independent fluctuation of human immunodeficiency virus type 1
TRANSCRIPT
JOURNAL OF VIROLOGY, Aug. 1991, p. 4502-45070022-538X/91/084502-06$02.00/0Copyright C 1991, American Society for Microbiology
Independent Fluctuation of Human Immunodeficiency Virus Type 1rev and gp4l Quasispecies In Vivo
LIVIA PEDROZA MARTINS,' NICOLE CHENCINER,1 BIRGITTA ASJO,2 ANDREAS MEYERHANS,"3AND SIMON WAIN-HOBSON'*
Laboratoire de Retrovirologie Moleculaire, Institut Pasteur, 75724 Paris, France'; Department of Virology,Karolinska Institute, S-10521 Stockholm, Sweden2; and Department of Virology, Institut for Medical
Microbiology and Hygiene, University of Freiburg, D-7800 Freiburg, Germany3
Received 4 March 1991/Accepted 15 May 1991
The human immunodeficiency virus type 1 (HIV-1) overlapping rev and env coding sequences have beenexamined from sequential peripheral blood mononuclear cell DNA samples from one individual. These were thesame DNA samples from which sequence data for the tat and nef/long terminal repeat loci have been derivedand span a 4-year period. The rev/env sequences were established by sequencing cloned polymerase chainreaction products. The structure of the populations of rev protein sequences increased in complexity withdisease, while those of the corresponding env sequences remained complex. This suggests that the rev and env
populations evolved differently, probably reflecting different selection pressures. No defective rev variantsencoded substitutions in residues 76 through 79, indicating that the experimental finding of down regulation ofrev activity by competitive inhibition may not necessarily occur in vivo. After having analyzed three HIV loci(15% of the genome) from the same individual over 4 years, it is clear that no two loci evolved similarly,indicating the difficulties in comparing data from different loci.
RNA viruses have been described as populations of viralgenomes, or quasispecies (5), waiting to be selected (4). Thisfeature is rooted in the elevated viral polymerase nucleotidemisincorporation rate. Reassortment and recombination can
contribute significantly to the heterogeneity of an isolate(11). The quasispecies nature of human immunodeficiencyvirus (HIV) in vivo and ex vivo has been intensively exam-
ined (6, 8, 16, 22, 24). Sequence analyses have described theevolution of HIV proviral sequences in vivo, thus overcom-ing the selective constraints of ex vivo culture upon thequasispecies (3, 16, 27). A longitudinal study of the HIV-1proviral DNA sequences from a Swedish patient has beenundertaken. Thus far, the tat and nefllong terminal repeat(LTR) loci have been analysed for the period June 1985 toJune 1989 (3, 16). Disease progression was not correlatedwith the appearance of more efficient tat or LTR sequences.These and other studies have revealed considerable propor-tions of functionally defective genomes (8, 16).
Here, we have focused on the second rev coding exon ofHIV-1. The rev protein is a small molecule of 116 residuesencoded by two exons specifying residues 1 through 26 and27 through 116 (25). It is essential to viral replication and isinvolved in directing high-molecular-weight (i.e., gaglpoland env) mRNAs to the cytoplasm either by aiding transport(15) or by modulation of splicing (1, 13). The rev protein actsvia a complex RNA secondary structure called the rev-
responsive element located in the env open reading frame(ORF) (10, 15). At least three important functional regions ofthe rev gene have been identified. The first is the aminoterminus, which is thought to be involved in binding to therev-responsive element (14, 19). The second is a highly basicsequence (residues 35 through 50), which is involved intargeting the rev protein to the nucleus or nucleolus (14, 19).Substitutions in the third region (residues 76 through 79),
* Corresponding author.
while inactivating rev function, resulted in mutants capableof competitively inhibiting the native rev protein (14).
