Vol. 174, No. 17JOURNAL OF BACTERIOLOGY, Sept. 1992, p. 5584-55920021-9193/92/175584-09$02.00/0Copyright © 1992, American Society for Microbiology

Site-Specific Integration of the Temperate Bacteriophage fadh intothe Lactobacillus gasseni Chromosome and Molecular

Characterization of the Phage (attP) andBacterial (attB) Attachment Sitest

R. R. RAYA,' C. FREMAUX,1 G. L. DE ANTONI,1 AND T. R. KLAENHAMMERl.2*Departments ofMicrobiology2 and Food Science and Southeast Dairy Foods Research Center,1

North Carolina State University, Raleigh, North Carolina 27695-7624

Received 22 April 1992/Accepted 7 July 1992

The temperate bacteriophage +adh integrates its genome into the chromosomal DNA ofLactobaciUus gasseriADH by a site-specific recombination process. Southern hybridization analysis of BclI-digested genomic DNAfrom six relysogenized derivatives of the prophage-cured strain NCK102 displayed phage-chromosomaljunction fragments identical to those of the lysogenic parent. The +adh attachment site sequence, attP, waslocated within a 365-bp EcoRI-HindIII fragment of phage 4adh. This fragment was cloned and sequenced.DNA sequence analysis revealed striking features common to the attachment sites of other site-specificrecombination systems: five direct repeats of the sequence TGTCCCTTTT(C/T) and a 14-bp inverted repeat.Oligonucleotides derived from the sequence of the aftP-containing fragment enabled us to amplify predictedjunction fragment sequences and thus to identify attL, attR, and attB. The core region was defined as the 16-bpsequence TACACTTCTTAGGAGG. Phage-encoded functions essential for site-specific insertion of phage+adh were located in a 4.5-kb BcII fragment. This fragment was cloned in plasmid pSA34 to generate theinsertional vector pTRK182. Plasmid pTRK182 was introduced into L. gassedi NCK102 by electroporation.Hybridization analysis showed that a single copy of pTRK182 had integrated at the attB site of the NCK102erythromycin-resistant transformants. This is the first site-specific recombination system described inlactobacilli, as well as the first attP-based site-specific integration vector constructed for L. gassed ADH.

Programmed DNA rearrangements mediated by site-spe-cific recombination are described in several biological phe-nomena, including, among others, integration and excisionof temperate bacteriophages (1, 4, 17, 19, 21, 42) andStreptomyces spp. plasmids (5, 6, 23, 25, 37) into chromo-somal DNA, DNA inversion controlling gene expression (12,36), control of plasmid amplification of the 2,um plasmid inSaccharomyces cerevisiae (9), dimer resolution and stablepropagation of phage P1 (2), and resolution of cointegratesstructures formed by transposons Tn3 and -yI (33). Thehallmarks of all of these site-specific recombination systemsare that DNA exchange occurs between two specialized,short DNA sequences and that general recombination func-tion(s) are not required.

Integrative recombination of phage lambda provides theclassical example of site-specific integration and excision ofa temperate bacteriophage (42). Extensive studies of thissystem have allowed the characterization of its componentsin great detail and definition of the mechanism and regula-tory circuits involved in the recombination process. Thisinformation provides a model which has facilitated thecharacterization of other genetic elements encoding site-specific recombination systems.Lysogeny within the gram-positive, rod-shaped lactoba-

cilli has been extensively reported (10, 31). However, dem-onstration of classical lytic and lysogenic cycles of replica-tion have been limited to the phages PL-1 (40), 4)FSW (34),and 4adh (27). Bacteriophage +adh, a temperate phage of

* Corresponding author.t Paper no. FS91-22 of the journal series of the Department of

Food Science, Raleigh, N.C.

Lactobacillus gassedi ADH, has a hexagonal head and anoncontractile tail, and its genome is a linear double-stranded DNA molecule of 43 kb (27). Genetic and physicalcharacterization of 4adh lysogens showed that phage 4adh isintegrated into the ADH chromosome. This observation andthe presence of cohesive ends on the phage 4adh genomesuggested that 4adh prophage integration involves circular-ization of its DNA by cohesive end joining, followed by achromosomal Campbell-like integration event analogous tothat in phage lambda. In this study, we initially determinedthat +adh integration into the ADH chromosome was sitespecific. The attachment site sequences of phage +adh DNA(attP site) involved in the process of insertion were located,cloned, and sequenced. Furthermore, the attachment siteattB, attL, and attR sequences were defined. The attP siteand a putative phage-encoded integrase of this site-specificrecombination system were used to construct an insertionalvector which was delivered successfully into the chromo-somal DNA of a prophage-cured derivative strain.

MATERIALS AND METHODSBacteria, phage, and plasmids. Bacteria and plasmids used

in this study are listed in Table 1. Lactobacillus strains werepropagated at 37°C in MRS broth (Difco Laboratories,Detroit, Mich.). Escherichia coli strains were grown in LBbroth (24) at 37°C with agitation. Agar (BBL MicrobiologySystems, Cockeysville, Md.) was used at 1.5% in solidmedia. All stock cultures were maintained at -20°C ingrowth medium with 10% glycerol. When appropriate, ampi-cillin, chloramphenicol, erythromycin, and tetracycline wereadded at concentrations of 100, 10, 2, and 10 ,ug/ml, respec-tively. Bacteriophage +adh was induced from ADH

5584

on June 28, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

SITE-SPECIFIC RECOMBINATION IN L. GASSERI 5585

TABLE 1. Bacteria and plasmids

Strain or plasmid Relevant characteristicsa Reference or origin

L. gasseri ADHNCK97 4adhr pTRK15 28NCK101 +adh+ str-1O spc-11 pTRK15 15, 22NCK102 +adh- pTRK15 28NCK445 NCK102::pTRK182 This study

