanol vehicle (-) for various times (hours) after which total RNA was prepared by the urea/LiCI method. Cytochrome c mRNA levels in 20 pg of total COS RNA were quantified by RNase protection analysis using an Sp6-generated antisense riboprobe (432 nucleotides) containing a portion of the cytochrome c first intron and second exon. Properly spliced cytochrome c mRNAs should protect a 108-nucleotide probe fragment as indicated. Lanes 17 and 18 contained 20 pg of E. coli tRNA and were either treated with RNase ( tRNA ) or not digested (Probe).

times after treatment with forskolin to increase intracellular cAMP levels and assayed for cytochrome c mRNA levels by RNase protection (Fig. 7). No increase in cytochrome c mRNA levels was detected a t any time point following forskolin treatment. Similarly, the transfected RC4 promoter was not stimulated by forskolin (RC4/-326, Table I).

One explanation for these results is that the COS-1 cells were not responsive to elevated cAMP levels under these

14366 Trans-activators of the Cytochrome c Gene in Animal Cells TABLE I

The effect of forskolin treatment on cytochrome c and RSVpromoters containing either RC4 ATF or VIP CREB sites

Single oligonucleotides containing either the cytochrome c ATF binding site (RC4 ATF), the vasoactive intestinal peptide cAMP response element (VIP), or four tandem copies of the VIP oligonucleotide (4 X VIP) were cloned upstream of the indicated promoters. Each vector was assayed for expression of chloramphenicol acetyltransferase (CAT) activity either in the presence of 10 PM forskolin (+) or ethanol vehicle (-). RSV/-55 denotes the Rous sarcoma virus promoter truncated at position -55 from the transcription start site. RC4/-326 and RC4/-215 denote the rat cytochrome c promoter truncated at the indicated positions upstream of the transcription start site. The vector RSV-55/+42;RC4/+46 contains the RSV promoter truncated a t position -55 plus 42 nucleotides of the RSV first exon fused to the cytochrome c first exon at position +46. The chloramphenicol acetyltransferase activities of the parent vector for each series are defined as 1.0. Numbers in parentheses are the activities of each parent vector expressed in milliunits of chloramphenicol acetyltransferase activity per nanogram of vector DNA recovered from transfected cells. Because the RSV/-55 vectors contain SV40 sequences downstream of the chloramphenicol acetyltransferase coding region whereas the RC4 vectors contain cytochrome c sequences downstream of the chloramphenicol acetyltransferase gene, these two series of vectors cannot be compared directly. The final column (+/-) contains the ratio of chloramphenicol acetyltransferase activity produced by each vector in the presence of forskolin compared to ethanol vehicle. ND, not determined.

Relative CAT activity

oligonucleotide - Forskolin Parent promoter Cloned ATF

+ +/-

RC4/-326 RC4/-215

RSV/-55 RC4 ATF None

VIP 4 x VIP

None None RC4 ATF VIP 4 x VIP

RC4/+46 None 4 x VIP

RSV-55/+42;

1.0 (0.00074) 18 20 38

1.0 (6.0) 1.0 (2.4) 1.8 1.3 1.1

1.0 (0.0017) 8.9

1.7 1.7 62 3.5 84 4.2

580 15

1.4 1.4 1.5 1.5 2.5 1.4 1.5 1.2 1.4 1.3

ND 120 13

conditions. Alternatively, the ATF site is not a cAMP response element in the context of the cytochrome c promoter. To distinguish between these possibilities, the DNA oligomer containing the RC4 ATF site was cloned upstream in an RSV promoter vector containing only a TATA box. This allowed a direct comparison of the cAMP response of this site to a known cAMP responsive element from the vasoactive intestinal peptide gene (22) in an identical promoter context. Like the VIP construct, the RC4 ATF site enhanced the promoter activity of the RSV vector approximately 20-fold in transfected COS-1 cells (Table I). Both RC4 and VIP vectors also responded identically to forskolin treatment with a significant increase in promoter activity. In the converse experiment, cloning either the VIP or the RC4 ATF oligomers upstream of the RC4 promoter (/-215) did not result in an increase in basal activity or in its stimulation by forskolin treatment. Furthermore, the cloning of four VIP CREB sites in tandem (4xVIP) conferred an even greater cAMP response upon the RSV promoter but had no effect on the RC4 promoter when cloned at position -215. Therefore, the RC4 ATF binding site and the VIP CREB binding site behaved identically. Both sites functioned as a CAMP-responsive element in the context of the RSV promoter but neither could confer cAMP stimulation upon the RC4 promoter. When cytochrome c sequences upstream from + 46 were replaced with RSV promoter sequences from -55 to +42 the CAMP stimulation by the 4XVIP

element was indistinguishable from that observed with the RSV vector (Table I). These results indicate that the cAMP stimulation mediated by ATF recognition sites depends upon promoter context.

