identification of interaction partners and substrates · cyclin a1 interaction partners - 5 - the...

Cyclin A1 Interaction Partners

- 1 -

IDENTIFICATION OF INTERACTION PARTNERS AND SUBSTRATES

OF THE CYCLIN A1/CDK2 COMPLEX

Sven Diederichs1, Nicole Bäumer1, Ping Ji1, Stephan K. Metzelder1, Gregory E.

Idos1,2, Thomas Cauvet1, Wenbing Wang1, Jörg Gromoll3, Mark G. Schrader4, H.

Phillip Koeffler2, Wolfgang E. Berdel1, Hubert Serve1 and Carsten Müller-Tidow*1

1Department of Medicine, Hematology/Oncology, University of Münster, Münster,

Germany

2Division of Hematology/Oncology, Cedars-Sinai Research Institute/UCLA

School of Medicine, Los Angeles, CA

3Institute of Reproductive Medicine, University of Münster, Münster, Germany

4Department of Urology, University Hospital Benjamin Franklin, Berlin, Germany

Running title: Cyclin A1/CDK2 interaction partners in testis

Keywords:

Cyclin A1, CDK2, Cell Cycle, Testis, Meiosis, Spermatogenesis, Leukemia

*Please address correspondence to: Carsten Müller-Tidow

Department of Medicine, Hematology/Oncology; University of Münster

Domagkstr. 3; D-48129 Münster; Germany

Phone: +49-251-835-6229

Fax: +49-251-835-2673

Email: [email protected]

JBC Papers in Press. Published on May 24, 2004 as Manuscript M401708200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on June 11, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 2 -

SUMMARY

The CDK2-associated cyclin A1 is essential for spermatogenesis and contributes

to leukemogenesis. The detailed molecular functions of cyclin A1 remain unclear

since the molecular networks involving cyclin A1/CDK2 have not been

elucidated.

Here, we identified novel cyclin A1/CDK2 interaction partners in a yeast-triple-

hybrid approach. Several novel proteins (INCA1, KARCA1, PROCA1) as well as

the known proteins GPS2, Ku70, RACK1/GNB2L1 and RBM4 were identified as

interaction partners. These proteins link the cyclin A1/CDK2 complex to diverse

cellular processes such as DNA repair, signaling and splicing. Interactions were

confirmed by GST-pulldown assays and co-immunoprecipitation. We cloned and

characterized the most frequently isolated unknown gene which we named

INCA1 (INhibitor of CDK interacting with Cyclin A1). The nuclear INCA1 protein

is evolutionary conserved and lacks homology to any known gene. This novel

protein and two other interacting partners served as substrates for the cyclin

A1/CDK2 kinase complex.

Cyclin A1 and all interaction partners were highly expressed in testis with

varying degrees of tissue-specificity. Highest expression levels were observed at

different time points during testis maturation whereas expression levels in germ

cell cancers and infertile testes decreased.

Taken together, we identified testicular interaction partners of the cyclin

A1/CDK2 complex and studied their expression pattern in normal organs, testis

development and testicular malignancies. Thereby, we establish a new basis for

future functional analyses of cyclin A1. We provide evidence that the cyclin A1-

CDK2 complex plays a role in several signaling pathways important for cell cycle

control and meiosis.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 3 -

INTRODUCTION

Regulation of the cell cycle is one of the most complex features of eukaryotic

cells. Cyclins are regarded as the major regulators of the cell cycle (1-3). Cyclin-

dependent kinases provide the catalytic subunit of the active cyclin/CDK

complex (4-6). Cyclins are involved in the regulation of the mitotic as well as the

meiotic cell cycle (7,8), though the distinct regulatory mechanisms differ (9,10).

Dysregulation of the cell cycle leads to abnormal cell growth and thus

contributes to tumorigenesis (11-14).

Two A-type cyclins are yet known to be involved in cell cycle regulation: cyclin

A1 and cyclin A2. Cyclin A2, also known as cyclin A, is a key regulator of the cell

cycle in mammalian cells. It is ubiquitously expressed and essential for

progression through the cell cycle. Cyclin A2 is involved in both S phase and

G2/M transition through its association with distinct CDKs (15,16). Several lines

of evidence indicate its oncogenic potential (17-19). Cyclin A2 associates with

CDK2 (20) at the onset of DNA replication in S phase (21) and with CDK1 mainly

at the G2/M transition (15).

The second type of human cyclin A (22), named cyclin A1 (in homology to

findings earlier in mouse and Xenopus) associates with CDK2 in vitro and in

vivo, but not with CDK1 in contrast to the interaction of cyclin A1 with CDK1 in

mice. The CDK2/cyclin A1 complex shows kinase activity on histone H1 (22).

Cyclin A1 expression is tissue-specific and high levels of expression are

restricted to testis in the healthy organism in humans (22), to eggs and early

embryos in Xenopus (23) and to the germline in mice (24). Cyclin A1 is

expressed shortly before or during the first meiotic division in spermatogenesis

(25) and male cyclin A1 knockout mice are infertile (26). Spermatogenesis is

arrested prior to entry into metaphase I associated with inactive cyclin B/CDK1


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 4 -

complexes and therefore loss of MPF activity (27). Cyclin A1 expression is also

diminished in patients suffering from infertility (28). Cyclin A1 expression

increases at the entry into S phase of previously synchronized leukemic cells

(22). In G2/M phase, cyclin A1 expression and the cyclin A1/CDK2 kinase activity

reach their maximum levels, but cyclin A1 is detectable throughout the cell cycle

in contrast to cyclin A2 (29). It interacts with the cell cycle regulators E2F and

pRb and neutralizes the cell cycle inhibition by pRb in SAOS-2 cells (29), which

indicates a tissue-specific role in mitosis. However, the expression throughout

the cell cycle rules out a major regulatory role for cyclin A1 in the mitotic cell

cycle. The promoter of cyclin A1 is dependent on four Sp1-transactivation sites

in a CpG-island upstream of the transcriptional start site (30).

Cyclin A1 is supposed to play a role in the pathogenesis of myeloid leukemia

since it is highly expressed in leukemias of myeloid origin (31). Upon induction of

myeloid differentiation, cyclin A1 expression decreases (31). Overexpression of

murine cyclin A1 in transgenic mice leads to abnormal myelopoiesis in the first

months after birth as well as to the development of myeloid leukemia at a low

frequency. This indicates that cyclin A1 alone is not sufficient to induce

transformation but contributes to leukemogenesis (32).

The molecular functions of cyclin A1 in pathological and physiological settings

have not been investigated in detail. The distinct functions of cyclin A1 in

mitosis, meiosis and malignant diseases remain currently unknown. In addition,

potential roles of cyclin A1 in other cellular processes have not been

characterized. The major drawback of functional analyses of cyclin A1 on the

molecular level results from the lack of knowledge about interaction partners and

substrates of cyclin A1.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 5 -

The aim of this study was the identification of interaction partners of the cyclin

A1/CDK2 complex in the testis. In a yeast-triple-hybrid approach, we identified

several potential interacting proteins of cyclin A1/CDK2 from a testis cDNA

library. We confirmed the interaction with cyclin A1 by GST pulldown assays and

analyzed the expression of the interaction partners in normal organs, in testis

maturation and in testicular malignancies. We have cloned a novel protein,

INCA1 (INhibitor of CDK interacting with Cyclin A1). INCA1 interacted with cyclin

A1, was phosphorylated by the cyclin A1/CDK2 complex and tissue-specifically

expressed in the testis. In summary, we characterized novel interaction partners

of the cyclin A1/CDK2 complex that will guide the future functional analysis of

cyclin A1.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 6 -

EXPERIMENTAL PROCEDURES

Yeast-Triple-Hybrid-System

To identify cyclin A1-interacting proteins, a yeast-triple-hybrid (Y3H) screen was

performed using the MatchmakerGal4 Two-Hybrid-System 3 (Clontech, Palo

Alto, CA). All experiments were carried out according to the recommendations of

the supplier (Clontech: Yeast Protocols Handbook, Matchmaker Two-Hybrid-

System 3).

In brief, a human testis cDNA library was cloned into the pACT2-AD vector

(Clontech). Cyclin A1 served as bait for the library translation products. Cyclin

A1 and CDK2 were both cloned into pBridge. The plasmids were co-transformed

into the yeast strain AH109 (Clontech). The number of screened clones was

calculated to be 1x107 clones. Transformed yeast cells were grown on high

stringency selection plates (-Met, -Leu, -Trp, -His, -Ade, +XGal). The cDNA

inserts in the positive yeast colonies were amplified by nested PCR. Sequences

were analyzed by alignment to the NCBI databases. For control purposes, we

performed a conventional yeast-two-hybrid (Y2H) screen in parallel with cyclin

A1 as bait but without additional co-expression of human CDK2. This approach

helped to exclude the identification of proteins binding to cyclin A1 only and not

to the active cyclin A1 / CDK2 complex. Only sequences identified in more than

one yeast colony in the Y3H and not present in the Y2H control screen are

presented here and were used for further investigations.

GST fusion proteins & GST pulldown assays

The interaction partners (INCA1 & GPS2: full length cds, all others: longest clone

isolated from the Y3H) were cloned in-frame into the pGEX-5X-2 plasmid


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 7 -

(Amersham Pharmacia Biotech, Piscataway, NJ) for expression of GST-fusion

proteins. GST fusion protein was expressed in E. coli BL21-DE3 and purification

was carried out according to the manufacturer's recommendations (GST Gene

Fusion System, Amersham Pharmacia Biotech) using glutathione agarose beads

(Sigma). To control the preparations for equal concentrations and protein

degradation, 10 µl of the slurry were run on an SDS-PAGE gel and stained with

Coomassie Brillant Blue.