In the present study, two questions were addressed. First,since this exon overlaps completely the gp4l region of theenv ORF and the second tat exon, could the amino acidsequences evolve differently? Second, could defective rev
gene products (14) be used as a means of autoregulation ofHIV, as has been shown experimentally? Consequently, a
longitudinal structure-function study of rev quasispecies invivo as well as an ex vivo isolate was undertaken with thesame DNA samples from the Swedish patient.The clinical and immunological data associated with the
blood samples (Li, L2, L3, L5, and L6) and virus isolation(V6) have been previously described (3, 16). Suffice it to saythat Li, L2, L3, L5, and L6 were taken in June 1985, March1986, June 1986, February 1989, and June 1989, respectively.V6 corresponds to the HIV-1 isolate derived from coculti-vation of the L6 sample with donor peripheral blood mono-
nuclear cells. Total DNA was extracted as previously de-scribed (3, 16).The segment of the HIV-1 genome amplified from patient
DNA is shown in Fig. 1A. It was decided not to amplify the3-kb fragment encoding the two rev coding exons for threereasons. First, natural recombination between HIV-1 ge-nomes will probably uncouple any possible cis evolution ofthe two exons (3, 11). Second, it was important to avoidpolymerase chain reaction (PCR)-mediated recombination(17). This was shown to be sequence specific. The probabil-ity of generating PCR-mediated recombinants would surelyhave been greater upon amplification of the 3-kb fragment,as opposed to the 300-bp test fragments (17). Third, the firstrev coding exon quasispecies were already established as
part of the preceeding study of the tat gene and alreadyshown to be reasonably homogeneous.Thus, the second exon of the rev gene was amplified as
part of a larger 411-bp fragment from patient DNA by usingprimers REV3 and REV5 (Fig. 1A). The DNA plus strandprimer REV3 (5'-CACCTCGAGTGATAGTAGGAGGCTT
4502
Vol. 65, No. 8
NOTES 4503
EJEJE~~.rev.SI pi0I l
-
Da vI I%aenv uI i env I
r~~~~~-"
A PBMC DNA
5 HIV-1 LAI
EXPRESSIONC VECTOR
ATG SD
REV IB REV2
SV40 E HindillL===;ATG SD
-_ SA TAG
REV 3 REV 5
SA TAG
REV 3 REV 4
Sacl Bgill/BamHIXho
SA TAG
FIG. 1. PCR amplification of the HIV-1 rev gene and construction of chimeric rev expression vector. The organization of the HIV-1genome is shown at the top of the figure. (A) Segment (stippled box) amplified from fresh peripheral blood mononuclear cell DNA (Li, L3,L6) and from the V6 isolate by using primers REV3 and REV5. The amplified region encoded both second coding exons of rev and tat anda fragment of the gp4l gene. (B) The regions harboring the first and the second coding exons of rev (open boxes) were amplified from HIV-1Lai plasmid DNA by using PCR primers REV1B, REV2, REV3, and REV4. The major rev splice donor and acceptor sequences are indicatedby SD and SA, respectively. ATG and TAG indicate the rev gene start and stop codon. (C) The amplified fragments of HIV-1 Lai were clonedinto the pASA7 expression vector containing the simian virus 40 early promoter and the hepatitis B virus poly(A) segment. The restrictionsites indicated were those used in its construction and were introduced into the PCR primers. DNA fragments corresponding to rev variants(stippled box) were then subcloned by replacement of the corresponding HIV-1 Lai fragment.
GG) and minus strand primer REV5 (5'-CCGAGCTCTATAACCCTATCTGTCC) mapped to positions 7880 to 7897 and8308 to 8291, respectively, on the HIV-1 Lai sequence (28).In light of recent findings, LAV has been renamed HIV-1 Lai(29). The primers carried XhoI and SacI restriction sites(underlined), respectively. Optimized PCR conditions forthese primers were 1.25 mM MgCl2, 25 pmol of each primer,and 2.5 U of Taq polymerase per 100-,I reaction. The DNAwas amplified for 42 cycles. Thermal cycling parameterswere as follows: denaturation, 95°C, 30 s; annealing, 50°C,25 s; and elongation, 72°C, 2 min. Amplification was fol-lowed by a final 10-min step at 72°C. High-temperature Taqaddition was employed. PCR products were cloned as usual(3). Plaques were screened by hybridization with a rev-specific 32P-radiolabelled probe. Twenty M13 recombinantswere picked from each sample and grown up for sequencing.Single-stranded DNA was sequenced by the dideoxy chaintermination method with fluorescent M13 universal primers,7-azadGTP, and Taq polymerase. The products were re-solved by an Applied Biosystems 370A DNA sequencer. Theerror associated with PCR amplification is such that 1 to 1.5amino acid substitutions per 20 sequences may be due to Taqpolymerase.
