Central JSM Regenerative Medicine & Bioengineering

Cite this article: Kochegarov A, Moses-Arms A, Hanna MC, Lemanski LF (2015) Identification of Genes Involved in Limb Regeneration in the Axolotl Ambys-toma mexicanum. JSM Regen Med Bio Eng 3(1): 1014.

*Corresponding authorAndrei Kochegarov, Department of Biological and Environmental Sciences, Texas A&M University-Commerce, PO Box 3011, Commerce, TX 75429-3011, USA, Tel: 903-886-5602; Fax: 903-886-5997; Email:

Submitted: 22 January 2015

Accepted: 20 February 2015

Published: 23 February 2015

Copyright© 2015 Kochegarov et al.

OPEN ACCESS

Keywords•Ambystomamexicanum•Limb•Regeneration•Blastema•Retinoic acid

Research Article

Identification of Genes Involved in Limb Regeneration in the Axolotl Ambystoma mexicanumAndrei Kochegarov*, Ashley Moses-Arms, Michael C. Hanna and Larry F. LemanskiDepartment of Biological and Environmental Sciences, Texas A&M University-Commerce, USA

Abstract

The Mexican axolotl, Ambystoma mexicanum, is a unique vertebrate species which has amazing powers of limb regeneration. In the present study we have used a Subtractive Amplification approach to identify genes which are activated and overexpressed during the limb regeneration process. In our initial studies, we have found that levels of expression of 11 genes are increased during the limb regeneration process. This group includes Cellular retinoic acid-binding proteins (CRABP1 and CRABP2), Retinal dehydrogenase 2 isoform 4, Homeobox protein MSX-2, Bone morphogenetic protein, BMP2, Homeobox protein MEOX-2, LIM homeobox transcription factor 1-alpha, LMX1A, Fibroblast growth factors (FGFR4 and FGFR8) and some others. Thus, our data support the hypothesis that retinoic acid and Epidermal Growth Factors may be a morphogens that plays an important role in proximodistal limb patterning.

ABBREVIATIONSRA: Retinoic Acid; AEC: Apical Epidermal Cap

INTRODUCTIONSalamanders are the only vertebrate species that have the

unique ability to regenerate whole damaged limbs, eye lenses and parts of the heart. Ambystoma mexicanum is an endangered salamander species native to the mountainous lake regions surrounding Mexico City. Limb regeneration in these urodele amphibians occurs in several steps: first, dedifferentiation of adult cells into cells similar to pluripotent stem cells forming a blastema, second, proliferation of the cells, and third, cell differentiation and limb patterning [1]. After amputation of a limb, epidermal cells migrate to cover the limb stump forming a structure called the apical epidermal cap (AEC) [2]. Because the blastema and AEC are formed only when the bone has been severed, we hypothesize that mesenchymal bone marrow cells are very important in initiation of regeneration and blastema formation. Multiple signals, from blood thrombosis, and from damaged bone and possibly nerves, must converge to initiate dedifferentiation of cells and formation of the blastema. Platelets, neutrophils, macrophages and fibroblasts appear to be the primary cells that produce cytokines, including interleukin (ILS), TNF-α, and platelet-derived growth factor (PDGF) in response to injury, perhaps are important for initiation of regeneration

[3]. Mesenchymal bone marrow cells are adult stem cells that are similar to blastema cells. Although, mesenchymal bone marrow cells may be the first cells to begin to dedifferentiate, later the other types of cells also dedifferentiate to form an undifferentiated blastema. As soon as cells proliferate in an amount sufficient to form a small limb bud, they undergo limb patterning, the process in which cells are appointed to form a certain part of a limb. Interestingly, the amputated limb does not grow gradually from proximal to distal components, but rather, the distal digits (fingers) are formed first and proximal parts are formed later. One of the attractive models explaining pattern formation during limb regeneration is a gradient hypothesis that postulates that a biochemical substance, a morphogen, governs the pattern of limb development and sets the positions of cells within the new limb. Our goal in this study was to determine which genes, including possible morphogens, are expressed or upregulated during limb regeneration. Determination of these genes may aid in future possible tissue regeneration in other eukaryotes and in humans. Using Ambystoma mexicanum as an animal model and Subtractive Amplification approach followed by subsequent cloning and sequencing, we have determined that there are at least eleven genes expressed and upregulated during limb regeneration. These genes include those involved in cell proliferation and limb patterning and suggest retinoic acid as a possible morphogen

