MOLECULAR AND CELLULAR BIOLOGY, May 1987, p. 1807-1814 Vol. 7, No. 50270-7306/87/051807-08$02.00/0Copyright C 1987, American Society for Microbiology

Interaction between Two Different Regulatory Elements Activatesthe Murine oA-Crystallin Gene Promoter in Explanted

Lens EpitheliaANA B. CHEPELINSKY,* BERND SOMMER, AND JORAM PIATIGORSKY

Laboratory of Molecular and Developmental Biology, National Eye Institute, Bethesda, Maryland 20892

Received 30 October 1986/Accepted 9 February 1987

Previous experiments have indicated that 5' flanking DNA sequences (nucleotides -366 to +46) are capableof regulating the lens-specific transcription of the murine aA-crystallin gene. Here we have analyzed these 5'regulatory sequences by transfecting explanted embryonic chicken lens epithelia with different aA-crystali-CAT (chloramphenicol acetyltransferase) hybrid genes (aA-crystallin promoter sequences fused tothe bacterial CAT gene in the pSVO-CAT expression vector). The results indicated the presence of a proximal(-88 to +46) and a distal (-111 to -88) domain which must interact for promoter function. Deletionexperiments showed that the sequence between -88 and -60 was essential for function of the proximal domainin the explanted epithelia. A synthetic oligonucleotide containing the sequence between -111 and -84 activatedthe proximal domain when placed in either orientation 57 base pairs upstream from position -88 of theaA-crystaflin-CAT hybrid gene.

The lens crystallins are encoded by four major genefamilies (a, P, fy, and 8), which are expressed in the eyelenses of vertebrates. The expression of these genes istemporally and spatially regulated during development (forreviews, see references 4, 27, 46, and 47). a-Crystallin is thefirst crystallin to appear during lens differentiation in themouse (58). The a-crystallin gene family consists of the aA-and aB-crystallin genes. The aA-crystallin gene codes fortwo polypeptides (aA2 and aAins) which are produced byalternative RNA splicing (32, 33, 53). In previous experi-ments we demonstrated the presence of 5' flanking se-quences responsible for the transcription of the murineaA-crystallin gene. A DNA fragment containing 366 basepairs (bp) upstream from the cap site and 46 bp of exon 1 wasfused to the bacterial gene for chloramphenicol acetyltrans-ferase (CAT) (24). This aA-crystallin-CAT fusion gene wasexpressed specifically in lens cells when tested in transientexperiments with explanted chicken lens epithelia (7) andwith transgenic mice (44). Furthermore, the developmentalappearance ofCAT activity closely followed the appearanceof the endogenous aA-crystallin in transgenic mice (44).Whereas 366 bp of 5' flanking sequence of the murine

aA-crystallin gene promoted CAT gene expression, 88 bp of5' flanking sequence did not when the aA-crystalHin-CATfusion gene was introduced into explanted lens epithelia (7).These previous experiments suggested either that the se-quences responsible for the activation of this promoter arelocalized entirely in the region between nucleotides -366and -88 or that they must interact with sequences down-stream from -88. The present results support the latterhypothesis and map more precisely the two interactingregulatory elements of this lens-specific crystallin gene.

MATERIALS AND METHODSPlasmid constructions. All ligations were performed with

DNA fragments which were blunt ended with the Klenowfragment of DNA polymerase I and inserted into plasmidswhich were treated with alkaline phosphatase and blunt

* Corresponding author.

ended. In the construction with the synthetic oligonucleo-tide, the plasmid was phosphorylated. DNA fragments wereisolated by electroelution from polyacrylamide gels, andplasmids were purified as described previously (7).pa88CAT-N281a and pa88CAT-N281b were constructed

by BglII-AvaI digestion of pMaACrl800 (7) and isolation ofthe 281-bp fragment which was ligated to NdeI-digestedpaA88a-CAT (7). pa88CAT-N202a and pa88CAT-N202bwere constructed by EcoRI-AvaI digestion of pMaACrl800(7), isolation of the 202-bp fragment, and ligation to NdeI-digested paA88a-CAT (7). paA60a-CAT and paA66a-CATwere constructed by AvaI-BAL 31 nuclease-BamHI diges-tion of pMaACrl800 (7), electroelution of fragments ofapproximately 110 bp, and ligation to HindIII-digestedpSVO-CAT (24). pa66CAT-N202a and pa66CAT-N202bwere constructed by ligating the 202-bp (EcoRI-AvaI) frag-ment from pMaACrl800 (7) to NdeI-digested paA66a-CAT.pa60CAT-N202a was constructed by ligating the 202-bp(EcoRI-AvaI) fragment from pMaACrl800 (7) to NdeI-digested paA60a-CAT. paAllla-CAT was constructed byPvuII-BamHI digestion of pMaACrl800 (7), isolation of the157-bp fragment, blunt ending with the Klenow fragment ofDNA polymerase I, and ligation to HindIll-digested, blunt-ended, phosphatased pSVO-CAT (24) as described else-where (7). To construct pa88CAT-N26a and pa88CAT-N26b,the synthetic oligonucleotides 5'-OH-CTGCTGACGGTGCAGCCTCTCCCCCGAG3' and 5'-OH-CTCGGGGGAGAGGCTGCACCGTCAGCAG3' (OCS Laboratories, Inc.,Denton, Tex.) were hybridized and ligated to NdeI-digested,blunt-ended, phosphorylated pa88a-CAT (7) (see Fig. 4A).The subscripts a and b indicate that the aA-crystallin se-quences were inserted in the sense or antisense orientation,respectively, with respect to the original crystallin gene.

