immune selection in vitro reveals human immunodeficiency virus-1

Lewis et al 1 Mapping Nef MHC-I downregulation with Immune Selection

1

2

3

IMMUNE SELECTION IN VITRO REVEALS HUMAN 4

IMMUNODEFICIENCY VIRUS-1 NEF SEQUENCE MOTIFS 5

IMPORTANT FOR ITS IMMUNE EVASION FUNCTION IN 6

VIVO 7

8

9

Martha J. Lewis#1,2, Patricia Lee 1,2, Hwee L. Ng 1,2,3, Otto O. Yang 1,2,3 10

11

12

1Department of Medicine, Division of Infectious Diseases; 2UCLA AIDS Institute; 3Department 13

of Microbiology, Immunology, and Medical Genetics, Geffen School of Medicine at UCLA, Los 14

Angeles, CA, USA. 90095. 15

16

#Corresponding author: 10833 LeConte Ave., CHS 37-121, Los Angeles, CA, 90095. 17

[email protected]. (310) 825-0205 (office); (310) 825-3632 (fax). 18

19

Running title (54 characters): Mapping Nef MHC-I downregulation with Immune Selection 20

Word count: abstract – 226; Text – 5,949 21

Key words: HIV-1, MHC Class I Genes, Cytotoxic T-Lymphocyte, Nef, molecular evolution22

Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.00878-12 JVI Accepts, published online ahead of print on 2 May 2012

on April 14, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


ABSTRACT 23

Human Immunodeficiency Virus-1 (HIV-1) Nef downregulates Major Histocompatibility 24

Complex class I (MHC-I), impairing clearance of infected cells by CD8+ cytotoxic T 25

lymphocytes (CTLs). While sequence motifs mediating this function have been determined by 26

in vitro mutagenesis studies of laboratory adapted HIV-1 molecular clones, it is unclear whether 27

the highly variable Nef sequences of primary isolates in vivo rely on the same sequence motifs. 28

To address this issue, nef quasispecies from nine chronically HIV-1-infected persons were 29

examined for sequence evolution and altered MHC-I downregulatory function under Gag-30

specific CTL immune pressure in vitro. This selection resulted in decreased nef diversity and 31

strong purifying selection. Site-by-site analysis identified 13 codons undergoing purifying 32

selection, and one undergoing positive selection. Of the former, only 6 have been reported to 33

have roles in Nef function, including 4 associated with MHC-I downregulation. Functional 34

testing of naturally occurring in vivo polymorphisms at the 7 sites with no previously known 35

functional role revealed 3 mutations (A84D, Y135F and G140R) that ablated MHC-I 36

downregulation, and 3 (N52A, S169I, and V180E) that partially impaired MHC-I 37

downregulation. Globally, the CTL pressure in vitro selected functional Nef from the in vivo 38

quasispecies mixtures that predominately lacked MHC-I downregulatory function at baseline. 39

Overall, these data demonstrate that CTL pressure exerts a strong purifying selective pressure for 40

MHC-I downregulation and identifies novel functional motifs present in Nef sequences in vivo. 41

42


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


INTRODUCTION 43

The HIV-1/SIV accessory protein Nef, an abundantly expressed 27kDa myristoylated 44

protein, is not essential for viral replication but is central to pathogenesis (reviewed in (21, 48)). 45

This protein plays a key role in viral persistence and virulence. In humans, infection with Nef-46

defective HIV-1 has been associated with low-to-undetectable levels of viremia with vigorous 47

antiviral immunity and delayed disease progression (14, 18, 19, 31, 32, 34, 44). Similarly, 48

experimental infection of rhesus macaques with SIV in which Nef has been deleted 49

(SIV239Δnef) results in low-to-undetectable levels of viremia, asymptomatic infection, and 50

protection from subsequent challenge with wild type virus (17). This model system has been 51

considered the gold standard for a disease-attenuating vaccine model. 52

Although numerous functions have been attributed to Nef, the mechanisms whereby Nef 53

exerts these dramatic clinical effects appear to involve its ability to direct immune evasion. 54

While Nef initially was misunderstood as a negative transcriptional activator (2, 45), further 55

work has shown that it contributes to viral pathogenesis through multiple functions that enhance 56

viral infectivity, such as downregulation of CD4 on the surface of infected cells (24, 37) and 57

modulation of cellular activation (8, 9, 56, 58, 61). Furthermore, it is well established that Nef 58

downregulates Major Histocompatibility Complex class I (MHC-I) cell surface proteins (12, 13, 59

60). In vitro models demonstrate that Nef-mediated MHC-I downregulation impairs cytotoxic T 60

lymphocyte (CTL) recognition and clearance of infected cells (1, 13, 63, 68), suggesting that it 61

plays a central role in immune evasion. 62

In vivo evidence also suggests that this function is important for immune evasion. 63

Rhesus macaques infected with SIV containing Nef rendered specifically defective in MHC-I 64

downregulation function via difficult-to-revert mutations showed trends for higher CTL levels 65


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


and lower viremia in the first 14 weeks of infection followed by viral rebound accompanied by a 66

striking pattern of Nef evolution to reconstitute this function via new sequence motifs resembling 67

those in HIV-1 (62). In chronically HIV-1-infected humans, Nef has been shown to lose 68

function in persons with severely depressed cellular immunity due to very young age (25, 65) or 69

late stage AIDS (11, 33), and more specifically, its MHC-I downregulatory function correlates to 70

the breadth of the HIV-1-specific CTL response during chronic infection (40). These data 71

strongly suggest the importance of this function in the immunopathogenesis of infection by 72

reducing CTL clearance of virus-infected cells. Moreover, the variability of Nef function during 73

chronic infection suggests that it evolves to optimize its balance of different functions to 74

maximize viral persistence in the face of changing selective pressures in vivo (40). 75

Mutational studies of Nef in laboratory strains of HIV-1 have defined key amino acid 76

sites and functional domains involved in downmodulation of MHC-I (reviewed in (26, 47)). 77

However, the sequence of Nef is highly variable in primary isolates of HIV-1. It is likely that 78

Nef can adapt to downregulate MHC-I through altered or distinct motifs depending on its 79

sequence context, as seen in the SIV model (62). However, few studies have addressed the 80

ability of Nef from primary isolates of HIV-1 to downregulate MHC-I (46), and there is almost 81

no information about whether the functional motifs of primary isolates of Nef match those 82

identified by mutagenesis of laboratory adapted strains of HIV-1. 83

To address this issue, we investigated the interplay between the MHC-I downregulatory 84

function of primary isolate quasispecies Nef proteins and sequence evolution under 85

experimentally imposed selective pressure to evade Gag-specific CTLs. This selective pressure 86

caused a clear pattern of purifying selection coincident with the optimization of MHC-I 87

downregulation to allow viral persistence in the presence of CTL selective pressure. Sequence 88


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


analysis of this adaptive evolution identified key amino acid sites important for Nef-mediated 89

immune evasion in primary HIV-1 isolates, demonstrating the close reciprocal relationship 90

between Nef and CTL-mediated immunity in pathogenesis, and suggesting vulnerable regions 91

that could be targeted beneficially by vaccines or pharmacologic blockade. 92

93


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


MATERIALS AND METHODS 94

Isolation of plasma nef quasispecies and insertion into recombinant reporter viruses. The nef 95

gene was amplified from the plasma of 9 chronically HIV-1 infected subjects and cloned into an 96

NL4-3 based reporter virus as previously published (40). Briefly, cDNA was made from viral 97

RNA using the gene-specific primer Nef 9589R 5’ TAGTTAGCCAGAGAGCTCCCA. Then nef 98

was amplified using the following primers: Nef 9589R 5’ TAGTTAGCCAGAGAGCTCCCA, 99

Nef 8670F 5’AATGCCACAGCCATAGCAGTG, Nef 8675F 5’ 100

GCAGTAGCTGAGGGGACAGATAGG, Nef 8687F 5’ 101

GTAGCTCAAGGGACAGATAGGGTTA, Nef 8736F 5’ AGAGCTATTCGCCACATACC. A 102

nested PCR was performed with the following primers: Nef 8787 XbaIF 5’ 103

GCTCTAGAATGGGTGGCAAGTGCTCAA and Nef 9495R 5’ 104

TTATATGCAGCATCTGAGGGC. Following amplification overhanging A’s were added to the 105

ends of the PCR products then cloned in bulk by the TA method into pCR2.1-TOPO vector 106