E. coliJM110 rpsL thr leu thi lacYgalKgalT ara tonA tsx dam dem supE44 A(lac-proAB) 43

(F' traD36proAB lacIZ/M15)XL1 Blue recAl endAI gyrA96 thi hsdR17 (rK iK) supE44reMA A- (lac) [F' proAB 7

lacPqZiM15 TnlO (Tetr)]NCK438 XL1 Blue(pTRK180) This studyNCK439 XL1 Blue(pTRK181) This studyNCK440 JM110(pTRK182) This studyNCK441 JM110(pTRK183) This study

PlasmidspBS/KS+b lacZ Apr, 3.0 kb Stratagene, La Jolla, Calif.pSA34 Cmr Emr Tcr, 6.0 kb 29pTRK180 pBS/KS+::1.55-kb EcoRI 4)adh This studypTRK181 pBS/KS+::0.36-kb EcoRI-HindIII 4adh This studypTRK182 pSA34::4.5 kb-BclI o)adh This studypTRK183 pSA34::3.1-kb BclI-EcoRV 4adh This studypTRK209 pTRK182 deleted derivative This studypTRK208 pTRK209::2-kb PstI chromosomal junction fragment This study

a 4adh+, 4adh lysogen; 4adh-, cured of the 4adh prophage; 4adhT, 4adh lysogen not inducible with mitomycin; str-10, resistance to streptomycin (1,000Lg/ml); spc-11, resistance to spectinomycin (300 pg/ml).b pBS/KS+, pBlueScript KS+.

(NCK101) cells with 0.1 ,ug of mitomycin per ml and purifiedas described previously (27).

Isolation of 4adh lysogens. The prophage-cured derivativeL. gasseri NCK102 (NCK stands for Culture Collection ofT. R. Klaenhammer, Department of Food Science, NorthCarolina State University, Raleigh, N.C.) was infected withphage 4adh at a multiplicity of infection of 10. Survivor cellswere isolated on Lactobacillus selection agar (LBS; BBLMicrobiology Systems) supplemented with 10mM CaCl2 andreisolated twice on MRS agar. Single colonies which wereinduced to lysis with 0.1 ,ug of mitomycin per ml andresistant to phage +adh superinfection were considered)adh lysogens and used in hybridization analysis.DNA isolation and restriction. DNA was extracted from

phage 4adh particles purified by CsCl discontinuous andequilibrium density gradient centrifugations as describedpreviously (27). Plasmid DNA from E. coli was isolated bythe alkaline lysis technique and purified on CsCl-ethidiumbromide gradients (24). DNA was digested with restrictionenzymes as recommended by the suppliers (Bethesda Re-search Laboratories, Gaithersburg, Md., and BoehringerMannheim Biochemicals, Indianapolis, Ind.). Analytical orpreparative gel electrophoresis in Tris-acetate buffer wasperformed according to Maniatis et al. (24). DNA fragmentswere purified from agarose gels by using the Prep-A-Gene kit(Bio-Rad Laboratories, Richmond, Calif.).

Hybridization. DNA fragments cleaved with the appropri-ate restriction enzymes were transferred from agarose gelsto nylon membranes (Magnagraph; 0.45-,um pore size; Mi-cron Separations, Inc., Honeoye Falls, N.Y.) as describedby Southern (38). After transfer, the membranes were bakedat 80°C for 2 h. Probes were labeled with digoxigenin-11-dUTP, using a Genius kit (Boehringer). Hybridization reac-tions were performed according to the supplier's specifica-tions.

Cloning and transformation experiments. Cloning experi-

ments were performed with T4 DNA ligase (Bethesda Re-search Laboratories), using standard DNA recombinanttechniques (24). E. coli transformation was performed asdescribed by Dower et al. (11). Lactobacilli were trans-formed by electroporation with a Gene Pulser (Bio-Rad)apparatus according to the method of Luchansky et al. (22),with the following modifications: 100 ml of cells propagatedto an optical density at 590 nm of 0.7 was harvested, washedtwice with 50 ml and then 5 ml of electroporation buffer (1 Msucrose, 2.5 mM CaCl2), and suspended with 1 ml of buffer.Two hundred microliters of this suspension was mixed with10 ,u of DNA and electroporated at 25 ,uF, 2.5 kV, and 200ohms, using a 0.2-cm cuvette. Time constants of 4.1 to 4.5ms were observed under these conditions. After electropo-ration, cells were diluted 1:15 in MRS broth and incubated at37°C for 18 h. Erythromycin-resistant (Emr) transformantswere recovered from a 0.2-ml aliquot of these cells afterplating onto MRS agar containing 2 pLg of erythromycin perml and aerobic incubation at 37°C for 48 h.DNA amplification. Amplification of the 3.7-kb BclI junc-

tion fragment was performed with the single-specific-primerpolymerase chain reaction (PCR) described by Shyamalaand Ames (35). Ten micrograms of chromosomal DNA fromNCK97 was cut with TaqI. TaqI-cut DNA fragments rangingfrom 1 to 2 kb were recovered from an agarose gel, using thePrep-A-Gene kit (Bio-Rad), in a volume of 30 IlI; 15 ,lI of thissample was ligated with 1 ,ug of ClaI-digested pBlueScriptKS+ at 15°C for 16 h. The sample was ethanol precipitated,washed with 70% ethanol, and resuspended in 20 RI of TEbuffer (10 mM Tris, 1 mM EDTA [pH 8.0]). A 2-,ul aliquot ofthe ligation mix was amplified in a total volume of 100 pAwhich contained lx PCR buffer (Promega, Madison, Wis.),2.5 ,uM (each) deoxynucleoside triphosphate, 2.5 U of TaqDNA polymerase (Promega), and 7.5 pM primer T3 plusprimer 1 (CClTTIlCAAG'llAACAATC) or primer T7plus primer 1. Amplification of DNA was carried out for 40