Constructions were sequenced by primer extension withthe following primers, as appropriate: 5'ACGCATCTGTGCGGTA3' (complementary to pBR322 sequence [14 nu-cleotides from the NdeI site and 71 nucleotides from theHindIII site in pSVO-CAT] [24]); 5'GCCTGCACAGAATGGA3' (complementary to murine aA-crystallin gene nu-cleotides -33 to -48); 5'CAACGGTGGTATATCCAGT

1807

1808 CHEPELINSKY ET AL.

20 40 60 80 100

-366Im d

AGATCTCTGG6AGTTTCGGAGCTCTGCAGAT6GCCTGCTAATCT6TGCCTACCTC

-287 r

p 4 s - o r Ppo

TCCCCACCTGTGAAACAGGGCTCTGAATTCTTCCTCCAAAGGAGGCCAGGAGGATGCCTCAGTACAATGTGGGAAGAAACAGTGATGTCCCTTGGCTCAAh n n

f s - m k - a b c - g

AGGATAAGGCTCTCCACAGACCTTCTTGGAGACATCTGGTCTGAGAGCCTCTGCTGCTCAGCGTGTGTTGCTGGGGCTGGCAGGSC6GGTGAGICATTCCAI

-111 -88 -66 -60 9 N f+Ik e-------- d

NWcd b

GCTGCTGACGGTGCAGCCTCTCCCCCGAGCTGAGCATAGACATTTTGGGAAATCCCTTAATTCCTCCATTCTGTGCAGGCA|^TTAGGGAGGGCTGGAAh n

+1 +46a ffi

CGCTAGCTCACCACCGCACTGCCCAGAGGCTCCTGTCTGACTCACT6CCASCCTTCGS*

FIG. 1. 5' Flanking DNA sequence of the murine aA-crystallin gene. This sequence contains additional 5' sequences and some correctionsto that previously published (32). The major transcription initiation site (asterisk), TATA box (solid-line box), sequence resembling theconsensus sequence of some viral enhancers (56) (broken-line box), alternating purines and pyrimidines (dashed under lines), and repeatedsequences (arrows labeled with the same letters) are indicated. In our constructs below, position +46 is followed by ATC before the CATgene sequence. The A comes from the constructed BamHI site (7).

G3' or 5'TAGCTCCTGAAAATCTCGCC3' (complemen-tary to the CAT gene sequence and either 46 to 66 nucleo-tides from the HindIlI site or next to the HindIII site,respectively, in the pSVO-CAT plasmid [24]). The primerswere hybridized to plasmids digested with restriction en-

zymes with one or multiple recognition sites and sequencedby the dideoxynucleotide method (51, 55) with a sequencingkit (New England BioLabs, Inc., Beverly, Mass.). In some

cases, the appropriate restriction fragment was sequencedby the Maxam and Gilbert method (38).

Plasmid paA364a-CAT (7) has been renamed potA366a-CAT, and paA87a-CAT (7) has been renamed paA88a-CAT,since we have made several corrections in our originalsequence (see Fig. 1). The numbers represent the base pairsof the aA-crystallin 5' flanking sequences upstream from thecap site fused to the CAT gene.

Restriction enzymes were from New England BioLabs or

from Bethesda Research Laboratories, Inc., Gaithersburg,Md. Klenow DNA polymerase I was from Boehringer Mann-heim Biochemicals, Indianapolis, Ind.; T4 DNA ligase andT4 polynucleotide kinase were from Pharmacia Inc.,Piscataway, N.J.; reverse transcriptase was from Seikagakuof America, St. Petersburg, Fla.; synthetic oligonucleotideswere from OCS; [ot-32P]dATP was from Amersham Corp.,Arlington Heights, Ill.; [y-32P]ATP was from ICN Pharma-ceuticals, Inc., Irvine, Calif.; ['4C]chloramphenicol was

from New England Nuclear Corp., Boston, Mass; and acetylcoenzyme A and actinomycin D were from Pharmacia Inc.Lens epithelia explants and transfection. Lens epithelia

from 14-day-old chicken embryos were explanted, cultured,and transfected as indicated before (7). In each case, sixexplants were precultured for approximately 20 h andtransfected with the specified plasmid DNA. Approximately65 h after transfection, the original explants were removedwith forceps under the microscope and homogenized (7).

