identification of four common culex ) (diptera:...

Knight & Nayar: Electrophorectic Identification of

Culex

species 1

IDENTIFICATION OF FOUR COMMON

CULEX

(

CULEX

) (DIPTERA: CULICIDAE) SPECIES FROM FLORIDA WITH ISOENZYME ANALYSIS

J. W. K

NIGHT

AND

J. K. N

AYAR

Florida Medical Entomology Laboratory, and Department of Entomology and NematologyIFAS/University of Florida, 200 9th Street, S.E., Vero Beach, FL 32962

A

BSTRACT

Females of four common

Culex

(

Culex

) species from Florida were analyzed for isoenzymesusing polyacryamide gel electrophoresis. Ten enzymes that yielded 11 putative loci werestudied. Most of the loci showed diagnostic characteristics in the four species, but four of theloci (glycerol-3-phosphate dehydrogenase [

Gpd

-2], hexokinase [

Hk

], isocitrate dehydroge-nase [

Idh

-1], and malate dehydrogenase [

Mdh

]) could be used in sequence to identify thefour

Culex

species.

Culex salinarius

and

Cx. p. quinquefasciatus

could be separated from

Cx.restuans

and

Cx. nigripalpus

by

Mdh

locus.

Culex salinarius

could be distinguished from

Cx.p. quinquefasciatus

by

Hk

locus and

Cx. nigripalpus

could be distinguished from

Cx. restu-ans

, by

Idh

-1 and/or

Gpd

-2 loci. Randomly combined specimens of these four

Culex

specieswere identified accurately by using these enzyme loci.

Key Words: Mosquito indentification,

Culex

species,

Culex nigripalpus

,

Culex pipiens quin-quefasciatus

,

Culex restuans

,

Culex salinarius

, isoenzyme analysis, Florida

R

ESUMEN

Las hembras de cuatro especies comunes de

Culex

(

Culex

) de Florida fueron analizadas paraisoenzimas usando un gel poliacrilamida de electroforesis. Diez enzimas que produjeron 11loci (lugares) putativas fueron estudiados. La mayoría de los loci mostraron caracteristicasdiagnosticadas en las cuatro especies, pero cuatro de los loci (glicerol-3-fosfato-deshidroge-nasa [

Gpd-

2], hexocinasa [

Hk

], isocitrato-deshidrogenasa [

Idh

-1], y el malato-deshidroge-nasa [

Mdh

]) pudieron ser utilizados en secuencia para identificar las cuatro especies de

Culex

.

Culex salinarius

y

Cx. p. quinquefasciatus

pudieron ser separadas de

Cx. restuans

y

Cx. nigripalpus

por el locus de

Mdh

.

Culex salinarius

pudieron ser distinguidas de

Cx. p.quinquefasciatus

por el loci de

Hk

y

Cx. nigripalpus

pudieron ser distinguidas de

Cx. restu-ans

, por los loci

Idh

-1 y/o

Gpd

-2i. Especímenes de las cuatro especies de

Culex

, combinados

al azar fueron identificados correctamente utilizando estos loci de enzimas.

Mosquitoes belonging to the

Culex

(

Culex

) spe-cies have been shown to be among the importantepizootic or epidemic vectors of arboviruses in-cluding St. Louis encephalitis (SLE) virus andWest Nile Virus (WNV) in the United States (Tsai& Mitchell 1989, CDC 2002). Accurate identifica-tion of field-collected

Culex

mosquitoes is essen-tial for epidemiological and control efforts. Field-collected specimens of females of

Culex

(

Culex

)species are often difficult to identify, becauseadult collections are commonly made with vari-ous trapping methods and, unfortunately, thecharacteristic patterns of scales used to identify

Culex

adult females are frequently rubbed off bythe devices or simply lost as the mosquito ageswith the result that unidentified

Culex

speciesare lumped together as

Culex

spp. for identifica-tion and for virus analysis. During the last 30years, several attempts have been made to iden-tify field-collected

Culex

mosquitoes by methodsother than the morphological methods. These in-clude identification of

Culex

species by isoenzymeelectrophoresis in Indiana (Saul et al. 1977; Cor-saro & Munstermann 1984) and by a species-

diagnostic polymerase chain reaction assay(Crabtree et al. 1995; Miller et al. 1996; Crabtreeet al. 1997). Since some

Culex

species present inFlorida are different from species found in otherparts of the United States, the objective of thisstudy was to identify females of Florida’s fourcommon

Culex

(

Culex

) species (

Cx. nigripalpus

Theobald,

Cx. pipiens quinquefasciatus

Say,

Cx.restuans

Theobald and

Cx. salinarius

Coquillett)by using isoenzyme electrophoresis.

M

ATERIALS

AND

M

ETHODS

Mosquito Collection

Egg rafts of the four

Culex

species were col-lected in oviposition pans containing oak leaf and/or hay infusion from the field at the Florida Med-ical Entomology Laboratory (Knight & Nayar1999) from January through April 2003 when allfour species are present (O’Meara & Evans, 1983;Provost 1969). Individual egg rafts were allowedto hatch in the laboratory in vials and the first in-stars of each species were identified (Dodge 1966;

2

Florida Entomologist

87(1) March 2004

Haeger & O’Meara 1983). Larvae from 16 to 20egg rafts from each species were reared, one raftper tray, to the adult stage. The identification ofnewly emerged adults was reconfirmed by mor-phological characters before samples of femaleswere frozen to be used later in polyacrylamide gelelectrophoresis.

In order to confirm our results, 6 individuals/gel of each of the four

Culex

species, each individ-ual representing a different family, were ran-domly processed for the previously determinedfour diagnostic enzyme loci as described in theResults section below. A total of 24 individuals ofeach

Culex

species, each individual representinga different family, were processed.

Electrophoretic Methods

Preparation of individual mosquitoes, buffersystems and electrophoretic protocols were thesame as were described by Black and Munster-mann (1996). Mini-Protean II Cell® (Mini-verti-cal electrophoretic system from Bio-RadLaboratories, Hercules, CA) was used for thesestudies. Each female was homogenized in 30 µl ofloading buffer (20% sucrose, Triton X-100 [0.5%],Tris-citrate pH 7.0 electrode buffer and traceamount of bromophenol blue tracking dye), andcentrifuged for 10 min at 2,000 g. The superna-tant (24 µl) was dispensed equally (3 µl) into 8,0.5-ml Eppendorf tubes and frozen at -80°C untilused for electrophoresis. At the time of electro-phoresis, a 1.0-µl sample was loaded into eachlane of the gel. Using this method we could ana-lyze up to 16 enzyme loci from each mosquito(Nayar et al. 2002).

Ten enzyme systems were analyzed and arelisted by name, abbreviation and Enzyme Com-mission number: aconitase hydratase (

Acoh

, EC4.2.1.3); adenylate kinase (

Ak

-2, EC 2.7.4.3); glyc-erol-3-phosphate dehydrogenase (

Gpd

-2, EC1.1.1.8); glucose-6-phosphate isomerase (

Gpi

, EC5.3.1.9); hexokinase (Hk-2-4, EC 2.7.1.1 scored asone enzyme); isocitrate dehydrogenase (

Idh

-1 and

Idh

-2, EC 1.1.1.42); malate dehydrogenase (

Mdh

,EC 1.1.1.37), malate dehydrogenase (NADP+)/malic enzyme

(Mdhp

-2/

Me

, EC 1.1.1.40); phos-phogluconate dehydrogenase (

Pgd

, EC 1.1.1.44),and phosphoglucomutase (

Pgm

, EC 5.4.2.2.).Three females, each from a separate family, wereanalyzed on each gel, and eight gels were assayedfor each group of four species plus controls. Refer-ence females of

Aedes aegypti

L. (ROCK strain)were also included in each run.

Statistical Analysis

Genetic variation was analyzed with a BIO-SYS-2 Program for desktop computer (Black1997). This program is a modification of BIOSYS-1 (Swofford & Selander 1981).

T

ABLE

1. A

LLELE

FREQUENCIES

IN

FOUR

C

ULEX

SPECIES

(

CS

=

C

X

.

SALINARIUS

,

CR

=

C

X

.

RESTUANS,CQ = CX. P. QUINQUEFASCIATUS AND CN = CX.NIGRAIPALPUS). TWENTY-FOUR SPECIMENS,EACH FROM A SEPARATE FAMILY, WERE ANA-LYZED FROM EACH SPECIES.

Locus & Rf valuesa

Species

CS CR CQ CN

Acoh95 0.000 0.000 0.083 1.000

100 0.875 0.208 0.917 0.000105 0.125 0.792 0.000 0.000

Ak-290 1.000 1.000 0.000 0.00095 0.000 0.000 0.000 1.000

100 0.000 0.000 1.000 0.000Gpd-2

100 1.000 1.000 1.000 0.083120 0.000 0.000 0.000 0.917

Gpi84 0.000 0.000 0.000 0.04295 1.000 0.000 0.000 0.000

100 0.000 0.083 1.000 0.833105 0.000 0.917 0.000 0.125

Hk86 0.917 0.000 0.000 0.00093 0.083 0.000 0.000 0.375

100 0.000 1.000 1.000 0.625Idh-1

100 0.000 0.000 1.000 0.000107 0.000 1.000 0.000 0.000133 0.625 0.000 0.000 1.000147 0.292 0.000 0.000 0.000153 0.083 0.000 0.000 0.000

Idh-294 0.667 0.000 1.000 0.00097 0.000 1.000 0.000 1.000

100 0.167 0.000 0.000 0.000111 0.167 0.000 0.000 0.000

Mdh83 0.000 1.000 0.000 1.000

100 1.000 0.000 1.000 0.000Mdhp-2

95 0.042 1.000 0.000 1.000100 0.333 0.000 0.875 0.000103 0.000 0.000 0.125 0.000108 0.625 0.000 0.000 0.000

Pgd67 0.792 0.083 0.125 0.000

100 0.208 0.917 0.875 1.000Pgm

87 0.167 0.458 0.000 0.333100 0.833 0.542 0.958 0.542109 0.000 0.000 0.042 0.125

aThe eleven variable enzymes are Acoh = aconitase hy-dratase; Ak-2 = adenylate kinase; Gpd-2 = glycerol-3-phosphatedehydrogenase; Gpi = glucose-6-phosphate isomerase; Idh-1and Idh-2 = isocitrate dehydrogenase; Hk = hexokinase; Mdh =malate dehydrogenase; Mdhp-2 = malate dehydrogenase(NADP+); Pgd = phosphogluconate dehydrogenase; and Pgm =phosphoglucomutase.

Knight & Nayar: Electrophorectic Identification of Culex species 3

Fig. 1. Isoenzyme profiles of four enzymes (six loci, Mdh, Hk, Idh-1 and Idh-2, and Gpd-1 and Gpd-2). In Figs.1a-1d, individuals numbered 1-3, 4-6, 8-10 and 11-13 represent known Culex salinarius (CS), Cx. restuans (CR), Cx.p. quinquefasciatus (CQ) and Cx. nigripalpus (CN), respectively. Individual numbered 7 (Aa) is Aedes aegypti con-trol. Figs. 1e-1h, are used to identify unknown individuals as described in the text, except that individual numbered7 (CQ) Cx. p. quinquefasciatus was used as a control.