For GST-pulldown assays, 1 µg GST protein on glutathione beads was washed

once in 1X binding buffer (50 mM Tris-HCl (pH 7.5), 1.0% NP-40, 400 mM NaCl,

1mM DTT) and resuspended in 100 µl binding buffer in siliconized tubes. 4 µl of

in vitro transcribed and translated cyclin A1, which was radioactively labeled with

[35S]methionine with the TNT QuickCoupled Transcription/Translation System

(Promega, Madison, WI) or lysates of baculovirus-infected Sf9 cells expressing

cyclin A1 were added, and the reaction mix was incubated for one hour at 4°C.

After washing with binding buffer and SDS-PAGE, the gel was dried and

analyzed by autoradiography or western blotting for cyclin A1, respectively.

In vitro kinase reactions

For in vitro kinase assays, GST fusion proteins were incubated with cell lysates

of baculovirus-infected Sf9 cells. 5 µCi [γ-32P]ATP (Perkin Elmer, Boston, MA)

were added to 15 µl of GST fusion beads (50% slurry, equal concentrations

controlled by Coomassie-staining) and 6 µg insect cell lysate, and incubated for

30 minutes in 1X kinase buffer (10 µM ATP, 50 mM Hepes (pH 7.5), 1 mM DTT,

10 mM MgCl2, 0.1 mM Na3VO4, 1 mM NaF). After washing and SDS-PAGE,

phosphorylation of INCA1 was detected by autoradiography. Site-directed

mutagenesis of potential phosphorylation sites to alanine was carried out using


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 8 -

Quickchange strategy (Stratagene, La Jolla, CA) following standard protocols

(Primer: Supplementary Table 1).

Real-time quantitative RT-PCR & Northern blot

For expression analysis in normal organs, a commercially available cDNA library

containing pooled human cDNA from various organs was used (Clontech). For

expression analysis in malignant tissues, total RNA was isolated from fresh

frozen tissue samples using TRIzol (Invitrogen, Carlsbad, CA) according to the

manufacturer's recommendations. Twenty µg of total RNA were used for

Northern blot hybridization (31) and probed with the [32P]-labeled cDNA of

human INCA1.

For RT-PCR, 1 µg of total RNA was reverse transcribed using random primers

and MMLV reverse transcriptase (Promega) following the manufacturer's

protocol. cDNA samples were diluted to 100 µl and 2.5 µl of cDNA were used for

each PCR reaction. PCR-amplification of the housekeeping gene

glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) was used to confirm the

quality of cDNA and standardize the total amount of cDNA between different

samples. The quantitation of mRNA expression levels was carried out using a

real-time fluorescence detection method based on TaqMan technology (PE

Biosystems, Foster City, CA) (33,34). All primer and probe combinations (see

Supplementary Table 1) were designed to span an exon-exon junction to avoid

amplification of genomic DNA. The probes were labeled at the 5' end with the

fluorescent dye FAM (cyclin A1, INCA1) or VIC (GAPDH) and at the 3' end with

the quencher TAMRA. For the other interacting clones, specific primer pairs

were designed and the SYBRGreen detection method was used. At least two

independent analyses were performed for each sample. The expression data


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 9 -

regarding testis maturation was extracted from published primary microarray

data (35).

Statistical analyses were carried out with SPSS 11.0 for Windows. For

correlation analyses, the non-parametric Kendall Tau correlation analysis was

used. To identify significant differences in gene expression, the non-parametric

Mann-Whitney-U-test and Kruskal-Wallis-test were performed. All P values

indicate two-sided comparisons and P<0.05 was considered as significant.

5’-RACE for INCA1

Transcribed fragments of the genomic clone hRPC.1050_D_4 had been isolated

from six colonies. The encoded gene was cloned by 5’ Rapid Amplification of

cDNA Ends (5'-RACE, Invitrogen). In addition, the murine homolog of INCA1 was

identified by homology searches and 5'-RACE. The GenBank Accession

Numbers for INCA1, KARCA1 and PROCA1 are given in Supplementary Table 2.

For the analysis of the nucleotide and the amino acid sequence of INCA1,

several web-based resources were used. Detailed information about the

software and prediction results are listed in Supplementary Table 3.

The discovered cDNA sequence was PCR-amplified from human testis cDNA

and cloned into different vectors. The vector pcDNA3.1(+) (Invitrogen) was used

as an expression vector in mammalian cells in transfection experiments. In

addition, INCA1 was cloned into pcDNA3.1(+) fused to EGFP (Clontech) or

fused to a Myc-tag. Other vectors and constructs used are described in the

corresponding sections. Where applicable, cyclin A1 was expressed in

pcDNA3.1(+)(33).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 10 -

Promoter activity & Luciferase assay

Following PCR amplification of the sequence upstream of the human INCA1

gene, it was cloned into the pGL3 basic vector in promoter position to the firefly

luciferase gene. Luciferase assays for promoter activity were carried out

essentially as described (30,34) using the Dual-Luciferase Reporter Assay

System (Promega, Madison, WI). Briefly, Cos-7 or S2 cells were transfected with

the promoter constructs in pGL3 vectors and pRL-CMV for standardization

purposes. The promoter activity was determined as the ratio of firefly luciferase

luminescence divided by renilla luciferase activity. All experiments were carried

out independently three times and data are indicated as mean with standard

error.

Cell Culture & Transfection

Cos-7 (simian renal cells transformed by SV40) cells were cultured at 37° C and

5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen)

supplemented with 10% fetal calf serum (FCS, Biochrom KG, Berlin, Germany),

100 units/ml penicillin and 100 µg/ml streptoMycin (Biochrom), and 2 mM L-

glutamine (Biochrom). ML-1 myeloid leukemia cells were cultured in RPMI with

10% FCS, penicillin and streptomycin at 37°C and 5% CO2. Sf9 insect cells were

cultured at 27° C in Schneider’s insect cell medium (Invitrogen) containing 10%

FCS (Biochrom).

Mammalian cells were transfected using SuperFect (QIAgen, Hilden,

Germany) according to the manufacturer’s protocol. Sf9 Drosophila cells were

infected by baculovirus constructs (Baculovirus Expression Vector System,

PharMingen, San Diego, CA). The cells were lysed on ice in 50 mM Tris-HCl (pH

7.5), 0.5% NP-40, 150 mM NaCl, 1 mM EDTA, and protease inhibitors.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 11 -

For localization analysis of INCA1, EGFP-INCA1 or EGFP alone were

transfected into Cos-7 cells, stained with 1 µg/ml DAPI for DNA and 2.5 µg/ml

TRITC-Phalloidin (both: Sigma) for actin and analyzed by conventional

fluorescence or confocal microscopy.

Antibodies, Co-immunoprecipitation & Western blotting

RIPA lysates (150 mM NaCl, 1.0% NP-40, 0.5% deoxycholic acid, 0.1% SDS,

50 mM Tris-HCl (pH8.0)) with Complete EDTA-free protease inhibitor) or

indicated protein solutions were run on SDS-PAGE gradient gels (Bio-Rad,

Hercules, CA). Subsequently, proteins were electroblotted onto PVDF

membranes Immobilon-P (Millipore, Bedford, MA), stained with specific primary

antibodies and peroxidase-linked secondary antibodies (AffiniPure F(ab’)2

fragment, Jackson ImmunoResearch Laboratories, West Grove, PA) and

detected with ECL plus (Amersham).

Primary antibodies against human INCA1 were raised in rabbits against peptides

aa 26-40 (α-INCA1 #1) and aa 156-170 (α-INCA1 #2) and affinity-purified for the

different peptides. Additional primary antibodies used for immunoprecipitation or

western blot detection were mouse-α-cyclin A1 (B88-2, PharMingen), mouse-α-

c-Myc (9E10, Santa Cruz Biotechnology, Santa Cruz, CA), α-Actin (Sigma),

monoclonal α-EGFP (Clontech).

For co-immunoprecipitation, 500 µl lysate of transfected cells were rotated with 2

µg α-Myc antibody at 4°C for one hour, then 60 µl protein A/G agarose beads

(Santa Cruz Biotechnology) were added, and the reaction mix was rotated at 4°C

again for two hours. After washing with ice-cold RIPA, the bound proteins were

subjected to SDS-PAGE and blotted for EGFP-cyclin A1.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 12 -

For co-immunoprecipitation experiments with endogenous proteins, ML-1 cells,

which highly express cyclin A1 (22), were starved for 24 hours at 0.1% FCS to

induce expression of INCA1 and lysed in NP-40 lysis buffer. A total of 300 µg

protein were precleared with rabbit pre-immune serum and then incubated at

4°C over night with either pre-immune serum or anti-INCA1 serum. Agarose

beads coupled to protein A/G (Santa Cruz) were used for precipitation. Beads

were washed and subjected to SDS-PAGE under non-reducing conditions. The

western blot was then detected with anti-Cyclin A1 antibodies (PharMinGen). A

non-specific band at about 90 kDa was used to demonstrate equal loading of

both samples.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 13 -

RESULTS

Identification of cyclin A1/CDK2 interaction partners

The molecular function of cyclin A1 remains to be elucidated due to a lack of

information about interactions on the molecular level. To identify cyclin A1

interaction partners, we screened a human testis cDNA library for interacting

proteins. A yeast-triple-hybrid-system (Y3H) with CDK2 co-expression was

performed (Fig. 1A). The Y3H should mimic best the physiological conditions of

the active kinase complex of cyclin A1 and CDK2. To minimize the probability of

false positive clones, we only report sequences here that were found at least in

two independent clones. We identified eight sequences for putative cyclin A1

interaction partners in more than one yeast clone: four known genes, two

expressed sequence tags (ESTs) and two unknown cDNAs (Fig. 1B).

