instructions for use lymphotrack mrd software v1.2 · are less suitable for mrd testing due to the...

7-500-0008 LymphoTrack MRD Software 280364 Rev. E | January 2020

For RESEARCH USE ONLY. Not for Use in Diagnostic Procedures

The Research Use Only (RUO) LymphoTrack MRD Software v1.2.0 is a bioinformatics tool that runs on supported Microsoft Windows® platforms. This software is intended to detect the presence of clonotype sequences within the output files generated using the Invivoscribe LymphoTrack Assays and accompanying LymphoTrack bioinformatics software. This software is not intended to define the significance of finding such sequences.

For a Sequence Detected result, the software will report the number of reads and cumulative frequencies of exact sequence matches and similar sequences (up to two mismatched nucleotides).

For a Sequence Not Detected result, the software will report the number of reads and cumulative frequencies of exact sequence matches and similar sequences (up to two mismatched nucleotides). In addition, the software will report the confidence level at 10-3, 10-4, 10-5, and 10-6 sensitivity for the searched sequence based upon the sample DNA input and read depth obtained.

For additional information related to sample setup for Minimal Residual Disease (MRD) studies, please refer to the technical bulletin Study of MRD - Using LymphoTrack Assays ( MM0022). This technical bulletin can be found on the RUO LymphoTrack MRD Software CD ( 7-500-0008) and on the RUO LymphoTrack Instructions for Use CD ( 261406). The technical bulletin can also be provided upon request by emailing [email protected].

Minimum System Requirements Processor: Intel Core 2 Duo or newer CPU recommended. Hard Drive: At least 1 GB of free disk space is required; 2 GB recommended. RAM: 4 GB required; 8 GB or more recommended. Operating System: Windows 10 (64-bit) is required. A CD-ROM drive. Up to date Adobe fonts required for viewing PDF reports can be found at

https://supportdownloads.adobe.com/thankyou.jsp?ftpID=6484&fileID=6484 with the following file name:FontPack1900820071_XtdAlf_Lang_DC.msiur.

Warnings and Precautions Instruction for Use. Please read the Instructions for Use carefully prior to running the LymphoTrack MRD software and

follow each step closely. Sleep or hibernate settings. If the computer is set to enter sleep or hibernate modes after a period of inactivity, consider

disabling this feature before executing the LymphoTrack MRD Software. If the computer enters sleep or hibernate mode,the software analysis may terminate prematurely.

File Naming. Be certain to use very descriptive file names that can be easily identified, as multiple file names are generatedby the LymphoTrack MRD Software output.

o Characters in pathname and file name. 1) Avoid spaces in the pathname for the files (pathnames include file foldersand file names) to be analyzed; only one space is permitted. 2) It is important that the filenames only contain thefollowing characters (A-Z, a-z, 0-9, _ (underscore), - (hyphen)). If the software encounters a character not within thisset, it may fail to complete analysis.

Instructions for Use LymphoTrack® MRD Software v1.2.0

mailto:[email protected]

https://supportdownloads.adobe.com/thankyou.jsp?ftpID=6484&fileID=6484

of 18

LymphoTrack MRD Software 280364 Rev. E | January 2020


Product Compatibility The RUO LymphoTrack MRD software v1.2.0 is intended to be used with the following Invivoscribe LymphoTrack Assays and Controls to track clonal sequences identified by the corresponding LymphoTrack Software (for Ion S5/PGM 7-500-0007 or MiSeq 7-500-0009).

Catalog # Description Quantity

4-088-0098 LymphoTrack B-cell Low Positive Control 1 Tube – 5 reactions

4-088-0118 LymphoQuant B-cell Internal Control 1 Tube – 120 reactions

4-088-0108 LymphoTrack T-cell Low Positive Control 1 Tube – 5 reactions

4-088-0128 LymphoQuant T-cell Internal Control 1 Tube – 120 reactions

7-121-0009 LymphoTrack IGH FR1 Assay Kit A - MiSeq 8 indices – 5 reactions each

7-121-0039 LymphoTrack IGH FR1 Assay Panel - MiSeq 24 indices – 5 reactions each

7-121-0149 LymphoTrack IGH FR1 Assay Panel B - MiSeq 24 indices – 5 reactions each





7-121-0129 LymphoTrack IGH FR1/2/3 Assay Kit A - MiSeq 8 indices per FR region – 5 reactions each

7-121-0139 LymphoTrack IGH FR1/2/3 Assay Panel - MiSeq 24 indices per FR region – 5 reactions each

7-121-0059 LymphoTrack IGHV Leader Somatic Hypermutation Assay Kit A - MiSeq 8 indices – 5 reactions each

7-121-0069 LymphoTrack IGHV Leader Somatic Hypermutation Assay Panel - MiSeq 24 indices – 5 reactions each

7-122-0009 LymphoTrack IGK Assay Kit A – MiSeq 8 indices – 5 reactions each

7-122-0019 LymphoTrack IGK Assay Panel – MiSeq 24 indices – 5 reactions each

7-225-0009 LymphoTrack TRB Assay Kit A – MiSeq 8 indices – 5 reactions each

7-225-0019 LymphoTrack TRB Assay Panel – MiSeq 24 indices – 5 reactions each

7-227-0009 LymphoTrack TRG Assay Kit A – MiSeq 8 indices – 5 reactions each

7-227-0019 LymphoTrack TRG Assay Panel – MiSeq 24 indices – 5 reactions each

7-121-0007 LymphoTrack IGH FR1 Assay - S5/PGM 12 indices – 5 reactions each

7-121-0037 LymphoTrack IGH FR2 Assay – S5/PGM 12 indices – 5 reactions each

7-121-0047 LymphoTrack IGH FR3 Assay - S5/PGM 12 indices – 5 reactions each

7-121-0057 LymphoTrack IGH FR1/2/3 Assay - S5/PGM 12 indices per FR region – 5 reactions each

7-122-0007 LymphoTrack IGK Assay – S5/PGM 12 indices – 5 reactions each

7-227-0007 LymphoTrack TRG Assay – S5/PGM 12 indices – 5 reactions each

of 18



1. Definitions Low Positive Control (LPC) - Designed specifically for MRD testing, the LymphoTrack Low Positive Controls are

optimized to work in concert with the LymphoQuant Internal Controls. When run together as intended, these controls ensure that MRD levels of sensitivity are confidently interrogated in samples where the LymphoQuant Internal Control is being used.