4 Florida Entomologist 87(1) March 2004

RESULTS

Allele frequency data for four Culex speciesfrom Florida are presented in Table 1. Compari-son of the frequency values of enzyme loci showedthat even though most of the enzyme loci have dif-ferences in Rf values that could separate differentspecies from each other, the Rf values in only fourof the loci (Gpd-2, Hk, Idh-1 and Mdh) were dis-tinctive enough to be used to separate the fourspecies (Table 1; Fig. 1). These four loci are as fol-lows: malate dehydrogenase (Mdh) is monomor-phic in Cx. salinarius and Cx. p. quinquefasciatusat Mdh100, and in Cx. nigripalpus and Cx. restuansat Mdh83 (Table 1; Fig. 1a). Hexokinase (Hk), thatis represented by three-banded pattern and some-times by a six-banded polymorphic pattern(Tabachnick & Howard 1982), is slower in Cx.salinarius (Hk86, 86 /93) than in the other three Culexspecies (Cx. restuans Hk100, Cx. p. quinquefascia-tus Hk100 and Cx. nigripalpus Hk93,100, 93/100) (Table 1;Fig. 1b). Isocitrate dehydrogenase-1 (Idh-1) ispolymorphic in Cx. salinarius Idh-1133, 133/147,133/153

but homozygous in the other three species (Cx.restuans Idh-1107, Cx. p. quinquefasciatus Idh-1100

and Cx. nigripalpus Idh-1133) (Table 1; Fig. 1c).Glycerol-3-phosphate dehydogenase (Gpd-2120, 100/

120) is moving faster in Cx. nigripalpus in one al-lele than the other three species (Cx. restuansGpd-2100, Cx. salinarius Gpd-2100, and Cx. p. quin-quefasciatus Gpd-2100) (Table 1; Fig. 1d). SinceGpd-2 in Cx. nigripalpus is sometimes heterozy-gous, caution is needed in using it as a distin-guishing character. From this information wedeveloped a key to separate the four Culex species(Table 2).

Further analysis of the data in Table 1 showedthat Cx. p. quinquefasciatus exhibited a low num-ber of alleles per locus (1.3 ± 0.1), the lowest per-centage of polymporphic loci (23.1%) and thelowest Hardy-Weinberg heterozygosity (0.054 ±0.03) from the other three species (Cx. nigripal-pus, 1.6 ± 0.2, 46.2% and 1.95 ± 0.07; Cx. restuans,1.3 ± 0.1, 30.8% and 0.091 ± 0.05; and Cx. salinar-ius, 1.8 ± 0.2, 69.2% and 0.207 ± 0.05, respec-tively). Since Cx. p. quinquefasciatus wasmonomorphic for the four enzyme loci chosen tobe used in the key (Table 2), we used it as a con-trol instead of Ae. aegypti (ROCK strain) to iden-

tify other Culex species. Thus, using Cx. p.quinquefasciatus as a control (#7 in Figs. 1e-1h)and the key (Table 2), we were able to identify cor-rectly 24 randomly selected individuals of all fourCulex species (Figs. 1e-1h, only 12 individuals areshown in these Figs.). Individuals numbered 3, 5,8, 10, 11 and 13 (Fig. 1e) had a faster moving Mdhallele and represented either Cx. salinarius or Cx.p. quinquefasciatus, whereas individuals num-bered 1, 2, 4, 6, 9 and 12 had a slower Mdh allelerepresenting either Cx. restuans or Cx. nigripal-pus. Individuals numbered 5, 8, 10 and 13 (Fig.1f) had a slower moving Hk allele that identifiedit as Cx. salinarius, and distinguished it from theother two faster moving individuals numbered 3and 11 that were identified as Cx. p. quinquefas-ciatus. Individuals that represented either Cx.restuans or Cx. nigripalpus and were numbered1, 4, 9 and 12 (Fig. 1g) had a faster moving Idh-1allele that identified it as Cx. nigripalpus, anddistinguished it from a slower moving Idh-1 allelein individuals numbered 2 and 6 that were iden-tified as Cx. restuans. Culex nigripalpus individu-als numbered 1, 4, 9 and 12 were identified byusing Gpd-2 enzyme loci. The most common Gpd-2 in Cx. nigripalpus was faster than Gpd-2 in theother three Culex species (Fig. 1h).

CONCLUSION

Our results show that Culex (Culex) speciesfrom Florida can be unambiguously distinguishedfrom each other by using four isozymes (Mdh, Hk,Idh-1 and Gpd-2) in sequence. These studies sug-gest that from various types of trapping collec-tions for Culex species, those individuals thatcannot be identified to separate species with stan-dard morphological characters can be identifiedby isoenzyme analysis, instead of pooling them to-gether as Culex spp. It is worth pointing out herethat the four species of mosquitoes used in thisstudy were collected from January through April,when all four species were present in Florida. It ispossible that some of the isoenzyme systems mayshow some degree of polymorphism when thesespecies of mosquitoes are collected at differenttimes of the year or from different locations as ob-served in Cx. nigripalpus (Nayar et al. 2002) andCx. p. quinquefasciatus (Nayar et al. 2003).

TABLE 2. ELECTROPHORETICE KEY FOR IDENTIFICATION OF OUR COMMON CULEX (CULEX) SPECIES IN FLORIDA.

1. Mdh, faster, monomorphic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Cx. salinarius or Cx. p. quinquefasciatus (2)Slower, monomorphic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Cx. restuans or Cx. nigripalpus (3)

2. Hk, slower . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Cx. salinariusFaster, monomorphic. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cx. p. quinquefasciatus

3. Idh-1, faster, monomorphic;Gpd-2, faster, usually monomorphic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Cx. nigripalpus

Both Idh-1 and Gpd-2 slower, monomorphic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cx. restuans

Knight & Nayar: Electrophorectic Identification of Culex species 5

Therefore, a word of caution may be appropriate.A broader application of this technique to identifyCulex species from other areas must be confirmedwith samples from different localities before thistechnique should be used outside Florida.

Isoenzyme analysis by electrophoresis tech-nique is reliable, accurate and simple to performonce the electrophoretic equipment is set-up inthe laboratory (Black & Munstermann 1996) anda person is trained to run the equipment. Thistechnique is especially useful when freshly col-lected or frozen Culex mosquitoes are to be usedfor virus analysis or surveillance during differentseasons of the year; however, this technique can-not be used for dead or dried specimens. Isoen-zyme analysis is less expensive and faster thanthe PCR technique for DNA identification of dif-ferent Culex species (Miller et al. 1996; Crabtreeet al. 1995, 1997), but DNA analyses can be usedfor dead or dried specimens.

ACKNOWLEDGMENTS

This article is Florida Agricultural ExperimentalStation Journal Series No. R-09582.

REFERENCES CITED

BLACK, W. C. IV. 1997. Biosys-2. A Computer Programfor the Analysis of Allelic Variation in genetics. Col-orado State University, Ft. Collins, CO.

BLACK, W. C. IV., AND L. E. MUNSTERMANN. 1996. Mo-lecular taxonomy and systematics of arthropod vec-tors, pp. 438-470. In B. J. Beaty, and W. C. Marquardt(eds.). The Biology of Disease Vectors. UniversityPress of Colorado, Niwot, CO.

CDC. 2002. Provisional surveillance summary of theWest Nile Virus epidemic—United States, Januaryto November. MMWR. 51: 1129.

CORSARO, B. G., AND L. E. MUNSTERMANN. 1984. Iden-tification by electrophoresis of Culex adults (Diptera:Culicidae) in light-trap samples. J. Med. Entomol.21: 648-655.

CRABTREE, M. B., H. M. SAVAGE, AND B. R. MILLER.1995. Development of a species-diagnostic poly-merase chain reaction assay for the identification ofCulex vectors of St. Louis encephalitis virus based oninterspecies sequence variation in ribosomal DNAspacers. Am. J. Trop. Med. Hyg. 53: 105-109.

CRABTREE, M. B., H. M. SAVAGE, AND B. R. MILLER.1997. Development of a polymerase chain reactionassay for differentiation between Culex pipiens pipi-ens and Cx. p. quinquefasciatus (Diptera: Culicidae)in North America based on genomic differences iden-tified by subtractive hybridization. J. Med. Entomol.34: 532-537.

DODGE, H. R. 1966. Studies on mosquito larvae. II. Thefirst-stage larvae of North American Culicidae andof world Anophelinae. Can. Entomol. 98: 337-393.

HAEGER, J. S., AND G. F. O’MEARA. 1983. Separation offirst-instar larvae of four Florida Culex (Culex). Mos-quito News 43: 76-77.

KNIGHT, J. W., AND J. K. NAYAR. 1999. Colonization ofCulex nigripalpus Theobald (Diptera: Culicidae) bystimulation of mating using males of other mosquitospecies. J. Am. Mosq. Control Assoc. 15: 72-73.

MILLER, B. R., M. B. CRABTREE, AND H. M. SAVAGE.1996. Phylogeny of fourteen Culex mosquito species,including the Culex pipiens complex, inferred fromthe internal transcribed spacers of ribosomal DNA.Insect Mol. Biol. 5: 93-107.

NAYAR, J. K., J. W. KNIGHT, AND L. E. MUNSTERMANN.2002. Temporal and geographic genetic variation inCulex nigripalpus Theobald (Diptera: Culicidae), avector of St. Louis encephalitis, from Florida. J. Med.Entomol. 39: 854-860.

NAYAR, J. K., J. W. KNIGHT, AND L. E. MUNSTERMANN.2003. Temporal and geographic genetic variation inCulex pipiens quinquefasciatus Say (Diptera: Culi-cidae) from Florida. J. Med. Entomol. 40: 882-889.

O’MEARA, G. F., AND F. D. S. EVANS. 1983. Seasonal pat-terns of abundance among three species of Culexmosquitoes in a south Florida wastewater lagoon.Ann. Entomol. Soc. 76: 130-133.

PROVOST, M. W. 1969. The natural history of Culex ni-gripalpus. In St. Louis encephalitis in Florida. Flor-ida State Board of Health. Monogr. No. 12: 46-62.

SAUL, S. H., P. R. GRIMSTAD, AND G. B. CRAIG, JR. 1977.Identification of Culex species by electrophoresis.Am. J. Trop. Med. Hyg. 26: 1009-1012.

SWOFFORD, D. L., AND R. B. SELANDER. 1981. BIOSYS-1: a FORTRAN program for the comprehensive anal-ysis of electrophoretic data in population geneticsand systematics. J. Heredity 72: 281-283.

TABACHNICK, W. J., AND D. J. HOWARD. 1982. Geneticcontrol of hexokinase variation in insects. Biochem.Genet. 20: 47-57.

TSAI, T. F., AND C. J. MITCHELL. 1989. St. Louis enceph-alitis, pp. 113-143. In T. P. Monath (ed.), The Arbovi-ruses: Epidemiology and Ecology. Vol. IV. CRC Press,Boca Raton, FL.