Four known genes interacted with the cyclin A1/CDK2 complex

The G-protein Pathway Suppressor 2 (GPS2, Acc# U28963, identical to AMF1)

was identified in four clones. GPS2 has been assigned to different functions in

G-protein, Ras, MAPK and p53 signaling and is part of the nuclear NCOR1-

HDAC3 complex that inhibits JNK activation. We found the nuclear protein Ku70

(Acc# NM_001469) in two clones that binds double-stranded and plays an

essential role in DNA repair. The Guanine Nucleotide Binding protein Beta-2-

Like-1 (GNB2L1, Acc# NM_006098), which is identical to the Receptor for

Activated Protein Kinase C 1 (RACK1), is a homolog of the beta-subunit of

heterotrimeric G proteins. The mRNA-Binding Motif Protein 4 (RBM4, Acc#

NM_002896) is the human homolog to the Drosophila Lark gene that is essential

for embryonic development. Human RBM4 modulates alternative pre-mRNA


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 14 -

splicing and antagonizes SR protein function. In two clones, sequences of the

mRNA DKFZ p686G052 (Acc# AL832200, abbreviated here with "DKFZ") were

enclosed. In a database, this sequence was found in 157 ESTs (UniGene

Hs.317304) from several tissues including acute myeloid leukemia. In 69 ESTs

from normal organs, 13 sequences derived from testis. The mRNA encodes a

hypothetical protein of 1686 amino acids (aa) of unknown function.

Identification of three novel proteins interacting with cyclin A1

In six clones, we found fragments of a novel mRNA that was not part of any

human cDNA or EST sequence but was present in a genomic clone (Acc#

AC004771). As this transcript was detected most often in our Y3H assay, we

cloned and characterized it in more detail (see below: Fig. 7 - 9). The sequence

was unknown before and did not contain any homologies or conserved motifs.

Additional functional analyses revealed an inhibitory effect on CDK activity

(Diederichs et al., unpublished). Therefore, we named it "INhibitor of CDK

interacting with Cyclin A1" (INCA1).

In addition, we identified sequences from another mRNA (MGC 33338, Acc#

BC022077) in two Y3H clones. The published mRNA sequence of 1328

nucleotides (nt) contains a small open reading frame (ORF) encoding only 111

aa. In our sequences, we found an insertion of 19 nt in the middle of the

sequence giving rise to a novel ORF coding for 288 aa using a different reading

frame than the hypothetical protein of 111 aa. The larger protein (31 kDa) was in

the same reading frame as the GAL4 activation domain in the pACT2 vector

used for the Y3H assay confirming this new reading frame. The novel full-length

mRNA contains 1347 nt with a coding sequence of 867 nt. The predicted protein

contains amino acid sequences with homologies to two kelch motifs, two ankyrin


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 15 -

repeats and a galactose oxidase domain (InterProScan), therefore we named it

"Kelch / Ankyrin Repeat containing Cyclin A1 interacting protein" (KARCA1).

In two other clones, we found a novel mRNA sequence which was only partially

similar to an EST (EST zt86e02, Acc# AA398001). This novel sequence does

not contain a stop codon, but comprises an ORF over its full-length of 399 nt

encoding a protein 133 aa. The gene is located on chromosome 17 and

transcribed from the genomic sequence (Acc# AC010761) in three exons all

adhering to the GT/AG rule for intron start and end sequences. This novel

protein was predicted to be localized in the nucleus and contained a proline-rich

region from residues aa 4 to aa 60 that could be involved in protein-protein

interaction. We assume that we identified a partial coding sequence of a novel

protein that we called "PROline-rich Cyclin A1 interacting protein" (PROCA1).

A novel gene: "INhibitor of CDK interacting with Cyclin A1" (INCA1)

encoded a 221 aa protein and localized to chromosome 17

We identified different fragments of one cDNA in six yeast clones. The

sequences corresponded to a genomic clone (clone hRPC.1050_D_4, GenBank

Acc# AC004771.1). This gene was not described before and did not exhibit any

homologies to other known genes (see below). Due to further functional

experiments (Diederichs et al., unpublished), we named it "INhibitor of CDK

interacting with Cyclin A1" (INCA1). We performed 5'-RACE (Rapid Amplification

of cDNA Ends) with the unknown cDNA sequence of INCA1 and isolated a

mRNA sequence of 1383 nucleotides (nt) including an open reading frame

(ORF) of 221 amino acids (aa) (Fig. 2A). Human INCA1 consisted of eight exons

with the coding sequence located from exons three to eight. The second exon

was alternatively spliced leading to an mRNA of only 1221 nt which did not alter


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 16 -

the ORF. We also identified the murine homolog of INCA1. Murine INCA1

(mINCA1) included seven exons with 1218 nt. The coding sequence was located

from exons two to seven and encoded a protein sequence of 231 aa. The first

murine exon could be alternatively spliced giving rise to four splice variants of

1080 nt, 1150 nt, 1189 nt and 1218 nt, which all encode the same protein.

Human INCA1 localized to chromosome 17p13, the murine homolog mapped to

chromosome 11B. The primary nucleotide and amino acid sequences of human

and murine INCA1 were analyzed with several web-based bioinformatic tools

(Supplementary Table 3). For the human INCA1 protein, a molecular weight of

the unmodified protein of 25.2 kDa was predicted, for the murine homolog

26.5 kDa. The human and the murine INCA1 coding sequences showed 70.8%

homology on the nucleotide and 57.4% identity on the amino acid level. The

localization of both proteins was predicted to be nuclear. Both sequences

contained multiple consensus sites for phosphorylation and other

posttranslational modifications. Upstream of the human INCA1 gene, we found a

functional promoter sequence for INCA1 (compare Fig. 7).

The nucleotide and amino acid sequences of the three novel proteins INCA1,

KARCA1 and PROCA1 are presented in Fig. 2 and have been deposited into

GenBank (Accession Numbers in Supplementary Table 2).

Interaction with cyclin A1 and phosphorylation by the cyclin A1/CDK2

complex

The eight putative interacting proteins and their fragments isolated in the Y3H

are given in figure 3A. All of these proteins contained several SP or TP motifs,

which provides the minimal consensus motif for CDK phosphorylation, and four


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 17 -

of them contained the full consensus motif for CDK phosphorylation

(S/T)PX(K/R) (Fig. 3A).

The interaction with cyclin A1 was confirmed for all eight proteins in vitro by GST

pulldown assays. Recombinant radioactively-labeled cyclin A1 was incubated

with GST fusion proteins of the interaction partners. Cyclin A1 was not pulled

down with GST alone, but with all other GST fusion proteins (Fig. 3B).

The analysis of the interaction with cyclin A1 was hindered by the lack of

available antibodies for the interacting proteins. We cloned mammalian

expression vectors for three interaction partners (INCA1, GPS2, Ku70) and

confirmed also the interaction in vivo for these. In co-immunoprecipitation

assays, antibodies against Myc-tagged interaction partners INCA1, GPS2 and

Ku70 also precipitated cyclin A1, whereas unspecific IgG or Myc alone did not

(GPS2: Fig. 3C). The interaction with INCA1 was studied in more detail and is

presented in Fig. 10. The interaction with Ku70 was further analyzed and will be

published elsewhere (Müller-Tidow et al., manuscript submitted).

To examine whether the cyclin A1/CDK2 complex could phosphorylate its

interaction partners, we carried out in vitro kinase assays with the GST fusion

proteins. The fusion protein or GST alone bound to glutathione agarose beads

were incubated in the presence of [γ-32P]ATP with lysates of baculovirus-infected

Sf9 insect cells expressing either cyclin A1 and CDK2 together (Fig. 3D) or

cyclin A1 or CDK2 alone (Fig. 3E). GST alone was not phosphorylated by cyclin

A1/CDK2. Cyclin A1/CDK2 phosphorylated INCA1, Ku70 and RBM4 (Fig. 3D).

This phosphorylation was specific for the cyclin A1/CDK2 complex as it was not

seen for cyclin A1 or CDK2 alone (Fig. 3E). For RACK1/GNB2L1, a faint band

was observed in some experiments, but was not considered significant.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 18 -

Cyclin A1 interaction partners are expressed in the testis

So far, the main identified cellular function of cyclin A1 is its involvement in

meiosis (26). In normal organs, cyclin A1 is tissue-specifically expressed in the

testis ((22) & Fig. 4A).

The expression patterns of cyclin A1 and its interaction partners were analyzed

in a panel of sixteen normal organs by real-time quantitative RT-PCR (Fig. 4B).

The amount of cDNA in each sample was standardized using the expression

level of the housekeeping gene GAPDH. Gene expression was normalized to the

expression in testis (testis expression = 1) for each gene.

All genes showed high expression levels in the testis. Some genes (Cyclin A1:

4A, INCA1: 4B, PROCA1: 4I) were almost exclusively expressed in the testis

with low levels of expression in other organs, e.g. in the ovary. Other genes

(GPS2: 4C, Ku70: 4D, RBM4: 4F, DKFZ: 4G, KARCA1: 4H) were highly

expressed in the testis and also showed high expression levels in some other

organs. Only one gene (RACK1/GNB2L1: 4E) was expressed at an intermediate

level in the testis and higher in eight other organs. The predominant expression

in the testis is obvious in a logarithmic bar graph standardized to the testicular

expression levels (Fig. 4J) in which all genes including cyclin A1 demonstrate

lower expression (below x-axis) in other organs than in testis except

RACK1/GNB2L1.

Cyclin A1 and its interaction partners are regulated during testis

maturation and spermatogenesis

Recently, a microarray study analyzing gene regulation throughout post-natal

testis development has been published (35) and the expression data are

available through the world wide web. Murine homologs of cyclin A1 and seven


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 19 -

of the eight interacting proteins were included in the oligonucleotide microarray.

Our novel mRNA PROCA1 was not found on the array. We extracted primary

microarray data for the other genes of interest. The expression data were

normalized to the maximal expression of each gene to facilitate the direct

comparison of expression regulation throughout testis development for different

genes (Fig. 5A).

