in vitro studies of the initiation of staphylococcal ... · precipitable material) of negatively...

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 265, No. 10, Issue of April 5, pp. 55194530, 1990 0 1990 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S. A.

In Vitro Studies of the Initiation of Staphylococcal Plasmid Replication SPECIFICITY OF RepD FOR ITS ORIGIN (oriD) AND CHARACTERIZATION OF THE Rep-ori TYROSYL ESTER INTERMEDIATE*

(Received for publication, August 21, 1989)

Christopher D. Thomas+, Deborah F. Balsonj, and W. V. Shawn From the Department of Biochemistry, University of Leicester, Leicester LEl 7RH, United Kingdom

Several staphylococcal plasmids from different incompatibility (inc) groups which replicate by a rolling circle mechanism each specify a replication initiator protein (Rep) which is homologous with that of the inc3 tetracycline resistance plasmid pT181. The rep gene sequences of six pT181-like plasmids are known, each encoding proteins of molecular mass 38 kDa with 62% overall amino acid sequence identity. The initiation of replication in uiuo by each of the Rep proteins is plasmid specific, acting in trans only at the cognate replication origin (ori) of the encoding plasmid.

Previous studies in vitro of the RepC protein of pT181 demonstrated replication initiator, topoisomerase-like, and DNA binding activities, which appeared to be specific for the origin (oriC) of pTl81 when compared with unrelated staphylococcal plasmids. Although RepD, specified by the inc4 chloramphenicol resistance plasmid pC221, has a range of activities similar to those noted previously for RepC, manipulation of in vitro conditions has revealed discrete steps in the overall reaction of RepD with oriD. In addition, factors have been identified which are necessary not only for sequence-dependent discrimination in vitro by Rep proteins for all pT181-like plasmids but also for the absolute specificity of RepD for its cognate pC221 replication origin (oriD), the latter occurring in vivo and a function of the topological state of the or&containing target DNA.

Here we also demonstrate the presence of a covalent phosphoryl-tyrosine linkage between the RepD protein of plasmid pC22 1 and an oligonucleotide substrate corresponding to its replication origin (oriD). The reac- tive tyrosine (Tyr- 188) was identified from amino acid sequences of 32P-labeled peptide-oligonucleotide fragments. Substitution of Tyr-188 with phenylalanine confirms the importance of the tyrosyl hydroxyl group since the Y188F protein retains the sequence-specific DNA-binding capabilities of wild-type RepD but is unable to attach covalently to the replication origin or participate in the nicking-closing reaction in vitro.

*This work was supported in part by a project grant from the Science and Engineering Research Council. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Supported by a studentship from the Medical Research Council. § Supported by a studentship from the Science Engineering Re-

search Council. l l To whom correspondence should be addressed.

The 4.4-kb’ staphylococcal inc3 tetracycline resistance plasmid pT181 specifies RepC, a 38-kDa protein required for the initiation of pTl81 replication (l-3). Purified RepC has been shown to have both replication initiator and topoisomerase- like activities in vitro (4, 5). The target of both activities is the pT181 replication origin, referred to as oriC (but unrelated to the Escherichia coli chromosomal replication origin given the same abbreviation), where RepC has been shown to bind (6, 7) and from which unidirectional replication is initiated (6, 8). Such a process is analogous to the first step of the rolling circle model of replication promoted by the gene A product of bacteriophage +X174 (9). Regulation of RepC expression is mediated by a complementary RNA counter- transcript. system (lo), akin to those of the ColEl and IncFII- like plasmids of E. coli (11, 12). in uiuo RepC acts in truns to support replication of plasmids carrying an intact cognate replication origin (oriC) but will not support replication of unrelated plasmids such as the erythromycin resistance plasmid pE194 (13). Similar replication initiator specificity for RepC in vitro has also been reported (4).

A number of other small staphylococcal plasmids have since been found to contain open reading frames related to repC of pT181, including chloramphenicol resistance plasmids pC221 (14), pCW7 (15, 16), pUBll2 and pC223, and the streptomy- cin resistance plasmid pS194 (17). Each of the above pT181- like plasmids is representative of a different incompatibility (inc) group (see Table l), the Rep proteins of which share an overall 62% amino acid sequence identity. The present study deals with the RepD protein specified by the inc4 plasmid pC221. The replication functions of pC221 are known to be contained within a 1986-bp Mb01 fragment, encompassing both the repD coding region and oriD, which can be circular- ized to yield a smaller autonomous replicon designated pCW41 (15). A candidate for the predicted regulatory coun- tertranscript which controls RepD expression has also been mapped (14).

In addition to showing the in uitro replication initiator, topoisomerase-like, and DNA-binding activities of RepD which are identical to those for RepC, we have identified reaction components or conditions which are required at discrete steps of the initiation mechanism and have investi- gated further the factors involved in DNA sequence specificity. The topoisomerase reaction may be interrupted not only by substitution of certain divalent metal cations for Mg” but also by reduction in ambient ionic strength, under which

1 The abbreviations used are: kb, kilobase pairs; inc, incompatibility group; ori, replication origin; SDS, sodium dodecyl sulfate; SC, negatively supercoiled; RC, relaxed, covalently closed; OC, open circular; PAGE, polyacrylamide gel electrophoresis; PTH, phenylthiohydantoin.

5519

Tyrosyl Ester Intermediate in Plasmid Replication

conditions a covalently linked protein-DNA intermediate is accumulated. The preferred substrate for formation of this product is relaxed, covalently closed plasmid.

We have observed that negatively supercoiled forms of all plasmids of the pT181-like family are substrates for not only the topoisomerase activity of RepD but also its ability to initiate unidirectional replication in vitro from their respective origins. Similar broad specificity has been found for RepC (17). Such results must be contrasted with those of studies performed in ho, where both RepC and RepD have been found to be absolutely specific for the replication origins of their respective cognate replicons, oriC of pT181 and oriD of pC221 (13, 17). Further studies of the interaction of RepD with different replication origins by (a) initiation of replication of relaxed, covalently closed plasmids, (b) nicking of relaxed plasmids at low ionic strength, and (c) gel shift analysis of restriction fragments mixed with RepD reveal a marked preference of the latter for oriD over the replication origins of other pT181-like plasmids. Taken together the results suggest that plasmid topology may be an important recognition factor in plasmid-specific initiation of replication by the Rep proteins in uiuo.

We have also studied the nature of the Rep-or-i complex by the use of synthetic oligonucleotides corresponding in sequence to the replication origin and including the Rep-induced nick site common to the Rep group of pT181-related staphylococcal plasmids. DNA-protein linkage was demonstrated through transfer of [32P]phosphate from ori-containing DNA to RepD, and the tyrosyl residue through which this covalent attachment is achieved was identified by peptide sequence analysis. Its substitution by site-directed mutagenesis yielded a protein which retains sequence-specific DNA binding abilities but promotes neither the nicking-closing reaction nor the formation of a covalent linkage with ori DNA.

EXPERIMENTAL PROCEDURES*

RESULTS

Preparation of RepD-Purification of RepD yielded significantly greater amounts of soluble protein when buffers of high ionic strength (300 mM KCl) were used instead of the lower concentrations (50-100 mM KCl) used in the isolation of RepC (4). Typically 40 mg of RepD was obtained from 1 liter of induced culture when cell suspensions were solubilized at high ionic strength compared with the reported value of 0.3 mg of RepC prepared at lower ionic strength from the same volume of culture medium (4). Indeed, at such lower ionic strengths RepD was found to aggregate irreversibly, with less than 5% soluble RepD remaining after incubation in 100 mM KC1 for 1 h at 30 “C. The use of denaturants such as 6 M guanidine HCl or 8 M urea to solubilize RepD from the observed inclusion bodies was unsuccessful, as dilution or dialysis from either denaturant caused irreversible precipita- tion of RepD.

SDS-polyacrylamide gel electrophoresis of purified RepD routinely indicated a molecular mass of 35 kDa, in contrast to the value of 37.4 kDa deduced from the DNA sequence (Fig. 2). Analytical gel filtration in 450 mM KC1 against appropriate molecular mass markers gave an elution profile in keeping with a molecular mass of 75 kDa, suggesting a

’ Portions of this paper (including “Experimental Procedures,” Tables 1 and 2, and Figs. 1, 2, 10, and 11) are presented in miniprint at the end of this paper. Miniprint is easily read with the aid of a standard magnifying glass. Full size photocopies are included in the microfilm edition of the Journal that is available from Waverly Press.

dimer of two identical subunits of 37.5 kDa each (data not presented). Amino-terminal amino acid sequence analysis by Edman degradation confirmed that deduced from the DNA sequence apart from the loss of the predicted N-terminal initiator methionine, typical of many recombinant proteins expressed in E. coli (38).

Replication of Plasmid DNA in Vitro-The addition of purified RepD to replication extracts derived from plasmid- free strains of Staphylococcus aureus greatly stimulated replication (judged by incorporation of [ methyL3H]TTP into acid precipitable material) of negatively supercoiled plasmids pC221 and a high copy number mutant, pC22lcop903 (Table 3). The products, as determined by agarose gel electrophoresis and autoradiography of 32P-labeled plasmids included OC (nicked, open circular) and RC (relaxed, covalently closed) forms. Since replication was stimulated by added RepD even in the presence of rifampicin, it is likely that initiation of pC221 replication in vitro does not require DNA-dependent RNA polymerase. Novobiocin was found to significantly inhibit [methyl-3H]TTP incorporation, suggesting a role for endogenous DNA gyrase activity in the extracts.