LymphoQuant Internal Control (LPIC) - B-cell or T-cell internal controls may be spiked into sample PCRs to estimate the respective number of clonotype B-cell or T-cell equivalents and calculate the percent clonotype present. Addition of a spike-in internal control to the sample PCR facilitates clonotype tracking over time without additional sequencing run cost. Consistent use of a spike-in internal control enables objective monitoring of a clonotype over time with a highly standardized, sensitive method.

# of Replicates – The number of independent PCR amplifications per sample.A PCR replicate for a sample is defined as an independent PCR amplification with a unique LymphoTrack master mix (index).

o For example, if Sample A is tested in three separate PCRs by TRG MiSeq 01, TRG MiSeq 02, and TRG MiSeq 03, respectively, Sample A would have three different PCR replicates.

o Each PCR replicate sequenced will have a *.unique_reads file generated by the LymphoTrack software.

# of Resequences – the number of times the same PCR replicate is sequenced on a different sequencing run, potentially because a sample did not reach adequate read depth the first time it was sequenced.

# of Reads per Sequencing – The desired read depth for each sequenced PCR replicate provided as a guide for planning experiments using the Project Planner; this number is assigned to each sequenced replicate, including each planned resequencing run or sample.

Read Depth – The number of sequencing reads generated per run per sample or sample replicate. The Project Planner refers to sample Read Depth as # of Reads per Sequencing.

Amount of DNA - the amount of DNA used in each PCR replicate, NOT the total amount of DNA interrogated across all replicates.

Run – An entire workflow as it pertains to the set of samples and controls per assay target, including resequences. Index – A unique oligo sequence used to identify samples and PCR replicates of the same sample. Confidence – The probability of all sequences resulting in a true negative (calculated using the variables # of Replicates,

# of Resequences, # Reads per Sequencing, and Amount of DNA) at a given threshold. Cumulative Read Count – In the context of this software, the sum of exact match read count plus 1 mismatch, plus 2

mismatch read counts. Cumulative Read Frequency (CRF) – The read count generated by a specific sample sequence in the LymphoTrack

Software divided by the total number of reads generated by that sample. Estimated Clonal Cell Equivalents – An approximate calculation of the number of cells containing the interrogated

clonotype sequence in the sample. Bi-allelic Clonotype –Two unique clonal sequences present on two alleles of the same gene; it is possible that two detected

alleles may arise from the presence of two mono-allelic clonotypes.

of 18



2. MRD Analysis is Locus-Sensitive The LymphoTrack suite of NGS assays offers a sensitive approach and when used with the respective Low Positive Control (LPC) and LymphoQuant Internal Control (LQIC) controls offer a standardized workflow for MRD clonotype tracking. Take precautions when determining suitability of a clonotype sequence for MRD tracking which are unique per locus and are outlined in the subsequent sections.

2.1. Immunoglobulin heavy chain (IGH)

Due to the high genetic diversity of IGH, there are typically no considerations that need to be taken into account when selecting sequences for MRD tracking.

2.2. Immunoglobulin kappa chain (IGK)

There are three common rearrangements that are likely unsuitable for MRD analysis due to the high frequency in which they occur. As a result, any of the three clonotype sequences listed below may not be suitable for MRD analyses:

Intron-Kdel V3D-20 with any J or Kdel V3-11 with any J or Kdel

2.3. T-cell receptor gamma (TRG)

The TRG locus is composed of fewer gene segments than IGH, IGK, and TRB, and thus is far less diverse. Due to this lack of diversity, TRG gene rearrangements of the same sequence are found between cells at a higher prevalence, increasing the likelihood of false positive MRD results. To minimize this risk, it is suggested to follow these precautionary measures:

Track only exact match sequences to reduce the likelihood of a false positive match. In other loci, tracking up to two mismatches is useful for accounting for sequencing error; however, using this method for the TRG locus will exacerbate the false positive frequency.

Track two clonal sequences to reduce the probability of a false positive match. The TRG locus has a strong propensity for bi-allelic rearrangements and will display as two clonal sequences in the LymphoTrack output. Use both of these sequences for MRD tracking. In cases of a bi-clonal sample, the output will likely include more than two clonal sequences and provide multiple trackable sequences that can improve the specificity of the assay.

2.4. T-cell receptor beta (TRB)

When tracking TRB gene rearrangements, please note that D-J rearrangements are less suitable for MRD testing due to the reduced diversity found in these immature rearrangements. To minimize the risk of false positive MRD results, track two clonal sequences using only exact match sequences for TRB clonotypes.

3. Installing the Software 3.1. Open the disk drive and double click on the LymphoTrackMRDv1.2.0-setup.exe file from the software CD. The

software installer will open and allow the software to be installed to a local drive on the computer. Click Install to accept all default choices.

Install software only on a local drive and not a network drive. The software might not function properly if run across a network connection.

3.2. The installer will add the software to the Start Menu; the default install location is C:\Program Files\Invivoscribe.

of 18



4. Using the LymphoTrack MRD Project Planner The Project Planner is a tool within the LymphoTrack MRD Software that aids in the design of experiments and features a confidence interval calculator to determine the confidence level of a true MRD negative sample. The software embedded calculator uses the number of replicates, number of resequences, number of reads per sequencing, and amount of (input) DNA to determine the confidence level of a true MRD negative sample from 10-3 to 10-6. The Project Planner ensures the experimental design meets the user-defined requirement for combined sensitivity and confidence necessary for MRD monitoring.