rev quasispecies. The populations of rev amino acid se-quences derived from samples Li, L3, and L6, as well as theV6 ex vivo sample, are shown in Fig. 2. One sequence,identified by the symbol *, was common to all four quasi-species (L102R, L304R, L602R, and V624R), while twoother sequences were common to Li and L3 only. That amajor form persisted for 4 years is unusual. Previously, themajor form was invariably derived from a minor formpresent in the preceding quasispecies (3, 16). The structure
of the population of Li rev sequences was most remarkable,being composed of three major (i.e., >5%) forms unaccom-panied by any minor form, at least given the resolution ofthis study. The number of variants in the quasispeciesappeared to increase from Li (3 sequences) to L3 (9 se-quences) to L6 (13 sequences). The internal rev sequencevariation for each of the three quasispecies was between 1and 5%. The isolation of HIV resulted in the outgrowth of aminor form and homogenization of the quasispecies, asevidenced by comparing the L6 and V6 data. Relatively fewdefective rev sequences were identified in this exon. Theyincluded L603R (W45--R45) and L302R. The latter encodeda substitution in the major rev splice acceptor (i.e., AG/AC-*AA/AC).The previous study of the tat sequences from the same
patient (16, 18) naturally included sequence data for the firstrev coding exon. The corresponding populations of proteinsequences specified by this exon are shown in Fig. 3. Asingle form was dominant in all the samples. Noteworthywas the L5 quasispecies, in which a full 30% of sequencesencoded a defective rev sequence due to a G->A transition inthe initiator methionine codon. The rev splice acceptors anddonor sequences 5' and 3' to this coding region wereconserved (23).
env quasispecies. The second rev coding exon is over-lapped by part of the env ORF corresponding to the cyto-plasmic tail of the gp4l transmembrane protein (Fig. 1).Consequently the nucleotide sequence of this region mightbe more constrained than any of the other regions examinedto date. Analysis of the same nucleotide sequence, but thistime in the gp4l ORF, yielded a very different profile. Thusthe Li, L3, and L6 env quasispecies were all complex, being
L---L.I LTR
HUV I-Oly AI
VOL. 65, 1991
4504 NOTES
35 45 55 65 75 85 95 105 115O L105R DPPPSPEGTR QARRNRRRRW RERQRQIRSI SGWIISTYLG RPAEPVPLQL PPLERLTLDC SEDCGTSGTQ GVGSPQILVE SPTVLESGTK
....................... N...... ...........
................ .N
Freq. Rel.Act(%)45 1.640 1 .315 1.6
..............N....... ...... N .............
.A...
... N ..... ...........
N . .A
.........R... ...........
............................ ..........
................ N......V...........
A... T.. ........N....
H
..T..A.TA.......N...I....
N...T..T..........N. T.
...N......
...N......
...N......
...N......
...N......
...N......
...N......
...N......
...N......
...N ......
...N......
...N......
. . .
...... R..
....A..... .
....A..... .
.......
..... A
...... A A
...... A A
40 1 . 320 1 . 610 1.65 0.15 2.65 2.65 0.95 2.75 N.D.
20 1 . 320 1.415 1 . 35 0.045 N.D5 3.05 0.95 2.05 1.75 1.05 1.85 0.8
* V601R ....I.....O V607R ....I.....* V624R .....
V606R ....I.....V621R ....I.....V630R ....I.....
.N....
.....
0. .......
G..K ...... ... .
. N. N
. . N. . N
. . N. . . . . . N
FIG. 2. Genetic and functional complexity of rev quasispecies. The sequences, given here in the one-letter code, were aligned with respectto the most abundant sequence in the initial sample Li. Only the differences were scored, a dot indicating sequence identity; § indicates a G-*Atransition which abolished the main splice acceptor. The four populations correspond to samples Li, L3, L6, and V6. The symbols (* 0 @0
*) on the left identify the same protein sequence in different samples. The activities of 21 of 23 rev variants were determined in a transient CATassay. N. D., not determined. CAT activities relative to HIV-1 Lai are shown in the last column. They represent the means of at least threeexperiments, except for L610, L614, L615, and L621, which represent the means of two experiments. CAT activities after cotransfection ofpIllIAR and HIV-1 Lai homologous plasmids were typically between 10 to 20%, whereas the negative controls were of the order of 1 to 2%.