RepD-dependent incorporation of [a-32P]dATP into pC221 or the copy number mutant pC221cop903, followed by restriction endonuclease digestion of the labeled DNA, agarose gel electrophoresis, and autoradiography (Fig. 3) showed that replication in vitro was initiated within the region of plasmid DNA containing the 5’ end of the repD reading frame, designated oriD. Replication appeared to be unidirectional in the direction 5’+3’ relative to the repD reading frame.

Each member of the pT181-like family of plasmids contains a replication origin related to oriD of pC221. Negatively supercoiled forms of these plasmids (such as pT181 or the copy number mutant pTl8lcop608 which contain oriC, and pCW7 containing oriN) also showed replication in vitro which was stimulated by RepD (Table 3). Such results were unex- pected, as the replication initiator activity of a given Rep protein in uiuo is specific for its cognate plasmid (13, 17). Incorporation of [o!-32P]dATP again showed that replication initiated within the region containing the rep reading frame at a site comparable with oriD (Fig. 3) and proceeded in the same relative direction for each of these plasmids. As expected, pC194, a staphylococcal chloramphenicol resistance plasmid which is not related to pT181 or pC221, showed no significant stimulation of replication in vitro by added RepD.

Topoisomerase Actiuity-RepD was found to have nicking- closing (topoisomerase) activity when incubated with negatively supercoiled (SC) plasmids pC221 or pC221cop903 in the presence of 300 mM KCl, 10 mM MgCl*, 10 mM Tris e HCl,

TABLE 3 RepD-dependent incorporation of deoxyribonucleotide

precursors into plasmid DNA Plasmid/conditions Incorporation”

% of control

Supercoiled pC221cop903 No additions 100 +Rifampicin 50 ng/pl 77 +Novobiocin 50 ng/rl 37

Other supercoiled plasmids pT181cop608 76 pC223 91 pUB112 99 pcw7 75 PC194 12

Relaxed, covalently closed pc221cop903 74 plasmids* pT181cop608 6

pcw7 20

’ Expressed relative to incorporation into pC221cop903 after sub- traction of background (typically 5-15% of total).

b In the presence of 50 ng/Fl novobiocin.

Tyrosyl Ester Intermediate in Plasmid Replication 5521

12AlA2 3 4 A3 A4 5 6 A5 A6 -- aP’ f@ -2420 c I rl) am-1380

-700 -653

‘0

PC221

b

PT181 pcw7

FIG. 3. Replication of plasmid DNA in vitro. Top, SC plasmids were replicated in vitro in the presence of RepD and [N-“PI dATP, followed by restriction endonuclease digestion, gel electrophoresis, and autoradiography. Lanes I and 2, ethidium bromide-stained gel of in uitro replicated pC221cop903 after digestion with HpaII/ Hind111 and Hi&, respectively; lanes 3 and 4, replicated pT181cop608 digested with HpaII/HindIII and TaqI; lanes 5 and 6, replicated pCW7 digested with HpaII/HindIII and Hinff. Lanes AZ-A6, auto- radiographs of l-6. The sizes (in base pairs) of principal labeled fragments are indicated. Bottom, location of labeled fragments within plasmids, relative to reading frames encoding replication initiator (rep) proteins and antibiotic resistance functions (cat, chloramphenicol resistance; Tc’, tetracycline resistance). Results are compatible with replication initiated by RepD at or near the adjacent HpaII sites (H) within the rep reading frames and proceeding principally in the directions shown.

pH 9.0, the products in both cases being relaxed, covalently closed (RC) plasmid forms with the same distribution of superhelical densities whatever the amount of added RepD. The topoisomerase-like activity displayed sequence preference, as RepD was able to relax other members of the pT181- like family (such as pT181, pT181cop608, pUBll2, pC223, and pCW7), and also recombinant plasmids containing the corresponding cloned ori sequences (pUC-C, pUC-D, pUC-I, pUC-J, and pUC-N), but not unrelated plasmids such as pC194 or pUC19 (Fig. 4a), pE194, or pT48. Such sequence discrimination reflects that seen for the initiation of replication in vitro as described above. RepD also appeared to act stoichiometrically, the molar ratio of protein monomer to substrate plasmid being 2:l for complete conversion of SC to RC plasmid forms, in keeping with a dimeric native structure of the protein (Fig. 4b).

RepD displayed similar topoisomerase activity when 300 mM Na’ or NH: was substituted for K’. Reduction in ionic strength from 300 to 100 mM KC1 also supported topoisomerase activity, but in the case of plasmids containing oriD also allowed single-strand cleavage without religation by RepD, as nicked, OC forms were produced in addition to RC forms (Fig. 5~). Production of such OC forms (“nicking”) was greater in the presence of a large molar excess of RepD over oriD plasmid and with incubation at pH 8.0 instead of pH 9.0.

Although topoisomerase activity was also observed on substitution of 10 mM Mn” for Mg’+, in the presence of Ba’+ or Ca’+ RepD was observed to convert SC forms of all pT181- like plasmids to OC form (Fig. 5~). However, the use of RC plasmids prepared by prior treatment with calf thymus DNA topoisomerase I demonstrated that Ba’+ failed to support the nicking of these topological forms in the presence of RepD. By way of contrast, the cleavage at low ionic strength to give OC product occurred only with RC forms of plasmids containing oriD (Fig. 5b).

Identification of the RepD-induced Cleavage Site-Initial mapping of the nick site resulting from incubation of pC221cop903 with RepD at low ionic strength was by cleavage of the strand opposite the nick with Sl nuclease, followed by restriction site mapping to determine the position of the double-stranded break (data not presented). The nick site was localized to within 50 bp of the adjacent HpaII sites at the replication origin oriD, at or near coordinates 1264 and 1280.

The precise location of the nick site was determined by cleavage with RepD of oriD-containing DNA fragments labeled strand-specifically, followed by size determination of the product by electrophoresis in parallel with sequencing tracks. On comparison of the latter, primed from the same 5’ sequence as the labeled strand for the cleavage reaction, the nick site was seen to occur at a unique position in the (+) strand of pC221, namely at the phosphodiester bond between bases T1273 and Al274 (Fig. 6a). No nicking of the (-) strand was observed.

Supercoiled plasmids pT181cop608 (oriC) and pC221cop903 (oriD) nicked by RepD either at low ionic strength or in the presence of Ba”’ (see above) were also digested further with restriction enzymes, the fragments being radiolabeled by 5’ phosphorylation with [-y-“‘PIATP. Similar size analysis of the labeled products (data not shown) confirmed the nick site to be in the same place as described above. The DNA sequence surrounding the nick site is conserved between all members of the pT181-like family (Fig. 66).

Gel Retardation Assays-The product of the RepD-induced cleavage reaction at low ionic strength (see above) appeared to be OC plasmid. After restriction endonuclease digestion of the nicked DNA gel electrophoresis revealed aberrant migration (retardation) of bands containing the replication origin (Fig. 7a). Normal migration of oriD-containing fragments was observed after digestion with Pronase, suggesting attachment of protein (RepD) to such fragments.

The above change in electrophoretic mobility of the protein- DNA complex (sometimes described as a “gel-shift assay”) was also found when RepD was incubated with DNA previously cleaved with restriction endonucleases (Fig. 7, b and c). Mg’+ was not required for the gel shift, which was specific for DNA fragments containing oriD. Gel-shift of fragments containing related origins (such as those containing oriC of pTl81) was not seen, although a cryptic secondary binding site within the cat gene of pC221 (localized between coordinates 2381 and 2573, data not shown) was detected. The mobility of the restriction fragment containing oriD was restored to normal if treatment with RepD in the absence of Mg’+ (or substitution of Ba*+ for Mg’+) was followed by incubation at 65 “C for 15 min in the presence of 1% SDS. Treatment of the oriD fragment with RepD in the presence of Mg’+ yielded a product with a retarded electrophoretic mobility which was partially resistant to such SDS/heat treatment, compatible with covalent attachment of RepD to DNA in the presence of Mg’+. The retarded fragment arising from binding to the cryptic site did not form such SDS/heat- resistant complexes.

5522 Tyrosyl Ester Intermediate

a 1 2 3 4 5 6 7 8 9101112

FIG. 4. Topoisomerase activity of RepD. a, specificity of RepD. 1 /*g of each SC plasmid DNA was incubated with 100 ng of RepD in the presence of 300 mM KCl, 10 mM MgCI, at pH 9.0, for 1 h at 30 “C before electrophoresis in the absence of ethidium bromide. RepD was present in lanes 2, 4, 6, 8, 10, and 12. Plasmids were lanes 1 and 2; pC221cop903; lanes 3 and 4, pT181cop608; lanes 5 and 6, pCW7; lanes 7 and 8, pC194; lanes 9 and 10, pUC19; lanes II and 12, pUC-D. b, stoichiometry of topoisomerization. 0.5 pg of SC pC221cop903 was incubated with RepD as in a at different molar ratios before electrophoresis in the presence of ethidium bromide. RepD monomer/ DNA ratios were I: 0, 2: 0.4, 3: 0.8, 4: 1.2, 5: 1.6, 6: 2.0, 7: 2.4, 8: 2.8.

a

oc- RC

sc-

t71 10 t5a b nl 10 ba PC221 pT181

oc-

SRE’

FIG. 5. Nicking of plasmid DNA by RepD. a, 1 rg of SC pC221cop903 or pT181cop608 were incubated with 100 ng of RepD under various conditions before electrophoresis in the absence of ethidium bromide. Lanes 1-4, pC22lcop903, lanes 5-8, pTl8lcop608. Lanes I and 5; SC plasmid controls; lanes 2 and 6, after incubation with RepD in the presence of high (300 mM) KC1 concentration, 10 mM MgCl,, pH 9.0; lanes 3 and 7, incubation with RepD at low (100 mM) KCl, 10 mM MgCl,, pH 8.0, lanes 4 and 8, as in lanes 2 and 6 but with substitution of 10 mM BaC12 for MgCl,. b, topological specificity of RepD. SC pC221cop903 and pT181cop608 (I and 5) were converted to RC form (2 and 6) by incubation with calf thymus topoisomerase I. 1 pg of these RC forms were then incubated with 55 ng of RepD in the presence of low (100 mM) KC1 concentration, 10 mM MgCl,, pH 8.0 (3 and 7); or 300 mM KCI, 10 mM BaCl,, pH 9.0 (4 and 8) before electrophoresis in the presence of ethidium bromide.