The Intron Promoter Element Contains Adjacent Spl Rec- ognition Sites-A third major determinant of promoter activity (region 111) was originally localized to 45 nucleotides (+71/ +115) within the first intron. This region contains two sequence homologies to the consensus S p l transcription factor binding site (37), a nine out of ten match at +83/+92 and a seven out of ten match a t +94/+103 (Fig. 8A). To further delineate the sequences responsible for promoter activity of this region a smaller deletion which removed both Sp l sites (+83/+100) was compared with the original mutation. Both the +71/+115 and the +83/+100 deletions resulted in a 20- fold reduction of activity (Fig. 8A) suggesting that the Spl consensus sequences contributed to promoter function. A series of clustered point mutations was also introduced throughout the region by site-directed mutagenesis. A mutant with a three-nucleotide disruption of the stronger Spl consensus at +83/+92 (SDM-1) had nearly the same effect on promoter activity as the deletions removing both Sp l sites. A more modest effect on activity was observed with the SDM-2 mutation changing four nucleotides within the adjacent Sp l sequence (+94/+103). Three nucleotide changes introduced either upstream from these sites (SDM-3) or between the sites (SDM-4) had no effect on the promoter activity. Thus, the Sp l consensus site between +83 and +92 was largely responsible for the promoter activity of intron region 111.

To confirm that Spl could recognize the intron promoter element, purified recombinant Sp l protein synthesized in E. coli (a gift from J. Kadonaga) was tested for binding by DNase I footprinting. An extended footprint between +83 and +lo3 was obtained with the wild-type promoter fragment indicating that both Spl consensus sites are protected by the purified factor (Fig. 8B). However, the SDM-1 mutation in the strong consensus site (+83/+92) eliminated the entire footprint while the SDM-2 mutation eliminated binding only to the weaker consensus site (+94/+103) without affecting the adjacent footprint. Thus, recognition of the +94/+103 sequence by Sp l did not occur in the absence of binding to the strong consensus site at +83/+92. These results are consistent with the relative contributions of the two sites to the promoter activity of the intron element.

DISCUSSION

The majority of gene products that specify mitochondrial function in mammals are encoded in the nuclear genome. The mitochondrial genome contributes only 13 polypeptide subunits of the respiratory complexes along with ribosomal and transfer RNAs of the mitochondrial translational system (1). Therefore, in addition to specifying most of the structural and catalytic components directly involved in energy metabolism, nuclear genes must also control mitochondrial transcription, translation, and replication. Despite the predominant role of the nuclear genome little is known about the regulation of nuclear respiratory genes or about the coordination of the nuclear and mitochondrial genetic systems in multicellular organisms. To serve as a model system, we have isolated mammalian genes for both the somatic (17, 18) and testis- specific (27) forms of cytochrome e. The promoter of the somatic gene was initially resolved into three broadly defined regions required for maximal activity in transfected kidney cells (19). Here we define specific promoter sites and begin to identify the nuclear factors with which they interact. The individual promoter elements determined by mutational map-


€3 P T ACTIVITY

RELATIVE

1.W

0.05

0.03

0.08

0.67

1.25

1.25

RC4 SON-1sou-2 Q O 1 3 0 1 3 0 1 3 "-

FIG. 8. Mutational analysis and Spl footprinting of the rat cytochrome c first intron. A, The sequence of the rat cytochrome c first intron is shown from the donor splice junction at +62 to position +120. The two homologies to consensus Spl binding sites are overlined with nucleotide mismatches underlined. Vectors (0.5 pg) containing the indicated deletions (dashes) and nucleotide substitutions (underlined lower case letters) were assayed for chloramphenicol acetyltransferase (CAT) expression by transfection analysis as described in Fig. 3. The chloramphenicol acetyltransferase activity produced by the parent plasmid pRC4CAT was defined as 1.0. B, 3' end-labeled DNA fragments containing sequences between -127 and +183 of the intact (RC4) or mutated (SDM- 1, SDM-2) cytochrome c promoter were subjected to DNase I footprinting using 0, 1, or 3 pi of purified bacterial- synthesized Spl (approximately 5 pg/ml) as indicated for each lane. The positions of the two intron sequence homologies to the Spl consensus binding site are marked by uertical bars. G, Maxam-Gilbert G reaction of the intact cytochrome c promoter fragment.