CAT assays (24) were performed with the supernatant frac-tion as described previously (7). Each time point of CATactivity was determined from the supernatant fraction ofthree explants. Each experiment was performed at leasttwice, and the reproducibility of relative CAT activitieswithin each experiment was within 20%.RNA purification from explanted lens epithelia. Thir-

ty-eight explants were transfected with the indicated plasmidand approximately 48 h later were homogenized inguanidine-isothiocyanate and centrifuged through a cesiumchloride cushion as indicated by Chirgwin et al. (8). Thepellet was extracted with phenol-chloroform-n-butanol andwas ethanol precipitated.RNA purification from murine lenses. Lenses from 10-day-

old mice were homogenized in 0.1 M Tris hydrochloride (pH7.5)-12.5 mM EDTA-0.15 M NaCl. Either random-bredSwiss [N:NIH(s)] or the homozygous aA-crystallin-CATtransgenic mouse no. 7378 (44) strains were used. Cytoplas-mic RNA was purified by phenol-chloroform-isoamyl alco-hol extraction and ethanol precipitation.Primer extension. The oligonucleotide 5'CAACG

GTGGTATATCCAGTG3', which is complementary to theCAT gene 46 to 66 nucleotides from the HindIII site inpSVO-CAT (24), or the oligonucleotide 5'CAGGGCACGCTTGAACCAAG3', which is complementary to nucleo-tides +92 to +111 of the murine aA-crystallin gene (32), was5' end labeled with [y-32P]ATP and T4 polynucleotidekinase. Approximately 106 cpm (2.5 ng) of primer was addedto the RNA in 10 ,ul of 0.3 M KCl-10 mM Tris hydrochloride(pH 7.5)-l mM EDTA. The RNA was heated at 75°C for 5min and hybridized at 42°C for 25 min. Primers wereextended in 100 mM KCl-50 mM Tris hydrochloride (pH8.3)-0.33 mM EDTA-8 mM MgCl2-4 mM dithiothreitol-250,M deoxynucleoside triphosphates-0.1 ,ug of actinomycin Dper ,lI-1.7 U of reverse transcriptase per RI in 30 p1 at 37°C

MOL. CELL. BIOL.

MURINE aA-CRYSTALLIN GENE PROMOTER REGULATORY ELEMENTS

-366 -85 -88 +46

A pci88CAT-N281ba w 57p* p ax88CAT-N281 b

"~

-287 -8'5 -88 +46L i "cA~~~~~rT

* pa 88CAT-N202 a . 57 bpo pct88CAT-N202b 0

A 0 0 * U A

4* * *w -cm-Ac3

.* -cm-Ac,

I 1 4 1 1 0 *CM

10 20 30 40

MINUTES CAT ASSAYFIG. 2. Effect of insertional mutagenesis on the activation of CAT gene expression by the murine aA-crystallin 5' flanking sequence. (A)

Murine aA-crystallin sequences -366 to -85 or -287 to -85 inserted at the NdeI site of paA88a-CAT in the sense (a) or antisense (b)orientation. The murine aA-crystallin flanking or gene sequences (_) and the pBR322 sequence (-) are indicated. (B) Transient CATexpression in transfected chicken embryonic lens epithelia. Each time point corresponds to three explants. Inset: autoradiogram of thin-layerchromatography for 20- to 22-min CAT assay. paA366a-CAT (0) and paA88a-CAT (A) are indicated, and the other plasmids are defined inpanel A. Abbreviations: cm, chloramphenicol; cm-Acl and cm-Ac3, monoacetylated forms of chloramphenicol.

for 1 hour (18). Extended products were analyzed in a 10%acrylamide-8 M urea sequencing gel.

RESULTS

5' Flanking sequence of the murine atA-crystallin gene. Wemade several corrections to the partial sequence of the 5'flanking region of the aA-crystallin gene published earlier(32). The corrected sequence is shown in Fig. 1. Thecorrections increase the homology of the 5' flanking regionof the oaA-crystallin gene of mice and hamsters (53). Severalinteresting features of this sequence include the TATA box(located between nucleotides -26 to -31), two regions of atleast eight alternating purines and pyrimidines (underlined),several repeated stretches of 5 to 8 bp (arrows), and oneregion resembling the consensus sequence of some viralenhancers (26, 31, 56). The sequence does not contain a5'CCAAT3' box in either strand, as found in many eucary-otic promoters (3, 25, 39, 42, 57).

Functional analysis of the murine aA-crystaliin promoter.Our earlier studies showed that a DNA fragment containing366 bp upstream from the cap site functions in transfected

chicken lens epithelia. By contrast, a DNA fragment con-taining only 88 bp upstream from the cap site promotes CATgene expression very inefficiently, if at all, in the aA-crystallin-CAT fusion gene (7). We thus focused our atten-tion on the sequences between positions -366 and -88.DNA fragments containing sequence -366 to -88 or -287to -88 were inserted in both orientations into the vector thatcontains only 88 bp upstream from the cap site (paA88a-CAT) at the NdeI site. This site leaves 57 bp of pBR322DNA between the inserted fragment of the aA-crystallingene and position -88 of the caA-crystallin gene flankingsequence (Fig. 2A). Both fragments were able to activateCAT expression after transfection into the explanted lensepithelia, even with the presence of the 57-bp spacer (Fig.2B). It is interesting to note that both fragments functionedpreferentially when they were inserted in the same orienta-tion as in the original gene (pa88CAT-N281a and pa88CAT-N202a). Whereas the sequence from -287 to -85 was able toactivate the region from positions -88 to +46 of the aA-crystallin promoter at a distance of 57 bp (pa88CAT-N202a),it was not able to activate the fragment from positions -88 to+46 when placed 1,634 bp downstream of the cap site of the