Cyclin A1 was strongly induced in the maturing testis with highest expression

from day 26 to the adult stage. Though not all other genes reached their maximal

expression level at this stage, they all were substantially expressed in adult

testis corroborating their potential functional interaction in the testis.

RACK1/GNB2L1, RBM4 and Ku70 decreased, whereas DKFZ, INCA1, GPS2

and KARCA1 expression levels increased during testis maturation. GPS2 and

KARCA1 showed an expression pattern identical to the cyclin A1 expression

pattern.

In the microarray studies, we detected earlier expression of INCA1 in the testis

than expression of cyclin A1. This finding was confirmed by expression studies

in ATM-/- mice which have a meiotic block at prophase I (36). These mice still

express INCA1 in the testis but do not express cyclin A1 anymore (Bäumer N &

Müller-Tidow C, unpublished).

Decreased expression of cyclin A1 interacting proteins in testis tumors and

infertile tissue

In testis samples from patients suffering from infertility, cyclin A1 expression was

lost in germ cell aplasia and its expression increased with progression of

spermatogenesis (28). We studied the expression levels of cyclin A1 and its

interaction partners in normal testis (n=6) and in biopsies from infertile patients


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 20 -

(n=35) with histologically different stages of maturation arrest. Compared to

normal testis, the average expression of all analyzed genes was two- to fourfold

decreased in the infertility testis samples (Fig. 5B). The differences between

normal and infertile testis were significant for cyclin A1, GPS2, Ku70,

RACK1/GNB2L1, RBM4 and KARCA1. Expression levels of all genes except

RACK1/GNB2L1 significantly correlated with the expression of cyclin A1.

Cyclin A1 was expressed in aggressive germ cell tumors, e.g. immature

teratoma or embryonal cell carcinoma, whereas its expression was lost in more

differentiated tumor types as mature teratoma (37). We analyzed the expression

of cyclin A1 and its interaction partners in normal testis (n=7) and in testis

tumors (n=29). Cyclin A1 expression was decreased in malignant testis tissue

compared to normal testis. Concurrently, expression of INCA1, GPS2, Ku70,

RBM4, DKFZ, KARCA1 and PROCA1 was significantly reduced (Fig. 6A). Only

RACK1 was higher expressed in testis tumors than in normal testis. In

correlation analysis including all patient samples, the expression levels of cyclin

A1 correlated significantly (P<0.05) with the expression levels of GPS2, Ku70,

RBM4, DKFZ and PROCA1. We differentiated the testis tumor samples into

histological subgroups (Fig. 6B-J; embryonal carcinoma (EC, n=6), immature

teratoma (iT, n=4), yolc-sac tumor (YS, n=3), seminoma (S, n=7), mature

teratoma (mT, n=6)). Three tumor samples were excluded from this analysis due

to an unclear histological classification. In Kruskal-Wallis analysis, the

expression levels of cyclin A1, INCA1, GPS2, Ku70, RBM4 and KARCA1 differed

significantly between the histological subtypes.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 21 -

INCA1 interacted with cyclin A1 in vitro and in vivo

Following the identification of INCA1 as a novel protein, we confirmed the

interaction between cyclin A1 and INCA1. To analyze the interaction in vitro,

GST pulldown assays with cell lysates or in vitro synthesized cyclin A1 were

performed. INCA1 was cloned as a GST-fusion protein, expressed in E. coli and

purified using glutathione agarose beads. Cyclin A1 was either pulled down from

lysates of baculovirus-infected Sf9 cells or transcribed and translated in vitro and

labeled with [35S]methionine. In GST pulldown assays, cyclin A1 interacted with

GST-INCA1, but not with GST alone, indicating a specific interaction between

cyclin A1 and INCA1 in vitro (Fig. 7A).

For analysis in vivo, Cos-7 cells were transfected with expression plasmids for

EGFP-cyclin A1 and Myc-INCA1. INCA1 was immunoprecipitated from whole cell

lysates with α-Myc antibodies. The subsequent western blot for EGFP-cyclin A1

demonstrated the specific interaction of INCA1 and cyclin A1 in vivo by their co-

immunoprecipitation. Cyclin A1 was not precipitated from the cell lysate by non-

specific antibodies (Fig. 7B). In addition, we confirmed interaction of endogenous

cyclin A1 and INCA1 in vivo. ML-1 myeloid leukemia cells express high levels of

cyclin A1 (22). Starvation of these cells led to induction of INCA1 (data not

shown). In protein lysates of these cells, we found in vivo interaction of

endogenous cyclin A1 and endogenous INCA1 by co-immunoprecipitation.

Cyclin A1 was not pulled down by pre-immune serum but specifically with

immune sera against INCA1 (Fig. 7B).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 22 -

Cyclin A1 and cyclin A2 in complex with CDK2 phosphorylated INCA1 in

vitro predominantly at Ser176

INCA1 interacted in vitro and in vivo with cyclin A1 and was found in the yeast-

triple-hybrid screen for interacting partners of cyclin A1 in complex with CDK2.

These findings and consensus sequences for potential phosphorylation by

cyclin-dependent kinases in the INCA1 sequence led us to the hypothesis, that

INCA1 was phosphorylated by the cyclin A1/CDK2 complex (Fig. 3D+E). To

examine whether the cyclin A2/CDK2 complex also could phosphorylate INCA1,

we carried out in vitro kinase assays with the fusion protein GST-INCA1. Indeed,

GST-INCA1 was strongly phosphorylated by the cyclin A1/CDK2 or by the cyclin

A2/CDK2 complex, but not by either protein alone (Fig. 7C).

Cloning and analysis of different INCA1 fragments indicated strong

phosphorylation of the C-terminus (aa 149-221) (Fig. 7D). The N-terminus (aa 1-

74) was weakly phosphorylated by cyclin A1/CDK2, whereas the intermediate

fragment was also phosphorylated by CDK2 alone (data not shown).

Human and murine INCA1 contain four potential phosphorylation sites that were

conserved between species: T167PGR matched exactly the consensus site for

CDK phosphorylation, whereas S23P, S176P and S179P only showed a conserved

SP motif necessary for CDK phosphorylation in both species. Site-directed

mutagenesis of the potential phosphorylation sites to non-phosphorylatable

alanine uncovered predominant phosphorylation of S23 in the N-terminus and

S176 and T167 in the C-terminus. For a double-mutant including T167A and S176A,

the strong phosphorylation of the C-terminus was diminished (Fig. 7E).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 23 -

INCA1 mRNA and protein were expressed in vivo

Since INCA1 was the interaction partner identified most often in our Y3H assay,

we studied this novel gene in greater detail. To determine whether the INCA1

gene was transcribed and translated in vivo, we performed Northern blot

analysis with total RNA from different organs of two monkey species (Macaca

fascicularis (M.f.), Callithrix jacchus (C.j.)), Homo sapiens (H.s.) and Mus

musculus (M.m.) (Fig. 8A). High expression of INCA1 mRNA was detected in

monkey and human testis. In murine testis, only a faint signal was seen, most

probably because of the human INCA1 probe used. The two bands for INCA1 in

monkey and human correspond to the two splice variants with 1.4 kb and 1.2 kb,

respectively.

To detect protein expression levels, we raised antibodies against two peptides of

human INCA1 and affinity-purified them using the epitopes aa 26-40 (α-

INCA1#1) or aa 156-170 (α-INCA1#2) (Fig. 8B-C). Transfection of the INCA1

coding sequence into insect and mammalian cell lines led to expression of

INCA1 protein (Fig. 8B). In Sf9 insect cells, the antibodies raised against

hINCA1 detected a band at an apparent molecular weight of approx. 28 kDa

(shown here for α-INCA1#1). This probably represented a posttranslationally

less modified protein and was closer to the predicted weight of 25.2 kDa. In

mammalian Cos-7 cells, the apparent molecular weight was approx. 36 kDa. By

bioinformatic sequence analysis, several putative consensus sites for

posttranslational modifications were detected, e.g. serine glycosylation or

tyrosine sulfation. Various putative phosphorylation sites for different kinases

existed in the INCA1 sequence. These included consensus sites for CDK

phosphorylation (see Fig. 8C & Supplementary Table 3).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 24 -

Western blot analysis of different human cell lines revealed low levels of INCA1

protein expression in HeLa, KCL22 and NB4. In the leukemic cell lines U937 and

ML-1, no INCA1 expression was observed. Both α-INCA1 antibodies detected

the INCA1 band at the same size in human cell lines and in INCA1-transfected

Cos-7 cells. In HeLa cells, a smaller band appeared on the Western blot, which

was not detectable with the second α-INCA1 antibody and therefore was

considered unspecific.

INCA1 localized to the nucleus

The INCA1 sequence was analyzed for intracellular localization signals. INCA1

did not show any transmembrane domains or docking sites for a GPI anchor,

suggesting that it was not membrane-bound. A signal sequence for nuclear

localization (NLS: RRKKRR = aa 75-80) was found within the INCA1 sequence.

To analyze the localization of INCA1 in vivo, we cloned a fusion protein of INCA1

and the enhanced green fluorescent protein (EGFP). EGFP-INCA1 was

expressed in Cos-7 cells and its localization was analyzed by conventional

fluorescence microscopy (Fig. 8D a+b) and confocal laser scanning microscopy

(Fig. 8D c+d). In addition, cells were stained with DAPI for DNA in the nucleus

and TRITC-Phalloidin for Actin in the cytoplasm. EGFP alone, used as negative

control, led to staining throughout the cell with predominance in the cytoplasm

(Fig. 8D a+c). EGFP-INCA1 exclusively localized to the nucleus of the cells (Fig.