Specificity of RepD for oriD in the in Vitro Replication Assay-Plasmids pC221cop903, pT181cop608 and pCW7 were relaxed with calf thymus topoisomerase I to produce RC forms prior to their use as substrates for RepD in the in vitro replication assay. In the presence of 50 rig/J novobiocin (to inhibit negative supercoiling of the plasmids by endogenous DNA gyrase activity in the S. aureus cell extract) it was found that replication initiator specificity was confined to pC221cop903, the incorporation of labeled precursors into relaxed pT181cop608 and pCW7 being drastically reduced compared with that incorporated into its SC form (Table 3). Such specificity mirrors that observed in Go, where the Rep

proteins are known to act in trans to initiate replication only at their cognate ori sequences (13, 17).

Covalent Attachment of Oligonucleotide II(+) to RepD-The replication origin (oriD) of pC221 consists of three adjacent inverted complementary repeats, the second of which is cleaved by RepD in the (+) strand (Fig. 6b). The synthetic oligonucleotides II(+) and II(-) correspond in sequence to the (+) and (-) strands of this second inverted repeat sequence (Fig. 8), which is common to the replication origin of all pT181-like plasmids, including pC221. The nick site, for RepC in pT181 (5) and RepD in pC221 in the (+) strand of both plasmids corresponds to the phosphodiester bond be-


a RepD: + +

- MS ACGT 1 234 A’C’G’T’

r*

yw; $-,-

1290 3 6-‘.‘. 1280 I

1273 s

@ye;

1270 e - 1260 l .=- 3:.

1250

FIG. 6. Determination of RepD cleavage site. a, oriD was specifically labeled with [tu-“‘P]dATP in the (+) strand by primer extension. This DNA was incubated in 100 mM KC1 at pH 8.0 with the addition of 1 mM EDTA (I and 2) or 10 rnM MgCI, (3 and 4), in the absence (I and 3) or presence (2 and 4) of 36 ng of RepD before electrophoresis adjacent to dideoxy sequencing tracks (A, C, G, T) primed from the same oligonucleotide. The compression of G1281-G1282 was resolved by sequencing using the 7-deaza analogue of gua- nine (A’, C’, G’, T’). b, location of nick site within pC221 replication origin oriD. The position of cleavage by RepD is indicated (V), relative to the adjacent HpaII restriction sites and inverted complementary repeat (ICR) sequences. The origin sequences of other plasmids re- b

1240

1230

5523

laxed by RepD in this study are also 1230 1240 1250 1260 1270 1280 1290 1300 1310 presented (sequences are identical to ‘Repo a that of oriD except where indicated). 5: Hpel HpaI ’ ,3’

-TACAAAATAAGGATTTAGACAATTTTT4CTAAAACCGGCTACTC~ATAGCCGGTTAAGTGGTAATTTTTT~ACCACCCCTC- oriD PC22 1

ICR I -tlCR II-(- ICR III -.G~.....C.C..,...................,..,..,.,.,...,..... ,GGACGCACATACTGTGTGCATAT,,G- oriC pT1’31 --,,-- -GCAT.GGA.GA..AAATTCA......GT.........A......,..........AAGTGGT~~C:TTGGGAAAAT,,.- orii @.Bll2

- - - - -..G.....C.C....C.......................................AGAC~~TTTCG~~A~TT~~A- oriJ pC223

- -.CG.....C.G............................................AAACCG~~C~~ACAC~C.GG- orjN,X?d,

1234

Rq>D - + ++ - + ++ pC221 - Mg Ba - Mg BT. - +Pronasc

Alul _ +SDS/heat

FIG. 7. Binding of oriD by RepD. a, 1 pg of pC221cop903 was incubated in 100 mM KCl, 10 mM MgCl> at pH 8.0, with the addition of 0, 100, or 1000 ng of RepD (1-3). Samples were digested with 2 units of AluI before electrophoresis in the absence of ethidium bromide. Lanes 4-6, as in lanes Z-3 after incubation with 16 pg of Pronase. Fragment sizes (in bp): A, 1202; B, 710; C, 692; D, 561; E, 253; F, 206; G, 180; H, 119; I, 113. Fragment E contains oriD and is retarded to position R by RepD. b, M$+-dependent attachment. 1 pg amounts of pC221cop903 previously digested with AluI were incubated with 250 ng of RepD in the presence of 100 mM KC1 at pH 8.0. Lane 1, DNA without added RepD; additions being: lanes 2-4, RepD; lane 3,10 mM MgCl,; lane 4, 10 mM BaCI,. Lanes 5-7, as lanes 2-4, hut adjusted to 1% SDS and incubated at 65 “C for 15 min before electrophoresis. c, origin- specific binding. pUC-D and pUC-C were digested with PstI and XbaI to release -250.hp fragments containing oriD (1 and 2) and oriC (3 and 4) as indicated. 1 pg of each DNA was then incubated with 250 ng of RepD (2 and 4) in 100 mM KCl, pH 8.0, before electrophoresis. R indicates the position of oriD retarded by RepD.

5524 Tyrosyl Ester Intermediate in Plasmid Replication

ce> RepLlcatlon or,gin or,LJ ,241 RepC-inaucea cteavage site 1310

I 4 I 5’..GATTTAGAChATTTTTCTAACCGGCTACTCTAATAGCCGGTT~GT~TAATTTTTTTACCACCCCTC..3’

-> <---) <- -> <-

ICR I ICR II ICR III

(b) OLlgO”“cleotlde sequences

5’ AACCGGCTACTCTAATAGCCGGTT 3’ I I (+I 3’ TTGGCCGATGAGATTATCGGCCAATT 5’ I! C-) 5’ AACCGGCTACTCT 3’ Il(+)i

5’ AATAGCCGGTT 3’ II(t)R

CC) Constructlo” Of LpR

I / (+)L: 5’ AACCGGCTACTCT.. 3’

+

. s’-I”PI-phospharylated I I c+>Fc 5’ pAATAGCCGGTT 3’

Ligate: I

. 5’ AACCGGCTACTCTpAATAGCCGGTT 3’ LpR

FIG. 8. Design of substrate oligonucleotides. a, the sequence of’the pC221 replication origin. Inverted complementary repeat (ICR) I-111 are the three inverted complementary repeat sequences. The site of phosphodiester bond cleavage by RepD in the (+) (upper) strand is shown. h, sequences of oligonucleotides II(+) and II(-) correspond to the upper and lower strands of inverted complementary repeat II. The 5’ ext.ension of II(-) allows radiolabeling of II(+) by extension against II(-) using Klenow polymerase and radiolabeled dATP. c, synthesis by internally labeled oligonucleotide LpR. 5’. Phosphorylation of II(+)R using [r-‘“P]ATP allows subsequent ligation to the 3’OH of II(+)L, the sequences being aligned by hybrid- ization to the complementary sequence II(-).

II+ ll+/ll- II+’ (a) oligo

123456

66- -

45- a- I-

-----(I

- -I70

36- --R

.b

29- - *?:

. ,.

Fro. 9. Covalent attachment of oligonucleotides to RepD. RepD was complexed with various oligonucleotides as described. Samples containing 5 pg of protein were boiled for 5 min in SDS loading buffer and analyzed by SDS-polyacrylamide gel electrophoresis. The gel (10% (w/v) polyacrylamide) was stained with Coomassie Brilliant Rlue. Lane I, molecular mass markers (masses given in kilodaltons): bovine serum albumin (66), ovalbumin (45), glyceralde- hyde-Z-phosphate dehydrogenase (36), carbonic anhydrase (29). Lane 2, RepD without added oligonucleotides. Lane 3, RepD complexed with excess oligonucleotide II(+); Lane 4, as lane 3, with the addition of excess oligonucleotide II(-). Lane 5, RepD in excess over labeled oligonucleotide LpR. Lane 6, autoradiograph of lane 5. R, RepD; RO, RepD-oligonucleotide complex.

tween bases 13 and 14 of the 24-base oligonucleotide II(+). RepD was found to nick 5’-“‘P-labeled II(+) at this position, releasing a 13-base labeled fragment which was detected by urea-PAGE and autoradiography (data not shown), causing a change in mobility of the RepD protein on SDS-PAGE (Fig. 9). The presence of complementary strand II(-) was not required for this cleavage to occur. Neither the corresponding (-) strand of plasmid pC221 at its replication origin nor oligonucleotide II(-) itself are cleaved by RepD (data not shown).