VOL. 174, 1992

on June 28, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

5586 RAYA ET AL.

cycles at the following temperatures: denaturation, 94°C for1 min; primer annealing 52°C for 1 min; and primer extension72°C for 2 min. Twenty microliters of the reaction mix wasanalyzed by electrophoresis on a 1.2% agarose gel.For amplification of the attB region, 10 ng of NCK102

chromosomal DNA and 10 pM each primer (B1CF [GCGCTGCAGTACATGCAAAG] and B2CF [ACGAACTGCAGGCCGAG]) were used with the GenAmp kit (Perkin ElmerCetus). Amplifications were carried out for 30 cycles in thefollowing conditions: denaturation, 93°C for 30 s; annealing,55°C for 15 s; and extension, 70°C for 1.5 min.DNA sequencing. The sequence of the 0.35-kb EcoRI-

HindIII fragment of phage iadh DNA and the sequencesflanking the integrated vector pTRK182 in NCK102 weredetermined by the method of Sanger et al. (30), using theSequenase version 2.0 DNA sequencing kit (United StatesBiochemical Corp., Cleveland, Ohio). Sequence analysiswas performed with the programs of the University ofWisconsin Genetics Computer Group sequence analysissoftware package and the PC/GENE program of IntelliGe-netics, Inc.The PCR-amplified a#B region of L. gasseri NCK102 was

determined on both strands, using a modification of themethod of Sanger et al. (30). After alkaline denaturation, theprimer was added and the DNA was ethanol precipitated.Following resuspension in the sequencing buffer, the mix-ture was boiled for 3 min and immediately cooled at -70°C.Sequencing reactions were performed as instructed for theSequenase version 2.0 DNA sequencing kit except for theelongation step, which was shortened to 45 s.

Nucleotide sequence accession numbers. The nucleotidesequence data shown in Fig. 3 and 9 have been deposited inGenBank under accession numbers M62697 and M95958,respectively.

RESULTS

Site-specific integration of phage 4adh DNA into ADHgenome. Phage Oadh excision from and integration into theL. gasseri ADH genome were detected previously by South-ern blot analysis (27). Those experiments showed that a4.5-kb BclI fragment of free phage 4adh DNA hybridizedwith two BclI junction fragments (ca. 3.7 and 8.3 kb) of thechromosomal digest of ADH. Also, no homology was de-tected between phage 4adh DNA and the chromosome of aprophage-cured derivative strain, NCK102 (27). To deter-mine whether integration of phage 4adh genome into ADHwas site specific or random, the size of phage 4adh::ADHDNA junction fragments detected in two original 4adhlysogens, strains NCK101 and NCK97, was compared withthe size of junction fragments which originated from six new4adh lysogens. Each of the new lysogens was derived froman independent infection experiment to ensure a single andexclusive event of integration. Lysogen clones were furtherpurified twice on MRS agar to eliminate the possibility of aphage carrier state (3). Chromosomal DNAs from all the4iadh lysogens (NCK101, NCK97, and the six new isolates)were cut with Bcll, separated by agarose gel electrophoresis,transferred to a nylon membrane, and hybridized withdigoxigenin-labeled total phage 4adh DNA. Junction frag-ments of 3.7 and 8.3 kb were detected in all of the digests(data not shown), suggesting that insertion of phage 4Radhgenome was site specific. Hybridization analysis also re-vealed that the 4.5-kb BclI fragment of phage 4adh DNA wascompletely absent in the hybridizing pattern of NCK97, astrain in which phage +adh does not replicate lytically.

1 2 3

kb

4.5

4 5 6 7

kb

18

1.1

0.7

FIG. 1. Identification of the 4adh aaP site in DNA digests ofNCK97, NCK101, and phage +adh DNAs. Digested DNA wereseparated on 0.8% (lanes 1 to 3) or 1% (lanes 4 to 7) agarose gels,transferred to a nylon membrane, and hybridized to the digoxigenin-labeled probe of the 1.55-kb EcoRI fragment (Fig. 2c). Lanes: 1, 4,and 6, phage +adh DNA digested with BclI, TaqI, and SspI,respectively; 2, NCK101 chromosomal DNA digested with Bcll; 3,5, and 7, NCK97 chromosomal DNA digested with BclI, TaqI, andSspI, respectively.

However, this fragment was still detected at reduced inten-sity in the chromosomal digests of ADH and the six newlysogens, suggesting that a small population of phage 4adhwas replicating lytically within these strains.

Location and cloning of the attP site. Comparison of aSouthern blot of genomic DNA from NCK97 to that of phage4adh, hybridized with total phage 4iadh DNA, localized theposition of attP within a 1.55-kb EcoRI fragment (notshown). This fragment was used to probe BclI digests of

a)

b)

c)

Cos ~~~~BclI BcII BclI BcllCo

aq Sp Taql HindiNSaI ata\qi

EcoRI EcoRI1.1-kb Taql

1.1-kb Sapi

43 kb

4.5 kb

1.56 kb

FIG. 2. (a) BclI restriction map of the 43-kb phage 4adh DNA.Hybridization analysis and restriction mapping localized the 4.5-kbBclI fragment at about 20 kb from the rightmost cohesive site (cos)of the 4adh genome. (b) EcoRI and EcoRV restriction maps of the4.5-kb BclI fragment. The position of the putative 4adh integrase(Int) is indicated. (c) Restriction map of the 1.55-kb EcoRI fragment.The position of the 4adh attP site is indicated.