8D b+d). Merging of EGFP and DAPI fluorescence demonstrated the differential

localization of EGFP and EGFP-INCA1. Confocal microscopy revealed a non-

homogenous granular staining pattern in the nucleus (Fig. 8D d).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 25 -

The expression of INCA1 is regulated by a Sp1-dependent promoter

To further analyze the genomic structure and transcriptional regulation of

hINCA1, we cloned the genomic sequence upstream of the transcriptional start

site of hINCA1. We found a fragment of 1620 base pairs reaching from -1523 to

+97 actively driving transcription in a luciferase assay (Fig. 9A). In Cos-7 cells,

promoter fragments of 1620 bp or 593 bp increased luciferase activity more than

50-fold compared to the empty pGL3 basic vector. The putative promoter

sequence contained several consensus sequences for binding sites of the

transcription factor Sp1. We therefore tested its promoter activity in S2 insect

cells lacking endogenous Sp1. In S2 cells without Sp1, no promoter activity was

detected, whereas coexpression of Sp1 strongly increased INCA1 promoter

activity (Fig. 9B). Fragmentation of the INCA1 promoter revealed high promoter

activities for fragments containing the sequence -254 / +97, that was

substantially decreased, when further sequences either on the 5` or on the 3`

site were deleted (Fig. 9C). In addition, we tested the INCA1 promoter response

to Trichostatin A (TSA) or 5-aza-Cytidine (Aza) in HeLa cells by analyzing the

INCA1 mRNA expression. The Histone-Deacetylase-Inhibitor TSA strongly

induced the mRNA expression of INCA1, whereas the inhibition of promoter

methylation alone by Aza did not significantly increase the INCA1 expression

level (Fig. 9D). These data indicate that the genomic sequence upstream of the

human INCA1 gene contained a functional promoter that was dependent on Sp1

and repressed by histone deacetylase activity.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 26 -

DISCUSSION

Cyclin A1 is essential for spermatogenesis (26) and possesses oncogenic

properties in the hematopoietic system (32). It is highly expressed in testis (22)

and in myeloid leukemia (31). Despite some progress in recent years (27,29,38),

its molecular and cellular function in either environment has not been

characterized in detail due to a lack of knowledge about interaction partners and

substrates of the cyclin A1/CDK2 heterodimer. A coherent view on its role in

spermatogenesis as well as in leukemogenesis is still missing.

In this study, we used a yeast-triple-hybrid approach to identify interaction

partners of the cyclin A1/CDK2 complex in a testis cDNA library. The interaction

was verified for all isolated proteins in GST pulldown assays. In in vitro kinase

assays with cyclin A1/CDK2, phosphorylation of INCA1, Ku70 and RBM4

indicated their role as substrate of the cyclin A1/CDK2 complex. The other

identified proteins might be phosphorylated only under in vivo conditions or are

interaction partners of the complex that are not phosphorylated.

Analysis of mRNA expression revealed a close correlation of cyclin A1

expression and its interaction partners in normal organs and in samples from

normal, malignant and infertile testis. In general, this pattern of co-expression

increases the likelihood of functionally important interactions between cyclin A1

and its co-regulated new interactors in vivo. The interacting proteins included

five previously described proteins (GPS2, Ku70, RACK1/GNB2L1, RBM4 and the

mRNA DKFZ p686G052) as well as three novel proteins (INCA1, KARCA1,

PROCA1).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 27 -

The interaction of cyclin A1 with known proteins hints to new functions

GPS2 suppresses growth and controls intracellular signaling via inhibition of the

Ras - MAPK - JNK pathway (39,40), modulates p53 transactivation (41),

interacts with viral proteins and is an integral subunit of the N-Cor - HDAC3 -

corepressor complex (42,43). GPS2 is a nuclear protein, a fact which fits well

with the localization of cyclin A1 in testis, and its expression pattern in normal

organs, testis maturation and malignant and infertile testis correlates well with

cyclin A1 expression patterns. Therefore, the interaction of GPS2 and cyclin

A1/CDK2 in testis is likely to be physiologically relevant and will be a prime

candidate for further investigations.

Ku70 is essential for DNA repair of double strand breaks by non-homologous

end joining (NHEJ) (44) and thereby contributes to genomic stability (45). It is

currently believed to function as a switch between NHEJ repair and homologous

recombination (46). It heterodimerizes with Ku86 to form a DNA helicase and

binds to and unwinds double stranded DNA ends (47). Its role in V(D)J

recombination (48) is well established. The expression and function of Ku70 in

testis has been a matter of debate: substantial age-dependent expression of

Ku70 in testis has been documented (49) as well as its absence in earliest

stages of meiosis (prophase I) (50). However, we isolated the Ku70 cDNA in our

Y3H assay from a testis cDNA library indicating expression in testis. In addition,

we found expression of Ku70 in normal testis in our samples by real-time

quantitative RT-PCR (Fig. 4) and Ku70 expression was also detected on the

microarrays of maturing testis (Fig. 5). Besides, cyclin A1 is expressed in other

organs than testis on intermediate levels as we report here (Fig. 4); therefore,

the interaction with Ku70 might also be important in other processes than

spermatogenesis. Other proteins involved in DNA repair are essential for


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 28 -

spermatogenesis, increasing the likelihood of a physiological role of Ku70 in the

testis (51). However, we provide evidence for the first time for an involvement of

a cyclin/CDK complex in Ku70-mediated DNA repair. In fact, we were able to link

cyclin A1 to DNA repair mediated by Ku70 and regulation by p53 after irradiation

(Müller-Tidow et al., manuscript submitted)

The RACK1/GNB2L1 protein is a receptor for activated protein kinase C and a

homolog of the beta subunit of heterotrimeric G proteins (52,53). RACK1 is a

substrate (54) and an inhibitor of the Src tyrosine kinase leading to growth

inhibition (55). RACK1 is detectable in the cytoplasm interacting with the

interferon receptor (56). RACK1 also binds to the p53-homolog p73 and to pRb,

which both localize to the nucleus (57); therefore, at least a fraction of RACK1

must be nuclear. In addition, pRb is also a substrate for the cyclin A1/CDK2

complex (29) suggesting a possible complex including pRb, cyclin A1 and

RACK1. However, as cyclin A1 is localized to the cytoplasm in myelopoiesis

(32), a functional interaction with RACK1 in this compartment is also possible.

The nuclear protein RBM4 is the human homolog to the Drosophila gene Lark

which is essential for embryonic development (58). RBM4 binds to mRNA and is

involved in the regulation of alternative splicing (59). Other RBM proteins are

connected to spermatogenesis (60). RBM4 not only binds to cyclin A1, it is also

in vitro phosphorylated by the cyclin A1/CDK2 complex. Hereby, we provide the

first link of cyclin A1 to splicing, whereas other cyclins have already been linked

to the splicing machinery (61,62), especially cyclin E (63) which associates with

CDK2 similar to cyclin A1.

We also found the hypothetical protein DKFZ p686G052 as a novel cyclin A1

interacting partner. Its sequence was found in several ESTs isolated e.g. from

testis or from AML samples indicating an overlapping expression pattern with


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 29 -

cyclin A1. In our expression analyses, we confirmed considerable expression of

this mRNA in testis and in other organs and we found significant induction during

testis development.

Taken together, expression studies in normal organs revealed substantial

expression of all interacting proteins in the testis. The induction of four of the

seven analyzed identified interaction partners during testis maturation and the

expression of all of them in the adult testis hints at their potential involvement in

meiosis or spermatogenesis which will be subject to further investigations.

Three novel proteins will provide new insights into cyclin A1 biology

In addition, we isolated three novel proteins interacting with the cyclin A1/CDK2

complex. Following the properties of the novel amino acid sequences, we named

these proteins "INCA1", "KARCA1" and "PROCA1". INCA1 and PROCA1 were

predicted to localize to the nucleus and all three new genes were significantly

expressed in the testis. The temporal expression profile of KARCA1 during testis

development was identical to cyclin A1, indicating its potential involvement in

meiosis and emphasizing the functional interaction with the active cyclin

A1/CDK2 complex. For KARCA1, we provide the full-length mRNA sequence,

whereas the PROCA1 sequence probably represents only a partial coding

sequence. KARCA1 contains two kelch motifs and two ankyrin repeats. Kelch

motifs were first identified in Drosophila egg chamber regulatory proteins and

were assigned to diverse functions including galactose oxidation (galactose

oxidase), sialic acid hydrolysis (neuraminidase) or actin cross-linking (scruin).

Ankyrin repeats belong to the most common protein-protein interaction motifs.

The usually tandemly repeated helix-loop-helix structures are also found twice in

KARCA1. This repeat was also found in proteins with a broad range of functions


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 30 -

reaching from transcriptional regulation, cell cycle control, cytoskeleton, ion

transport to signal transduction (e.g. Notch, p53 binding proteins and EGF-like

domains contain Ankyrin repeats). Therefore, the presence of neither the kelch

nor the ankyrin motifs directly hints to a specific function but opens several

opportunities for protein-protein interaction. Future functional studies will

uncover the role of these proteins in physiological and pathological settings.

INCA1 was the interacting sequence isolated most often in our Y3H approach

that we subsequently cloned and characterized. In the genomic sequences

upstream of the INCA1 gene, we identified a functional promoter corroborating

the identification of the full-length transcript and an intact genomic locus of

INCA1. This promoter was dependent on the transcription factor Sp1, which also

regulates the cyclin A1 promoter. In vitro, INCA1 was phosphorylated by cyclin

A1 or cyclin A2 in complex with CDK2, but at least in testis, the tissue-specific

expression pattern of cyclin A1 and INCA1 might indicate that cyclin A1 is

physiologically the more relevant interacting partner. The nuclear localization of

INCA1 reveals identical subcellular compartimentation of the active cyclin

A1/CDK2 complex and its substrate INCA1. In healthy tissue, INCA1 expression

was highest in testis, followed by intermediate expression levels in ovary,

pancreas, lung, liver and spleen. Therefore, expression patterns of cyclin A1 and

INCA1 correlated well with regard to the testis, whereas expression in other

organs was not closely correlated. The induction of INCA1 in testis maturation

hints at a potential role in spermatogenesis. Since INCA1 was the predominant

cyclin A1/CDK2-interacting protein identified in our studies, its functional

characterization will shed light on the molecular mechanisms underlying cyclin-

regulated meiosis and spermatogenesis. First functional analyses indicate a


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 31 -

growth-suppressive function through regulation of CDK activity by INCA1

(Diederichs et al., unpublished).