6


87(1) March 2004

SAFETY OF A NOVEL INSECTICIDE, SUCROSE OCTANOATE,TO BENEFICIAL INSECTS IN FLORIDA CITRUS

J. P. M

ICHAUD

1,2

AND

C. L. M

C

K

ENZIE

1,3

1

University of Florida, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL 33881

2

Agricultural Research Center—Hays, Kansas State University, 1232 240th Ave., Hays, KS 67601

3

USDA, ARS Horticultural Research Laboratory, 2001 South Rock Rd., Ft. Pierce, FL 34945

A

BSTRACT

Laboratory trials were used to estimate the toxicity of sucrose octanoate to beneficial insectsrepresenting four insect orders of importance in biological control in Florida citrus. First in-stars of the ladybeetles

Cycloneda sanguinea

L.,

Curinus coeruleus

Mulsant,

Harmonia ax-yridis

Pallas and

Olla v-nigrum

Mulsant (Coleoptera: Coccinellidae) and the lacewing

Chrysoperla rufilabris

Burmeister (Neuroptera: Chrysopidae) survived topical sprays of su-crose octanoate at 8,000 ppm without significant mortality, a concentration corresponding totwice the recommended field rate required to kill aphids and other soft bodied pests. Simi-larly, adults of the red scale parasitoid,

Aphytis melinus

De Bach (Hymenoptera: Aphelin-idae) and second instars of the predatory bug

Orius insidiosus

(Say) (Hemiptera:Anthocoridae) survived 24 h exposures to residues of 8,000 ppm sucrose octanoate on leafdisks without significant mortality. The efficacy of sucrose octanoate as a contact insecticideagainst various homopteran pests of citrus, combined with its low toxicity to key beneficialinsects in the citrus ecosystem, suggest that it may be a valuable material for incorporationinto IPM programs for Florida citrus.

Key Words:

Aphytis melinus

,

Curinus coeruleus

,

Cycloneda sanguinea

,

Harmonia axyridis

,

Olla v-nigrum

,

Orius insidiosus

, sucrose octanoate

R

ESUMEN

Pruebas de laboratorio fueron usadas para estimar la toxicidad de octanoate de sucrosa parainsectos benéficos representantes de cuatro ordenes. Larvas de primer estadió de los cocine-lidos

Cycloneda sanguinea

L.,

Curinus coeruleus

Mulsant,

Harmonia axyridis

Pallas y

Ollav-nigrum

Mulsant y el crisópido


Burmeister sobrevivieron asper-ciones topicales de octanoate de sucrosa en dosis de 8,000 ppm sin mortalidad significativa,una concentración corespondiente al doble de la dosis necesaria para matar áfidos y otras pl-agas homópteras en cítricos. En forma parecida, adultos del parásitoide de la escama roja,

Aphytis melinus

De Bach (Hymenoptera: Aphelinidae) y ninfas de segundo estadió de

Oriusinsidiosus

(Hemiptera: Anthocoridae) sobrevivieron sin mortalidad significativa un periodode 24 h expuestos a dosis residuales de octanoate de sucrosa de 8,000 ppm aplicadas en dis-cos de hoja. La eficacia del octanoate de sucrosa como insecticida de contacto contra variasplagas homópteras de cítricos, en combinación con su toxicidad baja contra insectos benéfi-cos en el ecosystema citrícola, sugiere que este material puede ser valioso para inclusión enprogramas de IPM en cítricos en la Florida.

Translation provided by author

One of the challenges of insect control withpesticides in agricultural IPM programs isachieving selection and kill of target pests whileminimizing mortality to beneficial insects. How-ever, phytophagous pest insects typically aremore resistant to synthetic toxins than are preda-cious and parasitic insects due to the evolution ofmechanisms for detoxification of plant secondarycompounds (Croft 1990). This problem might beovercome by the development of more selectivecompounds with modes of action specific to pestinsects, or by selective application techniquessuch as spot treatments that permit the survival

of beneficial insects in untreated refuges. Effec-tive IPM programs require, or are in need of, newmaterials with novel modes of action that can beapplied in rotation with existing pesticides toavoid strong directional selection for resistancedevelopment in pest populations.

Sucrose octanoate is one of a series of syntheticsugar esters that are analogues of compoundsnaturally occurring in the glandular trichomes ofwild tobacco,

Nicotiana gossei

Domin. Sugar es-ters, also known as acyl sugars or polyol esters,are a relatively novel class of insecticidal com-pounds produced by reacting sugars with ali-

Michaud & McKenzie: Safety of Sucrose Octanoate 7

phatic or aromatic fatty acids (Puterka et al.2003). Sucrose esters are benign to the environ-ment, occur naturally in plants and are commer-cially synthesized for use in the food industry(Chortyk et al. 1996). The exudates of glandulartrichomes of

N. gossei

have been known for manyyears to contain compounds with insecticidal ac-tivity (Thurston & Webster 1962). It was deter-mined during the last decade that the primaryinsecticidal compounds within these glandulartrichomes are sucrose esters (Buta et al. 1993,Pittarelli et al. 1993). Synthetic sucrose estersthat are similar in structure to those that natu-rally occur in

N. gossei

have comparable insecti-cidal activity (Chortyk et al. 1996). Both naturaland synthetic sucrose esters have been shown tohave contact toxicity with very rapid knockdownof soft-bodied arthropods, including aphids (Nealet al. 1994), whiteflies (Liu et al. 1996) and psyl-lids (Puterka & Severson 1995). Feeding and ovi-positional deterrence to mites (Neal et al. 1994),whiteflies (Liu & Stansly 1995) and leafminers(Hawthorne et al. 1992) also have been demon-strated with sucrose esters.

Although the mode of action is unknown, it hasbeen suggested that sugar esters affect the insectcuticle causing death by rapid desiccation (Thurs-ton & Webster 1962). Parr and Thurston (1968)observed that topical applications of

N. gossei

tri-chome exudates applied to larvae of

Manducasexta

(L.) turned the cuticle transparent andcaused rapid loss of body fluids followed by death.Similarly, Liu and Stansly (1995) observed thatnymphs of the whitefly

Bemisia argentifolia

Per-ring and Bellows dried quickly and detached fromthe leaf surface when treated with

N. gossei

ex-tracts.

McKenzie and Puterka (2000) demonstratedan LC

90

(topical spray) for sucrose octanoate rang-ing from 4,000-7,360 ppm for nymphs of the Asiancitrus psyllid,

Diaphorina citri

Kuwayama, animportant disease vector in citrus. Other workhas demonstrated good insecticidal activityagainst the brown citrus aphid,

Toxoptera citri-cida

(Kirkaldy) at even lower concentrations(McKenzie, unpublished data). Although thesafety of sucrose esters for beneficial insects incitrus has not yet been examined, Stansly and Liu(1997) found that they had little or no effect onthe whitefly parasitoid

Encarsia pergandiella

Howard. In order to ascertain the safety of su-crose octanoate for natural enemies in citrus, weselected candidate species for testing that repre-sented four different orders of beneficial insectsknown to be important in biological control ofhomopteran pests, the primary targets of this ma-terial.

Aphytis melinus

De Bach (Hymenoptera:Aphelinidae) is a primary parasitoid of the Cali-fornia red scale. The green lacewing

Chrysoperlarufilabris

Burmeister (Neuroptera: Chrysopidae),and the insidious flower bug,

Orius insidiosus

(Say) (Hemiptera: Anthocoridae), are both gener-alist predators of many small arthropods in cit-rus, including mites, aphids, psyllids and thrips.We also tested four species of ladybeetles,

Curi-nus coeruleus

Mulsant,

Cycloneda sanguinea

L.,

Harmonia axyridis

Pallas, and

Olla v-nigrum

Mulsant (Coleoptera: Coccinellidae) that are allimportant predators of homopteran citrus pests(Michaud 1999, 2002a; Michaud et al. 2002).

M

ATERIALS

AND

M

ETHODS

Adult beetles of each of the four coccinellid spe-cies were maintained in 1-L ventilated glassmason jars (~100-130/jar) filled with strips ofshredded wax paper for their first 9-12 days of lifefollowing emergence. During this period, beetleswere fed a diet of frozen eggs of

Ephestia

sp. andbee pollen with water

provided on a cotton wick.Mated adult females were transferred to individ-ual plastic Petri dishes (5.5 cm dia

×

1.0 cm) andprovisioned with

Ephestia

eggs and water encap-sulated in polymer beads. Eggs were harvesteddaily in the Petri dishes and held in an incubatorat 24°C, 60 ± 5% RH under fluorescent light (P:S-16:8) and hatched ca. 3.5 ± 0.5 days later underthese conditions. Newly hatched larvae wereplaced

in individual plastic Petri dishes (as above)and reared on

Ephestia

eggs and water beads on alaboratory bench at 24 ± 2°C, 60 ± 5% RH, withfluorescent lighting (P:S = 16:8). Larvae wereused for experiments when they were 24 ± 6 h old.

Eggs of

C. rufilabris

were obtained from Bene-ficial Insectary (Redding, CA) and held in an incu-bator at 24 ± 1°C until hatching. Larvae used inexperiments were 24 ± 6 h old.

Adult

A. melinus

were obtained from Rincon-Vitova Insectaries Inc. (Ventura, CA). Adultswere fed a diluted honey solution and used in ex-periments when they were 36-60 h old.

Newly hatched nymphs of

O. insidiosus

wereobtained from Entomos, LLC (Gainesville, FL).Nymphs were provided with frozen

Ephestia

eggsand water beads and used in experiments whenthey molted to the second instar.

Topical Sprays

The Potter Precision Spray Tower (BurkardManufacturing Co. Ltd., Rickmansworth Herts,UK) permits delivery of a standardized dose of aninsecticide at a specified concentration with a con-sistent droplet size under controlled conditions.The Potter tower has been used previously to de-termine the toxic concentrations of various con-ventional pesticides to beneficial insects in citrus(Michaud 2001, 2002b). First instars of each coc-cinellid species (n = 20) were treated directly witha 1.0-ml aqueous solution of sucrose octanoate at8000 ppm. Control larvae (n = 20) were treatedwith 1 ml of distilled water. Larvae were reared to

8


87(1) March 2004

adulthood in individual Petri dishes (as above) ona diet of frozen

Ephestia

eggs. Estimates of mor-tality incorporated all mortality through to emer-gence of adults. Data were corrected for controlmortality by Abbott’s correction (Abbott 1925)and analyzed with a Chi-square, Goodness-of-fitTest (

α

= 0.05).

Leaf Residues

Due to their high activity levels, adult parasi-toids and

Orius

nymphs were exposed to leaf resi-dues instead of topical sprays. Leaf disks werepunched from clean grapefruit leaves that hadbeen washed in a 0.5%-sodium hypochlorite solu-tion. Adaxial sides of the leaf disks (n = 25) werethen sprayed with a 1.0 ml-aqueous solution of su-crose octanoate at 8000 ppm in the Potter SprayTower; control disks (n = 25) were sprayed with 1ml distilled water. Treated leaf disks were placedin individual Petri dishes (5.0 cm dia

×

1.0 cm) andinsects were transferred individually to each dish.

Adult

A. melinus

were provided with a dropletof diluted honey on the lid of the Petri dish andmortality was assessed after 24 h. Nymphs of

O.insidiosus

were confined on the leaf disks for 24 h,removed to clean dishes, and reared to adulthoodon a diet of frozen

Ephestia

eggs and water beads.The mortality estimate for

O. insidiosus

incorpo-rates all mortality from nymph through adultstage. Data from all experiments were adjustedfor control mortality by Abbott’s correction (Ab-bott 1925) and analyzed by a Chi-Square, Good-ness-of-Fit test (

α

= 0.05).