J. BACTERIOL.

on June 28, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

SITE-SPECIFIC RECOMBINATION IN L. GASSERI 5587

1

61

EcoRIGAATTGATGAAGCTATGCAAAATTTTGAATAAAACTGTCCCTTTTCTGTCCCTTTTCAA

primer #1 l

GTTTAACAATCACACATAAAAGCCCTATAGCACTATTGCTACAGGGCTTTATTTATTGCT*- .4

12 1 Cd AcAcTTcTTAGGAGG-rTCAATGTGACGAAGTCACACCAATGTTGATATTAAAGCAAAA

181 CCATTGATAAATCAACAATTTTAGATATTAATTAGTTGTCAATAAGTGCCAATAAAAGTC

241 ACTTATTGTCCCTTTTTTGTCCCTTTTTTGTCCCTTTTTAAAGACCTAATTGCTCTC-*4* *primer #2

301 ICTGCTACATACTCTTCAATATTAGCTAAATCTTCTTCAGTCGCTAAATTCAATATGAAGCTTHindIII

FIG. 3. Nucleotide sequence of the 365-bp EcoRI-HindIII frag-ment containing the phage Oadh attP site. Direct repeats ( - ),inverted repeats ( .E-), and primers 1 and 2 are indicated.The core sequence for recombination is boxed (see Fig. 9).

NCK97, NCK101, and phage 4adh DNA (Fig. 1, lanes 1 to3). The results suggested that the attP sequence could belocated at one end of the 1.55-kb EcoRI fragment since theprobe failed to hybridize to one of the junction fragments.The same analysis was performed on TaqI- and SspI-di-gested DNA (Fig. 1, lanes 4 to 7). The results were consis-tent with the attP being located near one end of the 1.1-kbTaqI phage DNA fragment but outside the 1.1-kb SspIfragment, because DNA from both the phage and the lyso-gen had an SspI fragment of this size. Therefore, attP waswithin the 0.35-kb SspI-EcoRI fragment (Fig. 2c). It wassubsequently assigned to the 0.36-kb EcoRI-HindIII frag-ment (see below).

Nucleotide sequence of attP. Plasmid pTRK180 was ob-tained by cloning the 1.55-kb EcoRI fragment containing theattP region (Fig. 2c) into pBluescript KS+. A 1.2-kb EcoRI-HindIll deletion was performed in pTRK180, generatingplasmid pTRK181, which contains the 0.36-kb EcoRI-HindIII fragment (not shown). Both strands of the attP-containing fragment cloned in pTRK181 were then se-

quenced (Fig. 3). Analysis of the nucleotide sequence re-vealed a 365-bp sequence with a high A+T content, fivedirect repeats of the sequence TGTCCClTTT(C/T), and a14-bp inverted repeat (with one mismatch). These featuresare typical of other site-specific systems of recombination,and they may represent potential binding sites for proteinsinvolved in the recombination process.

Amplification of one junction fragment. Hybridization andnucleotide sequence analysis indirectly suggested that theattP site sequences of phage 4)adh were present in the0.36-kb EcoRI-HindIII fragment. If this were true, thenjunction sequences of phage 4adh DNA: :chromosomalDNA would be amplified in a PCR using part of the 0.36-kbEcoRI-HindIII sequence as a primer (Fig. 4). To evaluatethis hypothesis, 1- to 2-kb TaqI fragments of chromosomalDNA from NCK97 were purified from an agarose gel afterelectrophoresis and then ligated into the ClaI site of pBlue-Script KS+ and amplified with primers T3 and 1 or primersT7 and 1, using the single-specific-primer PCR (35). Anunique fragment of about 1.4 kb was obtained with primersT3 and 1 and primers T7 and 1. The 1.4-kb fragment wasisolated from an agarose gel and used as a probe in hybrid-ization reactions with DNA from NCK97, NCK101,NCK102, and phage 4oadh. The amplified 1.4-kb fragmenthybridized to the 4.5-kb Bcll fragment of phage 4adh DNA(Fig. 5, lane 4) and to the predicted (Fig. 4) 3.7-kb Bclljunction fragment from NCK101 and NCK97 (Fig. 5, lanes 3and 6). The 1.4-kb amplified fragment also hybridized with apredicted Bcll fragment (7.5 kb) from chromosomal DNA ofNCK102 (Fig. 5, lane 5) which contains the bacterial attach-ment site (attB) sequences (Fig. 4). These data indicate thatthe amplified fragment contains one of the junction se-quences and thus confirmed that the attP site sequence ofphage 4adh is present within the 0.36-kb EcoRI-HindIIIfragment of 4adh DNA.

Phage 4adh

---2.7 kb---_1.8 kb-

NCK102 (phage-)attB (7.5 kb)

-1.9 kb-------S.kbkb

NCK97 (phage+)attL (3.7 kb) prophage ,dadh

--1.9 kb--<--1.8 kb-

FIG. 4. Schematic representation of the Campbell-like integration of phage fadh genome into the bacterial attB site of NCK102. attL andattR, junctions fragments; open boxes, chromosomal DNA; shaded boxes, phage +adh DNA; <_ - -, primer 1, with the direction of DNApolymerization indicated.

attR (8.3 kb)

-.k------SuB kb-----2.7 kb---

--- .--- --. .- - .- - - I

4 1-

VOL. 174, 1992

on June 28, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

5588 RAYA ET AL.

1 2

kb t

8.3

4.53.7ao

1.5

3 4 5 6

kb

7.,

43.

FIG. 5. Southern hybridization analysis of BclI-digested chro-mosomal DNA of NCK101 (lanes 2 and 3), NCK102 (lane 5), andNCK97 (lane 6) and of phage 4adh DNA (lanes 1 and 4). Total phage4adh DNA was used as a probe in lanes 1 and 2. The amplified PCRfragment of 1.4 kb was used as a probe in lanes 3 to 6.