A

B 60

50

z0

-J

0-

40

30

20

10

VOL. 7, 1987 1809

1810 CHEPELINSKY ET AL.

-287Apa88CAT-N202a

-287pai66CAT-N202a

pca6OCAT-N2028

B 40r

z0

LU

o-

30

20

10

-85 -88 *+46. 57hn 1

-85 -66 *+48. 57bD I I

-287 -6 5760a

10 20 30 40

MINUTES CAT ASSAYFIG. 3. Effect of deletions in the proximal domain on acA-crystallin promoter activity. (A) Diagram of constructions. Mouse aA-crystallin

flanking or gene sequences (_), the major transcription initiation site (*), pBR322 sequence ( ), and CAT gene (C) are indicated. (B)Transient CAT expression with constructions containing deletions in the aA-crystallin proximal domain. Each time point corresponds to threeexplants.

aA-crystallin-CAT fusion gene (data not shown). Thus, theactivating element is not functional unless quite close to itsoriginal position. These data suggested to us that the aA-crystallin promoter contains proximal (-88 to +46) anddistal (-88 to -287) domains, which interact when thepromoter is active.

Interaction between the proximal and distal elements of theaA-crystallin promoter. We next investigated the proximalelement of the murine aA-crystallin promoter to determinehow many 5' flanking nucleotides in the fragment frompositions -88 to +46 must interact with the distal activatingelement to express the aA-crystallin-CAT fusion gene in theexplanted lens epithelia. The constructs included the distalactivating element (fragment -287 to -85) placed 57 bpupstream from fragments containing positions -88 to +46(pa88CAT-N202a), -66 to +46 (poL66CAT-N202a), or -60 to+46 (pa60CAT-N202a) of the murine aA-crystallin promoter(Fig. 3A). Unless otherwise stated, the activating element(positions -287 to -85) was in the same orientation as in theoriginal gene.The relative activity of these constructs was compared

(Fig. 3B). The upstream activating element did not promoteCAT activity as effectively when 66 bp of 5' flankingsequence was present (po66CAT-N2028) as when 88 bp of 5'

flanking sequence was present (pa88CAT-N202a). When thedistal domain was inserted in the opposite orientation(pa66CAT-N202b), there was no detectable expression of theCAT gene (data not shown). Moreover, the distal elementfailed to promote CAT activity when positions -88 to -61

were deleted from the proximal domain (pa60CAT-N202a).These results indicate that the sequence between positions-60 and -88 is essential for promoter activity.Sequences from -84 to -111 activating the proximal ele-

ment. To map more precisely the distal element, a fragmentcontaining 111 bp upstream and 46 bp downstream from thecap site of the murine aA-crystallin gene was introduced intothe pSVO-CAT vector (24). This fragment promoted expres-sion of the CAT gene when inserted in the same orientationas in the original gene (paAllla-CAT) (Fig. 4C). Since thesequence from -88 to +46 promotes little if any CATactivity in our assay, the 23 bp between -111 and -88should contain the active element of the distal domain. Totest this possibility, a 28-bp synthetic oligonucleotide withthe sequence corresponding to -111 to -84 of the aA-crystallin gene was inserted into paA88a-CAT. A 57-bpspacer of pBR322 DNA was left between the 3' end of theoligonucleotide and position -88 of the caA-crystallin pro-moter (Fig. 4A and B). Regardless of its orientation, thesynthetic oligonucleotide activated the proximal region ofthe caA-crystallin gene promoter. These experiments demon-strate that the active sequence in the distal domain is locatedbetween nucleotides -111 to -85.

Transcription initiation site. Primer extension experimentswere conducted to determine whether transcription initiatedby the murine aA-crystallin promoter occurred at the samesite(s) in hybrid genes as the site(s) of occurrence in vivo inthe endogenous gene. Moreover, we also performed a primerextension experiment involving the lenses of a transgenic

I .101 I Lip . .

a I .,# 0W a I lw

2 Ut LMJ a --I- I

MOL. CELL. BIOL.

MURINE atA-CRYSTALLIN GENE PROMOTER REGULATORY ELEMENTS

B-111 * +46

pot111aCAT

-111-84 -88 * +46

pa88CAT-N26a 57bp

pa88CAT-N26b -

Nde I

1 1 185' CTGCTGACGGTGCAGCCTCTCCCCCGAG 3'

3 GACGACTGCCACGTCGGAGAGGGGCC 5'

40

30

LU~~~L)

20

10

PCa88CAT-N26a

A

10 20 30 40

MINUTES CAT ASSAY

FIG. 4. Synthetic oligonucleotide activating the murine aA-crystallin promoter in explanted lens epithelia. (A) Insertion of sequences-111 to -84 obtained by chemical synthesis into paA88a-CAT. (B) Diagram of constructions. aA-crystallin flanking and gene sequences(_), the pBR322 sequence (-), and aLA-crystallin transcription initiation site (*) are indicated. (C) Transient CAT gene expressiondetermined as indicated before (7). Each time point corresponds to three chicken lens epithelia explants.

mouse strain containing the aA-crystallin-CAT gene (44) totest whether integration of the fusion gene into the cellchromosome affected transcription initiation. The hybridgene in transgenic mice contained the sequence betweenpositions -366 and +46 of the murine aA-crystallin genefused to the CAT gene. A primer complementary to the CATgene (50 to 70 bases from the aA-crystallin-CAT junction)was used for the RNAs derived from the hybrid genes, anda primer complementary to exon 1 of the murine aA-crystallin gene (nucleotides +92 to +111) was used for theRNAs derived from the natural gene (see Materials andMethods). The results are shown in Fig. 5. Lanes 1 and 2show the primer-extended products of aA-crystallin mRNAfrom lenses of normal mice and of transgenic mice contain-ing the aA-crystallin-CAT gene, respectively. In thesecases, the primer was complementary to the aA-crystallingene coding sequence. There is one major initiation site(extended product, 111 nucleotides long) and one minorinitiation site (extended product, 114 nucleotides long) forthe aA-crystallin mRNA. The major initiation site corre-sponds to position + 1 of the gene in Fig. 1 and the minor onecorresponds to position -3.