R

ESULTS

AND

D

ISCUSSION

Treatment mortality was never significantlydifferent from control mortality for any species ofbeneficial insect in any trial (Table 1). The factthat sugar esters seem to have active toxicity only

in liquid form (Puterka & Severson 1995) mayhave influenced the results obtained for

O. insid-iosus

and

A. melinus

with leaf disk residues. Yetthese authors showed residual activity to newlyeclosed nymphs. Contact with residues is proba-bly the primary form of exposure for foraging nat-ural enemies, so the lack of activity is significant.Similarly, Stansly and Liu (1997) found low toxic-ity of natural and synthetic sugar esters to

E. per-gandiella

, an important parasitoid of thesilverleaf whitefly, and concluded that these ma-terials would be compatible with biological con-trol of

B. argentifolia

in vegetable fields.Materials demonstrating toxicity to beneficial

insects in laboratory trials warrant further testingunder field conditions before it can be concludedthey pose a risk to biological control under real-world conditions (Croft 1990). This does not appearto be the case for sucrose octanoate. These labora-tory trials demonstrate the lack of toxicity of su-crose octanoate for insects representing fourdifferent orders of beneficial insects that includemost natural enemy species important for biologi-cal control in citrus. We conclude that sucrose oc-tanoate appears to have good potential forinclusion in IPM programs designed to manage ho-mopteran pests in citrus, with a low probability ofadverse side effects on important beneficial species.

Plant chemical defenses are rarely 100% effec-tive against herbivores, so advantages accrue toplants that can spare natural enemies, or even en-courage their recruitment. The fact that sucrose oc-tanoate has contact toxicity against certainherbivorous insects and mites, but not against lar-val predators, raises interesting questions regard-ing its mode of action. Are beneficial insectsresistant to sucrose octanoate because its bindingsites on the cuticle are lacking or insensitive? If so,characterizing differences in cuticular chemistry be-tween resistant and susceptible insects may provideinsights into the mode of action of sugar esters.

T

ABLE

1. P

ERCENT

MORTALITY

OF

BENEFICIAL

INSECTS

TREATED

WITH

TOPICAL

SPRAYS

OR

24

H

EXPOSURE

TO

LEAFRESIDUES

OF

A

2%

SUCROSE

OCTANOATE

SOLUTION

(=8000

PPM

).

Insect Order: Family Beneficial species Life stage nAdjusted

mortality (%)

1

P

Topical sprays @ 2%

Coleoptera: Coccinellidae

Curinus coeruleus

1st instar larvae 20 5.3 ns

Cycloneda sanguinea

20 10.9 ns

Harmonia axyridis

20 0.0 ns

Olla v-nigrum

20 4.7 nsNeuroptera: Chrysopidae


20 0.0 ns

Leaf residue @ 2%

Hemiptera: Anthocoridae Orius insidiosus 2nd instar nymphs adults

25 0.0 nsHymenoptera: Aphelinidae Aphytis melinus 25 0.0 ns

1Values were adjusted for control mortality using Abbott’s correction (Abbott 1925).

Michaud & McKenzie: Safety of Sucrose Octanoate 9

ACKNOWLEDGMENTS

We thank Dr. Gary J. Puterka of the AppalachianFruit Research Station, USDA-ARS, Kearneysville, WVfor supplying the experimental compound and reviewingthe manuscript, Drs. R. Stuart and C.W. McCoy for addi-tional reviews, and L. Tretyak for technical support. Thiswork was supported by the Florida Agricultural Experi-ment Station and grants from the Florida Citrus Produc-ers Research Advisory Council and USDA, APHIS andapproved for publication as Journal Series No. R09154.

REFERENCES

ABBOTT, W. S. 1925. A method of computing the effective-ness of an insecticide. J. Econ. Entomol. 18: 265-267.

BUTA, J. G., W. R. LUSBY, J. W. NEAL, JR., R. M. WA-TERS, AND G. W. PITTARELLI. 1993. Sucrose estersfrom Nicotiana gossei active against greenhousewhitefly, Trialeurodes vaporariorum. Phytochem.22: 859-864.

CHORTYK, O. T., J. G. POMONIS, AND A. W. JOHNSON.1996. Synthesis and characterizations of insecticidalsucrose esters. J. Agric. Food Chem. 44: 1551-1557.

CROFT, B. A. 1990. Arthropod biological control agentsand pesticides. John Wiley & Sons, New York. 723 pp.

HAWTHORNE, D. J., J. A. SHAPIRO, W. M. TINGEY, ANDM. A. MUTSCHLER. 1992. Trichome-borne and artifi-cially applied acylsugars of wild tomato deter feed-ing and oviposition of the leafminer Liriomyzatrifolii. Entomol. Exp. Appl. 65: 65-73.

LIU, T-X., AND P. A. STANSLY. 1995. Toxicity and repel-lency of some biorational insecticides to Bemisia ar-gentifolii on tomato plants. Entomol. Exp. Appl. 74:137-143.

LIU, T-X., P. A. STANSLY, AND O. T. CHORTYK. 1996. In-secticidal activity of natural and synthetic sugar estersagainst Bemesia argentifolii (Homoptera: Alyrodidae).J. Econ. Entomol. 89: 1233-1239.

MCKENZIE, C. L., AND G. J. PUTERKA. 2000. Activity ofsugar esters to Asiatic citrus psyllid (AsCP). Pro-ceedings of the International Society of Citriculture,Congress-2000, December 3-7, Orlando, FL.

MICHAUD, J. P. 1999. Sources of mortality in colonies ofthe brown citrus aphid, Toxoptera citricida. Biocon-trol 44: 347-367.

MICHAUD, J. P. 2001. Relative toxicity of six insecticidesto Cycloneda sanguinea and Harmonia axyridis (Co-leoptera: Coccinellidae). J. Entomol. Sci. 37: 83-93.

MICHAUD, J. P. 2002a. Biological control of Asian citruspsyllid in Florida: A preliminary report. Entomol.News 113: 216-222.

MICHAUD, J. P. 2002b. Non-target impacts of acaricideson ladybeetles in citrus: A laboratory study. FloridaEntomol. 85: 191-196.

MICHAUD, J. P., C. C. MCCOY, AND S. FUTCH. 2002. La-dybeetles as biological control agents in citrus. Cit-rus Industry 83 (3): 24-27.

NEAL, J. W., JR., J. G. BUTA, G. W. PITTARELLI, W. R.LUSBY, AND J. A. BENZ. 1994. Novel sucrose estersfrom Nicotiana gossei: Effective biorationals againstselected horticultural insect pests. J. Econ. Entomol.87: 1600-1607.

PARR, J. C., AND R. THURSTON. 1968. Toxicity of Nicoti-ana and Petunia species to larvae of the tobaccohornworm. J. Econ. Entomol. 61: 1525-1531.

PITTARELLI, G. W., J. G. BUTA, J. W. NEAL, JR., W. R.LUSBY, AND R. M. WATERS. 1993. Biological pesticidederived from Nicotiana Plants. U.S. Patent No.5,260,281.

PUTERKA, G. J., AND R. F. SEVERSON. 1995. Activity ofSugar esters isolated from the trichomes of Nicoti-ana gossei to pear psylla (Homoptera: Psyllidae). J.Econ. Entomol. 88: 615-619.

PUTERKA, G. J., W. FARONE, T. PALMER, AND A. BAR-RINGTON. 2003. Structure-function relationships af-fecting the insecticidal and miticidal activities ofsugar esters. J. Econ. Entomol. 96: 636-644.

STANSLY, P. A., AND T. X. LIU. 1997. Selectivity of insec-ticides to Encarsia pergandiella (Hymenoptera:Aphelinidae), an endoparasitoid of Bemisi argenti-folii (Hemiptera: Aleyrodidae). Bull. Entom. Res. 87:525-531.

THURSTON, R., AND J. A. WEBSTER. 1962. Toxicity of Nic-otiana gossei Domin to Myzus persicae (Sulzer). En-tomol. Exp. Appl. 5: 233-238.

10


87(1) March 2004

PHYLLOCNISTIS CITRELLA

(LEPIDOPTERA: GRACILLARIIDAE)AND ITS PARASITOIDS IN CITRUS IN ECUADOR

E

RNESTO

C

AÑARTE

B

ERMÚDEZ

1

, N

ÉSTOR

B

AUTISTA

M

ARTÍNEZ

2

, J

ORGE

V

ERA

G

RAZIANO

2

,H

UGO

C

ÉSAR

A

RREDONDO

B

ERNAL

3

,

AND

A

NTONIO

H

UERTA

P

ANIAGUA

2

1

Instituto Nacional Autónomo de Investigación Agropecuaria, Casilla postal 100Estación Experimental Portoviejo. Portoviejo-Ecuador

2

Instituto de Fitosanidad. Colegio de Postgraduados. Montecillo, Texcoco, México 56230

3

Centro Nacional de Referencia de Control Biológico. Km 1.5 Carr. Tecomán-Estación FFCC. Tecomán, Col. 28120

A

BSTRACT

The objectives of this study were to determine the population fluctuations of the citrus leaf-miner,

Phyllocnistis citrella

, and its parasitoids in three locations of Ecuador, to identify anddetermine the geographic distribution of

P. citrella

parasitoids within Ecuador, and to estab-lish which of eleven citrus species supported higher numbers of

P. citrella

and its parasi-toids. The highest population density of

P. citrella

occurred during the dry season. Thehighest infestations in three localities were in Lodana (43.8%) in October, in Riochico(45.7%) in November, and in La Unión (17.3%) in December. The greatest percentages of par-asitism occurred in Lodana in March (60%), in

Riochico in January (18.9%), and La Uniónin December (50%). The species

Ageniaspis citricola

Logvinovskaya,

Galeopsomyia

sp., and

Elasmus tischeriae

Howard were identified with 28.4, 2.2, and 0.07% parasitism, respec-tively. Although this is the first report of

A. citricola

in Ecuador, it is widely distributed in themain citrus producing zones of the country. Orange and grapefruit yielded higher numbersof citrus leafminers and their natural enemies than other citrus species.

Key Words: citrus leafminer,


, Gracillariidae, biological control

R

ESUMEN

Se determinó el porcentaje de infestación de el minador de hoja de los cítricos,

Phyllocnistiscitrella

y, sus parasitoides; se identificó y documentó la distribución geográfica de los para-sitoides de

P. citrella

y se estableció la preferencia de

P. citrella

y sus parasitoides a once es-pecies de cítricos. La mayor densidad poblacional de

P. citrella

se presentó durante la épocaseca, observándose en Lodana la infestación más alta en octubre con 43.8%; en Riochico ennoviembre (45.7%) y en La unión en diciembre con 17.4%. El parasitismo se presentó conmayor intensidad en Lodana en marzo con 60%, en Riochico en enero (18.9%) y La Unión con50% en diciembre. Se identificaron las especies


Logvinovskaya,

Galeop-somyia

sp. y

Elasmus tischeriae

con 28.4. 2.2 y 0.07% de parasitismo, respectivamente.Siendo este el primer reporte de

A. citricola

en Ecuador, ampliamente distribuido en lasprincipales zonas citrícolas del país. Se denota cierta preferencia de

P. citrella

y sus parasi-toides hacia las especies de naranja y pomelos.


The citrus leafminer (CLM),

Phyllocnistis cit-rella

Stainton, is a pest of plants in the Rutaceaefamily. CLM mine leaves, surface tissue of youngshoots and stems, and less frequently the fruit(Sponagel & Díaz 1994). The lamina of minedleaves dries and rolls, reducing leaf area and re-ducing photosynthetic activity of the plant.

CLM is native of Asia (Knapp et al. 1995). Today,it is found in nearly all citrus-growing regions ofthe world. In America it was reported for the firsttime in 1993 in Florida, U.S.A. (Heppner 1993), andlater in different regions of the U.S.A. In Ecuador, itwas reported in 1995 in the province of Manabí (IN-IAP 1995, 1996; Valarezo & Cañarte 1997). In a pe-riod of six months CLM invaded almost the entire

Ecuadorian coast and later the interior regions. In-festations of 97.14% were observed in Manabí, andit was estimated that numbers of fruits of West In-dies lime, (

Citrus aurantifolia

(Christmann) Swin-gle) decreased up to 45% and yield decreased 48%(Valarezo & Cañarte 1998).