Construction of an atP-based insertional vector. One strik-ing characteristic of bacteriophage and plasmid integrationsystems which are mediated by site-specific processes is thatfunctions required for integration (i.e., attP and integrase)are tightly clustered (16, 41, 42). The 4.5-kb BclI fragment of4adh DNA contains the attP sequences at ca. 1.8 and 2.7 kbfrom its ends and should therefore also contain the putativeintegrase. We evaluated whether or not the attP-containing4.5-kb BclI fragment could mediate integration of plasmidpSA34 into the chromosomal DNA of NCK102. PlasmidpSA34 (29) (Fig. 6A), with a length of 6.0 kb, has agram-negative origin of replication and carries genes confer-ring chloramphenical and tetracycline resistance in gram-negative bacteria and erythromycin resistance in gram-positive bacteria. However, pSA34 does not have a gram-positive origin of replication and therefore does not replicateextrachromosomally in L. gasseri ADH.The 4.5-kb BclI fragment of 4adh was inserted into the

BamHI site of plasmid pSA34, generating pTRK182. Arestriction map of the recombinant plasmid pTRK182 (10.5kb) is shown in Fig. 6B. Plasmid pTRK182 contains only oneBclI site, since the BclI sites of the insert DNA were lost inthe ligation experiment. Electrocompetent L. gasseriNCK102 cells were transformed with pTRK182, and Emrtransformants were isolated at a frequency of approximately2 x 1024±g of DNA. Transformants were not recovered withpSA34, indicating that the insert DNA in pTRK182 wasessential for retention and expression of Emr transformants.To confirm integration of pTRK182 into the NCK102 ge-nome, chromosomal DNA from three independent Emrtransformants and from NCK102 (recipient, Ems) were cutwith BclI and hybridized with digoxigenin-dUTP-labeledpSA34. The pSA34 probe did not hybridize with chromo-somal DNA from NCK102 (not shown), while two BclI-hybridizing bands of 11.7 and 6.3 kb were visualized in thechromosomal digests of all the Emr transformants (Fig. 7,lanes 1 to 3). The sizes of the two hybridizing bands detectedwere consistent with predictions for integration of one copy

ZooRI

A.

B.

C.

EBccRI SodIFIG. 6. (A) Restriction map of pSA34 (29). Cm, chloramphenicol

resistance; Em, erythromycin resistance; Tc, tetracycline resis-tance. Box represents gram-negative origin of replication. (B) Re-striction map of pTRK182. The 4.5-kb BclI fragment of phage +adhwas cloned into the BamHI site of pSA34, generating pTRK182.attP, attachment site of +adh; Int, putative integrase of 4adh. (C)Restriction map of pTRK183, a 1.4-kb EcoRV deletion derivative ofpTRK182.

of pTRK182 into the NCK102 genome at the attachment site(attB) present in the 7.5-kb BclI chromosomal fragment (Fig.8). These data indicated that integration of pTRK182 wassite specific and that the 4.5-kb BclI fragment of phage +adhcontains all information required for the recombinationprocess. In a subsequent experiment, plasmid pTRK183, a

J. BACTERIOL.

on June 28, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

SITE-SPECIFIC RECOMBINATION IN L. GASSERI 5589

1 2 3 4

kb

11.7

6.3

NCK102En?

Emr Bcil

pTRK182110.5 kb J

attP

---- 4.5 kb ----

------- 7.5 kb-

-----7.5 kb ----

NCK102

r Bl

FIG. 7. Southern hybridization of BclI-digested chromosomalDNA of three independent NCK102 Em' transformants (lanes 1 to3). Lane 4 contains BclI-digested pTRK182. Plasmid pSA34 was

used as the probe.

1.6-kb EcoRV deletion derivative of pTRK182 (Fig. 6C),failed to render Emr transformants of NCK102 recipientcells. This finding suggests that the DNA fragment to theright of the attP site (Fig. 2b) contains the putative integrasegene of phage 4~adh. Molecular characterization of theintegrase region will be described elsewhere (lla).Emr transformants (3 x 102/p.g of DNA) were also ob-

tained when the 4adh lysogen NCK101 was electroporatedwith plasmid pTRK182. Southern hybridization analysis ofthree independent Emr NCK101 transformants showedplasmid::chromosome BclI junction fragments of 11.7 and6.3 kb (data not shown), identical to the junction fragmentsobserved with Emr NCK102 cells (see above). The EmrNCK101 transformants were also sensitive to 4adh infectionand not inducible with mitomycin. These data suggest thatresident 4adh prophage DNA sequences were lost in theEmr NCK101 transformants as result of pTRK182 integra-tion.

Determination of atL, attR, and altB region sequences.

Plasmid pTRK209, a 2.5-kb HindIII-deleted derivative ofpTRK182, which left the putative int region and attP intact,was constructed for cloning of attL and attR and subse-quently amplification of attB. This plasmid was used as theinsertional vector; its detailed characteristics will be de-scribed elsewhere. Integration of pTRK209 occurred withina 2-kb chromosomal PstI fragment of NCK102 (data notshown). The fragment containing both the integrative vectorand its flanking chromosomal regions was isolated by a PstIdigestion of genomic DNA and ligation with T4 DNA ligaseto obtain circular molecules. Transformation of E. coliDH5a yielded seven transformants, five of which containeda 9.5-kb plasmid named pTRK208. This plasmid hybridizedto both pTRK181 and a 2-kb PstI chromosomal fragmentfrom NCK102, demonstrating the presence of both phageand chromosomal sequences. Restriction analysis showedthat pTRK208 contained a 2-kb chromosomal fragmentwhich was inserted within the attP region of pTRK209 (notshown).The flanking chromosomal regions present in pTRK208

were sequenced. Two sequencing primers (primers 1 and 2;

BcIl rEm (attR) Bcl

1. -kb --------------- 1 1.7 kb ---------------------

------- 6.3 kb ---------

FIG. 8. Schematic representation of pTRK182 site-specific inte-gration into the NCK102 genome. Open boxes, the 7.5-kb BclIfragment of chromosomal DNA containing the attB site; shadedboxes, the 4.5-kb BclI fragment of +adh DNA containing the attPsite; thick line, pSA34 DNA; thin line, chromosomal DNA.