The results with the CAT primer are shown in Fig. 5, lanes3 to 7. With this primer, the extended products should be 119and 122 nucleotides long if the initiation sites for transcrip-tion were at the same location in exon 1 in the normalaA-crystallin gene and the hybrid aA-crystallin-CAT gene.Two bands of expected length corresponding to initiationsites +1 and -3 were observed, indicating that the aA-crystallin promoter initiated transcription at the same sites inboth cases. RNA from lens epithelia transfected withpo88CAT-N26a (Fig. 5, lane 5) or poxAllla-CAT (lane 6)gave the same two extended products. Thus, the insertion offoreign sequences at position -88 does not affect the accu-racy of the initiation site directed by the mouse aA-crystallinpromoter. The primer-extended products derived from theplasmids, however, also showed several larger species. Thenature of these bands has not been established. The twoprincipal extended products with the CAT primer were notpresent when RNA was used from normal lenses lacking theotA-crystallin-CAT hybrid gene (lane 3) or from mock-transfected lens epithelia (lane 7). The result of a primerextension experiment with the CAT primer and lens RNAfrom transgenic mice containing the aA-crystallin-CAT gene

A

C

VOL. 7, 1987 1811

9

c

4

z00

Lc.4

Nc

151? CHEPELINSKY ET AL.

6 7

''lllCAT orime' --122.~~~~~~~~~~~~~~~~~....i..~~ ~~~"-9 -11l0

--90

-76

-67

FIG. 5. RNA analysis by primer extension. The autoradiogramprec,cnts data from primer extension with RNAs from the following>oaie>. L,anes: 1 and 3, wild-type mice lens; 2 and 4, otA-.lVstHfllin-CAT transgenic mice strain 7378 (44) lens; 5, plasmidn'>\SCl'l-N26,-transfected chicken lens epithelia; 6, plasmidAllI 1,,-CAT-transfected chicken lens epithelia; 7, mock-

rj-.insf'ected chicken lens epithelia. Lanes 1 and 2 show RNA (0.6 ,ug)c\Icnded with primer complementary to exon 1 of the aA-crystallin

-l: lanes 3 to 7 show RNA (50 ,ug) extended with primer)iiiplenmentary to the CAT sequence of the aA-crystallin-CAT

h% hi'di,ene. The lower and upper arrows on each side point to theiitnjior and minor extended products, respectively. The extendedrl0odiLltS on lanes 1 and 2 are 111 and 114 bases, and those on lanest L) ilric 119 and 122 bases. These lengths correspond to initiations+ lnd -3 in Fig. 1 (see text for further discussion). These

poHit)ons were determined in gels containing sequencing ladders. In.he -,el shown here, pBR322-MspI digestion fragments were used as

,iI/e Mnlrkers (indicated on right).

44) are shown in lane 4. Again, two products of these same

wizewere obtained. Thus, chromosomal integration of thishybrid gene did not affect its initiation site for transcription.

DISCUSSIONWc established previously that a DNA fragment contain-

ing 366 bp upstream and 46 bp downstream from the cap siteof the murine uA-crystallin gene has cis-acting regulatoryelements directing its lens tissue-specific expression (7, 44).lThe present results show that oaA-crystallin sequences be-tween nucleotides -366 and +46 still promote CAT gene

cxpiession when a 57-bp spacer is introduced at position-S8. (allowing us to define two separate regulatory elementsot the murine cxA-crystallin gene promoter (one distal, up-

stream from position -88, and one proximal, downstreamfrom position -88). Studies on the regulation of numerous

othcr eucaryotic genes have indicated that their promotersm-e aLctivated by an interaction between several controlclerments (2. 3. 10, 14, 17, 19-23, 52, 54, 57). A preliminaryreport also suggests the presence of two interacting domainsIor the function of the murine y2-crystallin gene promoter (S.ok. W. Stevens, M. Breitman, R. Gold, and L.-C. Tsui, J.

(cell Bliochem. Suppl. 1OD:121, 1986).