In summary, we identified eight interaction partners of the cyclin A1/CDK2

complex including three novel proteins and studied their expression pattern in

several organs and developing, adult normal, malignant and infertile testis. Our

analyses will guide future functional studies to unravel the molecular functions of

cyclin A1 in physiological and pathological settings and thereby establish a basis

for further investigations.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 32 -

ACKNOWLEDGEMENTS

We thank Maria Möller, Sarah Pierschalski and Barbara Mlody for excellent

technical assistance and Peijun Zuo for help with the initial identification of

INCA1. This research is supported by grants from the Deutsche Krebshilfe (10-

1539-Mü2), the Deutsche José-Carreras-Leukämie-Stiftung and the Deutsche

Forschungsgemeinschaft (Mu1328/2-3).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 33 -

REFERENCES

1. Evans, T., Rosenthal, E. T., Youngblom, J., Distel, D., and Hunt, T. (1983)

Cell 33, 389-396.

2. Murray, A. W., Solomon, M. J., and Kirschner, M. W. (1989) Nature 339,

280-286.

3. Pines, J. (1993) Trends Biochem Sci 18, 195-197.

4. van den Heuvel, S., and Harlow, E. (1993) Science 262, 2050-2054.

5. Nigg, E. A. (1995) Bioessays 17, 471-480.

6. Pines, J. (1999) Nat Cell Biol 1, E73-79.

7. Westendorf, J. M., Swenson, K. I., and Ruderman, J. V. (1989) J Cell Biol

108, 1431-1444

8. Kishimoto, T. (2003) Curr Opin Cell Biol 15, 654-663

9. Forsburg, S. L., and Hodson, J. A. (2000) Nat Genet 25, 263-268

10. Ortega, S., Prieto, I., Odajima, J., Martin, A., Dubus, P., Sotillo, R.,

Barbero, J. L., Malumbres, M., and Barbacid, M. (2003) Nat Genet 35, 25-

31

11. Hartwell, L. H., and Kastan, M. B. (1994) Science 266, 1821-1828.

12. Hanahan, D., and Weinberg, R. A. (2000) Cell 100, 57-70.

13. Sherr, C. J. (2000) Cancer Res 60, 3689-3695.

14. Evan, G. I., and Vousden, K. H. (2001) Nature 411, 342-348.

15. Pagano, M., Pepperkok, R., Verde, F., Ansorge, W., and Draetta, G.

(1992) EMBO J 11, 961-971.

16. Morgan, D. O. (1995) Nature 374, 131-134.

17. Guadagno, T. M., Ohtsubo, M., Roberts, J. M., and Assoian, R. K. (1993)

Science 262, 1572-1575.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 34 -

18. Barrett, J. F., Lewis, B. C., Hoang, A. T., Alvarez, R. J., Jr., and Dang, C.

V. (1995) J Biol Chem 270, 15923-15925.

19. Desdouets, C., Sobczak-Thepot, J., Murphy, M., and Brechot, C. (1995)

Prog Cell Cycle Res 1, 115-123

20. Tsai, L. H., Harlow, E., and Meyerson, M. (1991) Nature 353, 174-177

21. Tsai, L. H., Lees, E., Faha, B., Harlow, E., and Riabowol, K. (1993)

Oncogene 8, 1593-1602

22. Yang, R., Morosetti, R., and Koeffler, H. P. (1997) Cancer Res 57, 913-

920.

23. Howe, J. A., Howell, M., Hunt, T., and Newport, J. W. (1995) Genes Dev

9, 1164-1176.

24. Sweeney, C., Murphy, M., Kubelka, M., Ravnik, S. E., Hawkins, C. F.,

Wolgemuth, D. J., and Carrington, M. (1996) Development 122, 53-64.

25. Ravnik, S. E., and Wolgemuth, D. J. (1999) Dev Biol 207, 408-418.

26. Liu, D., Matzuk, M. M., Sung, W. K., Guo, Q., Wang, P., and Wolgemuth,

D. J. (1998) Nat Genet 20, 377-380.

27. Liu, D., Liao, C., and Wolgemuth, D. J. (2000) Dev Biol 224, 388-400.

28. Schrader, M., Müller-Tidow, C., Ravnik, S., Müller, M., Schulze, W.,

Diederichs, S., Serve, H., and Miller, K. (2002) Hum Reprod 17, 2338-

2343.

29. Yang, R., Müller, C., Huynh, V., Fung, Y. K., Yee, A. S., and Koeffler, H.

P. (1999) Mol Cell Biol 19, 2400-2407.

30. Müller, C., Yang, R., Beck-von-Peccoz, L., Idos, G., Verbeek, W., and

Koeffler, H. P. (1999) J Biol Chem 274, 11220-11228.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 35 -

31. Yang, R., Nakamaki, T., Lübbert, M., Said, J., Sakashita, A.,

Freyaldenhoven, B. S., Spira, S., Huynh, V., Müller, C., and Koeffler, H. P.

(1999) Blood 93, 2067-2074.

32. Liao, C., Wang, X. Y., Wei, H. Q., Li, S. Q., Merghoub, T., Pandolfi, P. P.,

and Wolgemuth, D. J. (2001) Proc Natl Acad Sci U S A 98, 6853-6858.

33. Müller, C., Readhead, C., Diederichs, S., Idos, G., Yang, R., Tidow, N.,

Serve, H., Berdel, W. E., and Koeffler, H. P. (2000) Mol Cell Biol 20, 3316-

3329.

34. Linggi, B., Müller-Tidow, C., van de Locht, L., Hu, M., Nip, J., Serve, H.,

Berdel, W. E., van der Reijden, B., Quelle, D. E., Rowley, J. D.,

Cleveland, J., Jansen, J. H., Pandolfi, P. P., and Hiebert, S. W. (2002) Nat

Med 8, 743-750

35. Schultz, N., Hamra, F. K., and Garbers, D. L. (2003) Proc Natl Acad Sci U

S A 100, 12201-12206

36. Xu, Y., Ashley, T., Brainerd, E. E., Bronson, R. T., Meyn, M. S., and

Baltimore, D. (1996) Genes Dev 10, 2411-2422

37. Müller-Tidow, C., Diederichs, S., Schrader, M. G., Vogt, U., Miller, K.,

Berdel, W. E., and Serve, H. (2003) Cancer Lett 190, 89-95

38. Müller-Tidow, C., Wang, W., Idos, G. E., Diederichs, S., Yang, R.,

Readhead, C., Berdel, W. E., Serve, H., Saville, M., Watson, R., and

Koeffler, H. P. (2001) Blood 97, 2091-2097.

39. Spain, B. H., Bowdish, K. S., Pacal, A. R., Staub, S. F., Koo, D., Chang,

C. Y., Xie, W., and Colicelli, J. (1996) Mol Cell Biol 16, 6698-6706

40. Jin, D. Y., Teramoto, H., Giam, C. Z., Chun, R. F., Gutkind, J. S., and

Jeang, K. T. (1997) J Biol Chem 272, 25816-25823.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 36 -

41. Peng, Y. C., Kuo, F., Breiding, D. E., Wang, Y. F., Mansur, C. P., and

Androphy, E. J. (2001) Mol Cell Biol 21, 5913-5924.

42. Peng, Y. C., Breiding, D. E., Sverdrup, F., Richard, J., and Androphy, E. J.

(2000) J Virol 74, 5872-5879

43. Zhang, J., Kalkum, M., Chait, B. T., and Roeder, R. G. (2002) Mol Cell 9,

611-623

44. Ouyang, H., Nussenzweig, A., Kurimasa, A., Soares, V. C., Li, X., Cordon-

Cardo, C., Li, W., Cheong, N., Nussenzweig, M., Iliakis, G., Chen, D. J.,

and Li, G. C. (1997) J Exp Med 186, 921-929

45. Ferguson, D. O., Sekiguchi, J. M., Chang, S., Frank, K. M., Gao, Y.,

DePinho, R. A., and Alt, F. W. (2000) Proc Natl Acad Sci U S A 97, 6630-

6633

46. Pierce, A. J., Hu, P., Han, M., Ellis, N., and Jasin, M. (2001) Genes Dev

15, 3237-3242

47. Tuteja, N., Tuteja, R., Ochem, A., Taneja, P., Huang, N. W., Simoncsits,

A., Susic, S., Rahman, K., Marusic, L., Chen, J., and et al. (1994) Embo J

13, 4991-5001

48. Manis, J. P., Gu, Y., Lansford, R., Sonoda, E., Ferrini, R., Davidson, L.,

Rajewsky, K., and Alt, F. W. (1998) J Exp Med 187, 2081-2089

49. Um, J. H., Kim, S. J., Kim, D. W., Ha, M. Y., Jang, J. H., Chung, B. S.,

Kang, C. D., and Kim, S. H. (2003) Mech Ageing Dev 124, 967-975

50. Goedecke, W., Eijpe, M., Offenberg, H. H., van Aalderen, M., and Heyting,

C. (1999) Nat Genet 23, 194-198

51. Hsia, K. T., Millar, M. R., King, S., Selfridge, J., Redhead, N. J., Melton, D.

W., and Saunders, P. T. (2003) Development 130, 369-378


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 37 -

52. Pitcher, J. A., Inglese, J., Higgins, J. B., Arriza, J. L., Casey, P. J., Kim,

C., Benovic, J. L., Kwatra, M. M., Caron, M. G., and Lefkowitz, R. J.