Central

Kochegarov et al. (2015)Email:

JSM Regen Med Bio Eng 3(1): 1014 (2015) 2/7

MATERIALS AND METHODS

Animal Surgery

This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and Texas A&M University-Commerce. Experiments were performed on axolotls (Ambystoma mexicanum) measuring 8–15 cm from snout to tail tip. All surgical procedures were performed while the animals were anesthetized in a 0.1% solution of MS222 (Ethyl 3-aminobenzoate methanesulfonate salt, Sigma) anesthesia, to eliminate pain and minimize suffering. Animals were kept anesthetized and covered with moist sterile lab tissues during surgery. Amputation of the limb was made using a sharp sterilized scalpel through the proximal mid-humerus levels of the limb. For subtraction hybridization experiments, tissue samples were collected from the contralateral intact limbs and from operated limbs 7 days after amputation. For qRT-PCR experiments,

samples of regenerated tissue were dissected 3, 5, 7, 15 and 30 days after amputation.

RNA Isolation Procedure

Tissue samples were homogenized by sonication with TRIzol reagent (Life Technologies, Grand Island NY), after which, 100% chloroform was added, vortexed and centrifuged to separate the aqueous layer containing RNA. RNA was precipitated from the upper aqueous layer with 100% isopropanol, centrifuged at 12,000g for 15 minutes at room temperature, washed with 75% ethanol and resuspended in RNAase-free water.

Subtractive hybridization

cDNAs were synthesized according to the manufacturer’s instructions for the PCR-Select™ cDNA Subtraction Kit (#637401) (Figure 1). 2μg of total RNA were combined with 3μM cDNA synthesis Poly-T primer and incubated at 70ºC for 2 minutes and cooled on ice. The first-strand synthesis mix

Figure 1 Schematic representation of subtractive hybridization procedure.

Central

Kochegarov et al. (2015)Email:

JSM Regen Med Bio Eng 3(1): 1014 (2015) 3/7

contained 1X first-strand Buffer, 1mM dNTPs, 2mM DTT, sterile H2O and 100 units SMARTScribe Reverse Transcriptase, and was allowed to incubate at 42ºC for 1.5 hours. Second-strand synthesis contained first-strand cDNA, 1X second-strand buffer, 2mM dNTPs, 1X second strand enzyme cocktail and sterile H2O. The reaction was incubated at 16ºC for 2 hours. Subsequently 6 units of T4 DNA Polymerase were added and further incubated at 16ºC for 30 minutes. Following reaction termination, (by 1X EDTA/glycogen mixture), cDNA was purified and precipitated by phenol chloroform extraction, Na4AOc/ethanol precipitation, 80% ethanol washing, and the precipitate was resuspended in 50μl of sterile H2O. Both tester (regeneration tissue) and driver (normal tissue) were Rsa I (15U) digested at 37ºC for 1.5 hours and purified and precipitated as previously described. Resultant cDNAs were resuspended in 5.5μl sterile H2O. Using 1μl of Rsa I digested tester cDNA, Adaptor 1 and Adaptor 2R were ligated using 1X ligation buffer, 400U T4 DNA ligase and sterile H2O at 16ºC overnight. Ligation reactions were stopped and ligase was inactivated by heating at 72ºC for 5 minutes. In separate tubes, equal amounts of normal tissue driver cDNA and Adaptor 1 ligated regeneration tissue tester cDNA or normal tissue driver cDNA and Adaptor 2R ligated regeneration tissue tester cDNA were combined with 1X hybridization buffer, denatured at 98ºC for 1.5 minutes and allowed to hybridize at 68ºC for 8 hours. Subsequently, excess normal tissue driver cDNA was denatured in 1X hybridization buffer as previously described, and combined with both Adaptor 1 ligated and Adaptor 2R ligated regeneration tissue tester cDNA, all in one tube and allowed to hybridize at 68ºC overnight. In order to fill in the missing strand of the adaptor, thus creating binding sites for the PCR primers, a PCR reaction was completed using 1μl of the hybridization reaction, 1X PCR reaction buffer, 0.2mM dNTP, 2.5 mM PCR Primer 1 (5′-CTAATACGACTCACTATAGGGC-3′), and 1X Advantage cDNA Polymerase Mix (Clontech 639102). Reactions were initially denatured at 94ºC for 25 seconds and cycled at 94ºC for 10 seconds, 66ºC for 30 seconds, and 72ºC for 90 seconds, 27 times. Following