Several different insecticides are used againstthis pest, but these may involve undesirable ef-fects on the environment, including interferencein control of the pest by natural enemies (Guerraet al. 1997). Biological control is the best optionfor controlling this pest (Peña 1997).

In many areas a reduction in the pest popula-tion has been observed because of the presence ofa diversity of natural enemies. However, activity of

Bermudez et al.: Parasitoids of


11

these natural enemies is variable and their valueas a factor in the regulation of CLM populationsdiffers in different geographical areas. This makesit necessary to determine the effect of climate andnatural enemies on populations of the pest to es-tablish their real value as CLM regulators.

Thirty-nine species of Hymenoptera have beenobserved attacking CLM in its native area (Hepp-ner 1993). Most of them are Eulophidae, but alsoEncyrtidae, Elasmidae, Eurytomidae and Ptero-malidae have been reported. In America, sevenparasitoids have been reported in Honduras,seven species in Colombia, the same number inCuba (González et al. 1995), and eight specieshave been reported each in Florida and Mexico(Perales et al. 1997).

The objectives of this study were to determinethe population fluctuations of

P. citrella

and itsparasitoids in three locations of Ecuador, to iden-tify and determine the geographic distribution of

P. citrella

parasitoids within Ecuador, and to es-tablish which of eleven citrus species

P. citrella

and its parasitoids prefer.

M

ATERIALS

AND

M

ETHODS


and parasitoid popula-tion fluctuations were determined from Septem-ber 2000 to March 2001 in Lodana, Riochico, andLa Unión in the province of Manabí, Ecuador.Each location represents a different type of man-agement system. In Lodana, leaves infested withCLM were collected every 10 days in a four-hect-are West Indies lime orchard in which only neem(aqueous extract and oil) was applied. In Rio-chico, leaves were collected weekly in a 12-hect-are West Indies lime orchard in which syntheticorganic pesticides were used. In La Unión, leafcollection was done every 15 days in a five-hect-are coffee (

Coffea arabica

L.) plantation in whichsweet orange (

C. sinensis

(L.) Osbeck) and man-darin orange (

C. reticulata

Blanco), were plantedat 50-80 trees/ha. For the samples, mandarin or-ange trees were selected. In this system no pesti-cides were applied.

Percent infestation of CLM in the three siteswas determined by selecting 10 trees and collect-ing from them 60 lime shoots in Lodana, 20 inRiochico and 20 in La Unión. These shoots wereno larger than 20 cm. Total number of leaves andmined leaves were counted on each shoot, and thepercentage of infestation was calculated.

For percent parasitism of CLM, 50 leaves werecollected from 10 trees (five leaves per tree) ineach location. The leaves from the middle andlower thirds of the trees were selected from devel-oped shoots (15 to 20 cm) with third instars andpupal chambers of CLM.

The evaluations of emergence of CLM or its par-asitoids were carried out daily for 22 days. Leaveswere checked to record parasitoids that did not

emerge due to the effect of management, prema-ture drying of leaves, or abiotic factors. The recov-ered parasitoid pupae were confined in trays withmoistened cotton until emergence of the adults.

For the geographic distribution of the parasi-toids of

P. citrella

in Ecuador, collections weredone in 38 sites of 18 municipalities of the prov-inces of Manibí, Guayas, and Los Ríos (coastal re-gion), Loja and Azuay (mountain region), and theNapo province (eastern region) (Fig. 1).

In each of the 38 sites, 100 leaves with CLMthird instars or pupal chambers were collectedonce. The leaves were placed in transparent plas-tic bags 30.4

×

25.2 cm lined with absorbent paperto maintain the moisture necessary for the miner,or its parasitoids, to emerge. Twenty-five leaveswere placed in each bag; bags were inflated,sealed with rubber bands, and hung with cords in-side the greenhouse until the parasitoids were re-covered. The parasitoids were identified with thekeys of Schauff and La Salle (1996).

To determine the preference of

P. citrella

andits parasitoids for different species of citrus, 11species of the national collection of citrus at thePortoviejo Experimental Station were evaluated.For each sample, 20 shoots per citrus species andaround 100 leaves with CLM third instars andpupal chambers were collected; these data wereused to calculate the percentage of parasitism.

R

ESULTS

AND

D

ISCUSSION

Percent Infestation of

P. citrella

and its Parasitoids

On 6881 leaves examined, it was observed thatin Lodana in October, December, and February,

Fig. 1. Municipalities where collections were done todetermine the presence of P. citrella parasitoids in Ec-uador, 2000.

12


87(1) March 2004

there were slightly higher percentages of infesta-tion than on other dates (43.8%, 30.4%, and38.5%, respectively). During these months therewere periods when sprouting was 100% (Fig. 2),coinciding with the months of greatest

P. citrella

infestation. Similar results were found by Curt-Díaz et al. (1998) and Valarezo and Cañarte(1997). Parasitism of 58.7% was found in Novem-ber, 53% in February, and 60% in March.

In Riochico, the highest values of infestation(45.7%, 40.8%, and 45.5%, respectively) were ob-served in September, October, and November.Flushing was quite uniform and not higher than50% in any month. Flushing in the dry months ofSeptember, October, and November was 49.4%,49.2%, and 47.2%, respectively, i.e., slightly high,while in the rainy season, (January to March)flushing decreased (Fig. 3). This reduction influshing and infestation in the citrus of this loca-tion during the rainy season is possibly associ-ated with the fact that during this period ofprecipitation diseases such as anthracnose(

Gloeosporium limetticola

R. E. Clausen) appear.These diseases cause shriveling of almost all ofthe tender shoots, or deform the tissue, interrupt-ing normal development of the insect. As a result,the percentages of these variables fall substan-tially, and more so when growers do not use anytype of control against the disease. This is consis-tent with the results of studies done by Roblesand Medina (1997).

Parasitism was low, possibly due to the grow-ers’ frequent applications of pesticides. The high-est percentage of parasitism, 18.9%, was observed

in January. This is compatible with observationsof Nuñez and Canales (1999) and Probst et al.(1999), in terms of the lower values of parasitismwhen insecticides are applied frequently.

In La Unión, in spite of the high increase insprouting, no increase was observed in CLM fromJanuary to March; in fact, there was a decrease inpopulation density, with the highest value inDecember with infestation of 17.4%. During thedry months, September to December, constantsprouting of about 25% was observed in the cit-rus. With the rainy season (January), sproutingintensity increased significantly, reaching 75% inFebruary and 100% in March of the same year(Fig. 4). This is due to the fact that the citrus treesare grown in association with coffee, and physio-logically have only one major sprouting period peryear, which is activated with the first rainfalls inJanuary. In December there was greater parasit-ism (50%), coinciding with the date of greatest in-festation by CLM.

The low CLM population densities are possiblydue to the combined action of biological regula-tors that exert natural control of the pest underthis system of production (Mendoza 1995;Castaño 1996; Valarezo & Cañarte 1998; Nuñez yCanales 1999). It is clear that the action of bene-ficial organisms is favored by the fact that in thisregion no pest control measures are carried out inthe coffee-citrus plantations.

Comparing the means, it can be seen that par-asitism is different among the locations. Thehighest was in Lodana (47.6%), followed by LaUnión (25.7%), and Riochico (11.6%). Pesticide

Fig. 2. Percent infestation of P. citrella and its parasitoids, and sprouting in lime in Lodana Ecuador. 2000-2001.



13

applications were different in each location. InLodana, during the 2000-2001 period, insecticide(cypermethrin) was applied only once. In Rio-chico, insecticides were applied every two weeksor monthly, using diverse synthetic organic insec-

ticides, natural substances, and mineral oils, con-taining at least 10 different active ingredients. InLa Unión, no control measures were carried out.This suggests that pest management methodsmay influence the percentage of parasitism.

Fig. 3. Percent infestation of P. citrella and its parasitoids and sprouting in lime in Riochico, Ecuador. 2000-2001.

Fig. 4. Percent infestation of P. citrella and its parasitoids, and sprouting in mandarin orange in La Unión, Ec-uador. 2000-2001.

14


87(1) March 2004

It is assumed that the parasitoid

Ageniaspiscitricola

Logvinovskaya arrived in Ecuador fromPeru, where it was introduced in 1996 as part of anational program of classical biological control ofCLM. Most of the parasitoids were released in Pe-ruvian citrus-producing zones, including the bor-der towns of Tumbes and Piura. Rates ofparasitism here reached 98% (Nuñez & Canales1999). Based on the presence of

P. citrella

in the18 municipalities near the border (Fig. 1), a possi-ble route of entry of the parasitoid was throughthe border province of Loja (Ecuador), and it ad-vanced northwards through Azuay, Guayas,Manabí, Los Rios, and finally Napo.

Geographic Distribution of Parasitoid Speciesof

P. citrella

in Ecuador

A total of 4388 leaves infested with CLM wereanalyzed to determine the presence of parasitoidsin the coastal, mountain and eastern regions. Thefollowing species were identified:

Ageniaspis citri-cola

(Hymenoptera: Encyrtidae),

Galeopsomyia

sp. (Hymenoptera: Eulophidae), and

Elasmus tis-

cheriae

Howard (Hymenoptera: Elasmidae). Thelatter two also were reported in Colombia(Castaño 1996). The predominant species was

A. citricola

(Table 1). As this is the first record ofthis parasitoid in Ecuador, its discovery has im-portant implication for the country’s citrus pro-duction. Parasitism observed for this parasitoidvaried between 13.3% and 79.3%. It is importantto note the presence of

A. citricola

in the easternregion; since between the coast and this regionthere is a natural barrier, viz, the Andes Moun-tains. Movement of plant material apparentlyspreads the pest.


is a highly effective para-sitoid of

P. citrella

, achieving 28.4% mean parasit-ism throughout Ecuador, while in one of the zones79.3% of the leafminers were parasitized by thisspecies (Table 1). Rates of parasitism of

P. citrella

have been reported as 80% in Florida, U.S.A. (Me-dina et al. 1997), and 100% in Australia (Peña1997). In Ecuador,

A. citricola

is the predominantspecies, relative to other species, which had lowincidences. Valarezo and Cañarte (1998) reportedthat in Ecuador

Elasmus

sp. was the most widely

T

ABLE

1. G

EOGRAPHIC

DISTRIBUTION

OF

PARASITOIDS

OF

P

HYLLOCNISTIS

CITRELLA

IN

E

CUADOR

AND

PERCENTAGE

OFPARASITISM

.