(Invitrogen). Ligation mixtures were grown in liquid culture and not subject to individual colony 107

selection on solid media in order to preserve the quasispecies mixture of cloned PCR products. 108

Plasmid DNA was digested with XbaI and BspEI (New England Biolabs) and subsequently 109

subcloned into the nef position of the half-genome construct p83-10 (4). Ten μg of each half 110

genome plasmid, p83-10 with nef and the reporter p83-2-HSAxVpr (4), was digested with EcoRI 111

(New England Biolabs). Both plasmids electroporated into 10 million T1 (174 x CEM.T1) cells 112

(57) using a GenePulser Electroporator (BioRad). Recombinant reporter virus stocks were 113

collected in the supernatant 7-10 days after electroporation. Control viruses carrying the Nef 114

mutant M20A unable to downregulate MHC-I (3) or standard NL4-3 Nef were made in parallel. 115

116


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


In vitro immune selection. One million T1 (HLA-A*02-positive) lymphocytes (see above) were 117

infected with virus stock containing 12.5 ng of p24. This is equivalent to an MOI of 118

approximately 0.05-0.1 based on previous titers. After infecting for 4 hours at 37oC cells were 119

washed and split into two wells of 0.5 x 106 each. Then either 0.5ml of RPMI supplemented 120

with 10%FCS and 50 units/ml IL-2 (R10-50) or 0.5ml of R10-50 with an HLA-A*02-restricted 121

CTL clone specific for the p17 Gag epitope SL9 was added to the infected cells at an effector to 122

target ratio of 1:4. Culture supernatant was collected on days 5 and 7 post-infection and virus 123

growth was quantified by p24 antigen ELISA. These p24 levels were used to set up a second 124

round of infections again with 12.5ng of p24 and 1 x 106 fresh T1 cells, and selection was 125

performed as before with the same CTL clone. The first round virus cultured in the presence of 126

the CTL clone was again cultured with the clone, and as a control for genetic drift the viruses 127

cultured without CTL selection were also cultured again without CTL selection. Again, culture 128

supernatants containing the selected quasispecies were collected on day 5 and 7 post-infection 129

and quantified by p24 ELISA to confirm viral growth. 130

131

RNA isolation, RT-PCR and nef sequencing. Viral RNA was isolated from either the viral stock 132

(i.e. – the input virus) or culture supernatant after 2 rounds of culture with or without the CTL 133

clone. RNA was isolated using the QiaAMP Viral RNA Mini Kit (Qiagen) according to the 134

manufacturer’s protocol then used as a template for cDNA synthesis using SuperScript III 135

Reverse Transcriptase (Invitrogen) and the gene-specific primer Nef 9589R 5’ 136

TAGTTAGCCAGAGAGCTCCCA. The resulting cDNA was used as template for nef 137

amplification using the high fidelity polymerase Phusion (New England Biolabs) and the 138

following primers: Nef 8787 XbaIF 5’ GCTCTAGAATGGGTGGCAAGTGCTCAA and Nef 139


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


9495R 5’ TTATATGCAGCATCTGAGGGC. PCR reactions were carried out using the 140

following conditions: 5 min. at 980C, 35 cycles of 980C for 10s, 570C for 30s, 720C for 30s, 141

followed by a final extension at 720C for 10 min. A 20 minute incubation at 720C with standard 142

Taq polymerase (New England Biolabs) and dNTPs added the necessary overhanging A’s, and 143

PCR products which were then cloned in bulk by the TA method into pCR2.1-TOPO vector 144

(Invitrogen). A minimum of 10 nef clones per subject were selected for sequencing using the 145

standard vector primers M13F and M13R and the Big Dye Terminator Reaction Kit 3.1(Applied 146

Biosystems). Cycle sequencing products were run on an ABI3130 Genetic Analyzer (Applied 147

Biosystems). 148

Sequence analysis. Nucleotide sequences were translated into amino acid sequences and 149

manually edited using the program BioEdit then aligned along with NL4-3 and the Los Alamos 150

HIV-1 database Clade B Consensus nef using CLUSTAL X. A neighbor-joining tree was 151

constructed using the DNADist and Neighbor programs of PHYLIP 3.64 (22). The tree was 152

statistically evaluated with 1000 bootstrap replicates. The sequences were then divided into 3 153

separate populations - input, with CTL, and without CTL selection - for the subsequent analyses. 154

Sequence diversity within the quasispecies swarm and overall divergence from Clade B 155

consensus sequence were determined using the program SENDBS with the Hasegawa model + 156

gamma and standard errors estimated from 500 bootstrap replicates. Change in diversity and 157

divergence was calculated by taking the value for the “with CTL” population minus the value for 158

the “no CTL” population. Difference between control and selected sequences were evaluated 159

with a two-tailed t test. Divergent sequences were examined for G to A hypermutation using 160

Hypermut 2.0 from the LANL HIV-1 database tools. Sequences with non-intact reading frames 161

due to frame shift or non-sense mutations were counted and excluded prior to the analysis for 162


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


adaptive evolution. Difference in the number of sequences containing stop codons between 163

control and selected sequences was evaluated by a two-tailed Χ2 test. All of the following 164

analyses were performed using HyPhy (50). The program MODELTEST (52) was used to 165

determine the best fitting model for the data was HKY85. The global dN/dS ratio along with its 166

95% confidence intervals were estimated after building and optimizing the maximum likelihood 167

function for each of the three data sets. Individual amino acid positions with evidence of adaptive 168

evolution were identified by three separate methods, ancestor counting (SLAC), relative-effects 169

likelihood (REL), and fixed-effects likelihood (FEL). A site was considered to be adapting 170

under CTL selective pressure if that site was identified by at least 2 of 3 methods with a 171

significance level of at least 95% and was only identified in the dataset with CTL and not in the 172

without CTL dataset. Additionally, only those sites with a dN/dS significantly > and < 1 were 173

considered positive. Selected sites were highlighted on the composite crystal structure of Nef 174

kindly provided by Dr. Art F. Y. Poon (Vancouver, B.C., Canada) using the program RasMol 175

http://www.umass.edu/microbio/rasmol/. Conservation of the selected sites was determined by 176

compiling an amino acid alignment of all complete, non-recombinant Nef sequences submitted 177

to the LANL HIV-1 Sequence Database through 2010, N=2114 including genotypes A-K. The 178

probability of each amino acid at the selected sites was plotted using WebLogo3 (16). 179

Creation of Nef Mutants by Site-directed Mutagenesis. The 7 sites undergoing purifying 180

selection with no previously known association with Nef function were selected for site-directed 181

mutagenesis. The following 8 mutations were created individually within the NL4-3 based p83-182

10 plasmid using the appropriate primers and the QuikChange XL-II Kit (Stratagene): N52A, 183

N52S, A84D, Y135F, G140R, S169I, H171A, V180E. The amino acid changes selected were 184

based on mutations observed at these sites in the primary isolates, except H171A. All mutations 185


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


were confirmed by sequencing. Recombinant reporter viruses were created by co-186

electroporation with p83-2 HSAxvpr as detailed above. 187

Assessment of MHC I downregulation by Nef. Levels of HLA A*02 on the surface of cells 188

infected by Nef recombinant reporter viruses was performed as previously described (40). 189

Briefly, T1 cells were infected with either the input virus stock or the supernatant containing the 190

quasispecies surviving after 2 rounds of CTL selection. All 9 input viruses were tested, and 5 of 191

9 samples after 2 rounds of culture with CTL yielded adequate samples for testing. Similarly, T1 192

cells were also infected with the 8 Nef mutants. On day 5 post-infection cells were stained with 193

FITC-anti-murine CD24 (HSA) (BD) to detect reporter positive infected cells and PE-anti-194

human HLA A*02 (ProImmune). At least 2x104 live cells were counted using a FACScan flow 195

cytometer, and data were analyzed using CellQuest software (Becton Dickinson). Maximum 196

levels of HLA A*02 were determined using the Mean Fluorescent Intensity (MFI) of the M20A 197

Nef mutant which is defective in MHC-I downregulation or Delta Nef virus. Percent HLA A*02 198

down-regulation was calculated using the MFI of M20ANef-infected cells as maximum and the 199