dilution of the original PCR reaction, nested PCR was completed. This reaction included 1X PCR reaction buffer, 2.5 μM Nested Forward Primer (5′-TCGAGCGGCCGCCCGGGCAGGT-3′), 2.5 μM Nested Reverse Primer (5′-AGCGTGGTCGCGGCCGAGGT-3′), 0.2mM dNTPs, and 1X Advantage cDNA Polymerase Mix. 12 cycles of PCR amplification were done. The cycles were denaturing at 94ºC for 10 seconds, annealing at 68ºC for 30 seconds, and extended at 72ºC for 90 seconds. The PCR mixture was then enriched for differentially expressed cDNAs. The synthesized DNA was ligated into Pgem-Y Easy Vector Systems Promega (#A137A) with “sticky” T-ends.

Cloning Procedure

Vectors and inserts were transformed in JM109 E. coli competent cells (Sigma-Aldrich J3895) by heat shock and grown overnight on solidified LB media with ampicillin (50μg/ml), IPTG (1 mM) and x-Gal (40 μg/ml). The pGEM-T vector contains an ampicillin resistance gene (ampR) and the β-galactosidase gene. The insert disrupted the β-galactosidase gene, and therefore these colonies remained white, while colonies having a vector without an insert, express β-galactosidase which turned the substrate blue. Only white colonies were selected to grow in 2xYT media ampicillin (50ug/ml). Plasmids were extracted according to manufacturer’s instructions using PureLinkHiPure Plasmid DNA Purification Kits (Invitrogen K2100-02).

RESULTS AND DISCUSSIONWe amputated limbs in axolotls and waited when regeneration

take place and extracted RNA from regenerated tissue. RNA from wound epidermis on non-amputated intact limb was used as a control. We compared gene expression from regenerated tissue in amputated limb with gene expression from wound epidermis to subtract genes which are exclusively expressed during regeneration but not during wound healing. During first week only wound epidermis is formed to cover stump. Two weeks after amputation a small regenerative bud was formed that was clearly

Figure 2 Limb regeneration of salamander. A. After amputation. B. Two weeks after amputation. C. Two weeks after amputation. Re-grown digits are noticeable. D. Eight weeks after amputation.

Central

Kochegarov et al. (2015)Email:

JSM Regen Med Bio Eng 3(1): 1014 (2015) 4/7

distinguishable from the surrounding older tissue (Figure 2). This regenerative bud was dissected for RNA extraction and analysis. Regenerative bud slowly increased in size and at one month post-amputation formed tiny primordial digits. We were particularly interested in the early stages of regeneration and expression of genes in the blastema rather than during digit development. Subtractive amplification is a molecular methodology which allows selective amplification of genes with increased expression. Subsequent sequencing identified 11 genes that had increased expression after amputation, but had not increased expression in wound epidermis (Table 1). Axolotl genes were identified by their sequences at the BLAST Ambystoma website (www.ambystoma.org/genome-resources/21-blast), and then searched for human homologous with the BLAST algorithm at NCBI website.

Alignment of axolotl genes in the human genome database showed significant matches, higher than 70% identity, with human homologous genes (Figure 3). Two cloned genes are involved in the transport of retinoic acid (CRABP1 and CRAB2) and a third cloned gene encodes the retinoic acid synthesizing protein, retinal dehydrogenase 2 (ALDH1A2). It is particularly interesting because in previous studies a significant effect of RA exposure on limb regeneration was observed and described as “super-regeneration” [4]. In that study on axolotls, a low concentration of retinoic acid resulted in the regeneration of additional forearm bones: ulna and radius. A medium concentration of retinoic acid elicited formation of additional forearms and elbows; and a high concentration of retinoic acid resulted in the regeneration of a whole additional limb after the level of amputation [4]. To study time-course expression we dissected regenerated tissue at various time periods after initial amputation. Using qRT-PCR we quantified the level of expression of cloned genes. Expression of CRABP1 and CRABP2 by qRT-PCR increased during first 3-5 days after limb amputation and stayed