(1992) Science 257, 1264-1267

53. Ron, D., Chen, C. H., Caldwell, J., Jamieson, L., Orr, E., and Mochly-

Rosen, D. (1994) Proc Natl Acad Sci U S A 91, 839-843

54. Chang, B. Y., Harte, R. A., and Cartwright, C. A. (2002) Oncogene 21,

7619-7629

55. Chang, B. Y., Conroy, K. B., Machleder, E. M., and Cartwright, C. A.

(1998) Mol Cell Biol 18, 3245-3256

56. Croze, E., Usacheva, A., Asarnow, D., Minshall, R. D., Perez, H. D., and

Colamonici, O. (2000) J Immunol 165, 5127-5132

57. Ozaki, T., Watanabe, K., Nakagawa, T., Miyazaki, K., Takahashi, M., and

Nakagawara, A. (2003) Oncogene 22, 3231-3242

58. Jackson, F. R., Banfi, S., Guffanti, A., and Rossi, E. (1997) Genomics 41,

444-452

59. Lai, M. C., Kuo, H. W., Chang, W. C., and Tarn, W. Y. (2003) Embo J 22,

1359-1369

60. Elliott, D. J., Millar, M. R., Oghene, K., Ross, A., Kiesewetter, F., Pryor, J.,

McIntyre, M., Hargreave, T. B., Saunders, P. T., Vogt, P. H., Chandley, A.

C., and Cooke, H. (1997) Proc Natl Acad Sci U S A 94, 3848-3853

61. Herrmann, C. H., and Mancini, M. A. (2001) J Cell Sci 114, 1491-1503

62. Dickinson, L. A., Edgar, A. J., Ehley, J., and Gottesfeld, J. M. (2002) J Biol

Chem 277, 25465-25473

63. Seghezzi, W., Chua, K., Shanahan, F., Gozani, O., Reed, R., and Lees, E.

(1998) Mol Cell Biol 18, 4526-4536


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 38 -

FIGURE LEGENDS

Fig. 1: Yeast-Triple-Hybrid System for cyclin A1/CDK2 interaction partners

1A: A Yeast-Triple-Hybrid System (Y3H) was used to identify interaction

partners of the cyclin A1/CDK2 complex from a testis cDNA library. Cyclin A1

served as bait fused to the GAL4-DNA-Binding Domain (BD), CDK2 was

coexpressed from the same vector and the testis cDNA library was fused to the

GAL4-Activation Domain (AD). Yeast growth only occurred upon interaction of

cyclin A1, CDK2 and a library cDNA. 1B: Eight genes were identified in more

than a single yeast clone. Three of them encoded novel proteins named INCA1,

KARCA1 and PROCA1.

Fig. 2: Sequences of the novel proteins INCA1, KARCA1 and PROCA1

2A: The mRNA of human INCA1 encoded a 221 aa protein which was not

homologous to any other known protein. The mRNA consisted of eight exons of

which the second one was alternatively spliced leading to mRNAs of 1383 nt and

1221 nt length, respectively (NLS = Nuclear Localization Signal). 2B: KARCA1

was a novel protein of 288 aa that showed homology to Kelch motifs and Ankyrin

repeats. 2C: PROCA1 encoded a novel amino acid sequence interacting with

cyclin A1 in our Y3H assay. The identified clone spanned 133 aa and was in

frame to the GAL4-AD. As the protein sequence did not start with a methionine

and did not contain any STOP codon, we assume the full-length protein to be

larger and therefore called this sequence partial coding sequence. The N-

terminal part of PROCA1 contained a proline-rich region.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 39 -

Fig. 3: Association of cyclin A1 with its novel interaction partners and substrates

3A: This figure shows the open reading frames of the identified cyclin A1-

interacting proteins and the parts of these proteins identified in the Y3H system

which constitute potential interaction domains. In addition, minimal and full

consensus motifs for CDK phosphorylation are displayed. 3B: In GST pulldown

assays, we proved interaction of all identified potential interaction partners with

cyclin A1 in vitro. GST alone or GST fused to one of the interacting proteins was

incubated with in vitro transcribed / translated radioactively labeled cyclin A1.

3C: Co-Immunoprecipitation of Myc-GPS2 with Cyclin A1 in lysates from

transfected Cos-7 cells confirmed their interaction in vivo. 3D: In in vitro kinase

assays, GST fusion proteins were incubated with lysates from baculovirally

infected Sf9 cells expressing cyclin A1 and CDK2 in the presence of [γ-32P]ATP.

3E: INCA1, Ku70 and RBM4 were phosphorylated by the cyclin A1/CDK2

complex. To control the specificity of their phosphorylation, GST fusion proteins

were incubated with Sf9 lysates from cells infected with empty vector, cyclin A1

alone or CDK2 alone.

Fig. 4: Expression of cyclin A1 and its interaction partners in normal organs

4A-4I: In a panel of healthy human organs, mRNA expression levels were

determined by real-time quantitative RT-PCR. Amounts of cDNA were

standardized to the expression levels of the housekeeping gene GAPDH.

Expression levels were normalized to their expression in testis (testis=1) (4A:

cyclin A1, 4B: INCA1, 4C: GPS2, 4D: Ku70, 4E: RACK1/GNB2L1, 4F: RBM4,

4G: DKFZ p686G052, 4H: KARCA1, 4I: PROCA1). 4J: An overview over

expression of all genes in normal organs is given in logarithmic scale. The x-axis

represents expression in testis (1.00). Diagram bars below the x-axis indicate


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 40 -

lower gene expression than in testis, bars above the x-axis indicate higher

expression than in testis. The graph clearly shows high expression in testis for

all genes except RACK1/GNB2L1 and therefore illustrates the testis-specific

expression pattern of most genes identified in our Y3H system.

Fig. 5: Expression of cyclin A1 and its interaction partners during testis

maturation and spermatogenesis and in testes with decreased fertility

5A: We analyzed previously published microarray data (35) for the expression of

the murine homologs of cyclin A1 and its interacting proteins throughout testis

development. Consecutive testis cDNA samples from day 1 after birth to adult

testis were hybridized to oligonucleotide microarrays. To allow easier

comparison of expression levels between different genes and to illustrate the

gene regulation throughout testicular maturation, gene expression levels were

normalized to the maximal expression level of each gene. Identical patterns of

induction were found for cyclin A1, KARCA1 and GPS2. Substantial expression

of all genes was confirmed in later stages of testis development when highest

cyclin A1 expression occurred. 5B: Gene expression levels were analyzed in

cDNA isolated from normal testis (n=6) and testis infertility patient samples

(n=35) by real-time quantitative RT-PCR. Mean expression levels and standard

errors are shown. Expression of seven genes differed significantly in normal and

malignant testis tissue.

Fig. 6: Expression of cyclin A1 and its interaction partners in testis tumors

6A: Gene expression levels were analyzed in cDNA isolated from normal testis

(n=7) and testis tumor patient samples (n=29) by real-time quantitative RT-PCR.

Mean expression levels and standard errors are shown. Expression of seven


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 41 -

genes differed significantly in normal and malignant testis tissue. 6B-6J:

Differentiation of the tumor samples into different histological subtypes is

presented in boxplots: normal testis (n=7), embryonal carcinoma (EC, n=6),

immature teratoma (iT, n=4), yolc-sac tumor (YS, n=3), seminoma (S, n=7),

mature teratoma (mT, n=6).

Fig. 7: Interaction and phosphorylation of INCA1 by cyclin A1

7A: GST pulldown assays of GST-INCA1 and cyclin A1 from either baculovirus-

infected Sf9 cell lysate or in vitro transcription/translation confirmed binding of

INCA1 and cyclin A1 in vitro. 7B: Cos-7 cells were transfected with EGFP-cyclin

A1 and Myc-INCA1. Immunoprecipitation with α-Myc antibody and subsequent

Western blotting for EGFP-cyclin A1 indicated interaction of cyclin A1 and INCA1

in vivo. ML-1 leukemia cells which express high levels of cyclin A1 were serum

starved to induce INCA1 expression. Immunoprecipitation was performed on

equal amounts of protein lysate with α-INCA1 immune serum or with pre-immune

serum for control purposes. Western blotting for cyclin A1 revealed interaction of

endogenous cyclin A1 with endogenous INCA1 in starved ML-1 cells. The higher

non-specific band ( ) is shown as a loading control. 7C: In vitro kinase assays

with GST-INCA1 and lysates from baculovirus-infected Sf9 cells were carried out

in the presence of [γ−32P]ATP. As with cyclin A1/CDK2 (compare Fig. 3E), GST-

INCA1 was phosphorylated in vitro by cyclin A2/CDK2, but not by CDK2 or either

cyclin alone. 7D: Three INCA1 fragments were fused to GST and used for in

vitro kinase assays. The C-terminal part of INCA1 was predominantly

phosphorylated by cyclin A1/CDK2. 7E: Potential phosphorylation sites were

point mutated to alanine. Mutation of Ser23, Thr167 and Ser176 strongly reduced in


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 42 -

vitro phosphorylation of INCA1. Equal concentration of GST fusion proteins was

confirmed by SDS-PAGE and Coomassie-staining (not shown).

Fig. 8: Expression of INCA1 mRNA and protein in vivo

8A: Northern blot analysis of total mRNA from different species (Macaca

fascicularis (M.f.), Callithrix jacchus (C.j.), Homo sapiens (H.s.) and Mus

musculus (M.m.)) showed the existence of INCA1 mRNA in vivo. Two bands

corresponding to the two splice variants were seen in human and monkey

organs with highest expression levels in the testis. 8B: Transfection of the cDNA

of INCA1 into Sf9 insect cells and into the mammalian cell line Cos-7 led to the

expression of INCA1 protein detected by Western blotting. 8C: Several cell lines

were tested for INCA1 expression by Western blotting using antibodies affinity

purified with two different peptides of INCA1. Transfected Cos-7 cells were used

as positive control. 8D: Cos-7 cells were transfected with EGFP or EGFP-INCA1

and stained for DNA (DAPI) and Actin (TRITC-Phalloidin). 8Da: The staining

pattern of EGFP (green) was predominantly localized in the cytosol and co-

stained with Actin (red) rather than with DNA (blue). 8Db: Fluorescence of EGFP

fused to human INCA1 was localized in the nucleus. 8Dc+d: Confocal laser

scanning microscopy gave a more detailed picture of localization and revealed a

non-homogenous nuclear staining pattern for INCA1.