MFI of isotype stained cells as minimum. Infections and flow measurements were repeated at 200

least 3 times, except for the passafed viruses for which only one sample was available. A two-201

tailed t test was used to determine differences between NL4-3 and mutant viruses. 202

203

Sequence Accession numbers: available upon acceptance of manuscript.204


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


RESULTS 205

Isolation of in vivo HIV-1 nef quasispecies. 206

As previously described (40), full length nef sequences were isolated from plasma of nine 207

persons with chronic, untreated HIV-1 infection. All subjects had detectable viremia ranging 208

from 400 to >750,000 RNA copies/ml and peripheral blood CD4+ T lymphocyte counts ranging 209

from 0 to 900 cells/mm3 (data not shown). The bulk nef quasispecies from each subject (“input 210

sequences”) were cloned into a replication-competent NL4-3-based reporter virus for subsequent 211

selection experiments. 212

Genetic evolution of primary nef quasispecies under experimental selection by Gag-specific 213

CTLs. 214

The influence on Nef of immune pressure against HIV-1 was assessed by subjecting the 215

recombinant viruses to experimental selection by HIV-1 Gag-specific CTLs. The recombinant 216

viruses containing primary nef quasispecies were cultured either alone as a control for random 217

genetic drift (“control”), or in combination with CTLs recognizing the Gag epitope 218

SLYNTVATL (“selected”) for two passages of seven days each, followed by clonal nef sequence 219

analysis of the resulting viruses. These control and selected sequences were aligned with the 220

input nef sequences (n=231) to create a neighbor-joining phylogenetic tree that was statistically 221

evaluated with 1000 bootstrap replicates (Figure 1). Sequences from each subject clustered 222

independently (>99% bootstrap support) with the exception of Subjects 00035 and 00039, who 223

previously were identified to have related viruses suggesting a common infection source (40). A 224

few highly divergent sequences were observed in the control quasispecies of subjects 00034, 225

00039, and 00041, although only the sequence from 00034 had evidence of G-to-A 226

hypermutation (p=0.02). Generally, however, the persisting nef sequences after immune 227


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


selection were intermingled with the input and control sequences. The CTL-selected sequences 228

formed phylogenetically distinct clusters (bootstrap values >70%) in two of nine subjects (00022 229

and 00034). In both of these cases these sequences converged towards the Clade B consensus 230

sequence, suggesting evolution towards a more fit sequence. 231

Increased maintenance of the nef reading frame as a result of CTL selection. 232

The nucleotide alignments were translated into amino acid sequences to examine the 233

status of the reading frame (Figure 2A). At baseline, 6.5% (7/107) of input sequences from 234

plasma contained non-sense mutations including both premature stop codons and frame-shift 235

mutations. The control passaged population cultured without CTL exhibited an increase to a 236

non-sense mutations frequency of 14.8% (12/81), consistent with genetic drift in a setting where 237

changes in Nef have little or no fitness cost, i.e. in vitro culture in immortalized T cells (29). In 238

contrast, the CTL-selected quasispecies had a significantly lower than expected non-sense 239

mutation frequency of 4.9% (4/81) (Χ2 p=0.0351). Overall, the increase in reading frame 240

preservation with CTL selection versus decrease in the absence of CTLs suggest that CTLs exert 241

selective pressure on Nef to increase viral persistence. 242

Reduced diversity of primary nef quasispecies after CTL selection. 243

The change of variability within the nef quasispecies population in response to immune 244

selective pressure was assessed for each subject individually and across all subjects by 245

calculating changes in diversity and divergence from the Clade B consensus sequence in the 246

absence and presence of selection by the Gag-specific CTLs. As mentioned above, the 247

quasispecies from subjects 00022 and 00034 with immune selection clearly converged on the 248

Clade B consensus sequence (Figure 1). For all other subjects, whether analyzed individually or 249

grouped, there was no significant change in sequence divergence with immune selection (data 250


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


not shown). However, for 4 of 9 subjects there was a significant (t test p<0.05) decrease in the 251

diversity of the quasispecies after CTL selection (Figure 2B and C). The decrease in diversity 252

and the convergence toward the consensus sequence in the presence of CTL suggest that CTL 253

selection places constraints on evolution of the nef reading frame. 254

Global adaptive evolution of nef for viral persistence in the setting of CTL immune 255

selective pressure. 256

The subset of nef sequences with intact reading frames was codon-aligned and used to 257

calculate the ratio of the rate of non-synonymous to synonymous changes (dN/dS) for the entire 258

coding region for each of three sequence groups: input plasma sequences (n= 94), CTL selected 259

sequences (n=71) and control passaged sequences (n= 67) (Figure 3A). The dN/dS ratio of the 260

input plasma nef sequences demonstrated purifying selection at baseline in vivo (dN/dS = 0.59, 261

95% CI 0.53-0.65), similar to previously reported data (39). Control sequences passaged without 262

CTL selection had a similar ratio to the input sequences (dN/dS = 0.61, 95% CI 0.56-0.68). 263

However, the CTL-selected nef sequences had significantly greater purifying selection (dN/dS = 264

0.47, 95% CI 0.42-0.53) compared to control sequences as demonstrated by the non-overalpping 265

95% CIs of the control and selected dN/dS estimates. These results demonstrate that CTLs 266

exerted selective pressure for maintenance of Nef through a functional constraint. 267

Amino acids in Nef undergoing selection lie in important functional domains. 268

To identify key sites within Nef that were undergoing selection, dN/dS ratios were 269

calculated for each codon using ancestor counting (SLAC), relative-effects likelihood (REL), 270

and fixed-effects likelihood (FEL) methods (50). Codons were considered to be under 271

significant selection if they reached p <0.05 by at least two of these three methods for the CTL 272

selection and not the control sequences. Site-by-site analysis identified 13 sites subject to 273


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


purifying selection and 1 site undergoing positive selection (Figure 3B and Table 1). Of these 14 274

sites, 7 were previously reported to be associated with motifs important for Nef function, of 275

which 5 were linked specifically to MHC-I downregulation (Table 1). 276

The identified sites are located in key domains of Nef (Figure 4A), such as the N-terminal 277

α-helix (E18) and unstructured loops that bind cellular proteins (E62, L164, and D175) (27, 38). 278

Notably, site E62 lies within the EEEE acidic domain and site V74 lies at the “φ” position within 279

the PxφP motif, and both motifs are known to be required for MHC-I downregulation, although 280

V74 has not been tested specifically for its effect on downregulation independently of the 281

prolines (43, 49, 56, 67). Site D123 is required for dimerization of Nef and therefore all its 282

functions (7, 41, 67), including MHC-I downregulation. Site E18 is the “X” within the RXR 283

motif important for β-COP binding and necessary for maximal MHC-I downregulation, although 284

previously only the arginines within this motif specifically have been tested (59, 67). Site L164 285

lies within the dileucine motif required for CD4 downregulation by Nef and is also important for 286

infectivity and replication in PBMCs (15, 26, 54). Sites V74, A83, and D175 lie within motifs 287

implicated in modulation of cell signaling pathways by Nef (20). While site S169 has no 288

previously identified role in Nef function, a recent analysis showed that this site is co-evolving 289

with N157 and therefore likely to have some functional role (51). The remaining six other sites 290

under purifying selection (N52, A84, Y135, G140, H171, and V180) have no previously defined 291

associations with known functions of Nef. 292

CTL selected sites in Nef are highly conserved in primary isolates of all HIV-1 genotypes. 293

To determine whether these selected sites in the cohort tested here are broadly important 294

to Nef in general all complete Nef sequences in the Los Alamos National Laboratory (LANL) 295

HIV-1 Sequence Database were examined for amino acid sequence conservation at these sites. 296


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


A total of 2114 complete, non-recombinant Nef sequences representing genotypes A-K 297

submitted through 2010 were aligned and translated into amino acid sequences. The probability 298

of each amino acid at each of the 13 sites under purifying selection was plotted (Figure 4B). At 299

11 of the 13 sites there was >90% conservation of the amino acid with only Y135 and S169 300

showing significant variability. There was virtually 100% conservation of 7 of 13 sites (V74, 301

A84, D123, G140, L164, H171, and D175) of which, A84, G140, and H171 have no previous 302

association with Nef function. By comparison, the LANL Nef sequences were also examined for 303

conservation at other sites previously known to be associated with MHC-I downregulation: R17, 304