Province/MunicipalityLeaves

analyzed

% parasitismTotal

parasitism

A. citricola Galeopsomyia sp. E. tischeriae

Manibí Province (coastal region)Portoviejo 1825 18.31 2.45 0.09 20.85Santa Ana 715 45.97 6.48 0.00 52.45Jipijapa 490 18.08 3.15 0.00 21.23Pichincha 187 29.56 0.87 0.00 30.43Chone 154 27.89 0.53 0.00 28.42Pajan 139 35.88 1.18 0.00 37.06Junín 110 13.34 2.96 0.00 16.30Flavio Alfaro 97 13.33 0.00 0.00 13.33Olmedo 86 20.95 0.00 0.00 20.95Bolívar 83 28.43 0.00 0.98 29.4124 de Mayo 82 50.00 0.00 0.00 50.00Sucre 70 79.31 6.90 0.00 86.21

Guayas Province (coastal region)Municipio Guayaquil 76 25.81 0.00 0.00 25.81

Los Ríos Province (coastal region)Quevedo 81 14.00 2.00 0.00 16.00Buena Fé 85 17.14 2.86 0.00 20.00

Loja Province (mountain region)Municipio Malacatos 5 — — — —

Azuay Province (mountain region)Santa Isabel 5 — — — —

Napo Province (Eastern region)Coca 98 16.67 5.00 0.00 21.67Mean 28.42 2.15 0.07 30.63



15

distributed species, followed by

Horismenus andGaleopsomyia, which are present in five, four andtwo of the nine municipalities studied, respec-tively. Table 2 presents the developmental stagesthat are attacked by the parasitoids.

The success of A. citricola as a parasitoid ofP. citrella can be explained by its specific and gre-garious character, which makes it more efficient(Hoy & Nguyen 1994), and more competitive(Nuñez & Canales 1999), compared with the na-tive generalist species. Native parasitoids surviveon alternate hosts, such as leafminers of othercultivated plants or weeds, as in the case of Leu-coptera coffella Guerin in coffee (Mendoza 1995;Bautista et al. 1997; Bautista et al. 1998; Valar-ezo & Cañarte 1998). This characteristic wouldexplain the fact that, during this study, only twoof the 11 species that had been reported up to1998 were found (INIAP 1996a; Valarezo &Cañarte 1998).

Since, from the beginning of the study, the pre-dominance of A. citricola in Londana, Ríochico,and La Unión, Manibí, was evident, the numberof parasitoids present in each CLM pupa chamberwas quantified. On 2503 infested leaves, it wasdetermined that 69.3% of the chambers had threepupae of A. citricola, 23.14% had two pupae, and7.6% had one, four or five pupae. Occasionally, upto six pupae of A. citricola per CLM chamber wereobserved, still within the range reported byNuñez and Canales (1999), who found betweentwo and nine pupae arranged like “sausages.”

Preferences of P. citrella and its Parasitoids for Eleven Citrus Species

Between 50% and 75% of the plants in the Na-tional Citrus Collection at the time of evaluationwere flushing. Infestation data seem to denote acertain preference of CLM for some species andvarieties. It can be seen in Table 3 that Washing-ton navel oranges (naranja ‘Washington navel’),and red and white grapefruit (pomelo ‘rojo’ y‘blanco’) have slightly higher rates of infestation(37.4%, 35.1%, and 33.1%, respectively). Severalauthors have mentioned a differential behavior ofCLM toward certain species of citrus. In this re-gard, González et al. (1995) report that navel or-anges are more susceptible than other types ofcitrus. This greater susceptibility of some variet-ies also could be related to leaf size (Zhang et al.1994) as well as to their thickness and consis-tency (Latif & Yunnes 1951). Singh and Azam(1986) contend that miners prefer more succulentleaves with a thin cuticle. In this study, the differ-ence in parasitism among the species wasmarked, with very high percentages of A. citricola(74.2%) in white grapefruit, compared with thelow percentages in “tangor” and “chonera” man-darin orange with only 2.6 and 4.4% parasitism,respectively (Table 3).

CONCLUSIONS

1. The highest percent infestation of P. citrellaoccurred during the dry season. The highest

TABLE 2. SPECIES OF PARASITOIDS OF P. CITRELLA AND THE DEVELOPMENTAL STAGES THEY ATTACK.

Parasitoid Biological stage attacked

Ageniaspis citricola Logvinovskaya Eggs, larva IGaleopsomyia sp1 Girault Larva II, III, prepupa and pupaElasmus tischeriae Howard Larva II, III and pupa

TABLE 3. INFESTATION AND NATURAL BIOLOGICAL CONTROL BY PHYLLOCNISTIS CITRELLA IN ELEVEN CITRUS SPECIESIN MANABÍ, ECUADOR.

Species Common name Flushing (%) Infestation (%) Parasitism (%)

C. aurantium Naranja agria 50 14.37 21.43C. reticulata Mandarina Cleopatra 75 23.87 7.22

Tangor 50 26.31 2.63C. reticulata Mandarina chonera 50 27.06 4.44C. grandis Toronja 50 27.56 45.45C. sinensis Naranja valencia 75 29.89 53.57C. aurantifolia Limón sutil 75 30.61 40.91C. reticulata × C. paradisi Tangüelo 50 32.76 13.51C. paradisi Pomelo blanco 75 33.07 74.19C. paradisi Pomelo rojo 50 35.10 52.83C.sinensis Naranja Wston. navel 50 37.43 56.38


infestations in three localities were as follows:in Lodana (43.8%) in October, in Riochico(45.7%) in November, and in La Unión (17.4%)in December.

2. The greatest intensity of parasitism occurredin Lodana in March (60%), in Riochico in Jan-uary (18.9%), and in La Unión in December(50%).

3. The species A. citricola, Galeopsomyia sp.,and E. tischeriae were identified at 28.4%,2.2%, and 0.1% parasitism, respectively. Al-though this is the first report of A. citricola inEcuador, it is widely distributed in the maincitrus producing zones of the country.

4. A preference of P. citrella for varieties of or-ange and grapefruit over other citrus typeswas noted. The most preferred was Washing-ton navel oranges.

ACKNOWLEDGMENTS

The authors thank the Ministry of Agriculture andLivestock of Ecuador and the Executive Unit of Compet-itive Funds of the Program of Modernization of Agricul-tural Services (PROMSA) and World Bank for theirfinancial support of this work. Also, we thank the au-thorities of the National Autonomous Institute of Agri-cultural Research (INIAP-Ecuador) for the technicalfacilities they made available in the development of thisstudy.

REFERENCES CITED

BAUTISTA M. N., J. L. CARRILLO, AND H. BRAVO. 1997.Enemigos naturales y uso del nim (Azadirachta in-dica A. Juss) para el control del minador de la hojade los cítricos (Phyllocnistis citrella Stainton) (Lepi-doptera: Gracillariidae) en el estado de Veracruz InSimposium Internacional de Control Biológico delMinador de la Hoja de los Cítricos (Memorias) Guad-alajara, México. 1997. SAGAR, 33 p.

BAUTISTA, N., O. MORALES, J. CARRILLO, AND H BRAVO.1998. Mortalidad de Phyllocnistis citrella con unaceite mineral y nim. Revista de Manejo Integradode Plagas. Costa Rica. No. 50 1998. p. 29-33.

CASTAÑO, O. P. 1996. El minador de la hoja de los cítri-cos (Phyllocnistis citrella, Stainton) In XXII Con-greso Sociedad Colombiana de Entomología.Cartagena de Indias. Julio 17 a 19 de 1996 (Memo-rias). Universidad de Caldas. Facultad de CienciasAgropecuarias p. 9-23.

CURTI-DÍAZ, S.; U. DÍAZ-ZORRILLA, J. LOREDO-ZALAZAR,R. SANDOVAL, L. PASTRANA-APONTE, AND C. RO-DRÍGUEZ-CUEVAS. 1998. Manual de Producción deNaranja para Veracruz y Tabasco. Libro Técnico. No.2. CIRGOC. INIFAP. SAGAR. México. 175 p.

GONZÁLEZ, C., M. BORGES, A. CASTELLANOS, N.GONZÁLEZ, L. VÁZQUEZ, AND M. GARCIA. 1995. Phyl-locnistis citrella Stainton. Minador de la hoja de loscítricos. In II Taller Nacional sobre el Minador de Hojade los Cítricos Phyllocnistis citrella Stainton. Institutode Investigaciones de Cítricos, La Habana, Cuba. 35 p.

GUERRA, L., J. MARTÍNEZ, D. MARTÍNEZ, F. GONZÁLEZ,R. MONTERO, H. QUIROZ, J. SÁNCHEZ, V. RODRÍGUEZ,AND M. BADII. 1997. Biología y control del minador

de la hoja de los cítricos Phyllocnistis citrella Stain-ton (Lepidoptera: Gracillariidae), en el Estado deNuevo León. Facultad de Ciencias Biológicas;UANL; INIFAP-SAGAR, México. 4 p.

HEPPNER, J. B. 1993. Citrus leafminer Phyllocnistis cit-rella in Florida (Lepidoptera: Gracillariidae: Phyl-locnituinae). Tropical Lepidoptera 4(1): 49-64.

HOY, M., AND R. NGUYEN. 1994. Control clásico del mi-nador de la hoja de los cítricos en la Florida. CitrusIndustry. p. 22-25.

HOY, M., AND R. NGUYEN. 1996. Departamento Nacio-nal de Protección Vegetal. Sección Entomología. Est-ación Experimental Portoviejo. Informe AnualTécnico. Ecuador. 69 p.

HOY, M., AND R. NGUYEN. 1996a. Departamento Nacio-nal de Protección Vegetal. Sección Entomología. Es-tación Experimental Tropical Pichilingue. InformeAnual Técnico. Ecuador. 56 p.

INSTITUTO NACIONAL AUTÓNOMO DE INVESTIGACIONESAGROPECUARIAS (INIAP). 1995. Departamento Na-cional de Protección Vegetal. Sección Entomología.Estación Experimental Portoviejo. Informe AnualTécnico. Ecuador. 81 p.

KNAPP, J., L. G. ALBRIGO, H. W. BROWNING, R. C. BUL-LOCK, J. B. HEPPNER, D. G. HALL, M. A. HOY, P.NGUYEN, J. E. PEÑA, AND P. A. STANSLY. 1995. Cit-rus leafminer Phyllocnistis citrella Stainton. A newpest of Florida citrus. In Citrus leafminer workshop.Florida Cooperative Extension Service. Institute ofFood and Agriculture Sciences. University of FloridaGainesville. 26 p.

LATIF, A., AND C. YUNNES. 1951. Food-plants of citrusleaf-miner (Phyllocnistis citrella Stainton) in thePunjab. Bull Ent. Res. 42: 311-316.

MEDINA, V., M. ROBLES, AND H. ARREDONDO. 1997.Manejo integrado del minador de la hoja en limónmexicano, avances preliminares. In Simposium In-ternacional Control Biológico del Minador de la Hojade los Cítricos (Memorias). Guadalajara. México. 33p.

MENDOZA, J. 1995. El minador de la hoja del café Perile-ucoptera coffeella y su control. INIAP, EET Pichil-ingue. Ecuador. 17 p.

NUÑEZ, E., AND A. CANALES. 1999. Ageniaspis citricola.Controlador del minador de la hoja de los cítricos.Experiencia Peruana. Servicio Nacional de SanidadAgraria. Perú. 87 p.

PEÑA, J. E. 1997. Estado actual del control biológico delminador de la hoja de los cítricos Phyllocnistis cit-rella Stainton. University of Florida. Tropical Re-search and Education Center. Homestead, FL. 6 p.

PERALES, M., H. ARREDONDO, E. GARZA, AND C. DÍAZ.1997. Control biológico del minador de la hoja de loscítricos en Colima. In Simposium Internacional.Control biológico del minador de la hoja de los cítri-cos (Memoria). Guadalajara, México. 1997. SAGAR.33 p.

PROBST, K., L. PULSCHEN, J. SAVERBORN, AND C. ZE-BITZ. 1999. Influencia de varios regímenes de uso deplaguicidas sobre la entomofauna del cultivo de to-mate en las tierras altas del Ecuador. RevistaManejo Integrado de Plagas. Costa Rica. No. 54.p. 53-62.