We have identified the sequence between positions -111and -84 in the distal element as critical for activation of theproximal element of the murine aA-crystallin promoter. It isinteresting that one regulatory sequence identified in the 5'flanking region of a chicken aA-crystallin promoter-8-crystallin hybrid gene, when tested in cultured lens cells ofmice (43), is different from the distal sequence and furtherupstream to that described for the murine otA-crystallingene. Although the 5' flanking sequences of the aA-crystallingene of the mouse and hamster are highly conserved, thechicken 5' flanking sequence is quite different from that ofthe other two species (42, 52). There are three 8-bp regionsof complete homology between mouse and chicken in theaA-crystallin promoter. One is in the mouse proximal do-main, positions -57 to -64 (5'GAAATCCC3'); one is in thedistal domain, -104 to -111 (5'CTGCTGAC3'); and one isfurther upstream, -129 to -136 (5'CTGGGCAG3').The distal regulatory element of the murine aA-crystallin

promoter was functional in either orientation when it wasrelatively close to its original site. Possibly a dyad ofsymmetry in the distal activating element (5'GC tACGGTGCAGC3') contributes to this orientation indepen-dence. Some regulatory proteins bind to DNA as dimersthrough a-helix domains that contact the major groove (seereferences 45 and 48). Interestingly, the distal elementappeared to function less efficiently when inverted andplaced several hundred base pairs upstream, as judged fromthe experiment in which the sequence between positions-85 and -287 was reversed. One possible explanation ofthis result is that sequences between positions -111 and-287 specifically interfered with promoter activity whensituated between the distal and proximal element. We do notknow whether promoter efficiency would also be reduced ifthe distal element (-111 to -88) were placed in its originalorientation at a comparable position upstream. However,dependence upon distance and orientation has been ob-served for regulatory elements of other genes (1, 6, 9, 15, 16,21, 35, 41), and it has been suggested that the ability tofunction in one or both orientations may be sequence depen-dent (6).The sequence of the 5' flanking region of the murine

aA-crystallin gene shows several interesting features withrespect to its ability to regulate gene expression. First, theproximal domain does not contain a classical 5'CCAAT3'box, which is present in many (3, 25, 39, 42, 57) but not all(30) eucaryotic genes transcribed by RNA polymerase II. Itis unlikely that either of the two CAT sequences at positions-78 to -76 and -72 to -70 (which occupy generally similarpositions as the CCAAT boxes in other genes) acts as atypical CCAAT box, since it has been shown for the murinemajor 3-globin gene (42) and for the herpes simplex virusthymidine kinase gene (25) that a single base change in thepentanucleotide 5'CCAAT3' severely lowers transcription.Nonetheless, the present experiments indicate that thisregion (positions -88 to -60) is a critical, functional stretchof the proximal element of the murine aA-crystallin pro-moter. We do not know whether the murine aA-crystallinpromoter interacts with a member of the CCAAT-bindingproteins (25, 39) or with another, different trans-actingfactor. It is interesting to note that among the crystallins, aclassical CCAAT box is found only in the chicken 81-crystallin gene (5, 28) and is absent from either strand of the5' flanking region of the chicken 82-crystallin gene (5); themurine (present study), chicken (43), and hamster (53)aA-crystallin gene; the hamster aB-crystallin gene (49); therat ,B1-crystallin gene (13); the human ,A3/A1-crystallin

MOL. CELL. BIOL.

MURINE aA-CRYSTALLIN GENE PROMOTER REGULATORY ELEMENTS

gene (29); and the murine (36, 37), rat (12), and human (11,40) -y-crystallin genes.

Finally, there are other sequences of possible interestwithin the proximal and distal domains of the murine aA-crystallin promoter. One of these comprises the three A andT stretches present between positions -51 and -71; dA.dTregions have been reported to be involved in DNA bending(34). It is also possible that the alternating purine andpyrimidine stretches in the distal or proximal domain have aregulatory role. Alternating purines and pyrimidines arefound in Z DNA and may affect DNA function (50). Lastly,the 5 to 8 bp which are repeated in the proximal and distaldomains or those which are repeated within the distaldomain may deserve further attention.

ACKNOWLEDGMENTS

We thank Azriel Schmidt for useful suggestions on RNA purifi-cation, Paul F. Lambert for help in the sequencing, and DawnChicchirichi for typing the manuscript.Bernd Sommer is grateful to Deutscher Akademischer Austausch-

dienst, Sonderprogram Gentechnologie and to Alcon Laboratories,Inc. (award to Joram Piatigorsky) for support during the course ofthis work.

LITERATURE CITED1. Ares, M., M. Mangin, and A. L. Weiner. 1985. Orientation-

dependent transcriptional activator upstream of a human U2snRNA gene. Mol. Cell. Biol. 5:1560-1570.

2. Bergman, Y., D. Rice, R. Grosschedl, and D. Baltimore. 1984.Two regulatory elements of immunoglobulin K light chain geneexpression. Proc. Natl. Acad. Sci. USA 81:7041-7045.

3. Bienz, M., and H. R. B. Pelham. 1986. Heat shock regulatoryelements function as an inducible enhancer in the Xenopushsp70 gene and when linked to a heterologous promoter. Cell45:753-760.

4. Bloemendal, H. 1982. Lens proteins. Crit. Rev. Biochem. 12:1-38.

5. Borras, T., J. M. Nickerson, A. B. Chepelinsky, and J.Piatigorsky. 1985. Structural and functional evidence for differ-ential promoter activity of the two linked -crystallin genes inthe chicken. EMBO J. 4:445-452.

6. Boulet, A. M., C. R. Erwin, and W. J. Rutter. 1986. Cell-specificenhancers in the rat exocrine pancreas. Proc. Natl. Acad. Sci.USA 83:3599-3603.