R19, M20, E(62-65), P72, P75, and P78 (Figure 4C). There was less conservation of these sites 305

relative to the 13 selected sites, with only the 3 prolines demonstrating near 100% conservation, 306

and R17, R19 and E62 showing >90% conservation (60 vs. 85% showing >90% conservation 307

and 30 vs. 54% with near 100% conservation). There was significant variability at E(63-65) and 308

significant numbers of M20I and M20L isolates of unknown functional significance. These 309

results highlight the amino acid residues of primary Nef isolates that are associated with a 310

survival advantage, confirm previously-identified motifs and suggest novel residues that are 311

important for Nef structure/function in the context of CTL pressure. 312

Functional testing of Nef polymorphisms at CTL selected sites. 313

In order to determine whether any of the newly identified sites under purifying selection 314

affected Nef’s ability to downregulate MHC-I a panel of mutants was created. Site-directed 315

mutagenesis of NL4-3 Nef was used to incorporate the following polymorphisms, all observed in 316

one or more of the primary plasma sequences and removed by CTL purifying selection (except 317

H171A): N52A, N52S, A84D, Y135F, G140R, S169I, H171A, and V180E. Cells infected with 318

recombinant reporter viruses with these Nef polymorphisms were assessed for levels of MHC-I 319


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


downregulation compared to control viruses (Figure 5). Six of 8 mutants had significant 320

reductions in MHC-I downregulation compared to “wild type” NL4-3 Nef (Figure 5A). Nef 321

with G140R had complete loss of function, and Nef with A84D had a phenotype comparable to 322

Nef with M20A, a mutant known to be deficient in MHC-I downregulation (3) (Figure 5A and 323

B). Nef with Y135F had an intermediate phenotype, about 50% the function of NL4-3 Nef, 324

while Nef with N52A, S169I, or V180E had significant although more modest reductions to 325

approximately 80% the level of NL4-3 Nef. Polymorphisms N52S and H171A had no affect on 326

Nef function. These data show that the Nef polymorphisms removed from the quasispecies by 327

CTL purifying selection are associated with deficiencies in MHC-I downregulation. 328

Gag-specific CTLs select for MHC-I downregulatory function within primary Nef 329

quasispecies. 330

Because Nef-mediated downregulation of MHC-I is known to reduce the susceptibility of 331

HIV-1-infected cells to CTLs, the primary nef quasispecies were tested for this function both 332

before and after selection with the Gag-specific CTLs (Figure 6). Cells infected with 333

recombinant reporter viruses carrying the nef quasispecies were assessed for MHC-I 334

downregulation in comparison to viruses containing NL4-3 Nef (“wild type”) and M20A Nef 335

(Figure 6A). Infection with virus carrying NL4-3 Nef downregulated A*02 by about 80%, and 336

this level of function was unchanged after after passaging this virus in the presence of CTLs. 337

Similarly, virus with nef quasispecies from Subject 00021 was functional at baseline and after 338

selection. However, Subjects 00030 and 00034 had Nef quasispecies with partial function at 339

baseline, which increased to full function after selection. Most strikingly, Nef from Subjects 340

00022 and 00037 (both with late stage untreated AIDS and minimal CTL responses in vivo) had 341

no ability to downregulate MHC-I at baseline, but CTL pressure selected functional populations 342


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


of Nef (Figure 5B). Except for subject 00021, the baseline plasma quasispecies of all subjects 343

had amino acid polymorphisms at the sites identified in this analysis that would predict impaired 344

function, and viruses with these polymorphisms were not present after selection (Table II). 345

Quasispecies sequences were also examined for mutations at other sites previously known to be 346

important for Nef MHC-I downregulation since these would also likely impair baseline function 347

(Table II). Although we were not able to test selected viruses from all subjects, we previously 348

reported partial impairment of Nef-mediated MHC-I downregulation by the baseline plasma Nef 349

quasispecies of all subjects included in this study, with the exception of subject 21 (40). Thus 350

the presence of these mutations was associated with impaired function of the quasispecies, while 351

reconstitution of function was associated with loss of these polymorphisms from the 352

quasispecies. These data indicate that the sites identified by CTL selection play an important 353

role in Nef-mediated MHC-I downregulation and consequent immune evasion and provide a 354

functional context for the sequence evolution of nef under CTL selection in vivo. 355

356


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


DISCUSSION 357

Human and animal model data suggest that Nef-mediated MHC-I downregulation plays a 358

key role in pathogenesis through promoting viral persistence in the presence of a vigorous CTL 359

response. We previously reported an in vivo correlation between the breadth of the HIV-1-360

specific CTL response and the capacity of circulating Nef quasispecies to downregulate MHC-I 361

(40). Furthermore, it has been demonstrated with a laboratory strain of HIV-1 that CTLs exert 362

selective pressure to maintain functional Nef (3, 5). The preservation of Nef-mediated MHC-I 363

downregulation in the presence of CTL and its loss in the absence of strong CTL selection is also 364

consistent with the observation of predominately defective Nef in neonates (25, 65) and persons 365

with late stage AIDS and strong pressure to maintain Nef-mediated MHC-I downregulation in 366

SIV-infected macaques (11, 33, 62). Here we demonstrate a selective advantage for primary in 367

vivo Nef quasispecies that can downregulate MHC-I that correlates with the presence of both 368

known and novel amino acid residues important for this function. 369

Examination of nef quasispecies sequence evolution across subjects due to immune 370

selection by Gag-specific CTLs pinpointed 13 sites where key amino acid residues are involved 371

in the optimization of Nef-mediated immune. Examination of more than 2000 Nef sequences in 372

the LANL HIV-1 Database revealed >90% conservation of the amino acid sequence at 11 of 373

these 13 selected sites, with near 100% conservation at 7 sites. This analysis also confirmed 374

several sites that were identified previously through point mutagenesis studies of laboratory 375

adapted HIV-1 nef sequences to be involved in multiple Nef functions. These included residues 376

in the motifs important for dimerization (41), MHC-I downregulation (43, 49, 67), trafficking via 377

Adaptor Proteins and β-COP binding (59, 67) , and enhancement of viral replication through cell 378

signaling (20). 379


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


Additionally, 7 amino acid sites were identified as experiencing strong purifying 380

selection by CTL pressure and previously had no known role in Nef function. Mutations at 6 of 381

these sites, reflecting polymorphisms in vivo, resulted in significant impairment of Nef-mediated 382

MHC-I downregulation. Two sites in particular, A84 and G140, were both virtually 100% 383

conserved across all genotypes and resulted in complete or near complete loss of MHC-I 384

downregulation when mutated. Although H171 was similarly 100% conserved, mutation at this 385

site to an alanine had no affect on this Nef function. However, H171A was not among the 386

observed polymorphisms at this site in vivo (i.e.- H171 N, P, and G), and perhaps testing these 387

may yield a different result. The MHC-I downregulation function by Nef with N52A, S169I, and 388

V180E was only modestly affected suggesting either that these mutations may work 389

cooperatively with other mutations to have a more crippling effect, or that they represent trade-390

offs to optimize other Nef functions. A recent analysis has shown that site S169 co-evolves with 391

N157 (51), perhaps hinting that these sites may contribute to Nef function cooperatively. The 392

exact mechanism whereby these mutations affect Nef function, how they interact with other 393

sites, and whether they affect other Nef functions such as CD4 downregulation are not known 394

but are currently being investigated. 395

It is also important to note that the 3’ portion of nef overlaps with the U3 region of the 396

3’LTR, and consequently this region is potentially subject to additional LTR-related constraints 397

(36). However, the critical domains including binding sites for NF- κB and Sp1, and the 398

TATAA box are all downstream of the region of nef overlap. Five selected sites with no 399

previously identified Nef function (Y135, G140, S169, H171, V180) lie within this overlapping 400

LTR region. Although it is possible that these sites may be under strong purifying selection due 401

to an LTR-associated function, the sites we identified were specific for CTL selection (i.e. not 402