made up of 16, 13, and 13 sequences, respectively, none ofwhich exceeded 20% (Fig. 4). Only three sequences werecommon to Li and L3. None of the 13 distinct L6 sequenceswere found in the preceeding Li or L3 samples. The internalenv sequence variation for each of the three quasispecieswas between 1 and 5%. Finally the same locus encoded 30amino acid residues corresponding to the second tat codingexon. Despite its small size, fluctuations in the populationsof sequences were observed (data not shown). This contrastswith the striking stability and homogeneity of the data fromthe first rev coding exon (Fig. 3).A number of features in the data presented above might
suggest that stronger selection pressures were operative onthe rev than on the gp41 env locus. First, in both rev exonsa major form persisted for 4 years. Second, Li rev quasispe-cies was much more homogeneous than the correspondingenv quasispecies, and finally, the complexity of the rev
quasispecies increased during disease progression.This study represents the extension of analyses of the
HIV-1 regulatory gene sequences within a Swedish HIV-1-seropositive patient. The preceeding studies described thetat (16) and neftLTR loci (3). Figure 5 attempts to describethe evolution of HIV-1 quasispecies with time. In fact, itrepresents a simplification, since the notion of a quasispeciesmust describe not only the number and frequencies of thecomponent sequences but also the sequence variation. Onlythe rev quasispecies increased in complexity during diseaseprogression. Every locus evolved differently, and withineach locus, every ORF evolved independently. In view ofthis and the fact that the tat, revlenv and neflLTR repre-
Li MAGRSGDSDE.......
. .. .
. . . . .
. . . . . . .
ELLRTVRLIK
D.......... .
.P ........
FLYQS 80%.5%.5%
..... .s5%
.P... 5%
.
L2..................... 95% 0
....G............... 5%
L3 ......... ..... 87%
.. E .................... .7%.................... R. 7%
0
L5 58%
31%
.......N........... ..... 11% A
L6........... .......... ..... 95% 0
................... 5%
V6 .................. 80% 0
.......N............ ..... ... A
I................... ..... 5%
FIG. 3. Sequence variability of the rev amino terminus. Thenucleotide sequence data for Li, L2, and L3 have already beenpublished (16). L5 (February 1989), L6 (June 1989), and V6 (virusderived from sample L6) samples corresponded to subsequent timepoints (18). rev protein sequences, given here in the one-letter code,were aligned to the dominant form present in Li. Dots indicatessequence identity. The frequency of each sequence is given to theright of the figure. Symbols (- A *) indicate identical proteinsequences.
* L102R* L103R
* L304R ..........0 L303R ..........
* L319R ..........
L302R §.........L305R ..........
L31OR ..........
L315R ..........
L323R ..........
L327R ..........
J. VIROL.
* L602RL605R
O L620RL603RL607RL61ORL611RL614RL615R
* L619RL621RL625R
...
.... I.....
....
.... I.....
.... I.....
.... I.....
. . .
.... I.....
50 1 . 025 1 . 310 1 . 35 0.65 0.65 0.8
. .
. T ........ . T .......
.
. T .......
..T..........
..........
..........
..........
.......... .
.......... .
NOTES 4505
726 736 746L105E YSPLSFQTRL PAPRGPDRPD GTEEEGGERD RIL106E............................. .
L108EL11OEL107EL102EL103EL104EL109EL112EL114ELllSEL117EL118EL121EL137E
L310EL321EL308EL323EL311EL302EL303EL304EL305EL314EL315EL319EL324E
. . . . ...... . .. .. .. ...... . .. .. . .. .
* .. .. .. .. .
....... .
.........P
.........P
. . . . P
. . P
. P. . ...P
. . . P. . . . . ...P
. . . . . . . . ...P
. . . . . . .
..........
....P
..........
.P....
L602EL605EL603EL608EL610EL611EL614EL615EL619EL620EL621EL624EL625E
..- .......
..- .......
.SQ.......
..Q.......
..-Q .......
.SQ.......
..-Q .......SQ.......
.SQ.......
. SQ........
..- .......
.SQ.......
.SQ.......
. . . .. .. .. .
. . . .. .. .. .
. . . .. .. .. .
. . . . . . .
. . .. .. .. .
. . .. .. .. .
. . .. .. .. .
. . . . . .
. . . .
. . . . . . . . ..
.1....1I......1I.....
.1........
.1I.....
.1........E......
.1I.....
.1I.....
.1.....
.1I.....
.1I.....
. . . .
. . . . ..
. . . . . . . . .
. .. .. .. .. .
. .. .. .. .. .
...G ......
..........
..........
..........
..........
. .... .. .
. I ........
..........
K
756 766DRSGRLVDG LLAL IWDDLR.. ........... .. .. ...
. ... . .. . ... .. .. ..
.. . . . . . . I.........
......... ............ .....
. ... .. .. . .. .. .
......... ......... ..................
......... ...................
......... ......... ..........
......... ............................... ..........
......... ... p .....
......... ......... .... ....