7. Chepelinsky, A. B., C. R. King, P. S. Zelenka, and J.Piatigorsky. 1985. Lens-specific expression of the chloramphen-icol acetyltransferase gene promoted by 5' flanking sequences ofthe murine aA-crystallin gene in explanted chicken lens epithe-ha. Proc. Natl. Acad. Sci. USA 82:2334-2338.

8. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J.Rutter. 1979. Isolation of biologically active ribonucleic acidfrom sources enriched in ribonuclease. Biochemistry 18:5294-5299.

9. Ciliberto, G., L. Dente, and R. Cortese. 1985. Cell-specificexpression of a transfected human a1-antitrypsin gene. Cell41:531-540.

10. Cohen, R. S., and M. Meselson. 1985. Separate regulatoryelements for the heat-inducible and ovarian expression of theDrosophila hsp26 gene. Cell 43:737-746.

11. den Dunnen, J. T., R. J. M. Moormann, F. P. M. Cremers, andG. G. Schoenmakers. 1985. Two human -y-crystallin genes arelinked and riddled with Alu-repeats. Gene 38:197-204.

12. den Dunnen, J. T., R. J. M. Moormann, N. H. Lubsen, andJ. G. G. Schoenmakers. 1986. Concerted and divergent evolu-tion within the rat -y-crystallin gene family. J. Mol. Biol. 189:37-46.

13. den Dunnen, J. T., R. J. M. Moormann, N. H. Lubsen, andJ. G. G. Schoemmakers. 1986. Intron insertions and deletions inthe 3/-y-crystallin gene family: the rat PB1 gene. Proc. Natl.Acad. Sci. USA 83:2855-2859.

14. Derse, D., and J. W. Casey. 1986. Two elements in the bovineleukemia virus long terminal repeat that regulate gene expres-sion. Science 231:1437-1440.

15. Deschamps, J., F. Meulink, and I. M. Verma. 1985. Identifica-tion of a transcriptional enhancer element upstream from theproto-oncogene fos. Science 230:1174-1177.

16. Dynan, W. S., and R. Tjian. 1985. Control of eukaryoticmessenger RNA synthesis by sequence-specific DNA bindingproteins. Nature (London) 316:774-778.

17. Edlund, T., M. D. Walker, P. J. Barr, and W. J. Rutter. 1985.Cell-specific expression of the rat insulin gene: evidence for roleof two distinct 5' flanking elements. Science 230:912-916.

18. Eisenberg, S. P., D. M. Coen, and S. L. McKnight. 1985.Promoter domains required for expression of plasmid-bornecopies of the herpes simplex virus thymidine kinase gene invirus-infected mouse fibroblasts and microinjected frog oocytes.Mol. Cell. Biol. 5:1940-1947.

19. Falkner, F. G., and H. G. Zachau. 1984. Correct transcription ofan immunoglobulin k gene requires an upstream fragment con-taining conserved sequence elements. Nature (London) 310:71-74.

20. Foster, J., J. Stafford, and C. Queen. 1985. An immunoglobulinpromoter displays cell-type specificity independently of theenhancer. Nature (London) 315:423-425.

21. Garcia, J. V., L. Bich-Thuy, J. Stafford, and C. Queen. 1986.Synergism between immunoglobulin enhancers and promoters.Nature (London) 322:383-385.

22. Gluzman, Y. (ed.). 1985. Eukaryotic transcription. The role ofcis- and trans-acting elements in initiation. Current communi-cations in molecular biology. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

23. Gopal, T. V., T. Shimada, A. W. Baur, and A. W. Nienhuis.1985. Contribution of promoter to tissue-specific expression ofthe mouse immunoglobulin kappa gene. Science 229:1102-1104.

24. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982.Recombinant genomes which express chloramphenicol acetyl-transferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051.

25. Graves, B. J., P. F. Johnson, and S. L. McKnight. 1986.Homologous recognition of a promoter domain common to theMSV LTR and the HSV tk gene. Cell 44:565-576.

26. Gruss, P. 1984. Magic enhancers? DNA 3:1-5.27. Harding, J. J., and M. J. C. Crabbe. 1984. The lens: develop-

ment, proteins, metabolism and cataract, p. 207-440. In H.Davson (ed.), The eye: vegetative physiology and biochemistry,vol. 1B. Academic Press, Inc., New York.

28. Hayashi, S., H. Kondoh, K. Yasuda, G. Soma, Y. Ikawa, andT. S. Okada. 1985. Tissue-specific regulation of a chicken&crystallin gene in mouse cells: involvement of the 5' endregion. EMBO J. 4:2201-2207.

29. Hogg, D., L.-C. Tsui, M. Gorin, and M. L. Breltman. 1986.Characterization of the human -rystallin gene Hu,A3/A1reveals ancestral relationships among the fry-crystallin super-family. J. Biol. Chem. 261:12420-12427.

30. Jaynes, J. B., J. S. Chamberlai, J. N. Buskln, J. E Johnson,and S. D. Ha 1986. Transcriptional regulation of themuscle creatine kinase gene and regulated expression intransfected mouse myoblasts. Mol. Cell. Biol. 6:2855-2864.

31. Khoury, G., and P. Gruss. 1983. Enhancer elements. Cell33:313-314.

32. King, C. R., and J. Piatigorsky. 1983. Alternative RNA splicingof the murine xA-crystallin gene: protein-coding informationwithin an intron. Cell 32:707-712.