A T F l NRF-1 CREB CCAAT SPl

0 I I A A 1 t-( I l l

H M I II .

lOObp

FIG. 9. A schematic depiction of rat cytochrome c promoter elements defined by DNase I footprinting and mutational analysis. The location of promoter regions I, 11, and 111 and the positions of binding sites for the transcription factors ATF/CREB (open circle), NRF-1 (closed circle), and Spl (strong and weak binding sites indicated by large and small triangles, respectively) are indicated. Arrows show the positions of sequence matches to CCAAT transcription factor binding sites in region 11.

ping and DNase I footprinting are summarized in Fig. 9. A particularly interesting class of promoter elements may

serve to modulate cytochrome c expression in coordination with other nuclear genes that specify respiratory function. One candidate for an element of this type is the recognition site for a nuclear factor we designate as nuclear respiratory factor 1 (NRF-1). This upstream promoter site displays a strong DNase I footprint using nuclear extracts from a number of cell lines and tissues.* We also observe strong identities with similar sequences in the upstream regions of several recently isolated nuclear genes encoding mitochondrial gene products. The core of the NRF-1 footprint conserved between rat and human cytochrome c promoters has the sequence GCATGCGC. Matches to this sequence are found in the mouse mitochondrial RNA processing RNA gene (38; -289 GCACGCGC -282), the rat cytochrome c oxidase subunit VIc gene (39; +36 GCATGCGC +29; -36 GGATGCGC -29), and in the human cytochrome c1 gene (40; -446 GCACGCGC -439). Preliminary experiments suggest that most of these sequences compete for binding of NRF-1 to the cytochrome c promoter? The presence of an NRF-1 site in the mitochondrial RNA processing RNA gene is especially intriguing because it encodes the RNA moiety of a ribonucleoprotein endonuclease involved in generating primer RNAs for mitochondrial DNA replication (41,42). Coordinate control of this

* M. J. Evans and R. C. Scarpulla, unpublished work.

gene with genes for respiratory subunits through a common nuclear activator protein may provide an important mechanism for integrating the activities of nuclear and mitochondrial genetic systems.

A second promoter element was initially identified by transfection analysis in COS-1 and CV-1 cells as promoter region I (19) and has been further localized here to sequences between -184 and -166 (Fig. 9). This sequence, so far observed only in the somatic cytochrome c genes, is immediately adjacent to the NRF-1 recognition site. Specific interaction of a nuclear factor with region I has not yet been detected. Several lines of evidence establish the independence of region I and the NRF-1 site. Mutations in each sequence have a smaller effect on promoter activity than a mutation affecting both. Moreover, a mutation in region I diminished promoter activity but did not interfere with NRF-1 binding or NRF-l-dependent promoter activity. In addition, synthetic oligomers of each site function independently to stimulate the -66 promoter. Therefore, the region I and NRF-1 sites are independent determinants of cytochrome c gene expression and taken together have a potent stimulatory effect on promoter activity.

Because cytochrome c is required to meet the energy demands of all cells, a second class of promoter elements common to many nonrespiratory genes may generally contribute to the housekeeping function of cytochrome c. One such cis- acting element is a functional ATF recognition site located 270 nucleotides upstream from the transcription start site. Binding sites for ATF found in a number of viral and cellular genes (31, 35) are identical to the recognition sequence for the CREB transcription factor which mediates cAMP induction of gene expression (36, 43). In the context of the RSV promoter the RC4 ATF site was indistinguishable from a well characterized CRE from the VIP gene in stimulatingpromoter activity and conferring a response to CAMP. However, neither the transfected nor the endogenous cytochrome c promoter was responsive to cAMP induction in COS-1 cells. Moreover, four tandemly linked copies of the VIP CRE, which conferred a very strong cAMP response on the RSV promoter, were insufficient for cAMP induction when located upstream of the cytochrome c promoter truncated a t -215. The inability


to respond to cAMP appeared to reside in the cytochrome c promoter because a potent response to CAMP was observed when RC4 promoter sequences (-215/+46) were replaced with RSV sequences (-55/+42). I t is noteworthy in this context that the transcription factor AP-1 has been found to bind a consensus ATF site (44, 45) although CAMP stimulation is not mediated through AP-1 binding sites (46). In addition, ATF and AP-1 are immunologically cross-reactive and multiple forms of each have been found to copurify (44). Perhaps proteins interacting with the cytochrome c promoter in COS-1 cells influence whether ATF/CREB or AP-1 bind in vivo to the RC4 promoter. For example, it has been suggested that the binding specificity of multiple forms of nuclear factor 1 may be determined by the binding of other activator proteins to a given promoter (47). Although this RC4 element can function as an authentic recognition site for ATF/CREB and clearly influences basal cytochrome c promoter activity, the precise role of cAMP in regulating cytochrome c gene expression remains to be determined.