4.1. Open the start menu, and then click LymphoTrackMRD to open the software.

4.2. Read the license agreement. To accept the terms, click the Accept button to proceed.

4.3. From the main window, click the Help tab from the toolbar on the top left of the window, then select the Project Planner item from the drop-down menu.

4.4. A new window will appear which will allow the user to calculate the confidence of a true negative MRD result depending on estimates of the experimental setup. There are four different inputs the user must provide:

# of Replicates. Please note that subsequent values (# of resequences/# of reads/amount of DNA) pertain to EACH PCR replicate, not the total of all replicates combined.

# of Resequences. The typical value here is 1 (meaning only a single sequencing run).

o Resequences, by definition, will have the same sample index, and the selected unique reads files are assigned the same PCR replicate number in the Replicate field of the software, as described in 5.7.

# of Reads per Sequencing. Estimated read depth based on the read capacity of the flow cell or chip divided by the number of samples and sample replicates run on the flow cell or chip.

o If a value of 100,000 is assigned to a single replicate with only the initial sequencing, the total reads will be 100,000. If a value of 100,000 is assigned to a single replicate with the initial sequencing plus a resequenced run, (a value of 2 for # of Resequences), the total reads will be 200,000.

Amount of DNA: This is the amount of DNA input to each PCR replicate. For example, if the experiment setup was to sequence 5 replicates of 1000 ng of DNA, input the value 1000, NOT 5000.

4.5. After entering each value, click Calculate Confidence. The lower right quadrant of the window will display the percent confidence of a negative result at each sensitivity level when considering the number of PCR replicates, number of resequences, amount of DNA, and number of reads per sequencing.

A sensitivity level of 10-6 is equivalent to a level of one in a million. As such, being confident in a negative result at this level requires significantly more than one million reads or the amount of DNA from one million cells.

of 18

LymphoTrack MRD Software 280364 Rev. E | January 2020 For RESEARCH USE ONLY. Not for Use in Diagnostic Procedures

5. Running the LymphoTrack MRD SoftwarePrior to analyzing sample and control data with the LymphoTrack MRD Software, identify the clonal sequence(s) to be tracked using an initial highly clonal sample analyzed with the appropriate LymphoTrack Assay and the corresponding LymphoTrack Software (for Ion S5/PGM 7-500-0007 or MiSeq 7-500-0009). Once clonal sequences are identified they can be tracked using the LymphoTrack MRD Software. Refer to Figure 1 for a summary of the sample processing workflow.

Figure 1. MRD sample testing workflow begins with identification of the clonotype sequence(s) from highly clonal samples with the LymphoTrack Assay kits and Software. To track the clonotype over time, subsequent sample testing is performed using the LymphoTrack Assay kit with the respective LymphoQuant Internal Control and LymphoTrack Low Positive Control. Lastly, the LymphoTrack MRD Software is used to estimate the clonotype frequency over time.

Follow the diagram in section 13: Appendix A: Analysis Workflow for LymphoTrack MRD Software for a schematic on the steps to perform MRD data analysis. Use the below instructions to first perform analysis of the run control (LymphoTrack Low Positive Control and/or LymphoQuant Internal Control) to verify the entire run completed properly, then continue with the combined Sample and LymphoQuant Internal Control analyses following the same steps.

5.1. Click to open the Start Menu, and then click LymphoTrackMRD to open the software. To accept the terms, click the Accept button to proceed.

5.2. In the new window (Paste Clonotype Sequence Below), select the Gene Target used from the drop down menu.

5.3. Type in a project name using only the characters (A-Z, a-z, 0-9, _, -) and no more than one consecutive space in the field labeled Project Name.

5.4. Click on Sequence 1 and type in the name of the clonotype sequence to be tracked (control or sample) using only the characters (A-Z, a-z, 0-9, _, -) and no more than one consecutive space in the field labeled Sequence 1 Name. Copy and paste the appropriate control sequence (from Tables 1, 2, 3, or 4) or sample clonotype sequence (from the LymphoTrack Report) to be tracked into the open box.

The sequence can only contain capital letters [e.g. ACGT] without any spaces. Be sure to copy and paste the full control or clonotype sequence; any missing nucleotides will be treated as

mismatches and could generate an inaccurate Sequence Not Detected result.

IMPORTANT! The clonotype sequence name is used in the output filenames. Windows has a built-in limit of 255 characters for file pathnames and owing to the verbose naming conventions of NGS data, please consider this limitation.

of 18



5.5. If tracking two clonotypes (such as the case for both T-cell controls) or a single clonotype containing the LymphoQuant Internal Control (such as the case for the LymphoTrack B-cell Low Positive Control), click the Sequence 2 tab, type in the name of the control or clonotype sequence to be tracked using only the characters (A-Z, a-z, 0-9, _, -) and no more than one consecutive space in the field labeled Sequence 2 Name. Copy and paste the appropriate control sequence (from Tables 2, 3, or 4) or the second sample clonotype sequence to be tracked into the open box.

The sequence can only contain capital letters [e.g. ACGT] without any spaces. Be sure to copy and paste the full control or clonotype sequence; any missing nucleotides will be treated as

mismatches and could generate an inaccurate Sequence Not Detected result.