.. .. .. . .. . .. .. ...
.. . .. . .. .. .. ...
. .. .. ...
.......... .
.
.......... .
.......... .
. . . . . . .
...........E......
776SLCLFSYHRL
.... .. .
... ... .
. .... ...
..........
..........
..........
..........
..........
.. . ... ...
..........
.. . ... ...
..........
.. .. . .
.. .. .
.. ..
.. . ..
.. .
.. ... ..
. .
N. .. ... ...
.. F .......
.. .. .... .
..........
.... ..... .
N ........... ... ...
..F.. .. .. ..
..F.. .. .. ..
v . . .. .. .. .
.R.......
.F.
786RDLLSIAARI
....L......L.....L.L.....
....L.....
....L....
... .....
....L.....
. L.. T......... L ..T ...........L..T ..
..........
.L....T. ..
.... L......
.... L ..T...
. ... ...
....L.....
. .. ....
..L......... L........L.....
..........
....L.....
....L.....
....L.....
....L.....
....L.....
....L.....
....L.....
....L.....
....L.....
....L.....
....L.....
....L.....
796 806 815VELLGRRGWE VLKYWWNLLQ YWSQELKNR
I.....I...... . . . . ..
. .
I.....I.....I.....
... . . . . ..
I.....I...... . . . . . .
. . . . . . . .
I.....I.....
.
I.....I.....
. ...S .. .. ..I.....
. . . . . . . ..
. . . . . ..
I.........
I.....I.....
I.........I.........I.........I.........I.........I.........I.........I.........I.........I.........I.........I.........I.........
. . . . .
..R ..E...
..R......
..R.....
.. E.
..R......
.........
.........
.........
..R......
..R......
FIG. 4. Sequence complexity of env quasispecies in vivo. The sequences, given here in the one-letter code, were aligned with respect tothe most abundant protein sequence in the initial sample, Li. Only the differences were scored, a dot indicating sequence identity. The threepopulations correspond to samples Li, L3, and L6. The frequency of a given protein sequence is shown on the right. The symbols (*- V)on the right identify the same protein sequence in different samples.
sented together only 15% of the HIV genome, we feel that itis not prudent to extrapolate from these data to other regionsof the genome.
rev function. Several studies have shown that certainsegments of the HIV-1 genome harbor up to 15% of defectivegenomes (8, 16). Clearly, as evidenced by the high frequencyof rev mutant sequences in the L5 sample, the proportioncan be even greater. The contribution of defective genomesto the overall replication of HIV-1 has been addressed onlyin the context of particular experimental systems (14, 26). Inorder to test the activity of the rev variants, an expressionvector was first constructed from the two coding exons ofHIV-1 Lai. The backbone of the vector was derived frompASA7 (2), including the simian virus 40 early promoter andthe hepatitis B virus poly(A) sequences. The first rev codingexon was amplified from the HIV-1 Lai clone by using theREVlB and REV2 pair of primers (Fig. 1B). Their se-quences and coordinates were: REV1B, 5'-CCGAAGCTITGAAATGGCTGGAAGAAGCG, positions 5548 to 5566, andREV2, 5'-CACCTCGAGACCACACAACTATTGC, posi-tions 5710 to 5694. Furthermore, the primers encodedHindIII and XhoI restriction sites, respectively (underlined).In order to ensure efficient translation of the transcribed rev
gene, the nonoptimal Kozak sequence (12), surrounding thenatural initiator methionine codon (ATG), was changed fromCCTATGG to GAAATGG by incorporation of this lattersequence into the REVlB primer (shown in boldface). Thevpulenv splice acceptor sequence mapped within the REVlBprimer sequence (23). To eliminate this sequence, the all-important AG dinucleotide was substituted in the primer bya TG (also in boldface), without changing the rev codingsequence. The second coding exon of HIV-1 Lai was ampli-fied by using the REV3 and REV4 primer pair (Fig. 1B). Thesequence of REV4 was 5'-CCAGATCTGAGCTCTATAACCCTATCTGTC, and it mapped to 8306 to 8291. It includedboth BglII (underlined) and Sacl (doubly underlined) restric-tion sites at its 5' end. Approximately 100 ng of HIV-1 Laiplasmid DNA was amplified for 15 cycles. The two amplifiedfragments were cloned into the HindlIl and BamHI sites ofpASA7 (Fig. 1C). Eighty bases 3' to the rev splice donor and93 bases 5' to the splice acceptor were included, so as toensure correct splicing. This construct was designatedpASArev. DNA fragments from 21 of the rev variants were
subcloned into the pASArev vector. These subclones there-fore represented chimeras of the first coding exon of HIV-1Lai rev and the second rev exon from the Swedish patient
VOL. 65, 1991
10%10%10%10%5% 05% .5%5% V5%5%5%5%5%5%5%5%
15%15% *10%10%10%5%5%5%5%5% 05%5%5% V
20%15%15%5%5%5%5%5%5%5%5%5%5%
. . .