Fig. 9: INCA1 gene expression is driven by a Sp1-dependent promoter

9A: Fragments of the genomic sequence upstream of the INCA1 transcriptional

start site were cloned into the promoter position upstream of a luciferase cDNA.

Luciferase assays after transfection into Cos-7 cells showed high promoter

activity for a 1.6 kb and a 0.6 kb fragment. 9B: In Sp1-deficient S2 insect cells,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 43 -

no promoter activity was detected whereas co-transfection of the transcription

factor Sp1 led to strong activation of the INCA1 promoter fragments. 9C: The 0.6

kb fragment of the INCA1 promoter contained several putative Sp1 binding sites.

Deletional mutation of this fragment revealed the importance of the sequence -

254/+97 for Sp1-dependent promoter activation in luciferase assays. 9D: HeLa

cells were treated with 5-aza-Cytidine (Aza) or the HDAC inhibitor Trichostatin A

(TSA) and INCA1 mRNA expression was analyzed by real-time quantitative RT-

PCR. TSA treatment induced INCA1 expression whereas Aza had no effect on

the INCA1 promoter.

Supplementary Fig. 1: Sequence, genomic localization and structure of INCA1

S1A: The mRNA of human INCA1 encoded a 221 aa protein which was not

homologous to any other known protein. The mRNA consisted of eight exons of

which the second one was alternatively spliced leading to mRNAs of 1383 nt and

1221 nt length, respectively. Human INCA1 localized to chromosome 17p13.

S1B: The murine homolog of INCA1 encoded a 231 aa protein and contained

seven exons. The first exon was alternatively spliced giving rise to four splice

variants. The murine INCA1 gene mapped to chromosome 11B.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 44 -

SUPPLEMENTS

Supplementary Table 1: Primer and probes for Yeast colony PCR, quantitative

real-time RT-PCR (TaqMan) and mutagenesis

forward primer reverse primer TaqMan probe

Yeast colony PCR first PCR

ATACCACTACAATGGATG CAGTTGAAGTGAACTTGCGGGG

Yeast colony PCRnested PCR

CTATTCGATGAAGATACCCCACCAAACCC

GTGAACTTGCGGGGTTTTTCAGTATCTACGAT

TaqMan GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC CAAGCTTCCCGTTCTCAGCC

TaqMan Cyclin A1 GGGCTCCCAGATTTCGTCT CTGCAGTGCATTGCTTCAGA CCAGCAGCAGCCCGTGGA

TaqMan INCA1 cds GCAGGTGCAGGATGATGG A GAGATCGGCTGACCACCCT CAACCTCATCCCCTTTGCCAAGTGTTC

TaqMan INCA1 5'UTR CCTGGCTTCCTTCAGCTCC CACCTGCATGACTGGACGG TGGATCTAGCACCAAAAAGGAGACTAACTAC

TaqMan GPS2 AAAAACGGAGGCGAAAGGA GTGTGAACAGTCAGGCTCTGCT

CAGAGTGACCTGACCACCCTAACATCAGC

TaqMan Ku70 GCCTTGGCCTTGGATTTGAT CCCAGTCTTTTATTCATTGCTTCA

TaqMan GNB2L1 = RACK1

TGGGATGGAACCCTGCG GTATGGCCCACAAATCGCC

TaqMan RBM4 GGCGCGGTACTCAGCCTT CAACCGCAGCTCGGAATTT

TaqMan DKFZ p686G052

AATTTAGTGGTACTGATTTGCTTAATGG

GTAGAATGTGGTGAGACAACTACACTTG

TaqMan KARCA1 GCACCTATTGCTACAAGCAAGAAG GAGCAGGGCCGCACAGT

TaqMan PROCA1 GCTGGTGTGGCGTCCAC AGCAGCACTTGTCAGGCTCC

hINCA1 S23A GGTCAGCCGAGCTCCACCCCCAAGG

CCTTGGGGGTGGAGCTCGGCTGACC

hINCA1 T167A CCGTTTTCTCGCTCCCGGCAGGGCC

GGCCCTGCCGGGAGCGAGAAAACGG

hINCA1 S176A CCAGCTGCTTTGGGCTCCCTGGAGC

GCTCCAGGGAGCCCAAAGCAGCTGG

hINCA1 S179A CTTTGGTCTCCATGGGCCCCCCTGG

CCAGGGGGGCCCATGGAGACCAAAG

All sequences are given in 5'-3' direction. TaqMan probes were labeled at the 5'

end with the fluorescent dye FAM (GAPDH: VIC) and at the 3' end with the

quencher TAMRA.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 45 -

Supplementary Table 2: GenBank Accession Numbers for the novel genes

INCA1, KARCA1 and PROCA1

Gene Species Molecule Accession Number

INCA1 Homo sapiens mRNA, splice isoform 1 AY601906

INCA1 Homo sapiens mRNA, splice isoform 2 AY601907

INCA1 Homo sapiens coding sequence AY601908

INCA1 Mus musculus mRNA, splice isoform 1 AY601909




INCA1 Mus musculus coding sequence AY601913

KARCA1 Homo sapiens mRNA AY601914

KARCA1 Homo sapiens coding sequence AY601915

PROCA1 Homo sapiens partial mRNA AY601916


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 46 -

Supplementary Table 3: Bioinformatical analyses of the INCA1 sequence

For the analysis of the nucleotide and the amino acid sequence of INCA1,

several web-based resources were used. Detailed information about these

programs is listed in supplementary table 3A. Results and predicted properties of

INCA1 are shown in Table 3B.

Analyzed property Program ResourceBlast http://www.ncbi.nlm.nih.govWU-blastp http://www.ebi.ac.ukScanps http://www.ebi.ac.uk

Homology searches

BLAST2.0 http://www.ch.embnet.orgProtein parameters ProtParam http://www.expasy.ch/cgi-bin/protparam

Scan Prosite http://www.expasy.ch/cgi-bin/scanprositePosttranslationalmodifications Motif Scan http://hits.isb-sib.ch/cgi-bin/PFSCAN

PhosphoBase http://www.cbs.dtu.dk/databases/PhosphoBase- Phosphorylation

NetPhos 2.0 http://www.cbs.dtu.dk/services/NetPhos/- Tyr sulfation Sulfinator http://www.expasy.ch/cgi-bin/sulfinator.pl-Glycosylation NetOGlyc 2.0 http://www.cbs.dtu.dk/services/NetOGlyc/

big-PI predictor http://mendel.imp.univie.ac.at/gpi/cgi-bin/gpi_pred.cgi- GPI anchor

DGPI http://129.194.186.123/servlet_dgpi/dgpi

Localization & Signalsequences PSORT II http://psort.nibb.ac.jp/cgi-bin/runpsort.pl

Domain search S.M.A.R.T. http://smart.embl-heidelberg.de/smart- transmembrane

d iTMPred http://www.ch.embnet.org/cgi-bin/TMPRED_form_parser

Stability ProtParam http://www.expasy.ch/cgi-bin/protparam- PEST sequences PESTfind http://vienna.at.embnet.org/htbin/embnet/ PESTfind

http://genome.ucsc.eduChromosomallocalization http://www.ncbi.nlm.nih.gov/Genome

Table 3A: Bioinformatic tools for the analysis of the INCA1 sequence


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 47 -

Property ResultsHomologysearches no significant homology on the nucleotide or amino acid level

hINCA1 221 aaMW hINCA1

I25201.5 Da

pI hINCA1 6.92mINCA1 231 aaMW mINCA1

I26476.8 Da

Protein parameters

pI mINCA1 7.7Kinase # sitesPosttranslational

modifications Calmodulin II 3Protein Kinase A 3Casein Kinase I 2Casein Kinase II 1CDK 1Protein Kinase G 1

Phosphorylation

Protein Kinase C 1N-Myristoylation 92-97, 124-129, 213-218 3Tyr sulfation Tyr148 1Glycosylation Ser32 1only sites with high

potential (90%) of modification are shown GPI anchor - 0

Transmembrane Helices - 0Nuclear Localization Signal RRKKRRP (75-81) 1Other signal sequences - 0

Localization & Signal sequences

Predicted localization nuclearDomain search -

Destabilizing signals -Stability

Instability index 85.12 (unstable)hINCA1 chromosome 17p13.3Chromosomal

localization mINCA1 chromosome 11B3

Table 3B: Results and predictions from the sequence analysis of hINCA1

The nucleotide and amino acid sequence of hINCA1 and mINCA1 were analyzed

using several web-based bioinformatic tools. Results for hINCA1 and mINCA1

were highly consistent.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Berdel, Hubert Serve and Carsten Müller-TidowE.Cauvet, Wenbing Wang, Jörg Gromoll, Mark G. Schrader, H. Phillip Koeffler, Wolfgang

Sven Diederichs, Nicole Bäumer, Ping Ji, Stephan K. Metzelder, Gregory E. Idos, ThomasIdentification of interaction partners and substrates of the cyclin A1/CDK2 complex

published online May 24, 2004J. Biol. Chem.

10.1074/jbc.M401708200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

http://www.jbc.org/content/suppl/2004/07/08/M401708200.DC1


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M401708200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M401708200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/05/24/jbc.M401708200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/05/24/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/05/24/jbc.M401708200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/suppl/2004/07/08/M401708200.DC1

http://www.jbc.org/

identification of interaction partners and substrates · cyclin a1 interaction partners - 5 - the...

Documents