Table 1. LymphoTrack B-cell Low Positive Control Sequences for use with B-cell receptor LymphoTrack Assays

LymphoTrack Assay

LymphoTrack B-cell Low Positive Control Sequences

IGHV Leader

GGTCTTCTGCTTGCTGGCTGTAGCTCCAGGTAAAGGGCCAACTGGTTCCAGGGCTGAGGAAGGGATTTTTTCCAGTTTAGAGGACTGTCATTCTCTACTGTGTCCTCTCCGCAGGTGCTCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCTAGAGATCTCACAGGTTGTATTAGTACCAGCTGCTATCCTCCGAACTACTTTGACTACTGGGGCCAGGGAACCCT

IGH FR1

CATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCTAGAGATCTCACAGGTTGTATTAGTACCAGCTGCTATCCTCCGAACTACTTTGACTACTGGGGCCAGGGAACCCT

IGH FR2 TGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCTAGAGATCTCACAGGTTGTATTAGTACCAGCTGCTATCCTCCGAACTACTTTGACTACTGGGGCCAGGGAACCCT

IGH FR3 TCTGAGGACACGGCCGTGTATTACTGTGCTAGAGATCTCACAGGTTGTATTAGTACCAGCTGCTATCCTCCGAACTACTTTGACTACTGGGGCCAGGGAACCCT

IGK AGAGCCTCCTGCATAGTAATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGTTCTAATCGGGCCTCCGGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTCAGGACTTTTGGCCAGGGGAC

Table 2. LymphoQuant B-cell Internal Control Sequences for use with B-cell receptor LymphoTrack Assays

LymphoTrack Assay

LymphoQuant B-cell Internal Control Sequences

IGHV Leader

GTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTCTCCACAGGTGTCCAGTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATAGGCGCGGGGAATGGCCTCCCTCGGATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCAC

IGH FR1

CTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATAGGCGCGGGGAATGGCCTCCCTCGGATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCAC

IGH FR2 TGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATAGGCGCGGGGAATGGCCTCCCTCGGATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCAC

IGH FR3 TCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATAGGCGCGGGGAATGGCCTCCCTCGGATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCAC

IGK AGCAGGGCCACTGGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCCATGTACACCTTCGGCCAAGGGAC

of 18


Table 3. LymphoTrack T-cell Low Positive Controls Sequences for use with T-cell receptor LymphoTrack Assays

LymphoTrack Assay

Sequence #

LymphoQuant T-cell Low Positive Control Sequences

TRB

1 GAGTTGCTCATTTACTTTAACAACAACGTTCCGATAGATGATTCAGGGATGCCCGAGGATCGATTCTCAGCTAAGATGCCTAATGCATCATTCTCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTACTTCTGTGCCAGCAGTTTCTCGACCTGTTCGGCTAACTATGGCTACACCTTCGGTTCG

2 GGAGGTGAGAAGGAAGCCCCCGGCCTGGTCCATACCCCACCACCAACTTGCATAATGGGGGGTGATGTCACCCACCCTCCACTCCCCTCAAAGGAGCAGCTGCTCTGGTGGTCTCTCCCAGGCTCTGGGGGCGGACCCATGGGAGGGGCTGTTTTTGTACAAAGCTGTAACATTGTGGGGACAGGGTTTAGAACTCTGGAAACACCATATATTTTGGAGAG

TRG

1 GAAGACTAAGAAACTTGAGGTAAGTAAAAATGCTCACACTTCCACTTCCACTTTGAAAATAAAGTTCTTAGAGAAAGAAGATGAGGTGGTGTACCACTGTGCCTGTCAGATCCTCACAGGGCGGGTTTAAGAAACTCTTTGGCAGTG

2 GGAATCAGTCGAGAAAAGTATCATACTTATGCAAGCACAGGGAAGAGCCTTAAATTTATACTGGAAAATCTAATTGAACGTGACTCTGGGGTCTATTACTGTGCCACCTGGAAATTTTATTATAAGAAACTCTTTGGCAGTG

Table 4. LymphoQuant T-cell Internal Control Sequences for use with T-cell receptor LymphoTrack Assays

LymphoTrack Assay

Sequence #

LymphoQuant T-cell Internal Control Sequences

TRB

1 CAAAGCTGCTGTTCCACTACTATGACAAAGATTTTAACAATGAAGCAGACACCCCTGATAACTTCCAATCCAGGAGGCCGAACACTTCTTTCTGCTTTCTTGACATCCGCTCACCAGGCCTGGGGGACGCAGCCATGTACCTGTGTGCCACCAGCAGAGATGGAAAGGGCAGCAATCAGCCCCAGCATTTTGGTGATG

2 AAGGGCTGAGATTGATCTACTACTCACAGATAGTAAATGACTTTCAGAAAGGAGATATAGCTGAAGGGTACAGCGTCTCTCGGGAGAAGAAGGAATCCTTTCCTCTCACTGTGACATCGGCCCAAAAGAACCCGACAGCTTTCTATCTCTGTGCCTATTAGGGGAGAGTGGGCTCTCCTACGAGCAGTACTTCGGGCCGGGCACCA

TRG

1 GGAATCAGCCCAGGGAAGTATGATACTTACGGAAGCACAAGGAAGAACTTGAGAATGATACTGCGAAATCTTATTGAAAATGACTCTGGAGTCTATTACTGTGCCACCTGGGATGGAGCGTCTACGAATTATTATAAGAAACTCTTTGGCAGTG

2 TGGGTAAGACAAGCAACAAAGTGGAGGCAAGAAAGAATTCTCAAACTCTCACTTCAATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGGGTATTATTATAAGAAACTCTTTGGCAGTG

5.6. Click the Edit Replicates button to open a window.

To return to the previous screen at any time, click the Back button at the top right of the screen. Only the information saved will be retained.

5.7. Click the + button under Replicate field to create PCR replicate number.

Although the PCR replicate will not visibly update, an additional replicate will become available in the dropdownmenu with each additional click of the + button.

5.8. Select the PCR replicate number from the dropdown menu under the Replicate field.

5.9. For the replicate selected, in the field labeled Amount of DNA, enter the amount of total DNA (in nanograms) added to the reaction.