ROBLES, M., AND V. MEDINA. 1997. Fluctuación del dañodel minador de la hoja de los cítricos en limón mexi-cano. In: Simposium Internacional Control Biológicodel Minador de la Hoja de los Cítricos (Memorias).Guadalajara, México. 33 p.

Bermudez et al.: Parasitoids of Phyllocnistis citrella 17

SCHAUFF, E. M., AND J. LASALLE. 1996. Citrus leafminerparasitoids identification. Workshop IdentificationManual. Systematic Entomology Laboratory. USDA,National Museum of Natural History. NHB 168,Washington, D.C. 20560. USA. 28 p.

SINGH, J. V., AND K. M. AZAM. 1986. Seasonal Phylloc-nistis citrella Stainton occurrence population dy-namics leafminer. In Andhra Pradesh. IndianJournal Ent. 48 (1): 38-42.

SPONAGEL, K. W., AND F. J. DÍAZ. 1994. El minador de lahoja de los cítricos Phyllocnistis citrella. Un insectoplaga de importancia económica en la citricultura de

Honduras. La Lima Cortes. 1994. Fundación Hon-dureña de Investigación Agrícola. FHIA. pp. 1-31.

VALAREZO, O., AND E. CAÑARTE. 1997. El minador de lahoja, nueva plaga de los cítricos Phyllocnistis citrellaen Ecuador. IICA-CreA-PROCIANDINO-INIAP(plegable).

VALAREZO, O., AND E. CAÑARTE. 1998. El minador de lahoja de los cítricos Phyllocnistis citrella en el litoralecuatoriano. INIAP-COSUDE. 68 p.

ZHANG, A., C. LEARY, AND W. QUARLES. 1994. IPM forcitrus leafminer Practioner (In Chinese) 16(8): 10-13.

18


87(1) March 2004

HIGH-FIDELITY PCR ASSAY DISCRIMINATES BETWEENIMMATURE

LIPOLEXIS OREGMAE

AND

LYSIPHLEBUS TESTACEIPES

(HYMENOPTERA: APHIDIIDAE) WITHIN THEIR APHID HOSTS

A

NAND

B. P

ERSAD

, A

YYAMPERUMAL

J

EYAPRAKASH

AND

M

ARJORIE

A. H

OY

Department of Entomology and Nematology, University of Florida, Gainesville, FL 32611

A

BSTRACT

Species-specific molecular markers were developed to identify and distinguish between twoparasitoids of the brown citrus aphid,

Toxoptera citricida

Kirkaldy, in Florida. PCR primerswere developed for

Lysiphlebus testaceipes

Cresson and

Lipolexis oregmae

Gahan (=

scutel-laris

Mackauer) with DNA sequences from the internal transcribed spacer (ITS) region be-tween the 5.8S and 28S nuclear rRNA genes. With High-fidelity PCR, the

L. testaceipes

-specific primer produced a 520-bp band while that of

L. oregmae

resulted in a 270-bp band.Eggs of both parasitoids within their aphid hosts could be detected by 6 h after oviposition,but 100% detection rates only occurred after 24 h. A sensitivity analysis indicated that a par-asitoid egg within a single aphid could be detected 100% of the time when combined withDNA from up to 36 unparasitized aphids. A single first instar parasitoid could be detectedby High-fidelity PCR when the parasitized aphid was combined with up to 500 unparasitizedaphids, indicating a high level of sensitivity. Species-specific primers detected both imma-ture parasitoid species within aphids commonly found in citrus in Florida, including

Aphiscraccivora

Koch,

Aphis gossypii

Glover,

Aphis spiraecola

Patch,

Toxoptera aurantii

Boyerand

T. citricida

. This High-fidelity PCR assay provides an efficient method to monitor estab-lishment of

L. oregmae

in citrus groves in this classical biological control program in Florida.

Key Words:

High-fidelity PCR,

Toxoptera citricida, Lysiphlebus testaceipes

,

Lipolexis oreg-mae

, citrus

R

ESUMEN

Los marcadores moleculares específicos de las especies fueron desarrollados para identificar ydistinguir entre dos parasitoides del áfido pardo de los cítricos,

Toxoptera citricida

Kirkaldy, enla Florida. Se desarrollaron cebadores (= primers) de PCR para


Cres-son y

Lipolexis oregmae

Gahan (=

scutellaris

Mackauer) usando secuencias de ADN de la re-gión del separador transcrito interna (STI) entre los genes 5.8S y 28S del rARN nuclear.Usando PCR de Alta-fidelidad, el cebador específico de

L. testaceipes

produjo una banda de520-bp (pares de bases) mientras que el de

L. oregmae

resultó en una banda de 270-bp. Loshuevos de ambos parasitoides dentro de sus hospederos áfidos pudieron ser detectados a los 6horas después de la oviposición, pero una tasa de 100% de detección solamente ocurrio despuésde 24 horas. Un analísis de sensibilidad indicó que un huevo del parasitoide dentro de un soloáfido podian ser detectado 100% de las veces cuando fué combinado con ADN de hasta con 36áfidos no parasitados. Un solo parasitoide en la primera estadia podia ser detectado por el PCRde Alta-fidelidad cuando el áfido parasitado fué combinado con hasta 500 áfidos no parasita-dos, indicando un alto nivel de sensibilidad. Los cebadores específicos de las especies detecta-ron ambas especies de parasitoides inmaduros dentro los áfidos encontrados frecuentementeen los cítricos en la Florida, incluyendo

Aphis craccivora

Koch,

Aphis gossypii

Glover,

Aphisspiraecola

Patch,

Toxoptera aurantii

Boyer y

T. citricida

. Este ensayo de PCR de Alta-fidelidadprovee un método eficaz para realizar un monitoreo del establecimiento de

L. oregmae

en los

huertos de cítricos en este programa de control biológico clasico en la Florida.

The brown citrus aphid,

Toxoptera citricida

Kirkaldy (Homoptera: Aphididae), currently oc-curs throughout Florida and is a threat to citrusbecause it is the most efficient aphid vector of cit-rus tristeza virus. In an effort to control

T. citri-cida

, the parasitoid

Lipolexis oregmae

(Gahan)(=

scutellaris

Mackauer, Miller et al. [2002])(Hymenoptera: Aphidiidae) was imported, massreared and released in a classical biological con-trol program (Hoy & Nuygen 2000). Another aphi-diid,


Cresson, is abundantin citrus groves and also parasitizes

T. citricida

.

Sampling for

L. oregmae

is difficult becausemummified

T. citricida

containing

L. oregmae

arefound off the citrus plant (Hill & Hoy 2003). Themajority of mummies of

T. citricida

containing

L. testaceipes

also may occur off citrus foliage(Persad & Hoy 2003a). Thus, collection of

T. citri-cida

on foliage before mummification has oc-curred is necessary to monitor for establishmentand abundance of

L. oregmae

.To determine if

L. oregmae

has established,aphids on foliage were collected in citrus grovesand held in air-inflated plastic bags in the labora-

Persad et al.: High-fidelity PCR Assay for Immature Aphid Parasitoids 19

tory for 7-9 d so that adult parasitoids couldemerge. With this technique, adults of

L. oregmae

and

L. testaceipes

emerged from field-collectedsamples taken from citrus groves throughout Flor-ida. However, because mortality of immature par-asitoids may occur under these conditions due tomold, it is likely that the abundance of

L. oregmae

is underestimated, resulting in loss of critical data.Dissections and microscopic examinations of

immature parasitoids of both species revealedthat they are similar in appearance after the firstinstar (Persad & Hoy, unpublished data) and,thus, morphology is not adequate to resolve theidentity of immature parasitoids within field-col-lected aphids.

To resolve these problems, we developed andevaluated a molecular assay to detect immature

L. testaceipes

and

L. oregmae

within

T. citricida

and other aphid hosts found on citrus in Florida.

M

ATERIALS

AND

M

ETHODS

Cultures

Cultures of

T. citricida

and

L. oregmae

weremaintained on potted citrus in 63

×

63

×

63 cmmesh cages in the laboratory at 22-24°C and 55-65% RH and 16 L: 8 D as described by Hill & Hoy(2003) and Walker (2002). Cultures of

L. testa-ceipes

were initiated from field-collected popula-tions of parasitoids on

T. citricida

in citrus grovesthroughout Florida (Persad & Hoy 2003a). Adultparasitoids that emerged were held in batches of20-30 individuals in 2.5

×

6 cm plastic vials withmoistened honey-saturated paper strips for 24 h.One batch of

L. testaceipes

was released onto ninepotted citrus plants that were each infested with250-300 aphids of mixed instars in a 63

×

63

×

63cm mesh cage in the laboratory under similar con-ditions.

DNA Extractions

Genomic DNA from individual adults of

L. testa-ceipes

,

L. oregmae

and

T. citricida

was extractedwith PUREGENE reagents by the method sug-gested by the manufacturer (Gentra Systems, Min-neapolis, MN) and resuspended in 50 µl sterilewater. For screening large populations of field-col-lected specimens, genomic DNA was extracted frombatches of adults by grinding in 50µl Chelex (Bio-Rad, Hercules, CA) resin and treating the extractsfor 1 h at 60°C and 5 min at 94°C (Edwards & Hoy1993). One microliter of PUREGENE or Chelexpreparations was used for High-fidelity PCR.

Primers

PCR primers for the amplification of four in-sect mitochondrial gene fragments (12S, 16S, COIand NADH) (Kambhampati & Smith 1995) andnuclear rRNA primers (5.8S-F and 28 S-R) (Por-ter & Collins 1991) (Table 1) were used to amplifyextracted DNA.

High-fidelity PCR Protocol

High-fidelity PCR was performed in a 50-µl re-action volume containing 50 mM Tris, pH 9.2, 16mM ammonium sulfate, 1.75 mM MgCl

2

, 350 µMeach of dATP, dGTP, dCTP, dTTP, 800 pmol ofprimers, 1 unit

Tgo

DNA polymerase and 5 unitsof

Taq

DNA polymerase (Roche Molecular Bio-chemicals) (Barnes 1994). Reactions were over-laid with 50 µl of mineral oil and High-fidelityPCR was conducted with three linked tempera-ture profiles: (i) To eliminate possible templatesecondary structure, hot-start PCR at 94°C for 2mins was used for 1 cycle followed by (ii) 10 cycles,each consisting of denaturation at 94°C for 10 s,annealing at 49°C for 30 s and 40°C for 30 s for

T

ABLE

1.

PRIMERS

USED

FOR

AMPLIFICATION

OF

L

YSIPHLEBUS

TESTACEIPES

,

L

IPOLEXIS

OREGMAE

AND

T

OXOPTERACITRICIDA

DNA.