Internally labeled oligonucleotide LpR is identical in sequence to II(+) but with a [““Plphosphodiester bond at the

nick site. When RepD was incubated with LpR the “‘P radioactivity was found to comigrate with the retarded form of the protein. Similar results were also obtained with II(+) radiolabeled at the 3’ end with [a-““S]dATP by end repair using Klenow fragment of DNA polymerase I (data not shown). Thus, RepD was covalently attached to the 3’-terminal 11 bases of the target oligonucleotide after cleavage at the nick site, releasing the 5’ end as a 13-base unlabeled oligonucleotide. After acid hydrolysis, thin layer electrophoresis (36) revealed the RepD.LpR complex to contain a radioactive product which comigrated with phosphotyrosine and was dis- tinct from both phosphoserine and phosphothreonine (Fig. 10).

The results of the above analysis indicate not only that the bond between RepD and its DNA target is via a tyrosyl residue but also which bond in the DNA backbone participates in the linkage, given the known position of the “jP label within LpR. The sequence of RepD contains 14 tyrosine residues, 9 of which are conserved among all known Rep proteins of the pT181 family (17). As the replication initiator activity must be a common property of the related Rep proteins, and the cleavage events under study are part of the replication initiation process, it seemed certain that the phosphotyrosine product should correspond to one of the 9 conserved tyrosines.

Isolation and Sequence Analysis of a Single Labeled Tryptic Fragment-Proteolytic digestions of the RepD . LpR complex with trypsin, staphylococcal V8 protease, proteinase K, or Pronase each gave a single radioactive peptidyl-oligonucleotide species on analysis by urea-PAGE and autoradiography (data not shown). Each labeled species had a reduced mobility compared with that of the expected II-base oligonucleotide product, in keeping with the attachment of a peptide fragment to the distal (3’) segment of the cleaved LpR oligonucleotide substrate. The tryptic product was isolated for peptide sequence analysis.

The yield of radiolabeled complex formation was optimized by incubation of “ZP-labeled oligonucleotide LpR with an excess of RepD. Larger amounts of unlabeled complex were obtained by incubation of RepD with an excess of oligonucleotide II(+). Both labeled and unlabeled complexes were then digested with trypsin, and the radiolabeled tryptic peptide was found to elute from a reverse-phase fast protein liquid chromatography column at 4.8% (v/v) acetonitrile. This frac- tion, containing approximately 200 pmol of the unlabeled peptide-oligonucleotide complex as deduced from absorbance at 214 nm, was subjected to automated gas-phase Edman degradation. Initial yield was 30 pmol; the sequence obtained from the phenylthiohydantoin (PTH) products was isoleu- tine, followed by no yield, then asparagine followed by lysine. Sequencing was continued for a total of 20 cycles but no further PTH amino acids were detected.

The sequence I-NK occurs at a single position within the RepD sequence, at amino acid positions 187-190 (Fig. 11) and is in agreement with the predicted cleavage by trypsin at the carboxyl side of arginyl and lysyl residues to produce a peptide of four amino acids. The gap in the analyzed sequence I-NK corresponds to a tyrosyl residue, conserved in all Rep proteins. It is likely that no PTH-amino acid product was observed at this position because of retention of the phosphoamino acid derivative in the Polybrene-impregnated loading filter, as has been observed previously (45). As radiolabeled phosphotyrosine was identified from acid hydrolysis of the RepD-oligonucleotide complex the data taken together identify Tyr-188 of RepD as that involved in covalent linkage with the DNA at the nick site of the replication origin target sequence. NO other labeled species were identified, either labeled peptides


identified by urea-PAGE of whole proteolytic digests (see above) or eluted from the reverse-phase column.

Activities of Mutant RepD (Y188F)--To confirm the importance of Tyr-188 in the covalent attachment of RepD to DNA and to investigate the mechanism of the nicking-closing process, the hydroxyl group of Tyr-188 was deleted by substitution with phenylalanine to yield RepD mutant Y188F. After rein- sertion of the mutant RepD reading frame into the E. coli expression vector pHD the Y 188F protein was produced and purified by the same protocol used for the wild-type protein. The mutant protein displayed none of the sequence-specific nicking-closing activities observed for wild-type RepD (Fig. 12a). DNA fragments containing the replication origin (oriD) of pC221 were retarded by Yl88F on agarose gel electrophoresis (Fig. 12b), but such retarded complexes were unstable at 65 “C in the presence of 1% SDS, suggesting that the pre- sumed (Mg’+-dependent) covalent linkage found in the case of wild-type RepD protein could not form. Preliminary experiments with a range of protein concentrations for both the mutant and wild-type proteins suggest that they have similar non-covalent binding affinities for the pC221 replication origin (data not shown).

The ability of Y188F to bind to the replication origin in a non-covalent fashion with an apparent affinity similar to that shown by the wild-type protein indicates that the mutation is unlikely to have caused any major changes in protein confor- mation. Such a conclusion is also supported by the similar purification behavior of the Y188F protein; namely its solu- bility in ammonium sulfate and elution from heparin-Sepha- rose. As the only difference between the proteins is the para- hydroxyl group present in the wild-type protein at position

a 1234567

188, its importance is evident from the inactivity of the mutant protein in topoisomerization, the cleavage (“nicking”) reaction at low ionic strength, and Mg”+-dependent covalent attachment. The failure of Y188F to cleave supercoiled substrates in the presence of Ba’+ also suggests a role for a covalent tyrosyl-DNA linkage in this reaction, albeit short- lived as such a covalent complex has not been isolated under these conditions.

DISCUSSION

The range of activities which we have described for RepD are a reflection of those previously reported for RepC with plasmid pTl81 as substrate (4, 5, 7). However, the manipulation of buffer compositions has allowed dissection of the overall process facilitated by RepD into apparent partial reactions and has defined factors likely to be important in the sequence specificity of RepD for its origin.

Topoisomerase activity requires that at least one strand of the target DNA be broken to allow topological changes. As a single RepD-induced cleavage site has been identified, in the (+) strand only (Fig. 6), it follows that RepD acts as a type I topoisomerase. Since the nucleotide sequence bordering the cleavage site is present in all plasmids relaxed by RepD, it probably represents the functional target for both topoisomerase and replication initiator activities in vitro when negatively supercoiled plasmids of the pT181-like family are used as substrates. Although the sequence at the cleavage site matches the consensus sequence bound by the cl repressor of bacteriophage Pl (39), the staphylococcal Rep proteins do not show similarity to cl repressor either in known sequence or mechanism. Cleavage by a Rep protein produces a free 3’-

b 123456789

YFYFYFYF

WI - Mg

i SDS/heat

YFYFYF hi lo Ba

FIG. 12. Activities of wild-type HepD and mutant Y 188F. a, Y188F has no nicking-closing activity. 28 ng of RepD protein was incubated with 1 fig of negatively supercoiled pC221cop903 DNA at 30 “C for 1 h followed by agarose gel electrophoresis. Buffer conditions were 10 mM Tris.HCl, pH 8.0 with the following additions: lanes I- 3, hi (300 mM) KCI, 10 mM MgCI,; lanes 4 and 5, lo (100 tnM) KCI, 10 mM MgClr; lanes 6 and 7, 300 mM KCI, 10 mM BaCI?. Wild-type RepD was present in lanes 2, 4 and 6; mutant Y188F was present in lanes 3, 5, and 7. SC, negatively supercoiled plasmid; RC, relaxed, covalently closed topoisomers; OC, nicked, open circular DNA. b, the Y 188F-oriD DNA complex is not stable to SDS and heat treatment. 280 ng of RepD protein was incubated with 1 pg of pC221cop903 (previously digested with AluI) at 30 “C for 5 min followed by agarose gel electrophoresis. Buffer conditions were 10 mM Tris’HCl, pH 8.0, 100 mM KC1 with the addition of 10 mM MgCl, in lanes 4, 5, 8, and 9. Wild-type RepD was present in lanes 2, 4, 6, and 8; mutant Y188F was present in lanes 3, 5, 7, and 9. Samples in lanes 6’, 7, 8, and 9 were prepared as for samples in lanes 2, 3, 4, and 5 but adjusted to 1% (w/v) SDS and heated at 65 “C for 15 min before electrophoresis. Restriction fragments (sizes in base pairs) are A (1202), B (‘ilo), C (692), D (561), E (253), F (206), G (180), H (119), I(113). Fragment E, containing the replication origin oriU, is retarded to position R on binding of RepD.


hydroxyl from which unidirectional DNA synthesis and thus (+) strand replication occurs (5). The cleavage step is followed in the case of the topoisomerase reaction by relaxation of the plasmid, driven by release of superhelical tension, and subsequent religation.

At low ionic strength RepD appears to bind specifically to relaxed DNA targets containing oriD, resulting in the observed gel shift. Under such conditions the functional target must include sequences additional and adjacent to those conserved between related plasmids (6), resulting in the observed specificity. In the presence of Mg2+, RepD cleaves oriD, and the resistance of the resultant RepD-oriD complex to SDS and heat treatment is compatible with a covalent linkage. The requirement for Mg*+ seems likely to be at the linkage step, since Ba2+ permits cleavage but promotes neither a stable covalent linkage nor religation. In addition, Ba2+ fails to support the cleavage of RC plasmids by RepD. Thus, the correct geometry of the reaction centre seems to be precisely determined by the coordination of an appropriate divalent metal ion. The accessibility of the putative cleavage site may be influenced on the other hand by topological factors such as potential extrusion of the inverted complementary repeat sequences in a cruciform structure.