This value can range from 50 to 7000 ng. Do not use decimal places. When analyzing the LymphoTrack Low Positive Control, the Amount of DNA is 200 ng. When analyzing the LymphoQuant Internal Control from sample wells, the Amount of DNA is the total sample DNA

in each reaction (in nanograms).

of 18


5.10. Click the Select a Unique Reads File button and select the *.combined.fastq_unique_reads.tsv file to be analyzed.

These files are generated using the LymphoTrack Software (for Ion S5/PGM 7-500-0007 or MiSeq 7-500-0009). This file may have a TSV extension and will be located within an *._output run folder created by theLymphoTrack software after the initial analysis of the FASTQ data from either the MiSeq, Ion S5, or Ion PGMinstruments.

Note that the *.CDR3_unique_reads file can be analyzed to track only the CDR3 sequence. If this file is chosen,ensure to use a CDR3 sequence on Sequence 1 and Sequence 2 tabs in the main window.

IMPORTANT! The clonotype sequence and *.unique_reads file must both come from the same version of LymphoTrack software. Analyzing sequences or files from mismatched software versions can result in a false negative report. To check the version of the LymphoTrack software used, open the log file present in the *_output run folder. The software version will appear immediately after the ***System info*** tag.

IMPORTANT! Each PCR replicate sequenced will have a *.unique_reads file generated by the LymphoTrack software. When clicking Select a unique Reads File, each file is associated with a different replicate number from the Replicate dropdown list.

5.11. Once the input form is completed, click the Save Replicate button to add to the replicate list. Enter as many replicates as needed by repeating steps 5.8 through 5.11.

5.12. Once all replicate information is entered and all replicates are listed in the replicate list, close the Select Unique Reads File window by clicking the X in the top right corner, or by clicking the Back button.

5.13. After returning to the main window and completing all fields, click the Perform MRD Analysis button to start the analysis.

5.14. Correct any errors that appear in red; for additional details regarding error messages, please refer to section 8: Troubleshooting. If the setup contains no errors, a prompt will request an output location to be selected. Select the folder location to save files generated by the LymphoTrack MRD software.

The analysis begins processing automatically. While software is processing data, the window header may indicate (Not Responding).

5.15. Per the workflow diagram found in section 12 you may need to perform several MRD analyses to obtain results for the Low Positive Controls, LymphoQuant Internal Controls and/or sample clonotypes.

5.16. To start a new MRD analysis, click on X to close the Sequence windows, then click the File tab from the main window and select Start New MRD Analysis.

of 18


6. Software Results6.1. When the program is finished, two output windows will display the results containing the highest cumulative read

frequencies for exact sequence matches and one or two nucleotide mismatch sequences.

If one sequence was entered, the Sequence 2 pop-up window can be closed and ignored. The output data files for each sequence can be found in the output folder selected in step 5.14. The files created for each sequence are listed in Table 5, below.

Table 5. Output files Output Files Created Description of File

ProjectName_SequenceName_Date_output_table

A comma-separated-value (CSV) formatted file that contains intermediate data values used to produce the full output.

ProjectName_SequenceName_Date_one_mismatch_sequences

A FASTA formatted file that contains all sequences exactly one mismatch from the target sequence.

ProjectName_SequenceName_Date_two_mismatch_sequences

A FASTA formatted file that contains all sequences exactly two mismatches from the target sequence.

Date_project name_MRDReport A PDF file that contains the project and sequence information as well as displays the results containing the highest observed cumulative read frequencies for exact sequence matches and 1 or 2 nucleotide mismatch sequences for each run.

6.2. The results window will display the following information:

MRD Project Name, as defined in the main window. Sequence Detected or Sequence Not Detected and the number of PCR replicates analyzed. A PCR replicate

contains a unique index and may be resequenced to increase the number of reads for the PCR replicate—in whichthe read count is the sum of reads from each sequencing run.

Sequence Name, as defined in the main window. Amount of DNA (in nanograms), as defined on the Select Unique Reads File window for the replicate with the

highest cumulative read frequency. Number of Reads in Replicate, obtained from the unique reads file for the replicate with the highest cumulative

read frequency. MRD Analysis of a unique reads file defined on the replicate window for the replicate with the highest cumulative

read frequency. Read counts for an exact sequence match and one or two nucleotide mismatches. Read frequency for an exact match of the clonotype sequence, and Cumulative Read Frequency (CRF) for

sequences with one nucleotide mismatch, and for sequences with two nucleotides mismatch as compared to theclonotype sequences pasted on the main window.

Mutant will be displayed under Sequence Detected to flag if the read count for a sequence with one or twomismatches is greater than the read count for an exact sequence match.

If the clonotype sequence was Not Detected, the confidence values for this call at 10-3, 10-4, 10-5, and 10-6 sensitivitylevels are provided. The confidence level is determined using the amount of DNA, number of PCR replicates,number of resequences, and read depth.

IMPORTANT! The run time of the analysis will depend on the size of the sample file being analyzed, as well as the computer processor speed. A typical sample containing 100,000 unique reads will generally take less than three minutes to analyze. This run time may vary greatly depending on the complexity of the unique reads.

6.3. The software will also create a PDF Report in the output folder indicated in step 5.14.

The PDF Report will contain the project and sequence information as well as display the results containing thehighest observed cumulative read frequencies for exact sequence matches and one or two nucleotide mismatchsequences for one or two sequences.

of 18


7. Data Analysis7.1. Determine if the run was valid.

To analyze validity of a LymphoTrack Low Positive Control, track the specific sequence(s) for that target (found in Table 1 forB-cell assays and Table 3 for T-cell assays). A valid result of tracking this sequence is a Sequence Detected MRD Status; in theevent that this sequence is Not Detected, consider the run to be invalid. Please refer to the Troubleshooting section of therespective LymphoTrack assay IFU in the event of an invalid run.

NOTE: When using LymphoTrack T-cell Low Positive Control, at least one of the two tracked sequences must result in a Sequence Detected status.

To analyze validity of LymphoQuant Internal Control (within the LPC), track the specific sequence for that target (found in Table 2 for B-cell assays and Table 4 for T-cell assays). The result of tracking this sequence(s) should be a Read Count > 0; in the event that the read count is 0, consider the run to be invalid. Please refer to the Troubleshooting section of the respective LymphoTrack assay IFU in the event of an invalid run.