. . . . . . .
. . . . . . . .
. . . . . . . .
. . . . . . . . .
. . . . . . . .
. . . . . . . . . .
. . . . . . . .
. . . . . . . . . .
. . . . . . . .
. . . . . . . .
. . . . . . . . . .
. .
. . .
. . . . . .
. .
. .
. .
. . .
.
. . .
. . . .
. . .
. . . . . . .
. . . . . . . .
. . . . . . .
. . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . .
. . . . . .
. . . . . . . . .
. . . . . . .
. . . . . . .
. .
. . . . .
. . . .
. .
. .
. . . . . .
. . . . . .
. . . . . . . . .
. . . . . .
. . . . . . . . . .
. . . . . . . . .
. .
. . .
.
.
. . . . . .
. . . .
. . . . . . . .
. . . . .
. . . . . .
. .
. . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . .
. . . . . . . . . .
. . . . . . . . .
. . . . . . . . . .
. . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . .
. . . . . . . .
. . . . . . . . .
. . . . . . . .
. . . . . . . . . .
. . . . . . . . .
. . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . . .
. . . . . . . . .
. . . . . . . .
4506 NOTES
201
10-i
U)
ut
r.
0
6
z
Li L2 L3
0 10 20 30Time/months
FIG. 5. Complexity of different segments of tduring disease progression. The number of disquences per locus analyzed (i.e., tat, revlenv ofunction of time (months) is given. Thus, rev 1 andfrom the same locus (16, 18), as are rev 2, tat 2 andand nef (3). Because the lengths of the proteidifferent, the number of residues is indicated ifacilitate comparisons.
(Fig. 1C). The subclones were verified byplasmid DNA.Rev activity was determined using pIlAl
dent chloramphenicol acetyltransferase (C)plasmid (21) and Jurkat-tat T cells (20), as
scribed. For each assay, approximately 4 x
cotransfected with 3 ,ug of pIIIAR and 10,ugrev plasmid by using the DEAE-dextran r
experiments included pASArev as a positivenegative controls: pSV2gpt and a derivatiNwhich carried a + 1 frameshift mutation in theexon. Cells were harvested 48 h posttransfecCAT assays were conducted as previouslyafter having normalized lysates to equal prc
tion (by using the Bio-Rad protein assay).The activities of the heterologous rev prod
that of the homologous HIV-1 Lai construc
the right of Fig. 2. The values given were tleast two independent transfections, and thepercentage of acetylation given by a rev vai
that of HIV-1 Lai, i.e., plasmid pASArev.all the major forms were comparable to that c
Variants lacking the serine (S99) phosphoryfound in all samples (Fig. 2), and their a(affected, confirming previous findings that ris not essential to rev activity (14). Of the n
activity of L603R (W45-*R45) was in thnegative control, while that of the L302Rlacked the splice acceptor sequence, was gi
Site-directed mutagenesis of the third domzthrough 79) resulted in defective rev prote
able, nonetheless, to function as trans-dominthe native rev protein (14, 19). In the present
variant, V606R, encoded a substitution (R8domain which, however, did not alter rev
cantly. The defective rev genes identified he]
encoded substitutions in the other domains. This wouldI(206 aa) indicate that down regulation of rev activity by competitive
inhibition has not been seized upon by HIV-1 in vivo as apossible mode of autoregulation.
All the major forms tested, whether the gene were rev or41(99 aa) tat or the sequences were from the LTR, had activities
comparable to that of the corresponding HIV-1 Lai gene or
v2(91 aa) sequence. However, it is possible that our experimentalapproaches, i.e., transfection of mammalian cells and tran-sient expression of reporter genes such as CAT or secreted
2(30 aa) alkaline phosphatase, may not be sufficiently sensitive to7 detect subtle differences in gene function. This could be
t1(72 aa) overcome by cloning the variants back into an infectiousmolecular clone. Any subtle fitness advantage of a particularvariant with respect to its parent might be evident only after
rl(25 aa) multiple rounds of replication. Here a problem arises. Whichinfectious molecular clone should be used? Should it be one
L5 L6 of the molecular clones derived from virus adapted to40 50 established cell lines?