A second global transcriptional element that may in part account for the basal expression of cytochrome c in a variety of cell types resides in the first intron (Fig. 9). Functional promoter elements within an intervening sequence have been defined for only a few cellular genes (48-51). Here we show that two adjacent Sp l transcription factor binding sites account for the activity of the intron element. The strongest match to the Spl consensus contributes most to promoter activity and recognition of both sites by recombinant Spl purified from E. coli depends upon the integrity of this sequence. The correlation of in vitro binding with the activity of the transfected promoter mutants suggests that Spl is the factor which mediates the activity of the intron promoter element.

In summary, the control of cytochrome c expression in animal cells is mediated through interactions of nuclear factors with multiple promoter sites both upstream and within the first intron. Some of these (Spl and ATF) are common to many unrelated genes and may serve to integrate the expression of respiratory genes with those of other cellular metabolic systems. More importantly, others (NRF-1) may be specific to the coordinate control of nuclear respiratory genes. These may also serve to coordinate nuclear and mitochondrial genetic systems through the regulation of nuclear gene products required for mitochondrial transcription, translation, and replication.

Acknowledgments-We thank Gretchen Evans for excellent tech- nical assistance and the Northwestern University Biotechnology Fa- cilities for synthesis of oligonucleotides. We thank Dr. R. Goodman for the plasmid pVIP17CAT, Dr. J. Kadonaga for the purified bacterial Spl, Dr. B. Thimmappaya for the adenovirus E4 -63/-37 oligonucleotide, and Dr. L. Lau and J . Virbasius for critical comments.

REFERENCES 1. Attardi, G. (1985) Int. Reu. Cytol. 9 3 , 93-145 2. Hatefi, Y. (1985) Annu. Reu. Biochern. 5 4 , 1015-1069 3. Zitomer, R. S., Montgomery, D. L., Nichols, D. L., and Hall, B.

4. Laz, T. M., Pietras, D. F., and Sherman, F. (1984) Proc. Natl.

5. Guarente, L., Lalonde, B., Gifford, P., and Alani, E. (1984) Cell

6. Guarente, L., and Mason, T. (1983) Cell 32 , 1279-1286 7. Myers, A. M., Crivellone, M. D., Koerner, T. J., and Tzagoloff,

8. Trueblood, C. E., Wright, R. M., and Poyton, R. 0. (1988) Mol.

9. Guarent,e, L. (1987) Annu. Reu. Genet. 2 1 , 425-452

D. (1979) Proc. Natl. Acad. Sci. U. S. A. 76 , 3627-3631

Acad. Sci. U. S. A. 81,4475-4479

36,503-511

A. (1987) J. Bid. Chem. 262,16822-16829

Cell. Biol. 8 , 4537-4540

10. Williams, R. S., Garcia-Moll, M., Mellor, J., Salmons, S., and

Harlan, W. (1987) J. Biol. Chem. 2 6 2 , 2764-2767 11. Hennig, B. (1975) Eur. J. Biochem. 5 5 , 167-183 12. Kuhn-Nentwig, L., and Kadenbach, B. (1985) Eur. J . Biochem.

13. Houldsworth, J., and Attardi, G. (1988) Proc. Natl. Acad. Sci. U.

14. Scarpulla, R. C., Kilar, M. C., and Scarpulla, K. M. (1986) J.

15. Tata, J. R., Ernster, L., Lindberg, O., Arrhenius, E., Pederson,

16. Battini, R., Ferrari, S., Kaczmarek, L., Calabretta, B., Chen, S.,

17. Scarpulla, R. C. (1984) Mol. Cell. Biol. 4 , 2279-2288 18. Evans, M. J., and Scarpulla, R. C. (1988) Proc. Natl. Acad. Sci.