NOTE: When using LymphoQuant T-cell Internal Control, at least one of the two tracked sequences must result in a Read Count > 0.

7.2. Determining Clonotype Cell Equivalents Using the Sample and Respective LymphoQuant Internal Control Results

When tracking B-cell clonotypes (noting the limitations for certain IGK rearrangements, see section 2.2), theestimated clonotype cell equivalent for the sample can be calculated using the 2 Mismatch Cumulative ReadFrequency, shown in Equation 1:

Equation 1. Estimated clonotype B-cell equivalent

2 𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀ℎ 𝐶𝐶𝐶𝐶𝑀𝑀𝐶𝐶𝐶𝐶𝑀𝑀𝑀𝑀𝑀𝑀𝐶𝐶𝐶𝐶 𝑅𝑅𝐶𝐶𝑀𝑀𝑅𝑅 𝐹𝐹𝐹𝐹𝐶𝐶𝐹𝐹𝐶𝐶𝐶𝐶𝐹𝐹𝑀𝑀𝐹𝐹𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆

2 𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀ℎ 𝐶𝐶𝐶𝐶𝑀𝑀𝐶𝐶𝐶𝐶𝑀𝑀𝑀𝑀𝑀𝑀𝐶𝐶𝐶𝐶 𝑅𝑅𝐶𝐶𝑀𝑀𝑅𝑅 𝐹𝐹𝐹𝐹𝐶𝐶𝐹𝐹𝐶𝐶𝐶𝐶𝐹𝐹𝑀𝑀𝐹𝐹𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿 × 100 𝑀𝑀𝐶𝐶𝐶𝐶𝐶𝐶𝑀𝑀

When tracking T-cell clonotypes (noting the precautions mentioned in section 2.3), the estimated clonotype cellequivalent for the sample can be calculated using the Exact Match Cumulative Read Frequency, shown inEquation 2:

Equation 2. Estimated clonotype T-cell equivalent

𝐸𝐸𝐸𝐸𝑀𝑀𝑀𝑀𝑀𝑀 𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀ℎ 𝐶𝐶𝐶𝐶𝑀𝑀𝐶𝐶𝐶𝐶𝑀𝑀𝑀𝑀𝑀𝑀𝐶𝐶𝐶𝐶 𝑅𝑅𝐶𝐶𝑀𝑀𝑅𝑅 𝐹𝐹𝐹𝐹𝐶𝐶𝐹𝐹𝐶𝐶𝐶𝐶𝐹𝐹𝑀𝑀𝐹𝐹𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆

�𝐸𝐸𝐸𝐸𝑀𝑀𝑀𝑀𝑀𝑀 𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀ℎ 𝐶𝐶𝐶𝐶𝑀𝑀𝐶𝐶𝐶𝐶𝑀𝑀𝑀𝑀𝑀𝑀𝐶𝐶𝐶𝐶 𝑅𝑅𝐶𝐶𝑀𝑀𝑅𝑅 𝐹𝐹𝐹𝐹𝐶𝐶𝐹𝐹𝐶𝐶𝐶𝐶𝐹𝐹𝑀𝑀𝐹𝐹𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿 𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆 #1 + 𝐸𝐸𝐸𝐸𝑀𝑀𝑀𝑀𝑀𝑀 𝑀𝑀𝑀𝑀𝑀𝑀𝑀𝑀ℎ 𝐶𝐶𝐶𝐶𝑀𝑀𝐶𝐶𝐶𝐶𝑀𝑀𝑀𝑀𝑀𝑀𝐶𝐶𝐶𝐶 𝑅𝑅𝐶𝐶𝑀𝑀𝑅𝑅 𝐹𝐹𝐹𝐹𝐶𝐶𝐹𝐹𝐶𝐶𝐶𝐶𝐹𝐹𝑀𝑀𝐹𝐹𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿 𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆 #2 � × 100 𝑀𝑀𝐶𝐶𝐶𝐶𝐶𝐶𝑀𝑀

NOTE: When tracking bi-allelic clonotypes, add the sum of the Exact Match Cumulative Read Frequencies for both sample sequences.

Please refer to Figure 2 for an example of PDF report data.

of 18


Figure 2. Example of PDF report. • Use the 2 Mismatch Cumulative Read Frequency values to deterrmine the B-cell clonotype cell equivalent• Use the Exact Match Cumulative Read Frequency values to determine the equivalent T-cell clonotype cell equivalent

of 18


8. TroubleshootingThe following error messages will appear in the application of the input screen if any input parameters are either missing or incompatible.

Table 6. Input parameter error messages and corrective actions

Error Message Cause Resolution

Amount of DNA was not present or not a number

Did not input any number, or information contained non-numbers.

Input a whole number between 50 and 7000 ng in the Amount of DNA box.

Amount of DNA must be a whole number

A decimal number was entered. Only use whole number without decimal points.

Amount of DNA lower than 50 ng

Quantity of DNA in the input box was lower than 50 ng.

Input a number between 50 and 7000 ng in the Amount of DNA box.

Amount of DNA higher than 7000 ng

Quantity of DNA in the input box was higher than 7000 ng.

Input a number between 50 and 7000 ng in the Amount of DNA box.

Sequence missing A sequence was not added to the Input Sequence box.

Input a DNA sequence in the Input Sequence box, only including capitalized A, C, G, and T.

Unique Reads File was not selected

A unique reads file was not added to the Select Unique Reads File button.

Select a unique reads file using the Select Unique Reads File button.

Caution: Unique Reads file is from LymphoTrack 1.6 or earlier

A unique reads file generated by a LymphoTrack software version 1.6 or lower was selected.

Ensure the clonotype sequence and *.unique_reads file are both from the same version of the LymphoTrack software.

To check the version of the LymphoTrack software used, open the log file present in the *_output run folder. The software version will appear immediately after the ***System info*** tag.