elevated during the entire period of limb regeneration (Figure 4). Thus, expression of genes involved in retinoic acid metabolism and transport was increased in regenerating limb. Fibroblast growth factors (FGFs) have long been implicated in regulation of vertebrate skeletal muscle differentiation, but their precise roles in vivo remain unclear. Here, we show that FGF8 starts to express 7 days after amputation making it a possible candidate as another morphogen involved in limb patterning (Figure 4). Expression of FGF10 starts very early, by day 3, and reaches a maximum level in 15 days, indicating a likely role in limb regeneration. In other studies, fibroblast growth factors (FGFs) were identified as the essential signals produced by the apical ectodermal ridge (AER) for induction of proximodistal limb patterning during vertebrate embryonic development [5]. Genetic knockout experiments showed that knockout mice lacking both FGF4 and FGF8 cause a complete failure of limb formation during embryonic development [6]. Also, a previous study showed that FGF8 signaling is required for MyoD expression and differentiation of muscle precursor cells within the early somite [7].

Limb regeneration originated in fish and lower tetrapods, but through evolutionary processes the ability of limb regeneration has been lost in higher tetrapods. The genes that trigger regeneration process in salamander limbs would seem to be the most important genes for limb regeneration in all vertebrate species. We hypothesize that these genes should be activated upon severe injury involving blood clotting signals, signals released upon nerve and bone injuries or a combination of all these signals in the salamander. These hypothetical genes likely would be expressed very early after limb amputation and would be a critical step in initiating expression of all other genes responsible for cell de-differentiation, blastema formation, putative morphogen expression and limb patterning. Our data showing overexpression of FGF8 indirectly support the

Salamander gene, according to the Ambystoma genome database (4) Human homologous gene Maximal expression level

ID : C0366131 Name : contig366182 Cellular retinoic acid-binding protein 1, CRABP1 2.7

ID : C0091388 Name : contig91429 Cellular retinoic acid-binding protein 2, CRABP2 3.8

ID : C0111317 Name : contig111359 Retinal dehydrogenase 2 isoform 4, ALDH1A2 3.5

ID : C0327857 Name : contig327908 Homeobox protein MSX-2 3.6

ID : C0445207 Name : contig445258 Bone morphogenetic protein, BMP2 2.35

ID : C0515335 Name : contig515386 Homeobox protein MEOX-2 3.8

ID : C0230979 Name : contig231029 Homeobox protein engrailed-1, EN1 4.2

ID : C0331900 Name : contig331951 LIM homeobox transcription factor 1-alpha, LMX1A 2.7

ID : C0340977 Name : contig341028 Fibroblast growth factor 8, FGF8 3.6

ID : C0720749 Name : contig720800 Fibroblast growth factor receptor 4 isoform 2, FGFR4 4.5

ID : C0629449 Name : contig629500 Unidentified human protein 10.5

Table 1: Genes identified by subtractive amplification in regenerating axolotl limb.

Central

Kochegarov et al. (2015)Email:

JSM Regen Med Bio Eng 3(1): 1014 (2015) 5/7

Figure 3 Alignment of axolotl, Ambystoma mexicanum (Am) genes with human homologous genes (H): A. CRABP1, 78.9% identity, B. CRABP2, 80.4% identity, C.ALDH1A2, 85.7% identity.