19. Evans, M. J., and Scarpulla, R. C. (1988) Mol. Cell. Bid. 8 , 35-

20. Kunkel, T. A. (1985) Proc. NatL Acad. Sci. U. S. A. 8 2 , 488-492 21. Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, I.,

and Howard, B. H. (1982) Proc. Natl. Acud. Sci. U. S. A. 7 9 , 6777-6781

22. Fink, J. S., Verhave, M., Kasper, S., Tsukada, T., Mandel, G., and Goodman, R. H. (1988) Proc. Natl. A c Q ~ . Sci. U. S. A . 8 5 ,

23. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74 , 5463-5467

24. Hirt, B. (1967) J. Mol. Biol. 2 6 , 365-369 25. Alwine, J. C. (1985) Mol. Cell. Biol. 5 , 1034-1042 26. Drubin, D. G., Caput, D., and Kirschner, M. W. (1984) J. Cell

27. Virbasius, J . V., and Scarpulla, R. C. (1988) J. Biol. Chem. 2 6 3 ,

28. Krieg, P. A., and Melton, D. A. (1987) Methods Enzymol. 155,

29. Dignam, J . D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic

30. Bradford, M. M. (1976) Anal. Biochem. 72 , 248-254 31. Lee, K. A. W., Hai, T.-Y., SivaRaman, L., Thimmappaya, B.,

Hurst, H. C., Jones, N. C., and Green, M. R. (1987) Proc. Natl. Acad. Sci. U. S. A. 8 4 , 8355-8359

32. Kadonaga, J. T., and Tjian, R. (1986)Proc. Natl. Acad. Sci. U. S.

33. Santoro, C., Mermod, N., Andrews, P. C., and Tjian, R. (1988)

34. Chodosh, L. A., Baldwin, A. S., Carthew, R. W., and Sharp, P. A.

35. Lin, Y.-S., and Green, M. R. (1988) Proc. Natl. Acad. Sci. U. S.

36. Hardy, S., and Shenk, T. (1988) Proc. Natl. Acad. Sci. U. S. A.

37. Kadonaga, J. T., Jones, K. A., and Tjian, R. (1986) Trends

38. Chang, D. D., and Clayton, D. A. (1989) Cell 5 6 , 131-139 39. Suske, G., Enders, C., Schlerf, A., and Kadenbach, B. (1988) DNA

40. Suzuki, H., Hosokowa, Y., Nishikimi, M., and Ozawa, T. (1989)

41. Chang, D. D., and Clayton, D. A. (1987) EMBO J. 6,409-417 42. Chang, D. D., and Clayton, D. A. (1987) Science 235 , 1178-1184 43. Roesler, W. J., Vandenbark, G. R., and Hanson, R. W. (1988) J.

44. Hai, T., Liu, F., Allegretto, E. A., Karin, M., and Green, M. R.

45. Nakabeppu, Y., Ryder, K., and Nathans, D. (1988) Cell 55,907-

46. Imagawa, M., Chiu, R., and Karin, M. (1987) Cell 5 1 , 251-260 47. Gil, G., Smith, J. R., Goldstein, J. L., Slaughter, C. A., Orth, K.,

Brown, M. S., and Osborne, T. F. (1988) Proc. Natl. Acad. Sci.

48. Gillies, S. D., Morrison, S. L., Oi, V. T., and Tonegawa, S. (1983)

49. Rossi, P., and De Crombrugghe, B. (1987) Proc. Natl. Acad. Sci.

50. Coulombe, B., Ponton, A., Daigneault, L., Williams, B. R. G., and

51. Reisman, D., Greenberg, M., and Rotter, V. (1988) Proc. Natl.

149,147-158

S. A. 85,377-381

Biol. Chem. 261,4660-4662

S., and Hedman, R. (1963) Biochem. J. 86,408-428

and Baserga, R. (1987) J. Biol. Chem. 262,4355-4359

U. S. A. 85,9625-9629

41

6662-6666

Bid. 9 8 , 1090-1097

6791-6796

397-415

Acids Res. 11 , 1475-1489

A. 83,5889-5893

Nature 334 , 218-224

(1988) Cell 5 3 , 11-24

A. 85,3396-3400

85,4171-4175

Biochem. Sci. 11,20-23

(N . Y.) 7 , 163-171

J. Biol. Chem. 264 , 1368-1374

Biol. Chem. 263,9063-9066

(1988) Genes Deu. 2, 1216-1226

915

U. S. A. 85,8963-8967

Cell 33 , 717-728

U. S. A. 84,5590-5594

Skup, D. (1988) Mol. Cell. Biol. 8,3227-3234

Acad. Sci. U. S. A. 8 5 , 5146-5150

interaction of nuclear factors with multiple sites in the somatic

Documents