33. King, C. R., and J. Piatigorsky. 1984. Alternative splicing ofaA-crystallin RNA: structural and quantitative analyses of themRNAs for the aA2- and cuAVs-crystallin polypeptides. J. Biol.Chem. 259:1822-1826.

34. Koo, H., H. Wu, and D. M. Crothers. 1986. DNA bending atadenine-thymine tracts. Nature (London) 320:501-506.

35. Laimins, L. A., P. Gruss, R. Pozzatti, and G. Khoury. 1984.Characterization of enhancer elements in the long terminalrepeat of Moloney murine sarcoma virus. J. Virol. 49:183-189.

36. Lok, S., M. L. Breitman, A. B. Chepelinsky, J. Piatigorsky,R. J. M. Gold, and L.-C. Tsui. 1985. Lens-specific promoter

1813VOL. 7, 1987

1814 CHEPELINSKY ET AL.

activity of a mouse y-crystallin gene. Mol. Cell. Biol.5:2221-2230.

37. Lok, S., L.-C. Tsui, T. Shinohara, J. Piatigorsky, R. J. M. Goid,and M. Breitman. 1984. Analysis of the mouse -y-crystallin gehefamily: assignment of multiple cDNAs to discrete genomicsequences and characterization of a representative gene. Nu-cleic Acids Res. 12:4517-4529.

38. Maxam, A. M., and W. Gilbert. 1977. A new method forsequencing DNA. Proc. Natl. Acad. Sci. USA 74:560-564.

39. McKnight, S., and R. Tjian. 1986. Transcriptional selectivity ofviral gene in mammalian cells. Cell 46:795-805.

40. Meakin, S. 0., M. L. Breitman, and L.-C. Tsui. 1985. Structuraland evolutionary relationships among five members of thehuman y-crystallin gene family. Mol. Cell. Biol. 5:1408-1414.

41. Mercola, M., J. Goverman, C. Mirell, and K. Calame. 1985.Immunoglobulin heavy-chain enhancer requires one or moretissue-specific factors. Science 227:266-270.

42. Myers, R. M., K. Tilly, and T. Maniatis. 1986. Fine structuregenetic analysis of a 3-globin promoter. Science 232:613-618.

43. O i, K., K. Yasuda, H. Kondoh, and T. S. Okada. 1985.DNA sequences responsible for the tissue-specific expression ofa chicken a-crystallin gene in mouse lens cells. EMBO J.4:2589-2595.

44. Overbeek, P. A., A. B. Chepelinsky, J. S. Khiflan, J. Piatigorsky,and H. Westphal. 1985. Lens-specific expression and develop-mental regulation of the bacterial chloramphenicol acetyltrans-ferase gene driven by the murine aA-crystallin promoter intransgenic mice. Proc. Natl. Acad. Sci. USA 82:7815-7819.

45. Pabo, C. O., and R. T. Sauer. 1984. Protein-DNA recognition.Annu. Rev. Biochem. 53:293-321.

46. Piatigorsky, J. 1984. Lens crystallins and their gene families.Cell 38:620-621.

47. Piatigorsky, J. 1987. Gene expression and genetic engineering inthe lens. Invest. Ophthalmol. Visual Sci. 28:9-28.

48. Ptashne, M. 1986. A genetic switch. Gene control and phage K.Blackwell Scientific Publications, Ltd., Oxford.

49. Quax-Jeuken, Y., W. Quax, G. van Rens, P. M. Khan, and H.Bloemendal. 1985. Complete structure of the aB-crystallin gene:conservation of the exon-intron distribution in the twononlinked a-crystallin genes. Proc. Natl. Acad. Sci. USA 82:5819-5823.

50. Rich, A., A. Nordheim, and A. H. J. Wang. 1984. The chemistryand biology of left-handed Z-DNA. Annu. Rev. Biochem.53:791-846.

51. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 71:5463-5467.

52. Struhl, K. 1982. The yeast his3 promoter contains at least twodistinct elements. Proc. Natl. Acad. Sci. USA 79:7385-7389.

53. van den Heuvel, R., W. Hendricks, W. Quax, and H.Bloemendal. 1985. Complete structure of the hamster oaA-crystallin gene: reflection of an evolutionary history by means ofexon shuffling. J. Mol. Biol. 185:273-284.

54. Voss, S. D., U. Schiokat, and P. Gruss. 1986. The role ofenhancers in the regulation of cell-type-specific transcriptionalcontrol. Trends Biochem. Sci. 11:287-289.

55. Wallace, R. B., M. J. Johnson, S. V. Suggs, K. Miyoshi, R.Bhatt, and K. Itakura. 1981. A set of synthetic oligodeoxy-ribonucleotide primers for DNA sequencing in the plasmidvector pBR322. Gene 16:21-26.

56. Weiher, H., M. Konig, and P. Gruss. 1983. Multiple pointmutations affecting the simian virus 40 enhancer. Science 219:626-631.

57. Wu, B. J., R. E. Kinston, and R. I. Morimoto. 1986. HumanHSP70 promoter contains at least two distinct regulatory do-mains. Proc. Natl. Acad. Sci. USA 83:629-633.

58. Zwann, J. 1983. The appearance of a-crystallin in relation to cellcycle phase in the embryonic mouse lens. Dev. Biol. 96:173-181.

MOL. CELL. BIOL.