Figure 4 The time-course expression of genes CRABP1, CRABP2, FGF8 and FGF10 by qRT-PCR increased with time compared to the expression in the wound epidermis.

notion that the FGF species are key regulators in axolotl limb regeneration. Recent findings reveal that FGF2/8 and Bmp7 applied together induce limb regeneration in salamanders [8]. A new experimental system, called the accessory limb model (ALM) has become popular to study limb regeneration. The experiments where only skin were wounded result in wound healing but not in limb induction. However, nerve deviation to the wounded skin induces limb formation in ALM. Thus, nerves can be considered to have the ability to transform skin wound healing to limb

formation. Bmp and FGF gene expression can be observed in dorsal root ganglion (DRG) neurons, therefore, Bmp7 and FGF2/8 can be considered as nerve-expressed factors [9]. Application of FGF2/8 without Bmp7 led to blastema induction but was not sufficient for limb regeneration [10]. Application of Bmp7 and FGF2/8, instead of nerve deviation resulted in limb formation in the ALM of axolotl. In this experiment, application of chemical FGF and BMB signaling inhibitors did not prevent bud formation, but completely inhibited limb regeneration. These observations

Central

Kochegarov et al. (2015)Email:

JSM Regen Med Bio Eng 3(1): 1014 (2015) 6/7

suggest that FGF2/8 and BMP7 may serve as signals to initiate limb regeneration. These growth factors are also important in normal limb development. It was found that injection of FGF signaling inhibitors aborted limb development in chicken and mouse. One of the simplest explanation as to why mammals do not have the ability for limb regeneration is that severed mammal nerves or bones simply cannot express or release initiating signals such as FGF4/8, BMP7 or other nerve or bone factors upon injury. In this case, application of combination of these factors (FGF4/8 and BMP7) might be able to induce limb regeneration in mammals. However, there may be multiple explanations of lack of limb regeneration in mammals. For example, to receive a FGF signal and to respond on this signal, a specific set of cells should express corresponding FGF receptor and signaling mechanisms and specific transcription factors that initiate the regenerative responses. Current data do not permit us to determine which particular link is missing in mammalian regenerative events. Further experiment using mammalian model will be required to answer these critically important questions limb regeneration in mammals, including humans.

This group with increased expression in regenerating limb also includes the homeobox genes MSX-2, BMP-2, MEOX-2, and Engrailed-1. It was found that MSX-2 expression stays high during limb regeneration until digit formation [11]. However, as soon as the digits start to develop, MSX-2 expression in the limb ceases. Previous studies have shown that BMP2 signaling activates MSX-2 expression during regeneration of axolotl limb [11], and in Xenopus tail and limb regeneration [12]. MEOX-2 expression in the developing dorsal and ventral mesoderm of the chicken limb may play an important role in vertebrate limb myogenesis [13,14]. Engrailed-1(En-1) plays an important role in dorsoventral limb patterning, in dorsal limb differentiation and in development of the apical ectodermal ridge in rodent limbs [15]. Lmx-1 gene expression is also required for dorsal-ventral patterning during limb regeneration in Xenopus laevis larvae. The last axolotl gene in the table C0629449/contig629500 encodes an unidentified protein with unknown function. The sequence of the cloned gene contains 399 nucleotides followed by a poly-A tail:

GTGTTACATATTCCTAGCAGTGTCAAGGAAGTGATA -AAAATATTAATTTATATTATACTCTGAGTCAAGGATACATGCT-GAAATTCTTTGAGTAATGTCTAATAACTAAAAAGGAAGGGC-CAGGCCCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAG-GCCAAGGCGGGCAGATCACCTGAGGTCAGGAATTCGAGAC-

CAGCCTGGCCAACATGGCAAAACTCTGTCTCTACTAAAAATA-CAAAAATTAGCCGGGTGTGGTGACACGTGCCTGTAATCCCAGC-TACTCGAGAGGCTGAGACAGGAGAATTGCTTGAACTCAGGAG-GTGGAGGTTGCAGTGAGCCAAGATCGCGCCACTGCACTCCAGCCT-GGGCGACAGAGCAAGACTCCATCTCAAAAA

Searching the sequence of this gene with a megablast algorithm (highly similar sequences) did not find matches with the human genome. This gene may be unique in the axolotl genome, conferring these species their amazing regenerative power. Screening the NCBI database with another algorithm, blastn (somewhat similar sequences) in human genome (Table 2) revealed 6 similar genes.

CONCLUSIONGenes over expressed during early limb regeneration

including homeobox genes, genes responsible for the synthesis and transport of retinoic acid (RA) and Epidermal Growth Factors play important roles in limb regeneration. Our data support the hypothesis that Epidermal Growth Factors are critically important signals that initiate limb regeneration.