Fig. 3), each corresponding to one end of the attP regionsequence defined in the 0.36-kb EcoRI-HindIII fragmentfrom 4adh, were selected. The sequences were arbitrarilydesignated atL and attR (Fig. 9). To characterize the L.gasseri NCK102 attachment region (attB), two additionalprimers (primers BCF1 and BCF2) complementary to auLand attR were synthesized and used to amplify a 393-bpfragment from NCK102 chromosome by PCR. The chromo-somal sequence obtained from NCK102 was identical tothose regions deduced from the atL and affR sequences.Comparison with the affP region showed that they all sharea common 16-bp sequence, 5'-TACACTTCITAGGAGG-3'(Fig. 1 and 8), which constitutes the core chromosomalattachment site (attB) that recombines with attP.

DISCUSSION

This study demonstrated that the Lactobacillus phage4adh integrates its genome into the chromosomal DNA of L.gasseri ADH by a site-specific recombination process, fol-lowing Campbell's classic model of integration for phagelambda (8). Integrative recombination takes place betweenattP and attB sequences residing within the 4.5-kb BclIfragment of phage 4adh and the 7.5-kb BclI fragment of L.gasseri NCK102 chromosomal DNA, respectively. As theresult of the recombination event, the attP- and attB-con-taining fragments split into two hybrid chromosome::phageBclI junction fragments of approximately 3.7 and 8.3 kb.Integration of 4adh genome was always detected at the sameposition of the L. gasseri chromosome, indicating that the7.5-kb BclI fragment of NCK102 contains the primary bac-terial attachment site. Although integration assays andDNA-DNA hybridization techniques failed to detect second-ary sites for 4adh integration into the ADH genome, thepresence of these sites cannot be ruled out.

All of the phage functions required for integration of +adhgenome were localized within the 4.5-kb BclI fragment, sincethis fragment mediated site-specific integration of pTRK182into the ADH chromosome. Repeated detection of 11.7- and6.3-kb pTRK182::chromosomal junction fragments in Emrtransformants confirmed that a specific interaction betweenattP and attB sequences was involved in the integration ofpTRK182. Furthermore, when the 1.6-kb EcoRV fragmentto the left of the attP site was eliminated, no Emr transfor-

VOL. 174, 1992

E

on June 28, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

5590 RAYA ET AL.

-40 -30 -20 -10 -1+1 +10 +20 +30 +40

attP 5' -CCCTATAGCACTATTGCTACAGGGCTTTATTTATTGCTCTACACTTCTTAGGAGGTTCAATGTGACGAAGTCACACCAATGTTGATATTAAA-3'-- - - - -- - - -- - - - - - -- - - - - - - - - - - - -- - --- - - - -

attL 5' -CCCTATAGCACTATTGCTACAGGGCTTTATTTATTGCTCTACACTTCTTAGGAGGAGAAGTTTCGATCAGTCACCTATATCTAGTTCAAATT-3'

attR 5' -ATTACAGCTTAACCTGACCTAATGAAGAAAATAAATTGTTACACTTCTTAGGAGGTTCAATGTGACGAAGTCACACCAATGTTGATATTAAA-3'

attB 5' -ATTACAGCTTAACCTGACCTAATGAAG'AAAATAAATTGTTrACACTTCTTGAGGAGTCACAGTCACCTATATCTAGTTCAAATT-31

FIG. 9. Nucleotide sequences of the regions containing the attachment sites. Sequences are numbered from the center of the core; the baseimmediately to the right is +1, and the base immediately to the left is -1. The core sequence is double underlined. Phage 4adh DNA isunderlined with -, and the L. gasseni chromosomal sequences are underlined with +. Junction sequences between phage and bacterial DNAhave been arbitrarily designated atL and atR.

mants were obtained, suggesting that the deleted fragmentcontained some gene function(s) also required for site-specific recombination of bacteriophage adh. These resultsshow that the essential functions required for site-specificintegration of 4adh DNA are clustered in a small portion ofits genome, a characteristic of all site-specific integrationsystems. The minimal size of 4adh DNA with functionalintegration activity remains to be determined.The site-specific recombination events were shown by

analysis of the attP site and the attL-attR junction sequencesto occur within a 0.36-kb EcoRI-HindIII fragment. Struc-tural features of numerous attP site sequences described todate include (i) a central core sequence, where synapsis andstrand exchange occur, also present in the three otherattachment sites (attB, attL, and attR), and (ii) two uniqueelements (P and P' arm sequences) which surround the coreregion. Both arm and core DNA sequences contain invertedand direct repeats that represent binding sites for the specificintegrase and another protein(s) involved in the recombina-tion process. In this context, the 11-bp direct repeat se-quence of the 4adh attP site, TGTCCC1TTT(C/T), repeatedfive times at nucleotide positions 36, 47, 246, 257, and 268,shows two important features recognized by DNA-bindingproteins and therefore may represent potential arm bindingsites for a protein(s) involved in the integration of phage4adh. These two features are (i) the presence of poly(dT) [orA-tract DNA, as described by Hagerman (13)] in the directrepeat sequences and (ii) the fact that the 11-bp repeatapproximately defines one helical turn in the B form ofDNA. The A-tract DNA, which gives an intrinsic curvatureon a DNA molecule, has been identified in DNA sequencesinvolved in replication, site-specific recombination, tran-scription, transposition, and chromatin structure (13, 39). Onthe other hand, the helical repeat determined for the 11-bpsequence suggests that binding of the integrase (or otherprotein) would be in one face of the DNA. Interactions ofseveral other DNA-binding proteins have been found tooccur primarily along one face of the DNA helix (26).Interestingly, a perfect repeat sequence of 12 bp (TRTGCCCT lTFl; R = A or G) which bears striking homology tothe 4adh 11-bp repeat [TGTCCCTJTTT(C/T)] is found fourtimes in the P and P' arms of the attachment site ofStaphylococcus aureus bacteriophage L54a (18). The exten-sive homology between L54a attP and -adh attP directrepeats suggests that the site-specific recombination systemsof the two phages may be related and that these sequencesmay define conserved signals for integration processes. The