The Ba’+-dependent cleavage of SC ori-containingplasmids is thus fundamentally different from that induced at low ionic strength in the presence of Mg’+. The latter process involves two successive encounters between RepD and substrate, the first resulting in topoisomerization and the second, specific for oriD, yielding the accumulation of nicked (OC) plasmid DNA. Such products represent RepD covalently linked to oriD nicked at coordinates 1273-1274, there being no other products since no further change in superhelical density occurs. This single-stranded scission event not only resembles the specificity of the replication event in uiuo but also serves as a functional model for the event in uitro.

RepC initiates replication of pT181 replication by a rolling circle mechanism (40), not unlike that initiated by the gene A protein of bacteriophage %X174 (9). The very specific interaction between the RepC protein and oriC in viuo (13, 17) is apparently lost in vitro (17) where the specificity broadens to encompass both replication-initiator and topoisomerase activities for all members of the pT181-like family. While the reactions of RepD with negatively supercoiled substrates in vitro (replication initiator, topoisomerase, and Ba’+-induced nicking activities) also display such broadened specificity, those activities observed with topologically relaxed substrates (nicking at low ionic strength and gel shift effects) show absolute specificity for the appropriate oriD target. The superhelical density of plasmid DNA species in uiuo is gen- erally considered to be lower than that encountered in uitro after purification of plasmids by density gradient centrifuga- tion (41), an effect which may be due to their association in uiuo with DNA-binding proteins. If results with RepD can be extrapolated to the interaction of other Rep proteins of the pT181 family with ori targets, such reduced superhelical density would account for the observed specificity of replication in uivo.

In the topoisomerase assay RepD has been observed to act stoichiometrically rather than enzymically, a molar ratio of 2:l RepD monomer:oriD target being required for complete relaxation. Recent experiments suggest that inactive RepD is not reactivated in the presence of a large excess of ATP. Neither is it found to be associated with the relaxed plasmid nor is it able to bind to restriction fragments in the gel shift assay (data not shown). Thus, inactivation of the Rep proteins during the replication process may add another level of control

to the regulation of plasmid replication and copy number for the pT181-like plasmids.

In vitro the RepD-DNA covalent linkage is seen to fulfill the role of bond energy conservation during the relaxation process. Transient attachment of RepD to the 5’ end at the 3’ side of the nick via an 04-phosphotyrosine linkage traps the bond energy of the former phosphodiester linkage as relaxation of the supercoiled plasmid occurs. Subsequent religation is then achieved in the absence of an exogenous energy source by transesterification of the 5’ terminus from Tyr-188 back to the 3’-hydroxyl at the nick site. Mg2+, a requirement for this process, may serve to coordinate the phosphate group at the active site as bond transfer occurs. The Mg2+-dependent nicking of relaxed, covalently closed ori DNA at low salt concentrations reflects the dependence of binding affinity on ionic strength of the buffer. Ba’+-induced nicking of negatively supercoiled DNA by wild-type RepD does not display such dependence on ionic strength. Involve- ment of the hydroxyl group of Tyr-188 is implicated in both Me- and Ba*+-induced nicking events as Yl88F does not produce nicked plasmid forms under these conditions.

The RepD-oriD linkage almost certainly serves an identical function during replication of pC221 both in uitro and in viuo. Initiation of replication occurs as the Rep protein creates a nick at the replication origin in the (+) strand, producing a free 3’-hydroxyl group from which unidirectional replication may proceed (4). The displaced (+) strand probably retains the Rep protein linked to the 5’ end. After a second cleavage and two religation events, also mediated by Rep, the first daughter plasmid and a single-stranded circular displaced (+) strand are released; the latter may accumulate in the host if second-strand synthesis is disrupted (42).

Our approach to the identification of the single active site Tyr-188 in RepD followed that employed for the gene A protein of phage 9X174 (31,45), a replication initiator protein found attached to the 5’ end of nicked @X174 DNA through either of two tyrosine residues. RepD apparently shares many of the activities of the gene A protein (9, 43, 44), including sequence-specific nicking of both single-stranded and double- stranded substrates, with replication by a rolling circle mechanism (40). However, comparison of the amino acid sequence adjacent to 2 tyrosine residues identified within the gene A protein (45) with the region encompassing Tyr-188 of RepD reveals no obvious sequence identity apart from the proximity of the sequence NKK (Fig. 11). It has been suggested that both labeled tyrosines are involved in replication initiation by the gene A protein (45). Although no other [32P]phosphotyrosine residues within the primary structure of RepD were detected, a second tyrosyl residue could in principle be con- tributed by the equivalent Tyr-188 of the second subunit since functional RepD behaves as a dimeric protein by gel permea- tion chromatography (data not shown).

The amino acids involved in phosphodiester bond transfer of many other DNA nicking-closing enzymes have been identified. Examples are known of linkage between protein and DNA via 04-phosphotyrosine to the 5’ end of DNA (46-48), or to the 3’ end (49-51). Linkage to the DNA through phosphoserine has been implicated in the case of transposon y6 resolvase (52). The actual amino acids involved have been determined directly by peptide sequencing for @X174 gene A protein (45) and E. coli gyrase subunit A (48), by partial sequencing and mutation for lambda integrase (53), and by mutation studies for transposon y6 resolvase (54). However, sequence comparison of these and related sequences (55-57) again shows no homology with the RepD sequence (Fig. 11).

Acknowledgments-We thank Iain Murray for bacterial strains


and RF preparations of M13, John Keyte and Jim Turner for oligonucleotide synthesis, and Matthew Davison and Kay Harvey for 27. peptide sequence analysis. We are indebted to Richard Novick and Saleem Khan and their respective co-workers for advice and gratefully 28. acknowledge the communication of their work in advance of publication.

REFERENCES

1. 2.

3.

Iordanescu, S. (1979) Plasmid 2, 207-215 Khan, S. A., Carleton, S. M., and Novick, R. P. (1981) Proc. N&l.

Acad. Sci. U. S. A. 78,4902-4906 Novick, R. P., Adler, G. K., Majumder, S., Khan, S. A., Carleton,

S., Rosenblum, W. D., and Iordanescu, S. (1982) Proc. N&l. Acad. Sci. U. S. A. 79, 4108-4112

Koepsel, R. R., Murray, R. W., Rosenblum, W. D., and Khan, S. A. (1985) J. Biol. Chem. 260,8571-8577

Koepsel, R. R., Murray, R. W., Rosenblum, W. D., and Khan, S. A. (1985) Proc. Natl. Acad. Sci. U. S. A. 82. 6845-6849

Koepsel, R. R., Murray, R. W., and Khan, ‘S. A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 5484-5488

Koepsel, R. R., and Khan, S. A. (1986) Science 233, 1316-1318 Khan, S. A., Adler, G. K., and Novick, R. P. (1982) Proc. N&l.

Acad. Sci..U. S. A. 79,4580-4584 Eisenbers. S.. Griffith. J.. and Kornbere. A. (1977) Proc. Natl.

Acad. ski. i! S. A. 74, $198-3202 -’ Kumar, C. C., and Novick, R. P. (1985) Proc. Natl. Acad. Sci. U.

S. A. 82,638-642 Seizer, G., Som, T., Itoh, T., and Tomizawa, J. (1983) Cell 32,

119-129

29. 30.

4.

5.

6.

7. 8.

9.

10.

11.

12. 13.

14. 15.

16.

17. 18. 19.

20.

21.

22. 23.

24.

25.

26.

Nordstrom, K., Molin, S. and Light, J. (1984) Plasmid 12, 71-90 Projan, S. J., Kornblum, J., Moghazeh, S. L., Edelman, I., Gen-

naro, M. L., and Novick, R. P. (1985) Mel Gen. Genet. 199, 452-464

Brenner, D. G., and Shaw, W. V. (1985) EMBOJ. 4,561-568 Wilson, C. R., Skinner, S. E., and Shaw, W. V. (1981) Plusmid

5,245-258 Skinner, S. E. (1984) Staphylococcal Chloramphenicol Resistance

Plasmids, Ph.D. thesis. University of Leicester, United King- dom

Projan, S. J., and Novick, R. (1988) Plasmid 19, 203-221 Messing, J. (1983) Methods Enzvmol. 101. 20-78 Docheriy, A. J. P., Lyons, A., Smith, B. J., Wright, E. M.,

Stephens, P. E., and Harris, T. J. R. (1985) Nature 318, 66- 69

Emtage, J. S., Angal, S., Doel, M. T., Harris, T. J. R., Jenkins, B., Lilley, G., and Lowe, P. A. (1983) Proc. N&l. Acad. Sci. U. S. A. 80,3671-3675

Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Gene (Amst.) 33,103-119

Khan, S. A., and Novick, R. P. (1983) Plasmid 10,251-259 Carleton, S., Projan, S. J., Highlander, S. K., Moghazeh, S. M.,

and Novick. R. P. (1984) EMBO J. 3. 2407-2414 Horinouchi, S., and Weisblum, B. (1982) J. Bacterial. 150, 815-

825 Horinouchi, S., and Weisblum, B. (1982) J. Bacterial. 150, 804-

814 Catchpole, I., Thomas, C., Davies, A., and Dyke, K. G. H. (1988)

31.

Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) in Molecular Cloninp. A Laboratorv Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY - -

Tautz, D., and Renz, M. (1983) Anal. Biochem. 132, 14-19 Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl.