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


identified in both selected and control sequences), and Nef polymorphisms at 4 of these sites had 403

significant impairment of MHC-I downregulation making selection due to an LTR function alone 404

unlikely. 405

The important functional role played by these selected sites is clearly demonstrated by 406

the reconstitution of MHC-I downregulation after CTL-mediated purifying selection by removed 407

these mutants from the quasispecies population. Except for subject 00021 Nef, which functioned 408

at “wild-type” levels at baseline, plasma quasispecies of all subjects contained amino acid 409

polymorphisms at the sites of purifying selection that would predict impaired function that 410

subsequently were not present after selection. The most dramatic examples of functional 411

reconstitution were the plasma Nefs of Subjects 00022 and 00037, who had late stage AIDS and 412

minimal or undetectable HIV-1-specific CTL responses ((40) and data not shown), consistent 413

with prior reports of loss of MHC-I downregulation in vivo in the absence of any CTL selective 414

pressure in persons with AIDS (11, 33). Experimental selection by Gag-specific CTLs enriched 415

for nef alleles with the capacity to downregulate MHC-I, suggesting a strong selective advantage 416

for reconstituting this function of Nef in the presence of an active CTL response. The distinct 417

phylogenetic clustering of CTL-selected nef genes from Subject 00022 indicated overgrowth 418

from a small subset of clones from within the baseline quasispecies population, and the 419

convergence of these sequences (as well as those of Subject 00034) towards the clade B 420

consensus sequence indicated evolution towards the most generally optimal sequence. 421

While MHC-I downregulation is likely to be the main mechanism by which Nef 422

promotes HIV-1 survival under selection by CTLs, it is important to note that Nef is a poly-423

functional protein with numerous effects on infected cells, including CD4 downregulation and 424

cellular activation. Our data do not exclude other functions that may be important for viral 425


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


persistence in the face of CTL pressure. Some functions are likely to be separable due to distinct 426

locations of important functional residues, while others may be inter-related (43). Several of the 427

functionally important areas identified here and in other studies, such as the acidic domain, PxφP 428

motif, and dileucine motif, lie in unstructured flexible loops of the protein (23, 38). This may 429

allow Nef to have functional flexibility to evolve and optimize different functions or 430

combinations of functions in response to different environmental constraints. It is unexpected to 431

see that L164 of the dileucine motif critical for CD4 downregulation by Nef was identified as a 432

residue under strong purifying selection for viral persistence under CTL pressure. It may be that 433

the function of this motif to bind Adaptor Proteins is important for both MHC-I and CD4 434

downregulation, but more essential for the latter. It is also possible that other functions 435

associated with this amino acid residue such as enhancement of infectivity and replication may 436

have played a role is its selection under CTL pressure. 437

Because Nef is an attractive target for pharmacologic or immunologic inhibition in vivo, 438

examining primary isolate Nef proteins for crucial functional sites that could serve as therapeutic 439

targets is important. Mathematical modeling has predicted that blocking MHC-I downregulation 440

by Nef has the potential to decrease viremia in chronically infected individuals by up to 2.4 logs 441

by reducing Nef-mediated evasion of CTLs (66), and thus inhibition of this function of Nef could 442

be an effective therapeutic approach. Small molecule inhibitors of Nef have been considered for 443

this purpose (53, 55). Alternatively, an appropriately directed vaccine response could achieve 444

this goal by putting immune pressure directly on Nef (3). Of note, two of the six vaccine-445

induced epitopes that predicted efficacy of vaccination in reducing set-point viremia in the 446

HVTN 502 (STEP) trial were the Nef epitopes B*57-restricted HW9 (HTQGYFPDW, Nef 116-447

124) and A*02-restricted LV10 (LTFGWCFKLV, Nef 137-146) (10). These epitopes contain 448


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


the D123 and G140 sites we identified to be under selective pressure. While D123 is known to 449

be important for Nef dimerization and both CD4 and MHC-I downregulation (41), G140 was not 450

previously known to have an important functional role but now we demonstrate that mutation at 451

this site critically impairs MHC-I downregulation. Thus, examining primary isolate sequences 452

may be important for identifying sites in Nef that are most relevant for its role in immune 453

evasion, and for which pharmacologic or immunologic targeting may be most effective due to 454

strict functional constraints. 455

Prior reports have demonstrated that direct CTL targeting of Nef yields positive selective 456

pressure that leads to loss of function (5, 35, 64, 69), complementing our finding of purifying 457

selection and reconstitution of Nef function in the setting of CTLs targeting Gag and not Nef 458

directly. While the evolution of Nef and other HIV-1 proteins in vivo appears to be dominated 459

overall by purifying selection reflecting strong functional constraints (39), there is clear positive 460

selective pressure exerted by direct CTL targeting of Nef. This has been demonstrated 461

experimentally; in vitro selection of laboratory adapted HIV-1 strains with Nef-specific CTL 462

clones resulted in a dramatic pattern of point mutations, deletions, and non-sense mutations due 463

to lack of fitness cost for Nef deletion in vitro (6, 69). Subsequently, these selected laboratory 464

strain viruses deficient in functional Nef were demonstrated to become more susceptible to non-465

Nef-specific CTLs (6, 64). It was further shown that simultaneous addition of Gag-specific 466

CTLs placed a functional constraint on viral escape from Nef-specific CTLs by Nef mutation (5). 467

Our data confirm and extend these findings with more relevant primary isolate Nef alleles, and 468

suggest that these principles may apply for therapeutic interventions in vivo. 469

In summary, these results highlight the close reciprocal relationship between the host 470

CTL immune response and Nef function. Nef quasispecies under CTL selection display a pattern 471


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


of strong purifying selection associated with optimization of MHC-I downregulation. Studying 472

circulating primary isolate Nef alleles revealed novel amino acid residues that are directly 473

important for HIV-1 persistence under immune pressure by the host CTL response. Better 474

defining functional sites within circulating plasma Nef quasispecies will be useful for the design 475

of pharmacologic or immunotherapeutic agents targeting functionally crucial regions of Nef 476

capable of disabling its ability to direct immune evasion. 477

478


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


ACKNOWLEDGMENTS 479

480

This work was supported by NIH AI068449 (MJL), AI083083 (MJL), and AI051970 (OOY). 481

Interleukin-2 was provided by the NIH AIDS Reagent Repository. We wish to thank Ms. Mabel 482

Ching Yee Chan for her technical assistance. 483

484

485


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


REFERENCES 486

1. Adnan, S., A. Balamurugan, A. Trocha, M. S. Bennett, H. L. Ng, A. Ali, C. Brander, 487

and O. O. Yang. 2006. Nef interference with HIV-1-specific CTL antiviral activity is 488

epitope specific. Blood 108:3414-9. 489

2. Ahmad, N., and S. Venkatesan. 1988. Nef protein of HIV-1 is a transcriptional 490

repressor of HIV-1 LTR. Science 241:1481-5. 491

3. Akari, H., S. Arold, T. Fukumori, T. Okazaki, K. Strebel, and A. Adachi. 2000. Nef-492

induced major histocompatibility complex class I down-regulation is functionally 493

dissociated from its virion incorporation, enhancement of viral infectivity, and CD4 494

down-regulation. J Virol 74:2907-12. 495

4. Ali, A., B. D. Jamieson, and O. O. Yang. 2003. Half-genome human immunodeficiency 496

virus type 1 constructs for rapid production of reporter viruses. J Virol Methods 110:137-497

42. 498

5. Ali, A., H. L. Ng, M. D. Dagarag, and O. O. Yang. 2005. Evasion of cytotoxic T 499

lymphocytes is a functional constraint maintaining HIV-1 Nef expression. Eur J Immunol 500

35:3221-8. 501

6. Ali, A., S. Pillai, H. Ng, R. Lubong, D. D. Richman, B. D. Jamieson, Y. Ding, M. J. 502

McElrath, J. C. Guatelli, and O. O. Yang. 2003. Broadly increased sensitivity to 503

cytotoxic T lymphocytes resulting from Nef epitope escape mutations. J Immunol 504