Replicate number was not selected

A replicate was attempted to be saved without selecting a replicate number from the drop down.

Ensure that at replicates have been added by clicking the + button. Then select the replicate number from thedropdown list.

Amount of DNA for Resequencing must be equal.

Amount of DNA for resequencing must be equal.

The user cannot enter different DNA amounts for samples that share a Replicate Number.

Replicates that share Replicate Numbers are identified as resequences and can be drawn from the initial PCR replicate library.

Sequence Name missing A sequence Name was not added to the Sequence Name box.

Input a sequence name in the Sequence Name box following step 5.4.

Project Name missing A project Name was not added to the Project Name box.

Input a project name in the Project Name box following step 5.3.

Reads missing Unique Read files were not able to be read.

Unique Read files selected for replicate were not able to be read or no replicates have been entered.

No Replicates entered No replicates were saved. Ensure all data for a replicate has been entered and the replicate has been saved before leaving the Edit Replicate window.

Illegal Character in Project and/or Sequence Name

Naming convention was not followed. Use only letters, numbers, characters and a single space as identified in the Warnings and Precautions section.

Sequence Incomplete Either the sequence or the sequence name is missing.

A sequence and a sequence name are required before performing the analysis.

of 18


Table 6. Input parameter error messages and corrective actions

Error Message Cause Resolution

Identical Sequence Names Sequence 1 and 2 have identical names. Assign a unique sequence name for each sequence input.

Input Sequence unknown Sequence contains characters other than A, C, G, and T.

Sequence must contain [ACGT] in capital letters only.

Caution: A CDR3 sequence file has been selected, please ensure that the sequence is also a CDR3 sequence.

CDR3 sequence file detected.

The user may analyze unique read files for CDR3 unique reads, but a read summary file from the same version of LymphoTrack is also required. Ensure the sequence used from the CDR3 unique reads file is a sequence of interest.

Caution: Unknown Extension Unknown TSV detected.

The user selected an unknown unique reads file, with a corresponding read summary; however, the naming convention of the files has deviated from current LymphoTrack output.

The user may rename files to the original LymphoTrack extensions to remove warning.

9. Technical and Customer ServiceWe appreciate your business. We are happy to assist you with understanding this software, and will provide ongoing technical assistance Monday through Friday to keep the assays performing efficiently in your laboratory.

Contact Information Authorized Representative and EU Technical Assistance

Invivoscribe, Inc. Invivoscribe Technologies, SARL 10222 Barnes Canyon Road, Bldg. 1 Le Forum – Bât B San Diego, CA 92121-2777 515 Avenue de la Tramontane USA ZI Athélia IV

13600 La Ciotat, France

Phone: +1 858 224-6600 Phone: +33 (0)4 42 01 78 10Fax: +1 858 224-6601 Fax: +33 (0)4 88 56 22 89Technical Service: [email protected] Technical Service: [email protected] Service: [email protected] Customer Service: [email protected]: www.invivoscribe.com Website: www.invivoscribe.comBusiness Hours: 7:00AM – 5:00PM PST/PDT Business Hours: 9:00AM – 5:00PM CET/CEST

10. SymbolsThe following symbols are used in Invivoscribe NGS product labeling.

Catalog Number Manufacturer

Authorized Representative in the European Community Consult Instructions for Use

Lot Number Expiration Date

Storage Conditions





http://www.invivoscribe.com/

http://www.invivoscribe.com/

of 18


11. Software Frequently Asked Questions

Q1: Why did the software create two sets of output when only one sequence was entered?

A1: Software maintains consistent output to assure that analysis was completed successfully with one or two sequences. If no sequence was added to the Sequence 2 tab before analysis, the output files will be empty.

Q2: Why was a Replicate Number not created in the Replicate dropdown when the + button was selected?

A2: In some cases, Windows language packs have been identified to interfere with software buttons. If any problems occur when clicking a button that the system does not register, please contact [email protected] for information about the Windows language pack.

Q3: Why does the Software only display a single Replicate for the output window?

A3: Each replicate number represents an independent experiment. Statistical evidence to overcome the assumption of true negative requires a single experiment to reach the threshold of five reads. Separate PCR replicates cannot be added together for the sake of determination, and only the highest signal replicate is shown.

Q4: How does detection relate to expression?

A4: Analysis is qualitative and is intended to call only Detected or Not Detected. Read count and frequency are not intended to establish quantification.

Q5: Why do confidence values decrease when DNA Input is added to the Project Planner?

A5: Confidence values are based on statistical calculations involving the number of cells and the total read count. DNA Input does not form a linear relationship with confidence values, and can in fact hurt confidence. If more DNA is tested, but the read depth does not increase, it is possible to decrease confidence.

Q6: Why are some fields missing or blank in the PDF?

A6: In the event that fields are missing or blank, please use Adobe Reader. Internet Explorer has been observed to not display all PDF information. If the reports are blank when opening in Adobe Reader, please install the additional font package found at https://supportdownloads.adobe.com/thankyou.jsp?ftpID=6484&fileID=6484.

Q7: Why is the tracked clonotype sequence found in every sample in the run?

A7: Tracking a sequence for MRD requires a high level of sensitivity and specificity. To prevent cross-contamination due to low levels of index misassignment from impacting results, ensure that the highly clonal sample was not run on the same chip or flow cell as any of the follow-up samples assessed for the same clonal sequence. To ensure specificity, verify the clonal sequence is optimal for MRD assessment by searching for the clonal sequence in a *.combined.fastq_unique_reads.tsv file generated using the LymphoTrack Negative Control with the respective LymphoTrack Assay. It is important that the Negative Control sequence data used for this analysis was generated on an NGS run which did not contain any sample with the potential of containing the clonal sequence in question. Please refer to section 2: MRD Analysis is Locus-Sensitive for considerations which may aid in the selection of a suitable MRD sequence for tracking.


https://supportdownloads.adobe.com/thankyou.jsp?ftpID=6484&fileID=6484

of 18


12. End User License AgreementTHIS AGREEMENT MUST BE ACCEPTED BY AN AUTHORIZED REPRESENTATIVE OF THE END USER OF THIS PRODUCT PRIOR TO USING THE LYMPHOTRACK® SOFTWARE. BY USING THE LYMPHOTRACK® SOFTWARE, YOU ASSERT THAT YOU ARE AN AUTHORIZED REPRESENTATIVE OF THE END USER WITH AUTHORITY TO ENTER INTO THIS AGREEMENT.