Acad. Sci. U. S. A. 74, 5463-5467 Van Mansfeld, A. D. M., van Teeffelen, H. A. A. M., Baas, P. D.,

Veeneman, G. H., van Boom, J. H., and Jansz, H. S. (1984) FEBS Lett. 173,351-356

32. Wright, E. M., Humphreys, G. O., and Yarranton, G. T. (1986) Gene (Amst.) 49,311-321

33. Zoller. M. J., and Smith. M. (1984) DNA 3. 479-488 34. Bradford, M. M. (1976) Anal. Biochem. 72,248-254 35. Laemmli. U. K. (1970 Nature 227.680-685 36. Cooper, J. A., Sefton, B. M., and Hunter, T. (1983) Methods

Enzymol. 99,387-402 37. Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Methods

Enzymol. 154,367-382 38. 39.

Marston. F. A. 0. (1986) Biochem. J. 240, l-12 Eliason, J. L., and Sternberg, N. (1987) J: Mol. Biol. 198, 281-

293 40. Majumder, S., and Novick, R. P. (1988) Nucleic Acids Res. 16,

2897-2912 41. 42.

43. 44.

Lilley, D. (1986) Nature 320, 14-15 Gruss, A. D., Ross, H. F., and Novick, R. P. (1987) Proc. Natl.

Acad. Sci. U. S. A. 84, 2165-2169 Eisenberg, S. (198) J. Viral. 35, 409-413 Baas, P.-D., Heidekamp, F., Van Mansfeld, A. D. M., Jansz, H.

S., Van der Marel, G. A., Veeneman. G. H.. and Van Boom, J. H. (1981) in The Initiation of DNA Replication (Ray, D. S., ed) pp. 195-209, Academic Press, New York

Van Mansfeld, A. D. M., van Teeffelen, H. A. A. M., Baas, P. D., and Jansz, H. S. (1986) Nucleic Acids Res. 14, 4229-4238

Tse, Y.-C., Kirkegaard, K., and Wang, J. C. (1980) J. Biol. Chem. 255,5560-5565

45.

46.

47.

48.

49. Champoux, J. J. (1981) J. Biol. Chem. 256,4805-4809 50. Gronostaiski. R. M.. and Sadowski. P. D. (1985) Mol. Cell. Biol.

51. 5,3274-3279

Brouaham. M. J.. Rowe. T. C.. and Holloman. W. K. (1986)

52. Bio;hem&try 25, 736217368

Reed, R. R., and Moser, C. D. (1984) Cold Spring Harbor Symp. Quunt. Biol. 49,245-249

53.

54.

55. 56. 57.

J. Gen. Microbial. 134, 697-709 Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7, 1513-

1523

Rowe, T. C., Tewey, K. M., and Liu, L. F. (1984) J. Biol. Chem. 259,9177-9181

Horowitz, D. S., and Wang, J. C. (1987) J. Biol. Chem. 262, 5339-5344

Pargellis, C. A., Nunes-Diiby, S. E., de Vargas, L. M., and Landy, A. (1988) J. Biol. Chem. 263, 7678-7685

Hatfull, G. F., and Grindley, N. D. F. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,5429-5433

Huang, W. M. (1986) Nucleic Acids Res. 14, 7379-7390 Newman, B. J., and Grindley, N. D. F. (1984) Cell 38,463-469 Argos, P., Landy, A., Abremski, K., Egan, J. B., Haggard-Lju-

ngquist, E., Hoess, R. H., Kahn, M. L., Kalionis, B., Narayana, S. V. L., Pierson, L. S., III, Sternberg, N., and Leong, J. M. (1986) EMBO J. 5,433-440


SUPPLEMENTAL MATERIAL TO

IN WTRO STUDIES OF THE INITIATION OF STAPHYLOCOCCAL PLASMID REPLICATION

EXPERIMENTAL PROCEDURES

Source and mamlenance cl bacteml strains and plasmrd DNA- Escher~chra CCll *vans JM101 ,I*, and RZ1032 [V] Were ObtaIned from Dr I Murray (Leaester Umvwrs~ty) The ccnstwcf~cn ct the bacteriophage M13mpB pC221 (c) strand cc~“te~rate we the H,n dill s,tes has been described 1141 E. co6 str*l” JMIOI dam came from Dr I Epsrcn (L*IC*SW Un,v*rs~ty, E co!! s,r*~n ElO3S ,191 and plasmlds pMG171 and PCT54 ]20] w*re Qlfts from D, G Yarrantcn ,C*lltech Ltd. Slcu~h, UK) Cons,,uct,cn of express~cn vector pHD 1s d*scr,bed below Plasmtds p”C-C. WC-D, pUC-I. pUC-J and p”C-N were created by ~“sertlc” of -250bp blunted Taq I-Dla I fraQm*nts ccntalnlnQ the repllcatlc” CrlQlns Of pT181, pc221, PUSI 12, PC223 and pcw7 ESpeCtlvely ,n,o the H!” Cl, 5118 Of vector puc19 [21]

Strains of Staphyiccoccus aure”~ ccn,a~n~“~ plamds pT181, pT181co~608, and pC221cop903, and plasm,d-,,e* ~,,a,” RN1786 [4] w*re obtamed from Dr R Ncv,ck (Publ,c Health Research Institute, New York) Staphylcccccal plasm,ds are described I” Table 1

Table 1: StaPhylccoccal plasmids

pk& 2Lue PT181 4.4kb PT181 cop608 4 2kb PC221 4 6kb pc221 cop903 4 2kb PC194 2.8kb

Tc’ inch repC Tc’ mc3 r*PC Cm, md rep0 Crn’KIC4 r*pD Cm, mc8

puSI 4 6kb Cm’ mc9 rep, il7j PC223 4 6kb Cm’ ,“CIO r*pJ 1171 pE194 3 5kb El??, ,“Cfl P51 pT48 2 5kb ErWincfl 1261 WV7 4 6kb Cmrmc14*repN I151

Prcv~s~c”al ass~cnmw”f based on ,161. TC’. ml’, Em: &ta”C* to tetrac&?. chloramph*n,ccl. erythrcmycin !nc. lnccmpat,bil,ty ~rcup rep’ Genes eocodmg homologous Rep prcte~ns of th* pTl6l-Ilk* family cf plasmlds

Stra,“s of E co,, were grown on L-agar plate* (L-broth log,, Bactc- Tryptcne, log/l Y*ast *x,r*cf. 5g/l N&I. w,,h Sac,* aoar added tc 15gil. Sactc- Tryptcne. Yeas, extract and Bactc agar frcm DISCO. Detrc~t, USA) ccnfainmg apprcprlale *nf,blcbcs Strains of S a”,*“s were Qrcwn on R-agar plat*S (RI brcth: 2Og/l Bacfc-Tryptcns, IOQ,, Y*ast extract. ,OQ/, N&I, wdh Sacfc agar added lc 15gil) *gal” wdh the add,,ic” of apprcpr~ate anlflbmbcs L,qwd c”Itur*s were grown in R-broth Plawmld DNA was prepared by the msthcd of Blrnbcam and Dcly [27] wth the s”bs,,t”tlcn cf lyscstaph,” (Sigma) 10 5gpgiml I” place cf lysoryme for lys~s of S au~*u$ Negatively supercoiled plasmld DNA was purlfled by two rounds Of dye-bouyant densdy gradlen, cen,rlf”~a,,c” [28]. Relaxed, covalently closed tcpo~scmers 01 plasm~ds w*,* prepared by treatment with calf thymus DNA tcpclscm*ras* I (Bethesda R*s**rch Laboratones/Glbco. Pawley. UK). used according to manufa~turer’s ~n~frucbcn~

Manrpulaticn c, DNA- Re~,r,ct~cn enzymes were cbtamed from SRL and Amersham lnferna,,cnal (Amersham, UK) and used according tc m*n”f*c,ur*r*~ I”S,~UC~IC~S Where necessary, CC~WSIYW 8116s were rendered blunt by ,“c”batic” wfth 0.1 “nits of T4 DNA polymeras* (Anglnn B,c,*chnclcgy, Cclch*st*r, UK) ,n the presence of 0 05mM each dATP, dCTP. dGTP and TTP Prctelns were removed by exfractmn with phenol followed by sthancl preclpitaticn 01 DNA (281. DNA fragments were isolated frcm a~arcse gel lragments by the method of Tautz and Renr [29]. T4 DNA Itgas* (Bethesda Research Labcratcws) was wed lc, k~a,,cns.

Bactermphage MT3 cons,r”ct~ons were fransformed tnto E. co/i &am JM101 rendered ccmpetent by treatment ~8th CaCI,, subsequently plated cut I” a soft aoar overlay [16] Plasm~d DNAs w*,* transfc,m*d mtc E cc/, str*m E103S *gal” usmo CaCI,: ,ra”sfcrmanta were selected by plating c”t cn L-agar ccn,a,“,ng appropriate antlblcttcs (amplcllin 100p~iml, ~chlcr.&*n~ccl IO&ml). Smgle- stranded bacteriophage M13 DNA was isolated by standard m*,hcds [16] and nucleic aad sequsnce determined by dldeoxy chain term~natlcn [3O]

Synthesrs of oligcnuclsofid*s- Oligcnuclect~de* for Cla I site mutagenesis were synthes~sed ma”“ally “stn~ glass beads or paper d,scs as supporl [14] Those serv~nc as substrates for R*D bindfnc and the mutaaenesis of Tvr 188 war* synth&r*d ustng an Appltsd ‘B~csyst*& 3608 DNA s;nlh*sis*r Ol~~cnuclect~de II(+) was radtclabelled at the 5’ end by phcsphcrylat~on wl,h [+P]ATP and T4 pclynuclect~de k~nase (Bethesda R*s*arch Labcrafcnes). Oligonuclectide LpR was created by lhgatlc” c1 II(+)L 10 5’.[=P]-labelled II(+),? by the method of Van Mansfeld et a, [31].