171:3999-4005. 505

7. Arold, S., F. Hoh, S. Domergue, C. Birck, M. A. Delsuc, M. Jullien, and C. Dumas. 506

2000. Characterization and molecular basis of the oligomeric structure of HIV-1 nef 507

protein. Protein Sci 9:1137-48. 508


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


8. Baur, A. S., E. T. Sawai, P. Dazin, W. J. Fantl, C. Cheng-Mayer, and B. M. Peterlin. 509

1994. HIV-1 Nef leads to inhibition or activation of T cells depending on its intracellular 510

localization. Immunity 1:373-84. 511

9. Bodeus, M., A. Marie-Cardine, C. Bougeret, F. Ramos-Morales, and R. Benarous. 512

1995. In vitro binding and phosphorylation of human immunodeficiency virus type 1 Nef 513

protein by serine/threonine protein kinase. J Gen Virol 76:1337-44. 514

10. Brumme, Z. L., M. John, J. M. Carlson, C. J. Brumme, D. Chan, M. A. Brockman, 515

L. C. Swenson, I. Tao, S. Szeto, P. Rosato, J. Sela, C. M. Kadie, N. Frahm, C. 516

Brander, D. W. Haas, S. A. Riddler, R. Haubrich, B. D. Walker, P. R. Harrigan, D. 517

Heckerman, and S. Mallal. 2009. HLA-associated immune escape pathways in HIV-1 518

subtype B Gag, Pol and Nef proteins. PLoS One 4:e6687. 519

11. Carl, S., T. C. Greenough, M. Krumbiegel, M. Greenberg, J. Skowronski, J. L. 520

Sullivan, and F. Kirchhoff. 2001. Modulation of different human immunodeficiency 521

virus type 1 Nef functions during progression to AIDS. J Virol 75:3657-65. 522

12. Cohen, G. B., R. T. Gandhi, D. M. Davis, O. Mandelboim, B. K. Chen, J. L. 523

Strominger, and D. Baltimore. 1999. The selective downregulation of class I major 524

histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells. 525

Immunity 10:661-71. 526

13. Collins, K. L., B. K. Chen, S. A. Kalams, B. D. Walker, and D. Baltimore. 1998. 527

HIV-1 Nef protein protects infected primary cells against killing by cytotoxic T 528

lymphocytes. Nature 391:397-401. 529

14. Couillin, I., B. Culmann-Penciolelli, E. Gomard, J. Choppin, J. P. Levy, J. G. 530

Guillet, and S. Saragosti. 1994. Impaired cytotoxic T lymphocyte recognition due to 531


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


genetic variations in the main immunogenic region of the human immunodeficiency virus 532

1 NEF protein. J Exp Med 180:1129-34. 533

15. Craig, H. M., M. W. Pandori, and J. C. Guatelli. 1998. Interaction of HIV-1 Nef with 534

the cellular dileucine-based sorting pathway is required for CD4 down-regulation and 535

optimal viral infectivity. Proc Natl Acad Sci U S A 95:11229-34. 536

16. Crooks, G. E., G. Hon, J. M. Chandonia, and S. E. Brenner. 2004. WebLogo: a 537

sequence logo generator. Genome Res 14:1188-90. 538

17. Daniel, M. D., F. Kirchhoff, S. C. Czajak, P. K. Sehgal, and R. C. Desrosiers. 1992. 539

Protective effects of a live attenuated SIV vaccine with a deletion in the nef gene. Science 540

258:1938-41. 541

18. Deacon, N. J., A. Tsykin, A. Solomon, K. Smith, M. Ludford-Menting, D. J. Hooker, 542

D. A. McPhee, A. L. Greenway, A. Ellett, C. Chatfield, V. A. Lawson, S. Crowe, A. 543

Maerz, S. Sonza, J. Learmont, J. S. Sullivan, A. Cunningham, D. Dwyer, D. Dowton, 544

and J. Mills. 1995. Genomic structure of an attenuated quasi species of HIV-1 from a 545

blood transfusion donor and recipients. Science 270:988-91. 546

19. Dyer, W. B., A. F. Geczy, S. J. Kent, L. B. McIntyre, S. A. Blasdall, J. C. Learmont, 547

and J. S. Sullivan. 1997. Lymphoproliferative immune function in the Sydney Blood 548

Bank Cohort, infected with natural nef/long terminal repeat mutants, and in other long-549

term survivors of transfusion-acquired HIV-1 infection. Aids 11:1565-74. 550

20. Erdtmann, L., K. Janvier, G. Raposo, H. M. Craig, P. Benaroch, C. Berlioz-Torrent, 551

J. C. Guatelli, R. Benarous, and S. Benichou. 2000. Two independent regions of HIV-1 552

Nef are required for connection with the endocytic pathway through binding to the mu 1 553

chain of AP1 complex. Traffic 1:871-83. 554


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


21. Fackler, O. T., and A. S. Baur. 2002. Live and let die: Nef functions beyond HIV 555

replication. Immunity 16:493-7. 556

22. Felsenstein, J. 1989. PHYLIP-Phylogeny Inference Package (Version 3.2). Cladistics 557

5:164-166. 558

23. Franken, P., S. Arold, A. Padilla, M. Bodeus, F. Hoh, M. P. Strub, M. Boyer, M. 559

Jullien, R. Benarous, and C. Dumas. 1997. HIV-1 Nef protein: purification, 560

crystallizations, and preliminary X-ray diffraction studies. Protein Sci 6:2681-3. 561

24. Garcia, J. V., and A. D. Miller. 1991. Serine phosphorylation-independent 562

downregulation of cell-surface CD4 by nef. Nature 350:508-11. 563

25. Geffin, R., D. Wolf, R. Muller, M. D. Hill, E. Stellwag, M. Freitag, G. Sass, G. B. 564

Scott, and A. S. Baur. 2000. Functional and structural defects in HIV type 1 nef genes 565

derived from pediatric long-term survivors. AIDS Res Hum Retroviruses 16:1855-68. 566

26. Geyer, M., O. T. Fackler, and B. M. Peterlin. 2001. Structure--function relationships in 567

HIV-1 Nef. EMBO Rep 2:580-5. 568

27. Geyer, M., C. E. Munte, J. Schorr, R. Kellner, and H. R. Kalbitzer. 1999. Structure 569

of the anchor-domain of myristoylated and non-myristoylated HIV-1 Nef protein. J Mol 570

Biol 289:123-38. 571

28. Geyer, M., H. Yu, R. Mandic, T. Linnemann, Y. H. Zheng, O. T. Fackler, and B. M. 572

Peterlin. 2002. Subunit H of the V-ATPase binds to the medium chain of adaptor protein 573

complex 2 and connects Nef to the endocytic machinery. J Biol Chem 277:28521-9. 574

29. Gibbs, J. S., D. A. Regier, and R. C. Desrosiers. 1994. Construction and in vitro 575

properties of HIV-1 mutants with deletions in "nonessential" genes. AIDS Res Hum 576

Retroviruses 10:343-50. 577


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


30. Hodge, D. R., K. J. Dunn, G. K. Pei, M. K. Chakrabarty, G. Heidecker, J. A. 578

Lautenberger, and K. P. Samuel. 1998. Binding of c-Raf1 kinase to a conserved acidic 579

sequence within the carboxyl-terminal region of the HIV-1 Nef protein. J Biol Chem 580

273:15727-33. 581

31. Huang, Y., L. Zhang, and D. D. Ho. 1995. Characterization of nef sequences in long-582

term survivors of human immunodeficiency virus type 1 infection. J Virol 69:93-100. 583

32. Kestler, H. W., 3rd, D. J. Ringler, K. Mori, D. L. Panicali, P. K. Sehgal, M. D. 584

Daniel, and R. C. Desrosiers. 1991. Importance of the nef gene for maintenance of high 585

virus loads and for development of AIDS. Cell 65:651-62. 586

33. Kirchhoff, F., P. J. Easterbrook, N. Douglas, M. Troop, T. C. Greenough, J. Weber, 587

S. Carl, J. L. Sullivan, and R. S. Daniels. 1999. Sequence variations in human 588

immunodeficiency virus type 1 Nef are associated with different stages of disease. J Virol 589