core site for integration is, however, distinct between thetwo phages.The site of specific recombination was defined to be the

core sequence 5'-TACACITClT AGGAGG-3' by compari-son of the attL, attR, attB, and attP regions. Therefore,unlike transposition events, these recombination events oc-curred without DNA synthesis or sequence duplication.Nonreplicative integration events are typical among temper-ate phages. The attachment site core of two temperatephages from S. aureus are the only core sequences fromgram-positive bacteria that have been analyzed (18, 19).They have in common a 5'-ATGGGA-3' sequence butotherwise share no extensive homology with the core se-quences of phage from gram-negative bacteria. The phage4adh recombination site appears unique since it shares nohomology with or features common to those previouslydescribed.Chromosomal integration vectors have been constructed

previously for lactic acid bacteria by cloning fragments ofchromosomal DNA or insertion sequences into a plasmidunable to replicate in gram-positive bacteria (20, 28, 32).These recombinant plasmids were used to stabilize a plas-mid-borne proteinase gene in the Lactococcus chromosome(20), to inactivate a gene in L. lactis by replacement recom-bination (20), and to introduce heterologous genes into L.lactis (28) and Lactobacillus plantarum (32). Since integra-tion of these plasmids frequently resulted in amplification ofthe integrated structure with a head-to-tail arrangement onthe chromosome, these vectors may not be suitable forstudies of gene expression of a single-copy unit. The inte-gration vector constructed in this study, pTRK182, exempli-fies a class of integration vectors that offer a number ofadvantages. They could be used for introducing a singlecopy of homologous or heterologous DNA into the chromo-some of ADH by using 4adh-mediated site-specific func-tions. Potentially, large fragments of DNA may be inte-grated, since this att-based recombination system shouldaccommodate at least the genome size of 4adh, 43 kb. Sincea single copy is integrated, expression studies may beperformed under conditions that mimic chromosomal genesor operons present in only one copy. In addition, specificintegration of such vectors should not affect the viability ofthe transformants, since integration occurs in a nonessentialsite in the genome. Elucidation of the phage-specific integra-tion process in lactobacilli is expected to now provideopportunities to stabilize complex gene systems in the ge-

J. BACTERIOL.

-

on June 28, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

SITE-SPECIFIC RECOMBINATION IN L. GASSERI 5591

nome of bacteria that can be delivered to the intestinal tractof humans.

ACKNOWLEDGMENTS

This research and investigators were supported in part by theNorth Carolina Dairy Foundation, the National Dairy Promotionand Research Board, the Southeast Center for Dairy Foods Re-search, and Nestec, Ltd. G. L. De Antoni is a recipient of theResearch Carrier of Comisi6n de Investigaciones Cientificas de laProvincia de Buenos Aires, Argentina.We thank L. A. Miller for excellent technical assistance in the

sequencing of the 836-kb EcoRI-HindIII fragment.

REFERENCES

1. Astumian, J. H., A. S. Waldman, and J. J. Scocca. 1989.Site-specific recombination between cloned attP and attB sitesfrom the Haemophilus influenzae bacteriophage HP1 propa-

gated in recombination-deficient Escherichia coli. J. Bacteriol.171:1747-1750.

2. Austin, S., M. Ziese, and N. Sternberg. 1981. A novel role forsite-specific recombination in maintenance of bacterial repli-cons. Cell 25:729-736.

3. Barksdale, L., and S. B. Arden. 1974. Persisting bacteriophageinfections, lysogeny, and phage conversions. Annu. Rev. Mi-crobiol. 28:265-27.

4. Bertani, L. E., and E. Six. 1988. The P2-like phages and theirparasite P4, p. 73-143. In R. Calendar (ed.), The bacterio-phages, vol II. Plenum, New York.

5. Boccard, F., J.-L. Pernodet, A. Friedmann, and M. Guerineau.1988. Site-specific integration of plasmid pSAM2 in Strepto-myces lividans and S. ambofaciens. Mol. Gen. Genet. 212:432-439.

6. Brown, D. P., S.-j. D. Chiang, J. S. Tuan, and L. Katz. 1988.Site-specific integration in Saccharopolyspora erythrea andmultisite integration in Streptomyces lividans of actinomyceteplasmid pSE101. J. Bacteriol. 170:2287-2295.

7. Bullock, W. O., J. M. Fernandez, and J. M. Short. 1987.XL1-Blue: a high efficiency plasmid transforming recA Esche-richia coli strain with beta-galactosidase selection. BioTech-niques 5:376-378.

8. Campbell, A. 1962. Episomes. Adv. Genet. 11:101-145.9. Cox, M. M. 1989. DNA inversion in the 2pm plasmid of

Saccharomyces cerevisiae, p. 661-670. In D. E. Berg and M. M.Howe (ed.), Mobile DNA. American Society for Microbiology,Washington, D.C.

10. Davidson, B. E., I. B. Powell, and A. J. Hillier. 1990. Temperatebacteriophages and lysogeny in lactic acid bacteria. FEMSMicrobiol. Rev. 87:79-90.

11. Dower, W. J., J. F. Miller, and C. W. Ragsdale. 1988. Highefficiency transformation of Escherichia coli by high voltageelectroporation. Nucleic Acids Res. 16:6127-6145.

11a.Fremaux, C., G. L. De Antoni, and T. R. Klaenhammer.Submitted for publication.

12. Glasgow, A. C., K. T. Hughes, and M. I. Simon. 1989. BacterialDNA inversion systems, p. 637-659. In D. E. Berg and M. M.Howe (ed.), Mobile DNA. American Society for Microbiology,Washington, D.C.

13. Hagerman, P. J. 1990. Sequence-directed curvature of DNA.Annu. Rev. Biochem. 59:755-781.

14. Hsu, P.-L., W. Ross, and A. Landy. 1980. The lambda phage att

site: functional limits and interaction with Int protein. Nature(London) 285:85-91.