When taken together, the three studies of HIV-1 regula-the HIV genome tory genes and sequences derived from the patient suggesttinct protein se- that despite the disease stage, isolation of HIV-1 alwaysr neflLTR) as a resulted in the outgrowth of a minor form in vivo. Perhapstat 1 are deduced the single most important problem to be solved is thegp41 (this study), development of culture techniques which deform as little astn sequences are possible the HIV-1 quasispecies. Until this is achieved, then parentheses to quasispecies nature of HIV-1 will almost certainly constitute
an important barrier to a detailed molecular definition ofHIV-associated pathogenesis.
sequencing the We thank Rdmi Cheynier and John Sninsky for help and discus-sions and Craig Rosen for the pIIIAR plasmid.
R, a rev-depen- L.P.M. was supported by a fellowship from the Conselho Nacio-
AT) expression nal de Desenvolvimento Cientifico e Tecnologico (CNPq), Brazil.
Treviouslsde This work was supported by grants from the Institut Pasteur,previously de- l'Agence Nationale de Recherches sur le SIDA, and the Swedish106 cells were Medical Research Council.of recombinantnethod (7). All REFERENCEScontrol and two 1. Chang, D. D., and P. A. Sharp. 1989. Regulation of HIV revve of pASArev depends upon recognition of splice sites. Cell 59:789-795.first rev coding 2. Chenciner, N., F. Delpeyroux, N. Israel, M. Lambert, A. Lim, R.ction and lysed. Streeck, and J. F. Houssais. 1990. Enhancement of gene expres-described (9) sion by somatic hybridization with primary cells: high-level
tein concentra- synthesis of the hepatitis B surface antigen in monkey Vero cellsby fusion with primary hepatocytes. Bio/Technology 8:858-862.
3. Delassus, S., R. Cheynier, and S. Wain-Hobson. 1991. Evolution[ucts, relative to of human immunodeficiency virus type 1 nef and long terminalSt, are given on repeat sequences over 4 years in vivo and in vitro. J. Virol.the means of at 65:225-231.y represent the 4. Domingo, E. 1989. RNA virus evolution and the control of viralriant relative to disease. Prog. Drug Res. 33:93-133.[he activities of 5. Domingo, E., J. J. Holland, and P. Ahlquist (ed.). 1988. RNAf the pASArev. genetics. CRC Press, Inc., Baton Rouge, La.AtionhsitewSrev 6. Epstein, L. G., C. Kuiken, B. M. Blumberg, S. Hartman, L. R.,lationSite were Sharer, M. Clement, and J. Goudsmit. 1991. HIV-1 V3 domainctivity was not variation in brain and spleen of children with AIDS: tissue-
phosphorylation specific evolution within host-determined quasispecies. Virol-uinor forms, the ogy 180:583-590.e range of the 7. Fujita, T., H. Shibuya, T. Ohashi, K. Yamanishi, and T.variant, which Taniguchi. 1986. Regulation of human interleukin-2 gene: func-reatly impaired. tional DNA sequences in the 5' flanking region for the geneain (residues 76 expression in activated T lymphocytes. Cell 46:401-407.ins which were 8. Goodenow, M., T. Huet, W. Saurin, S. Kwok, J. Sninsky, and S.
iant inhibitors of Wain-Hobson. 1989. HIV-1 isolates are rapidly evolving quasi-antudy,inhii ofe species: evidence for viral mixtures and preferred nucleotidestudy, only one substitutions. J. Acquired Immune Defic. Syndr. 2:344-352.0-i>G80) in this 9. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982.activity signifi- Recombinant genomes which express chloramphenicol acetyl-re (Fig. 2 and 3) transferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051.
J. VIROL.
nel
NOTES 4507
10. Hadzopoulou-Cladaras, M., B. K. Felber, C. Cladaras, A. Atha-nassopoulos, A. Tse, and G. N. Paviakis. 1989. The rev (trslart)protein of human immunodeficiency virus type 1 affects viralmRNA and protein expression via a cis-acting sequence in theenv region. J. Virol. 63:1265-1274.
11. Hu, W. S., and H. M. Temin. 1990. Genetic consequences ofpackaging two RNA genomes in one retroviral particle: pseudo-diploidy and high rate of genetic recombination. Proc. Natl.Acad. Sci. USA 87:1556-1560.