ACKNOWLEDGEMENTS This work is supported in part by National Institute of Health

grant R01 HL061246 (Larry F Lemanski), American Heart Association grant 10GRNT453000 (Larry F Lemanski) and a NSF-RUI Award 1121151 (Larry F Lemanski, Andrei Kochegarov and Michael C Hanna). We give special acknowledgment to Dr. VenuCheriyath for using his NanoDrop machine for measuring RNA/DNA concentration.

REFERENCES1. Bryant SV, Endo T, Gardiner DM. Vertebrate limb regeneration and the

origin of limb stem cells. Int J Dev Biol. 2002; 46: 887-896.

2. Gardiner DM, Muneoka K, Bryant SV. The migration of dermal cells during blastema formation in axolotls. Dev Biol. 1986; 118: 488-493.

3. Shah JM, Omar E, Pai DR, Sood S. Cellular events and biomarkers of wound healing. Indian J Plast Surg. 2012; 45: 220-228.

4. Maden M, Hind M. Retinoic acid, a regeneration-inducing molecule. Dev Dyn. 2003; 226: 237-244.

5. Niswander L. Pattern formation: old models out on a limb. Nat Rev Genet. 2003; 4: 133-143.

6. Sun X, Mariani FV, Martin GR. Functions of FGF signalling from the apical ectodermal ridge in limb development. Nature. 2002; 418: 501-508.

7. Groves JA, Hammond CL, Hughes SM. Fgf8 drives myogenic progression of a novel lateral fast muscle fibre population in zebrafish. Development. 2005; 132: 4211-4222.

8. Makanae A, Mitogawa K, Satoh A. Co-operative Bmp- and Fgf-signaling inputs convert skin wound healing to limb formation in urodele amphibians. Dev Biol. 2014; 396: 57-66.

9. Makanae A, Hirata A, Honjo Y, Mitogawa K, Satoh A. Nerve independent limb induction in axolotls. Dev Biol. 2013; 381: 213-226.

10. Satoh A, makanae A, Hirata A, Satou Y. Blastema induction in aneurogenic state and Prrx-1 regulation by MMPs and FGFs in Ambystoma mexicanum limb regeneration. Dev Biol. 2011; 355: 263-274.

Human gene Identities

cell death regulator protein Aven 265/308(86%)

pro-interleukin-16 isoform 2 196/230(85%)

rho GTPase-activating protein 11B 247/304(81%)

uncharacterized protein LOC100128108 isoform X3 230/284(81%)

putative peptidoglycan-binding, domain containing 4 222/284(78%)

ADAM metallopeptidase with thrombospondin type 1 222/284(78%)

Table 2: Genes revealed in human genome similar to axolotl gene ID: C0629449.

Central

Kochegarov et al. (2015)Email:

JSM Regen Med Bio Eng 3(1): 1014 (2015) 7/7

Kochegarov A, Moses-Arms A, Hanna MC, Lemanski LF (2015) Identification of Genes Involved in Limb Regeneration in the Axolotl Ambystoma mexicanum. JSM Regen Med Bio Eng 3(1): 1014.

Cite this article

11. Carlson MR, Bryant SV, Gardiner DM. Expression of Msx-2 during development, regeneration, and wound healing in axolotl limbs. J Exp Zool. 1998; 282: 715-723.

12. Beck CW, Christen B, Barker D, Slack JM. Temporal requirement for bone morphogenetic proteins in regeneration of the tail and limb of Xenopus tadpoles. Mech Dev. 2006; 123: 674-688.

13. Stamataki D, Kastrinaki M, Mankoo BS, Pachnis V, Karagogeos D. Homeodomain proteins Mox1 and Mox2 associate with Pax1 and Pax3

transcription factors. FEBS Lett. 2001; 499: 274-278.

14. Reijntjes S, Stricker S, Mankoo BS. A comparative analysis of Meox1 and Meox2 in the developing somites and limbs of the chick embryo. Int J Dev Biol. 2007; 51: 753-759.

15. Loomis CA, Harris E, Michaud J, Wurst W, Hanks M, Joyner AL. The mouse Engrailed-1 gene and ventral limb patterning. Nature. 1996; 382: 360-363.