Construction of mpressron vector pH& Vector pHD was assembled frcm plasm~ds pMG171 and pCT54 (F,Qu,w 1) pMG171 IS s,m,lar an ccnstruct~cn lc pMG165 [32] and ccnta~n~ repl~ca,rw orlglns from both pSClO1 and ColEl, the latter bet”0 under contrcl of th* phase I r~~htward promote, and clg5, temperature ~ens~bvw repressor, contained tn the same plasmtd At low temperatures (typically 30°C) the plasm,d mainfa~na a lcw copy “umber detsrmmed by th* pSClO1 crigln. whereas cn lnduct,cn bv a hat step 15 minutes a, 42”CI and subsea”*“, (~rcwth a, 37°C the copy number ,ncr*as*s *s’th* I promoter ;sc*p*s represslo; and 115 ,ranscr,pt du*c,,y dw*s ,h* CclEl r*pl~cat,on cr,g,n. Plasmid pCT54 [ZOI contam both th* E. cob frp promoter and a bacteriophage T7 transcriptional termmatcr Adpcent to th* liboscm* blnding 5118 of th* trp promoter *r* unlqu* stws for fhe ies,r,cticn enzymes Cla I and ECC RI, the latter sl,* *Iso cverlapplng an ,n,fiafcr m*,hicn,ne ccdcn.

Deborah F B&on and W,ll,am V. Shaw.

The promoter *lem*n,s were ccmbmed ,wth pMG171 by ,solatmg ,h*m a a 1.6kb Barn HI-P*1 I ‘ragmen, from pCT54 and hgat,ng ,h,s lc ,h* 6.4kb Barn HI-Pst I ‘ragmen, of pMG171 ccnta~nm~ ,h* repi~cat~cn elements described, ,h,s recombination alsc recreating an acttve ampic~llm r*sistanc* funct~cn. Sdes for restrlcticn wnzymes C/a I and Eco RI adpcent to the trp promoter were mamta~ned as ““ iq”e I” fhe final ccnstr”ct pHD by remcval of the s,“gl* Cl* I and EC* RI sit** from pMG171 before w,lat,on of ,h* 6.3kb fragment, by r*sfr~ct,cn *nz,‘m* d~~eshcn, rep*,, of recessed 3 term~m wtfh T4 DNA polymeras*, and reli~at~cn Express~cn v*c,*r pHD thus ccntains a promoter whvzh may be activated m VW* by heat ~“d”ct,cn. the ,ncr*as* I” copy “umber of ,h* “ectcr by growth a, 37°C allcw,“~ ,h* f,p prcmcter lc escape repress~cn by the hmited amc”“, of chrwncscmal ,rpR prcduc, The “n,que cloning s,,*s “I* C/a I and Eco RI follow ,h* rlbc*cm* bmdlng sit* and an adjacent methlonine ccdcn respectively of ,h* Irp promoter, allcw~n~ both transcr~pt~cnal and translational fustons tc be made. This vector is closely related to vector pMG196 [31], wfh which I, *har*s many Ccmmcn *l*m*ntS.

Safe directed mutagenesis and construction of expression vector p&p& Sate drected mutagenesis was employed lo meats a new C/a I site 5’ of th* reading frame I” order to correctly ahgn th* lniflatcr mefh~cnme ccdcn 01 th* repD Reading frame 9bp distal tc ,h* r,bcsam* b,“d,“g s,,* of th* ,rP promo,*, cf “*c,cr pHD Mutagenesis 1331 of a cc~ntegrate of th* (+) strand of pC221 cloned mto M13mp6 VI* th* Hm dill site usmg the cligcnuclect~de 5’.CTGTACTCATAATCGATCGACTCCTT -3’ altered residues 1197.1199 in th* (+) strand of pC221 from TTT lc CGA. After verification of correct sequence mutants were retransformed Into a dam- sfraln of E. co\, JMlOl to allow the wclation 01 a 2272bp Cl* I fragment ccntainmg the repD and ca, genes Th,s fragment was hgated w,th Cla I-c”, pHD and used lc transform E. COB ElO3S. Transformants carrying the vector pHD ccnta~mn~ th* ~nsertsd fragment w*r* selected on L-agar plats* ccnfa~ning lOO~g/ml amplcillln

and IOpglml chloramphsnlcol. R*~frlcllcn se* mapp8ng ldenbfled reccmb~nants vnth the correct crmntaticn of repD reading frame relatwe to the trp promoter: one of these, designated pRep6, was selected for expr**w,n of RspD The sequence of the expressed r*pD gene was venf~ed aftsr subcloning the 2.3kb HP* ,-EC* RI fragment Of pRep6 ccntalnlng repD and cat I”,0 MtJmps Plasmld Cc”s,r”cllcll* *r* summarised on Table 2

Inducbon, ex~ress,on and porrhcafion of RspD- E co,, strain E103S ccnta~nln~ plasmld pRep6 was ~rcwn I” R-broth a, 30°C with a*,*,,~” lo a” OD*** of 0 4. Cultures were then heat tnduced at 42°C ‘c, 5 minutes, followed by incubation with aeratlcn at 37°C for 5 hours Cells were pelleted by centr~fu~at~cn (5 min”fws. 10000~. 4’C), and resuspended ,n 2OmM Tr,s HCI. pH8 0, 2OOmM KCI. ImM EDTA, ImM DTT, 10% v/v othanedol tc a final OD,,, of 50.

The purificatlcn prctcccl for RepD was based cn a method described for RepC [4] with mod~f~caticns. The csll susp*ns~cn was disrupted by scn~cat~cn and debris removed by centr~f”gat,cn (15 m,n”,*s, 12OOOg. 4°C) The s”p*m*,*nl was s”b,ect*d lc (NH&SO, fract~cna,~c”. the 25.40% sa,“ra,,c” fract~cn ccntalm”~ RepD being resuspended in buffer as before 10 Img prote~niml and applaed tc a 30ml column of heparin-Sepharose CL-66 LPharmac~a, Uppsala, Sweden) Aftsr wash,ng with 3 ~cl”mn vc,“m*s of res”spe”s,on buffer, pro,*,” was eluted. ,w,h a 300ml gradm, of ZOO-700mm KC, ,n the same b”ff*, R*pD was found 10 *I”,* betwesn 400 and 5OOmM KCI lndtvidual fractions (3ml) were mcndcred by their abscrbancs a, 280nm. prctem ccntsn, was determmed [34] usmg bovine **rum albumln as standard Purdy was judged by SDS-polyacrylamlde gel *l*ctrcphor*s~s (FIQUW 2) [35] Prctsr cbtalned was stored at -20°C for up lc 12 mcnths with nc s~gnfhcant 10% of repl~cat~cn mmatcr, tcpciscmerase, DNA blndmg or cleavage actiwties The method deswb*d typtcally yteldsd 40mg RepD prct*!n frcm 1 h,r* of mduced c”lt”r*. at an *st,ma,*d purity of better than 95%

FIGURE 1: CONSTRUCTlON OF VECTORS pHD AND pRep6

AAGGGT-TE.


w pMGI71 pCT54 4 Okb PAT153 derived YeClOr conlalning VP promoter 1201 w 7 8kb pMGl71 containing ,,p pronmer of pCT54 ~8th

@C-J p”C-N Ml3’O”D(+,

7 5kb 10 Ikb

FIGURE 2. PURIFICATION OF RepD

kDa 1234567 89101112

1

RepD

Physical charac,erisal,o” 0, RepD Obtamed I” this way included gel liltratlon and N.,erm,na, amino acid sequence analysis. For gel filtration *tLhe* RepD was diluted I” ao”M T”S.HCI (pH8.0). I”lM EDTA. 450”lM KCI an* applied 10 a superose 12 HR10/30 cOl”mn cOnneCted 10 Pharmacla FPLC eqtxpmenr. A”lomafed Edman degradamn to determme the anmo-terminal sequence of RepD was carried out On an Applted B~osysiems 470A pepbde sequencer.

Repltcalmn initlalor acttvity was measured by Ihe tncorporat~o” of iadloiabelled deoxyrlbonucleotlde triphosphares l”,O acid preclpitable “la,er,a Assay mlxf”re* (25pl) contamed 25”lM HEPES (p&3.0,. lOOrnM KC,. ,OrnM Mg,OAc),. ImM DTT. 2.5% WV PEG 4000. l,,Ci (methyl.W]TTP. 12.5pM each dATP,dCTP,dGTP, TTP. 2mM ATP. 120pM each CTPIGTPIUTP. 0.5pg of added piasmid DNA. 5~1 of cell. free extract. and IO-50”Q purlfled RepD. After l”C”ba,lon a, 30°C for I h0”i me reaction was stopped by the addifm” 01 Iml of 10% trlchloroacetic acid and lncubaflo” al 0-C for 20 mr”ules. Acid preclpitable material was collected on Whatman GFlC filters and radioactivity measured using Opttscfnt T (Fisons) as SCl”tilla”l.