15. Kleeman, E. G., and T. R. Kiaenhammer. 1982. Adherence ofLactobacillus species to human fetal intestinal cells. J. DairySci. 65:2063-2069.

16. Kusthoss, S., M. A. Richardson, and R. N. Rao. 1989. Site-specific integration in Streptomyces ambofaciens: localizationof integration functions in S. ambofaciens plasmid pSAM2. J.Bacteriol. 171:16-23.

17. Lee, C. Y., and S. L. Buranen. 1989. Extent of the DNA

sequence required in integration of staphylococcal bacterio-phage L54a. J. Bacteriol. 171:1652-1657.

18. Lee, C. Y., and J. J. Iandolo. 1986. Integration of staphylococcalphage L54a occurs by site-specific recombination: structuralanalysis of the attachment sites. Proc. Natl. Acad. Sci. USA83:5474-5478.

19. Lee, C. Y., and J. J. Iandolo. 1988. Structural analysis ofstaphylococcal bacteriophage 11 attachment sites. J. Bacteriol.170:2409-2411.

20. Leenhouts, K. 1990. Development and use of plasmid integrationsystems for lactococci. Ph.D. thesis. University of Groningen,Groningen, The Netherlands.

21. Leong, J. M., S. Nunes-Duby, C. M. Lesser, P. Youderian,M. M. Susskind, and A. Landy. 1985. The 80 and P22 attachmentsites. J. Biol. Chem. 260:4468 4477.

22. Luchansky, J. B., E. G. Kleeman, R. R. Raya, and T. R.Klaenhammer. 1989. Gene transfer systems for delivery ofplasmid DNA into Lactobacillus acidophilus ADH: conjuga-tion, electroporation, and transduction. J. Dairy Sci. 72:1408-1417.

23. Madon, J., P. Moretti, and R. Hutter. 1987. Site-specific inte-gration and excision of pMEA100 in Nocardia mediterranei.Mol. Gen. Genet. 209:257-264.

24. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

25. Omer, C. A., and S. N. Cohen. 1984. Plasmid formation inStreptonyces: excision and integration of the SPL1 replicon ata specific chromosomal site. Mol. Gen. Genet. 196:429-438.

26. Ptashne, M. 1986. Gene regulation by proteins acting nearby andat a distance. Nature (London) 322:697-701.

27. Raya, R. R., E. G. Kleeman, J. B. Luchansky, and T. R.Klaenhammer. 1989. Characterization of the temperate bacte-riophage +adh and plasmid transduction in Lactobacillus acido-philus ADH. Appl. Environ. Microbiol. 55:2206-2213.

28. Romero, D. A., and T. R. Klaenhammer. 1992. IS946-mediatedintegration of heterologous DNA into the genome of Lacto-coccus lactis subsp. lactis. Appl. Environ. Microbiol. 58:699-702.

29. Sanders, M. E., and J. W. Schultz. 1990. Cloning of phageresistance genes from Lactococcus lactis subsp. cremoris KH.J. Dairy Sci. 73:2044 2053.

30. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

31. Sechaud, L., P.-J. Cluzel, M. Rousseau, A. Baumgartner, andJ.-P. Accolas. 1988. Bacteriophages of lactobacilli. Biochimie70:401-410.

32. Scheirlinck, T., J. Mahillon, H. Joos, P. Dhaese, and F. Michiels.1989. Integration and expression of alpha-amylase and endoglu-conase genes in the Lactobacillus plantarum chromosome.Appl. Environ. Microbiol. 55:2130-2137.

33. Sherratt, D. 1989. Tn3 and related transposable elements:site-specific recombination and transposition, p. 163-184. InD. E. Berg and M. M. Howe (ed.), Mobile DNA. AmericanSociety for Microbiology, Washington, D.C.

34. Shimizu-Kadota, M., and N. Tsuchida. 1984. Physical mappingof the virion and the prophage DNAs of a temperate Lactoba-cillus phage 4FSW. J. Gen. Microbiol. 130:423-430.

35. Shyamala, V., and G. F.-L. Ames. 1989. Genome walking bysingle-specific-primer polymerase chain reaction: SSP-PCR.Gene 84:1-8.

36. Silverman, M., and M. Simon. 1983. Phase variation and relatedsystems, p. 537-557. In J. A. Shapiro (ed.), Mobile geneticelements. Academic Press, New York.

37. Sosio, M., J. Madon, and R. Hutter. 1989. Excision of pIJ408from the chromosome of Streptomyces glaucescens and itstransfer into Streptomyces lividans. Mol. Gen. Genet. 218:169-176.

38. Southern, E. M. 1975. Detection of specific sequences amongDNA fragments separated by gel electrophoresis. J. Mol. Biol.164:503-517.

39. Tohyama, K., T. Sakurai, and H. Arai. 1971. Transduction bytemperate phage PLS-1 in Lactobacillus salivarius. J. Jpn.

VOL. 174, 1992

on June 28, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

5592 RAYA ET AL.

Bacteriol. 26:487.40. Travers, A. A. 1989. DNA conformation and protein binding.

Annu. Rev. Biochem. 58:427-52.41. Waldman, A. S., S. D. Goodman, and J. J. Scocca. 1986.

Nucleotide sequences and properties of the sites involved inlysogenic insertion of the bacteriophage HP1c1 genome into theHaemophilus influenzae chromosome. J. Bacteriol. 169:238-246.

42. Weisberg, R. A., and A. Landy. 1983. Site-specific recombina-tion in phage lambda, p. 211-250. In R. W. Hendrix, J. W.Roberts, F. W. Stahl, and R. A. Weisberg (ed.), Lambda II.Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

43. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-

quences of M13 mp18 and pUC19 vectors. Gene 33:103-110.

J. BACTERIOL.

on June 28, 2018 by guesthttp://jb.asm

.org/D

ownloaded from