This End User License Agreement (‘EULA’) is made and entered into by and between INVIVOSCRIBE, INC. (‘Licensor’) and You (either an individual or a legal entity), the ‘Licensee,’ as defined herein for the licensing and usage of the Licensor’s software. Licensee acknowledges and agrees that Licensee’s right to use the software in any manner shall be controlled by this EULA and that such use shall be strictly in accordance with the terms and conditions of this EULA.

1. GRANT OF LICENSE. Licensor grants to Licensee a non-exclusive, non-transferable, limited license, without right to sublicense, to use the software and any accompanying written materials and any documents or other content embodying information contained within the software (collectively, the‘Product’) only for Licensee’s own use. Except as agreed in a document signed by Licensor, the software license granted in the preceding sentenceis limited to use with Licensor's LymphoTrack® Assays purchased from Licensor or from an authorized distributor of Licensor. Licensor reserves all rights not expressly granted to Licensee or to Licensee. The limited license granted by this EULA and Licensee’s payment of the license fee giveLicensee the right to use the Product only in accordance with the terms of this EULA. This license is not a sale of the original software or any copy.

2. CONFIDENTIALITY. Licensee agrees that the Product is based on and includes one or more proprietary trade secrets, copyrights, patentapplications, and/or granted patents (‘Intellectual Property’) of Licensor. Possession and use of the Product shall be strictly in accordance with thisEULA, and receipt or possession does not convey any rights to divulge, reproduce, or allow others to use the Product outside the terms of this EULA without specific written authorization of Licensor. Licensee agrees not to disclose, publish, translate, release, or distribute copies of the Product orany portion thereof to others outside the terms of this EULA. Licensee may not modify, adapt, translate, reverse engineer, decompile, disassemble,or create derivative works based on any portion of the Product, including any documents or other content produced using the software.

3. OWNERSHIP OF PRODUCT. Title to, ownership of, and all rights and interests in the Product, all copies thereof, and ‘Intellectual Property’ relatingthereto, remains at all times vested in Licensor.

4. COPY RESTRICTIONS. The Product is copyrighted. Unauthorized copying or modification of the Product, including software that has beenmodified, merged, or included with other software, is expressly forbidden. Licensee may be held legally responsible for any copyright infringementthat is caused or incurred by Licensee’s failure to abide by the terms of this EULA.

5. TRANSFER RESTRICTIONS. This Product is licensed to Licensee, and may not be transferred to anyone without the prior written consent ofLicensor. In no event may Licensee transfer, assign, rent, lease, sell, or otherwise dispose of the Product, or any portion thereof, on a temporarybasis, except as expressly provided herein.

6. TERMINATION. This license will be terminated automatically without notice if Licensee fails to comply with any provision of this license.

7. LIMITED WARRANTY. THE PRODUCT, INCLUDING SOFTWARE AND ACCOMPANYING WRITTEN MATERIALS, INCLUDINGINSTRUCTIONS FOR USE, ARE PROVIDED ‘AS IS,’ WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESS OR IMPLIED,INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULARPURPOSE. LICENSEE BEARS THE ENTIRE RISK OF THE QUALITY AND PERFORMANCE OF THE PRODUCT.

8. LIMITED LIABILITY. IN NO EVENT SHALL LICENSOR BE LIABLE FOR ANY DIRECT, INDIRECT, CONSEQUENTIAL, ORINCIDENTAL DAMAGES, INCLUDING DAMAGES FOR LOSS OF PROFITS, LOSS OF DATA, BUSINESS INTERRUPTION, OR LOSSOF GOODWILL, AND THE LIKE, ARISING OUT OF THE USE OF OR INABILITY TO USE THE PRODUCT, EVEN IF LICENSOR HASBEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. Because some states do not allow the exclusion or limitation of liability forconsequential or incidental damages, the above limitations may not apply to Licensee.

9. GOVERNING LAW. This EULA shall be governed by the laws of the State of California, and Licensee consents to jurisdiction by the state andfederal courts sitting in the State of California.

10. COMPLETE AGREEMENT. This EULA is the entire agreement between Licensor and Licensee with respect to the specific terms set forth hereinconcerning license and warranties of the Product and any other included term or obligation. This EULA replaces all prior understandings andagreements, whether written or oral. This EULA may not be modified unless Licensor and Licensee both assent in writing.

11. SEVERABILITY. If for any reason a court of competent jurisdiction finds any provision or part of any provision of this EULA unenforceable, thatpart or provision shall be enforced to the maximum extent permitted by law so as to affect the intent of the parties, and the remainder of the EULAshall continue in full force and effect.

© 2020 Invivoscribe, Inc. All rights reserved. The trademarks mentioned herein are the property of Invivoscribe, Inc. and/or its affiliates, or (as to the trademarks of others used herein) their respective owners. ILLUMINA® and MISEQ® are registered trademarks of Illumina, Inc. Life Technologies® is a registered trademark and Ion S5™ and PGM™ is a trademark of Thermo Fisher Scientific and its subsidiaries. MICROSOFT®, WINDOWS® and EXCEL® are registered trademarks of Microsoft Corporation.

of 18


13. Appendix A: Analysis Workflow for LymphoTrack MRD Software

of 18


instructions for use lymphotrack mrd software v1.2 · are less suitable for mrd testing due to the...

Documents