AulOradiOgraphy Of labelled piasmid used DNA replicated I” the presence 01 I ,,Ct 01 [a-W]dATP ~“sfead of [methyl-W,TTP. Radmlabelled DNA was ,sola,ed by phenol extractm” and ethanol prec,pitatlon. Alter restr~cf~on endonuclease dlgeslto”. fragmenls were separated by agarose gel electrophoresis. visuaked by statning with ethldlum bromide and pholographed under UV tllumlnatio” Radioiabelled fragments were located by autoradiography ustng FUJI RX X-ray film and Ph~hps Fast-Tungslale tnlensifytng screens.

Assay of ,opoisomerase ac,ivi,y- T~p~~s~merase assays contained 0.5.1 Ojrg

of plasmtd DNA I” a ,“,a, volume 01 25,,i of IOmM Tr,s.HCl (pHg.O). 300mM KC,. 1OmM MgCI,. 10% v/v ethanedioi: wtth 10~1000”g of purtfied RepD added as

rewred. After t”c”bat8o” al 30°C for 1 ho”r. 2pl 01 dye shtto” (50% “Iv glyceroi. 20mM EDTA) was added and plasmid lopologtcal forms idenltfied by eie~trophorew, at lO”,cm lhrough 1% wiv agarose gels in TBE (QOmM Tris.bora,e. pH8.3. 2.5mM EDTA) ~8th or witho~, e,h,dwm brom,de a, lpgiml. Where requred. gels were stat”ed ~8th ethldlum bromide (Ipgiml) before illuminalm” with UV llghl and photographed using Polarold Type 55 him through a” orange Wter.

Subsltlul~ons I” Ihe assay “vx ,“cl”ded IOmM B&I, I” place 01 IOmM MgCI,. and IOOmM KCI. lOmM Trls.HCl (pHB.0) I” place 01 300mM KCI. IOmM Tris.HCI (pH9 01. Topo!somerase assays used “egawely supercooled plasmtd DNA as substrate: We-specific “icklng was also demonstrated using plasmid DNA previously relaxed usmg calf thymus DNA lopo~somerase I (SW,. Agarose gels run I” the presence of elhidum bromide caused relaxed. cwalently closed (RC) Iopo~someis lo migrate as a smgle band ahead 01 the negatively supercooled (SC) lorm. itself migrating laster than nicked. open circular (OC) forms I” Ihe absence of efhldtum bromide. indlwdual RC fopoisomers were resolved between the SC and OC forms as a ladder

De,ermlna,ro” 0, ,tle sing,e srrand cicavage porn- Baclerlophage M13mplQ orrD recombrnants were created by tnsert~o” of restrrcl~o” fragments Of PC221 containing 0,rD a, ,he Ii,” CII 5118 of the vector analogous to Ihe ~onstruc,,~” 01 pUC D N”cleic ac,d sequence a”alys6 >de”t,f,ed recombinants containing e,,her ,he (+) or (.) Wands 01 orrD Primer extensmn 0” Sl”gle stranded forms of lhese recomb,“a”,s by Kle”0w polymerase I” Ihe presence Of lpC, of (a =P)dATP I” add,,,“” 10 0 05mM each dATP dCTP dGTP and TTP produced double stranded or,D spec,,,caily labelled I” one strand Such material was the” tncubated ~8th var,ous amw”,s 01 RepD a, 30°C for 10 mrnules I” Ihe presence 01 IOmM TM HC, pH6 0 ,OOmM KC! w,,h or w~tho”t the add,,,o” of IOmM MQCI, Nicked products were analysed by electrophoresls ad,ace”t 10 sequencing tr~iis dewed fro”, the same comblnat,“” 01 primer and tempiate

Ge, re,arda,ron assays- Plasrwd DNA was dtgested wth appropriate WS,,,C~~O” enzymes and the” s”b]ec,ed 10 phenol ex,ra~,,“” and etha”Dl prectp~lat~o” Amounts 01 lpg DNA were combined ~8th 10 IOOng RepD 8” a “dume of 25,, con,a,n,ng 100mM KC, 10mM TM HCI (pH8 0) ImM EDTA 10% Y Y e,ha”ed,ol aiternate samples also co”,a,“ed IOmM MgC,? or IOmM SaCI After incuba,,“” a, 30-C lo, 5 m,“~,es lurlher subsamples were ad,us,ed 10 1% WI” SDS and mcubated a, 65’C for 15 m,““,es TO al, samples 2~1 of dye soi”l~0” (50% “I” giycerol. POmM EDTA) was hen added and m,xlures analysed b; get electrophoresls through 1 5% agarose or 6% polyacrylamlde ustng TBE as ru”n>ng buffer Gels were staned wllh elhidwm broznde and photographed as above

Linkage 01 ohggo”“cleotrde to protern- 3”“m (1 lO,LQ, of RePD protein was comb,“ed Wh either 0 Ol‘lpmol (0 O!$Ci) of rad,olabelled ollQo”“cleotld~ LPR Or 50”r”“ l Of ollgo”“cleotlde II(+) I” 5oop of lO”lM TM HCI (pH8 0, lOrnt.4 MgCI? and IOOmM KC, Afler I”c”ba,io” at 30°C for 40 minutes ihe prote,n.oltgonucleotIde complex was precipllaled by the additto” 01 ammo”,“m sulphate 10 60% sat”ratl0” (2 4M) and resuspended I” 1,Opl of 50mM Tr,s HCI (pHB 0) 5mM CaCI, 0 1% WY) SDS

,de”,t,,CaflO” 0, phosphoammoacrds- A fraC,lO” (0 Olpmo~. 0 0350) 01 me RepDLpR complex deswbed above was prec,p,la,ed w,,h ,r,chloroacet~c acid and resuspended I” SM HCI Hydroiyss was a! 110-Z for I-3 hwrs after whch samples were d”ed under vacuum and resuspended I” 21~1 waler COntainlOg 2vQ each of unlabeiled standards phosphoserine phospholhreon~ne and phosphofyrosine (Sgma) Th-layer eieclrophores~s of these samples [36j I” 5% acek acid and 0 5% pyrldtne (pH3 5, was a! 1000” for 30 m,““,es Am,“” acids were staned Wh 0 2% WI” “lnhydrt” I” acetone and [=P] phosphoamt”” acids revealed by aulorad,ography

PrOmolylrC drgesrron 0, prom” DNA complex- Samples containing 51,Q Of Ihe RepD LpR complex I” 50rnM T”S HCI (pH8 0, 5’nM cao, 0 1% WI” SDS were d,ges,ed wilh 4pQ 0, the relwa”, prolease a, 37 C overnight Proreases l”cl”ded pronase (Calbtochem) prole~nase K Boehrmgeri s!aphyiocotCal “8 Proiease (Miles) and tryps,” (Cooper Siomed~cal) Bulk d,ges,,on before pepttde pur~l~cailo” used lOO,,g of iiepD LpR and 5Oug of RepD-II(+) complex combmed with 5% (WRY wth complex) iryps!” and ,“cubated a, 37 C for 6 ho”rs when a second ah2”“l 01 tryps,” was added and the l”c”baf>o” co”i~“ued overnIght

Purr,,ca,ron 01 Ihe ,,yp,,c pep,,& o,rgonuc,eo,rde compkx- PeptIdes iesuiting from Ihe buik d,gesho” descrrbed above we,e separared “Sing a slka reversed phase HR515 column (Pharmacia, connected 10 Pharmxla FPLC equ,pme”t Frac,,o”s were &led by a gradten, of 0 60% v v acet”“lirlle i” lO”IM ammo”,“m acelate us,ng the absorbance a, 214”m lo, Ihe detecW” 01 PePtlde peaks After separai~o” of ,he d,ges:,o” p,oduc:s of ,he labelled ~Ompiex O”e le”lh 01 each fra~ton was assayed Ior rad>oac,,w,y by liquid sc~“lWat~o” ‘X”“ll”Q Maleml was also dried under vacuum resuspended i” 4~ 01 water and a”aiyS’2d by elecfrophoress through gels co”s,sWg of 8M urea 20% acrylamtde (urea-PAGE) 8” TBE

Pep,,& sequence ana,ysis- The rema,ndei 01 the ,racl~o” idenllhed as conlalnlng Ihe trypt~c pepttde oiigonucleolide complex was drted under vacuum resuspended I” wa,er and dried agal” before ,esuspe”d,“g I” 0 1% trtfl”010acetic ac,d Th,s maler~al was loaded on,” a Polybrene ,mpreg”a,ed glass ftbre disc before automated gas phase peptide sequencing us,ng an Appiled B~osystems L70A sequencer and 120A PTH analyser

M”,agc”esis of Tyr 188- Mutagensis of the recombinant bacV?rlophJQe Ml3 Rep0 was by the method of Kunkel e, a, ,371 using Escherrchra cob IV1032 as tne dutung host and fhe 31 base ol,go”uciea,,de MUT (5 GATTTATTAGAATTTT TAATAAAAAACAAGA 3‘)as the mutagenic pruner The mutated repD reading frame w,,h codon 188 allered from spec,,y,“g ,yios,“e 10 phenyialanme was re~nserled #“lo “ettor pHD at the C,a I Me 10 produce ,he express,“” vector pRepYl88F


FIGURE 10: AClD HYDROLYSlS OF THE Rqm-LpR CCJMPLEX F,GURE 1,: LOCAT,ON OF ACTlVE SITE RESIDUES

pi ,‘Y

‘L’

IH I O-

lh

2 3

*t .

0

3h LPR

in vitro studies of the initiation of staphylococcal ... · precipitable material) of negatively...

Documents