73:5497-508. 590

34. Kirchhoff, F., T. C. Greenough, D. B. Brettler, J. L. Sullivan, and R. C. Desrosiers. 591

1995. Brief report: absence of intact nef sequences in a long-term survivor with 592

nonprogressive HIV-1 infection. N Engl J Med 332:228-32. 593

35. Koenig, S., A. J. Conley, Y. A. Brewah, G. M. Jones, S. Leath, L. J. Boots, V. Davey, 594

G. Pantaleo, J. F. Demarest, C. Carter, and et al. 1995. Transfer of HIV-1-specific 595

cytotoxic T lymphocytes to an AIDS patient leads to selection for mutant HIV variants 596

and subsequent disease progression. Nat Med 1:330-6. 597

36. Krebs FC, Hogan TH, Quiterio S, Gartner S, and W. B. 2001. Lentiviral LTR-598

directed Expression, Sequence Variation, and Disease Pathogenesis. Theoretical Biology 599

and Biophysics Group, Los Alamos National Laboratory, Los Alamos, NM. 600


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


37. Lama, J., A. Mangasarian, and D. Trono. 1999. Cell-surface expression of CD4 601

reduces HIV-1 infectivity by blocking Env incorporation in a Nef- and Vpu-inhibitable 602

manner. Curr Biol 9:622-31. 603

38. Lee, C. H., K. Saksela, U. A. Mirza, B. T. Chait, and J. Kuriyan. 1996. Crystal 604

structure of the conserved core of HIV-1 Nef complexed with a Src family SH3 domain. 605

Cell 85:931-42. 606

39. Lemey, P., A. Rambaut, and O. G. Pybus. 2006. HIV evolutionary dynamics within 607

and among hosts. AIDS Rev 8:125-40. 608

40. Lewis, M. J., A. Balamurugan, A. Ohno, S. Kilpatrick, H. L. Ng, and O. O. Yang. 609

2008. Functional adaptation of Nef to the immune milieu of HIV-1 infection in vivo. J 610

Immunol 180:4075-81. 611

41. Liu, L. X., N. Heveker, O. T. Fackler, S. Arold, S. Le Gall, K. Janvier, B. M. 612

Peterlin, C. Dumas, O. Schwartz, S. Benichou, and R. Benarous. 2000. Mutation of a 613

conserved residue (D123) required for oligomerization of human immunodeficiency virus 614

type 1 Nef protein abolishes interaction with human thioesterase and results in 615

impairment of Nef biological functions. J Virol 74:5310-9. 616

42. Lu, X., H. Yu, S. H. Liu, F. M. Brodsky, and B. M. Peterlin. 1998. Interactions 617

between HIV1 Nef and vacuolar ATPase facilitate the internalization of CD4. Immunity 618

8:647-56. 619

43. Mangasarian, A., V. Piguet, J. K. Wang, Y. L. Chen, and D. Trono. 1999. Nef-620

induced CD4 and major histocompatibility complex class I (MHC-I) down-regulation are 621

governed by distinct determinants: N-terminal alpha helix and proline repeat of Nef 622

selectively regulate MHC-I trafficking. J Virol 73:1964-73. 623


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


44. Mariani, R., F. Kirchhoff, T. C. Greenough, J. L. Sullivan, R. C. Desrosiers, and J. 624

Skowronski. 1996. High frequency of defective nef alleles in a long-term survivor with 625

nonprogressive human immunodeficiency virus type 1 infection. J Virol 70:7752-64. 626

45. Niederman, T. M., B. J. Thielan, and L. Ratner. 1989. Human immunodeficiency 627

virus type 1 negative factor is a transcriptional silencer. Proc Natl Acad Sci U S A 628

86:1128-32. 629

46. Noviello, C. M., S. L. Pond, M. J. Lewis, D. D. Richman, S. K. Pillai, O. O. Yang, S. 630

J. Little, D. M. Smith, and J. C. Guatelli. 2007. Maintenance of Nef-mediated 631

modulation of major histocompatibility complex class I and CD4 after sexual 632

transmission of human immunodeficiency virus type 1. J Virol 81:4776-86. 633

47. Piguet, V., and D. Trono. 1999. A structure-function analysis of the nef protein of 634

primate lentiviruses, p. 448-459. In C. L. Kuiken, B. Foley, B. Hahn, P. A. Marx, F. 635

McCutchan, J. W. Mellors, J. Mullins, S. Wolinsky, and B. Korber (ed.), Human 636

Retroviruses and AIDS. Los Alamos National Laboratory, Los Alamos, NM. 637

48. Piguet, V., and D. Trono. 1999. The Nef protein of primate lentiviruses. Rev Med Virol 638

9:111-20. 639

49. Piguet, V., L. Wan, C. Borel, A. Mangasarian, N. Demaurex, G. Thomas, and D. 640

Trono. 2000. HIV-1 Nef protein binds to the cellular protein PACS-1 to downregulate 641

class I major histocompatibility complexes. Nat Cell Biol 2:163-7. 642

50. Pond, S. L., S. D. Frost, and S. V. Muse. 2005. HyPhy: hypothesis testing using 643

phylogenies. Bioinformatics 21:676-9. 644

51. Poon, A. F., L. C. Swenson, W. W. Dong, W. Deng, S. L. Kosakovsky Pond, Z. L. 645

Brumme, J. I. Mullins, D. D. Richman, P. R. Harrigan, and S. D. Frost. 2010. 646


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


Phylogenetic analysis of population-based and deep sequencing data to identify 647

coevolving sites in the nef gene of HIV-1. Mol Biol Evol 27:819-32. 648

52. Posada, D., and K. A. Crandall. 1998. MODELTEST: testing the model of DNA 649

substitution. Bioinformatics 14:817-8. 650

53. Richter, S. N., I. Frasson, and G. Palu. 2009. Strategies for inhibiting function of HIV-651

1 accessory proteins: a necessary route to AIDS therapy? Curr Med Chem 16:267-86. 652

54. Riggs, N. L., H. M. Craig, M. W. Pandori, and J. C. Guatelli. 1999. The dileucine-653

based sorting motif in HIV-1 Nef is not required for downregulation of class I MHC. 654

Virology 258:203-7. 655

55. Saksela, K. 2004. Therapeutic targeting of interactions between Nef and host cell 656

proteins. Curr Drug Targets Immune Endocr Metabol Disord 4:315-9. 657

56. Saksela, K., G. Cheng, and D. Baltimore. 1995. Proline-rich (PxxP) motifs in HIV-1 658

Nef bind to SH3 domains of a subset of Src kinases and are required for the enhanced 659

growth of Nef+ viruses but not for down-regulation of CD4. Embo J 14:484-91. 660

57. Salter, R. D., D. N. Howell, and P. Cresswell. 1985. Genes regulating HLA class I 661

antigen expression in T-B lymphoblast hybrids. Immunogenetics 21:235-46. 662

58. Sawai, E. T., A. Baur, H. Struble, B. M. Peterlin, J. A. Levy, and C. Cheng-Mayer. 663

1994. Human immunodeficiency virus type 1 Nef associates with a cellular serine kinase 664

in T lymphocytes. Proc Natl Acad Sci U S A 91:1539-43. 665

59. Schaefer, M. R., E. R. Wonderlich, J. F. Roeth, J. A. Leonard, and K. L. Collins. 666

2008. HIV-1 Nef targets MHC-I and CD4 for degradation via a final common beta-COP-667

dependent pathway in T cells. PLoS Pathog 4:e1000131. 668


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


60. Schwartz, O., V. Marechal, S. Le Gall, F. Lemonnier, and J. M. Heard. 1996. 669

Endocytosis of major histocompatibility complex class I molecules is induced by the 670

HIV-1 Nef protein. Nat Med 2:338-42. 671

61. Smith, B. L., B. W. Krushelnycky, D. Mochly-Rosen, and P. Berg. 1996. The HIV nef 672

protein associates with protein kinase C theta. J Biol Chem 271:16753-7. 673

62. Swigut, T., L. Alexander, J. Morgan, J. Lifson, K. G. Mansfield, S. Lang, R. P. 674

Johnson, J. Skowronski, and R. Desrosiers. 2004. Impact of Nef-mediated 675

downregulation of major histocompatibility complex class I on immune response to 676

simian immunodeficiency virus. J Virol 78:13335-44. 677

63. Tomiyama, H., H. Akari, A. Adachi, and M. Takiguchi. 2002. Different effects of 678

Nef-mediated HLA class I down-regulation on human immunodeficiency virus type 1-679

specific CD8(+) T-cell cytolytic activity and cytokine production. J Virol 76:7535-43. 680