12. Kozak, M. 1989. The scanning model for translation: an update.J. Cell Biol. 108:229-241.
13. Lu, X., J. Heimer, D. Rekosh, and M. L. Hammarskjold. 1990.Ul small nuclear RNA plays a direct role in the formation of arev-regulated human immunodeficiency virus env mRNA thatremains unspliced. Proc. Natl. Acad. Sci. USA 87:7598-7602.
14. Malim, M. H., S. Bohnlein, J. Hauber, and B. R. Cullen. 1989.Functional dissection of the HIV-1 rev transactivator: deriva-tion of a transdominant repressor of rev function. Cell 58:205-214.
15. Malim, M. H., J. Hauber, S. Le, J. Maizel, and B. R. Cullen.1989. The HIV-1 rev transactivator acts through a structuredtarget sequence to activate nuclear export of unspliced viralRNA. Nature (London) 338:254-256.
16. Meyerhans, A., R. Cheynier, J. Albert, M. Seth, S. Kwok, J.Sninsky, L. Morfeldt-Manson, B. Asjo, and S. Wain-Hobson.1989. Temporal fluctuations in HIV quasispecies in vivo are notreflected by sequential HIV isolations. Cell 58:901-910.
17. Meyerhans, A., J. P. Vartanian, and S. Wain-Hobson. 1990.DNA recombination during PCR. Nucleic Acids Res. 18:1687-1691.
18. Meyerhans, A., and S. Wain-Hobson. Unpublished data.19. Perkins, A., A. W. Cochrane, S. M. Ruben, and C. A. Rosen.
1989. Structural and functional characterization of the humanimmunodeficiency virus rev protein. J. Acquired Immune Defic.Syndr. 2:256-263.
20. Rosen, C. A., J. G. Sodroski, K. Campbell, and W. A. Haseltine.1986. Construction of recombinant murine retroviruses thatexpress the human T-cell leukemia virus type II and human
T-cell lymphotropic virus type III transactivator genes. J. Virol.57:379-384.
21. Rosen, C. A., E. Terwillinger, A. Dayton, J. G. Sodroski, andW. A. Haseltine. 1988. Intragenic cis acting art gene responsivesequences of the human immunodeficiency virus. Proc. Natl.Acad. Sci. USA 85:2071-2075.
22. Saag, M., B. H. Hahn, J. Gibbons, Y. Li, E. S. Parks, W. P.Parks, and G. M. Shaw. 1988. Extensive variation of humanimmunodeficiency virus type-1 in vivo. Nature (London) 334:440-444.
23. Schwartz, S., B. K. Felber, D. M. Benko, E. M. Fenyo, and G.Pavlakis. 1990. Cloning and functional analysis of multiplyspliced mRNA species of human immunodeficiency virus type1. J. Virol. 64:2519-2529.
24. Simmonds, P., P. Balfe, C. A. Ludlam, J. 0. Bishop, and A. J.Leigh Brown. 1990. Analysis of sequence diversity in hypervari-able regions of the external glycoprotein of human immunode-ficiency virus type 1. J. Virol. 64:5840-5850.
25. Sodroski, J., W. C. Goh, C. A. Rosen, A. Dayton, E. Terwill-inger, and W. A. Haseltine. 1986. A second post-transcriptionaltrans-activator gene required for HTLV-III replication. Nature(London) 321:412-417.
26. Trono, D., M. B. Feinberg, and D. Baltimore. 1989. HIV-1 gagmutants can dominantly interfere with the replication of thewild-type virus. Cell 59:215-223.
27. Vartanian, J.-P., A. Meyerhans, B. Asjo, and S. Wain-Hobson.1991. Selection, recombination, and G-+A hypermutation ofhuman immunodeficiency virus type 1 genomes. J. Virol. 65:1779-1788.
28. Wain-Hobson, S., P. Sonigo, 0. Danos, S. Cole, and M. Alizon.1985. Nucleotide sequence of the AIDS virus, LAV. Cell40:9-17.
29. Wain-Hobson, S., J.-P. Vartanian, M. Henry, N. Chenciner, R.Cheynier, S. Delassus, L. Pedroza Martins, M. Sala, M.-T.Nugeyere, D. Guetard, D. Klatzmann, J.-C. Gluckman, W.Rozenbaum, F. Barre-Sinoussi, and L. Montagnier. 1991. LAVrevisited: origins of the early HIV-1 isolates from the InstitutPasteur. Science 252:961-969.
VOL. 65, 1991