64. Ueno, T., C. Motozono, S. Dohki, P. Mwimanzi, S. Rauch, O. T. Fackler, S. Oka, 681

and M. Takiguchi. 2008. CTL-mediated selective pressure influences dynamic evolution 682

and pathogenic functions of HIV-1 Nef. J Immunol 180:1107-16. 683

65. Walker, P. R., M. Ketunuti, I. A. Choge, T. Meyers, G. Gray, E. C. Holmes, and L. 684

Morris. 2007. Polymorphisms in Nef associated with different clinical outcomes in HIV 685

type 1 subtype C-infected children. AIDS Res Hum Retroviruses 23:204-15. 686

66. Wick, W. D., P. B. Gilbert, and O. O. Yang. 2009. Predicting the impact of blocking 687

human immunodeficiency virus type 1 Nef in vivo. J Virol 83:2349-56. 688

67. Williams, M., J. F. Roeth, M. R. Kasper, T. M. Filzen, and K. L. Collins. 2005. 689

Human immunodeficiency virus type 1 Nef domains required for disruption of major 690


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


histocompatibility complex class I trafficking are also necessary for coprecipitation of 691

Nef with HLA-A2. J Virol 79:632-6. 692

68. Yang, O. O., P. T. Nguyen, S. A. Kalams, T. Dorfman, H. G. Gottlinger, S. Stewart, 693

I. S. Chen, S. Threlkeld, and B. D. Walker. 2002. Nef-mediated resistance of human 694

immunodeficiency virus type 1 to antiviral cytotoxic T lymphocytes. J Virol 76:1626-31. 695

69. Yang, O. O., P. T. Sarkis, A. Ali, J. D. Harlow, C. Brander, S. A. Kalams, and B. D. 696

Walker. 2003. Determinant of HIV-1 mutational escape from cytotoxic T lymphocytes. J 697

Exp Med 197:1365-75. 698

699

700


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


Table I. Nef Residues Under Selection by Gag-Specific CTLs. 701

702

Nef Residue (HXB2 numbering)

dN/dS Known Functional Role

E18 -4.37 “X” in RXR motif, ↓MHC-I, β-COP binding, (59, 67)

N52 -3.24 None reported

E62 -3.87 ↓MHC-I, PACS-1 binding (49, 67)

V74 -5.00 “φ” in PxφP motif, ↓MHC-I, cell signaling, (43, 56)

A83 3.68 ↓MHC-I, cell signaling (43)

A84 -3.00 None reported

D123 -4.45 ↓MHC-I, Dimerization, thioesterase binding (41, 67)

Y135 -4.38 None reported

G140 -3.00 None reported

L164 -4.97 Cellular Trafficking, ↓CD4 (15)

S169 -3.24 None reported

H171 -3.24 None reported

D175 -3.24 Cellular trafficking and signaling (28, 30, 42)

V180 -4.00 None reported

703

704


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


Table II. Primary Plasma Nef Mutant Genotypes1 at Selected and Known MHC-I-associated 705

Sites. 706

Subject No. Genotype at Selected Sites Genotype at Known MHC-I-

Associated Sites2 00021 All Consensus All Consensus

00022 E18D, E62K, G140E R19K, E63V/A, P72A

00026 A84D, G140R, H171G All Consensus

00030 E62K, V74A, H171P, D175N R17G, E63D, E65G, P78L

00034 E62G, D123G/N R19K/G, M20I

00035 E18K, E62K, Y135F, L164Y, H171N R19G

00037 N52S, D123N, G140R, D175E E63-65K

00039 E62G, Y135F E63G

00041 S169N/I, V180E All Consensus

1 indicates a change in at least one clone in the quasispecies mix, not necessarily fixed substitutions or consensus 707 sequences. 708 2 sites examined: R17, R19, M20, E62-65, P72, P75, P78 709

710


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


FIGURES AND FIGURE LEGENDS 711

712

Figure 1. Phylogeny of nef quasispecies in the absence and presence of immune selection by 713

Gag-specific CTLs. Plasma nef sequences from nine subjects (“input” sequences, n=94, blue 714

circles), nef sequences passaged in the absence of CTL selection (“control” sequences, n=71, 715

green squares), and nef sequences passaged in under Gag-specific CTL selection (“selected” 716

sequences, n=67, red triangles) were aligned with NL4-3 nef to create a neighbor-joining 717

phylogenetic tree. Independent clusters for each subject were supported by > 99% bootstrap 718

support, with the exception of Subjects 00035 and 00039, whose sequences were previously 719

found to be related (40). Significant clustering of CTL-selected sequences (bootstrap values 720

>70%) are marked with an “*”. 721


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


722

723

Figure 2. CTL selection exerts

evolutionary pressure on the nef

quasispecies.

The nef quasispecies sequences were

examined for changes resulting from

selection by the Gag-specific CTLs,

comparing the input, control, and

selected sequences. A.) The

percentages of sequences with non-

sense mutations (frameshift and/or

early stop mutations) are plotted for

each group across all subjects. B.) For

nef sequences from each subject,

pairwise diversity (calculated for each

group using 500 bootstrap replicates to

give the standard error of the mean) is

plotted for each group. C.) For each

subject, the change in nef diversity due

to CTL selection (comparing the

control to selected groups) is plotted,

and the median across all subjects is

indicated. * indicates a p-value<0.05

for the difference between control and

selected sequences.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


724

725

726

727

Figure 3. Passaging of HIV-1 in the

presence of Gag-specific CTLs results in

purifying selection of nef. The input,

control and selected sequences were

evaluated for evidence of selective

pressure as reflected by dN/dS ratios. A.)

Maximium likelihood estimates of the

global dN/dS ratios with 95% confidence

intervals are plotted for each of the three

groups of sequences. * indicates non-

overlapping CIs. B.) Site-by-site analysis

for CTL selection was performed with

multiple methods, shown here are results

from the SLAC method. The plot shows

the estimated dN/dS ratios for codons

(numbered according to the HXB2

numbering system) that demonstrated

significant selection (p <0.05) by both

SLAC and FEL methods.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


728

729

Figure 4. Structural locations and conservation of amino acids associated with MHC-I 730

downregulation. A.) The 13 codons determined to be under purifying selection are indicated on 731

the predicted three-dimensional structure of the Nef protein (composite crystal structure kindly 732

provided by Art F.Y. Poon). The probablility of each amino acid, based on an alignment of all 733

complete, non-recombinant Nef sequences including genotypes A-K submitted to the LANL 734

HIV-1 Sequence database through 2010 (N>2100 sequences), was calculated for B.) the sites 735

under purifying selection shown in Table I, and C.) sites previously identified as important for 736

Nef MHC-I downregulation. 737

738


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


739

Figure 5. Downregulation of MHC-I by Nef Mutants Identified by CTL Immune Selection. 740

Eight mutants at the 7 selected sites with no previously reported role in Nef function were 741

individually introduced into NL4-3 recombinant reporter viruses. Specific amino acid changes 742

were selected based on their presence in primary plasma isolates before selection, except H171A. 743

Their ability to downregulate HLA-A*0201 was measured by flow cytometry and compared to 744

NL4-3 Nef, Delta Nef, and M20A Nef, a mutant specifically deficient in MHC-I downregulation. 745

A.) Summary of the average HLA-A*0201 downregulation of each mutant relative to NL4-3 Nef 746

based on at least 3 separate infections, * indicates a significant difference from NL4-3 with a p-747

value <0.05, ** p<0.001. B.) shows the histogram plots of the levels of HLA-A*0201 on cells 748

infected with either mutant (filled histograms, mutant labeled in the upper right) or NL4-3 Nef 749

(open histograms). 750

751


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


752

753

754

755

756

Figure 6. CTL-selected Nef sequences have

preserved MHC-I downregulatory function.

Levels of A*0201 on the surface of cells

infected with reporter viruses carrying input

versus CTL-selected Nef quasispecies were

measured by flow cytometry. A.)

Histogram plots of A*0201 on cells infected

with wild-type NL4-3 Nef and M20A Nef,

deficient in MHC-I downregulation, (top

panels) and for Subjects 00021 and 00022

before and after immune selection (middle

and bottom panels, respectively). Open

histograms are cells without Nef; the filled

histograms are cells infected with the Nef

allele labeled in the upper right corner. B.)

Summary plots are given for Nef

quasispecies from Subjects 00021, 00022,

00030, 00034, and 00037 for input and

selected viruses, as well as a wild-type NL4-

3 virus control that underwent CTL

selection. The error bars indicate the

standard deviation for three independent

experiments with each input virus group.

Note that only one sample of each selected

virus was available for testing.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

immune selection in vitro reveals human immunodeficiency virus-1

Documents