Primer Sequence Gene segment

SR-J-14199 5’-TACTATGTTACGACTTAT- 3’ Mitochondrial 12S rRNASR-N-14594 5’-AAACTAGGATTAGATACCC-3’ ’’LR-J-13017 5’-TTACGCTGTTATCCCTAA-3’ Mitochondrial 16S rRNALR-N-13398 5’-CACCTGTTTAACAAAAACAT-3’ ’’CI-J-1632 5’-TGATCAAATTTATAAT-3’ Mitochondrial CO ICI-N-2191 5’-GGTAAAATTAAAATATAAACTTC-3’ ’’N5-J-7502 5’-CTAAAGTTGATGAATGAACTAAAG-3’ Mitochondrial NADH+ NADH5N4-N-8925 5’-GCTCATGTTGAAGCTCC-3’ ’’5.8 S-F 5’-GTGAATTCTGTGAACTGCAGGACACATGAAC-3’ Nuclear rRNA ITS-228 S-R 5’-ATGCTTAAATTTAGGGGGTA-3’ ’’LO-ITSF 5’-GGCCAGTTGTCGAGTCC-3’ ITS-2LT-ITSF 5’-CTAGCGATAAATGAATGTTC-3’ ’’

LO =

Lipolexis oregmae

and LT=


20


87(1) March 2004

ITS-2 and mitochondrial gene segments, respec-tively, and elongation at 68°C for 1 min 20 s and(iii) 20 cycles, each consisting of denaturation at94°C for 10 s, annealing at 49°C for 30 s, and ex-tension at 68°C for 1 min 20 s plus an additional20s for each consecutive cycle. PCR productswere separated on a 2% agarose gel, stained withethidium bromide and photographed under UVlight.

The PCR products were ligated into a PCR2.1 TOPO vector and used to transform compe-tent One Shot

E. coli

cells with subsequentampicillin selection following the manufac-turer’s directions (Invitrogen, Carlsbad, CA).Clones were incubated overnight in Luria-Ber-tani (LB) medium on plates containing ampicil-lin, IPTG and X-gal. Sixteen clear colonies wererandomly picked from each plate and separatelycultured for 16 h in 5 ml of LB medium. PlasmidDNA was extracted with a QIAGEN PlasmidMini-prep Kit (QIAGEN, Inc., Valencia, CA). Allplasmids were incubated and digested with

Eco

R1 and visualized on a 1% agarose gel to ver-ify that the inserts corresponded to the expectedsize of the PCR products. Three clear coloniescontaining plasmids with the inserts were re-cultured in 50 ml of LB medium with ampicillinfor each species. Plasmids were extracted withQIAGEN Plasmid Midi-prep kits. DNA insertswere sequenced with a Perkin-Elmer AppliedBiosystems ABI PRISM Automated DNA se-quencer located at the University of Florida In-terdisciplinary Center for Biotechnology,Research Core Facility.

Accuracy of Species-Specific Primers

Once primers were designed based on the se-quences obtained, ten adults each of

L. testaceipes

and

L. oregmae

and each of 10 third instars of

T. citricida

were placed individually into 0.5-mlthick-walled eppendorf tubes each containing 50µl of 5% Chelex resin suspension. A pestle wasmade by slowly heating a standard pipette tipwhich was then inserted into an empty 0.5-ml ep-pendorf tube so that the tip assumed the shape ofthe base of the tube to form a close-fitting pestle.New pestles were used to grind each adult speci-men, a procedure which lasted 30 to 40 sec. Aftergrinding, each tube was placed in a water bath at60°C for one h. The tubes were collected andplaced in a Perkin-Elmer DNA Thermal Cyclermodel 480 at 94°C for 5 mins after which sampleswere centrifuged for 30 sec.

High-fidelity PCR was used to evaluate thespecificity of the assay by subjecting 10 replicatesof DNA from

L. testaceipes, L. oregmae and T. cit-ricida to either primer. PCR products were sepa-rated on a 2% agarose gel, stained with ethidiumbromide and photographed under UV light.

Detection of Parasitoid Eggs and First-instars

Third instars of T. citricida were exposed tosingle oviposition opportunities by each parasi-toid in petri-dish arenas and returned to pottedcitrus plants in the laboratory. After periods of 6,12, 18, 24 and 48 h during which aphids were ex-posed to parasitoids, individual aphids wereground in 50 µl of Chelex and incubated for 1 h toextract DNA from the parasitoid eggs. Under lab-oratory rearing conditions, eggs of L. testaceipesand L. oregmae hatch after 55 h and 75 h, respec-tively (Persad & Hoy 2003b). Ten aphids were ex-posed to each parasitoid species and evaluated bythe High-fidelity assay for each of the five-time in-tervals. Sub-groups of exposed aphids were rou-tinely dissected 4 d after assumed ovipositionand, if parasitism was below the expected 98-100% (Persad & Hoy 2003b), then the group andthe PCR results observed were rejected.

The experiment was repeated to detect parasi-toid larvae 70 h after exposing aphid hosts toL. testaceipes or L. oregmae, respectively (first in-stars eclose at 55 and 61 h, respectively, Persad &Hoy 2003b). High-fidelity PCR was used to deter-mine the presence of eggs or larvae of both para-sitoid species in each of 10 trials with the aim offinding the earliest time after the oviposition op-portunity when 100% of 10 trials resulted in de-tection of parasitoid eggs or larvae in T. citricida.

Other Hosts of L. testaceipes and L. oregmae and Sensi-tivity of the Assay

Because other aphids are found in citrusgroves in Florida and both L. testaceipes andL. oregmae are known to parasitize aphids otherthan T. citricida (Fasulo & Halbert 1998; Hoy &Nguyen 2000), four additional aphid species werecollected from the field and greenhouse cultureswere initiated. Aphis spiraecola Patch, A. gossypiiGlover, and Toxoptera aurantii Boyer were main-tained on potted citrus, while A. craccivora Kochwas cultured through several generations on pot-ted eggplants.

In a preliminary experiment, 10 third instarsof each aphid species were exposed individually tofemales of either L. testaceipes or L. oregmae inpetri-dish arenas. After exposure for 24 h, High-fidelity PCR assays were conducted and theseconfirmed that parasitoid DNA was present in allexposed aphids.

Because field samples may involve hundredsor thousands of aphid individuals of different spe-cies, we wanted to determine whether aphidscould be pooled, yet still yield qualitative data forpresence/absence of L. testaceipes or L. oregmae.Ten replicates of High-fidelity PCR were con-ducted on samples containing ratios of one para-sitized (24 h after oviposition opportunity) to nineunparasitized third instars of brown citrus


aphids. Incremental increases of nine unparasit-ized aphids (ratios of 1: 9, then 1: 18, followed by1: 27, etc.) were evaluated with High-fidelity PCRuntil detection dropped from 100% to under 50%.

Interspecific Interactions of L. testaceipesand L. oregmae

Each of eight third instars of T. citricida wasexposed individually to an L. oregmae female in apetri-dish arena, and immediately afterwards thesame aphid was exposed to a L. testaceipes femalein the method described by Persad & Hoy (2003b).After the oviposition opportunities, the aphid wasreturned to a potted citrus plant for 24 h. The ex-periment was repeated with the reverse oviposi-tion sequence. The DNA from single aphids in alltrials was extracted with Chelex and High-fi-deltiy PCR was performed on each to determine ifthe DNA from more than one parasitoid within asingle aphid would affect the specificity of theL. testaceipes or L. oregmae primer.

Other Parasitoids

To determine whether the presence of DNAfrom other parasitoid species would give falsepositives we tested additional aphid parasitoids,some of which may occur in Florida; these in-cluded Lysiphlebus japonica Ashmead (obtainedin 70% alcohol, from the Florida Department ofAgriculture and Consumer Services, Division ofPlant Industry, Gainesville), Aphelinus gossypiTimberlake, Aphidius colemani Vierick, Aphidiuservi Haliday and Aphidius matricariae Haliday,(all obtained alive from BioBest International)and the hyperparasitoids Alloxysta megouraecomplex and Pachyneuron aphidisi Bouche (field-collected live specimens from Florida, identifiedby guidelines of Evans and Stange [1997]). Tenspecimens of each parasitoid species were groundindividually in 50 µl Chelex and the DNA wastested with the primers for both L. testaceipes andL. oregmae in High-fidelity PCR.

RESULTS AND DISCUSSION

Primers

Mitochondrial 12S and NADH primers pro-duced no discernible PCR products when usedwith DNA from L. testaceipes and L. oregmae. Onlythe 16S and COI primers produced discernibleDNA bands of the expected size (data not shown).The PCR products obtained with the16S primerswere cloned and sequenced (GenBank accessionnumbers AY498553 through and includingAY498558) because sequence differences are ex-pected to be higher than with the COI fragment(Simon et al. 1994). The entire 0.55 kb ITS-2 PCRproducts of L. oregmae were cloned and sequenced

but only 398 bp of the 0.75 kb product from L.testaceipes could be sequenced because the 3’ endwas ‘AT’ rich and difficult to sequence. The clonedsequences of the PCR products from T. citricida, L.testaceipes and L. oregmae were aligned byCLUSTAL W. Unfortunately the 16 S rRNA se-quences from L. testaceipes and L. oregmae dis-played low sequence divergence (14.8%) and nospecies-specific primers could be designed. How-ever, the sequence divergences of the nuclear ITS-2 region for L. testaceipes and L. oregmae and T. cit-ricida were high, allowing species-specific forwardprimers to be designed (Table 1). An L. oregmae-specific forward primer (LO-ITSF 5’-GGCCAGT-TGTCGAGTCC-3’) and an L. testaceipes-specificforward primer (LT-ITSF 5’-CTAGCGATAAAT-GAATGTTC-3’) were designed after obtaining thecomplete ITS-2 sequence from L. oregmae (GenBank accession no. AY498553) and a partial ITS-2sequence from L. testaceipes (Gen Bank accessionno. AY498554). PCR products from L. testaceipes-specific primers produced 520 bp bands whilethose of L. oregmae produced 270 bp bands (Fig. 1).

Accuracy of Species-Specific Primers

Both primers yielded bands specific to the re-spective adult parasitoid in each of the 10 repli-cates and both primers failed to detect DNA fromT. citricida (Fig. 1).

Fig. 1. High-fidelity PCR products obtained withparasitoid species-specific primers and DNA extractedfrom adults of Lysiphlebus testaceipes (520 bp), Li-polexis oregmae(270bp) and Toxoptera citricida (nobands).


Detection of Parasitoid Eggs and First-instars

As early as 6 h after exposure to L. testaceipesand L. oregmae, 34 and 46%, respectively, of the ex-posed third instars of brown citrus aphids pro-duced PCR products. For both parasitoids, allaphids that contained eggs could be detected 24 hafter oviposition opportunities (Fig. 2). Becauseparasitoid larvae contain more DNA than parasi-toid eggs, all aphids containing first instars yieldedPCR products with their respective primers in alltrials with High-fidelity PCR (data not shown).

Other Hosts of L. testaceipes and L. oregmaeand Sensitivity of the Assay

Table 2 indicates that six species of aphidscommonly associated with citrus in Florida wereall parasitized by L. oregmae when single oviposi-tion opportunities were allowed in the laboratory.The data suggest that L. oregmae can parasitizeand successfully complete its life cycle in all aphidhosts tested and thus may parasitize other aphidspecies in Florida citrus groves. This oligophagousnature of L. oregmae is expected (Stary & Zeleny1983; Hoy & Nguyen 2000) and, the ability to sur-vive on other pest aphids may be advantageous tothe parasitoid. Field collections of aphids for stud-ies on the establishment of L. oregmae shouldtherefore include any aphid species encounteredon plants in, and adjacent to, citrus groves, in-cluding weeds, ornamentals or vegetables.

Fig. 2. Detection of eggs of Lysiphlebus testaceipesand Lipolexis oregmae within third instars of Toxopteracitricida with species-specific primers 24 h after expos-ing aphids to parasitoid females.

TABLE 2. DETECTION RATES WHEN UNPARASITIZED APHIDS WERE MIXED WITH ONE THIRD INSTAR APHID PARASITIZED1

BY LYSIPHLEBUS TESTACEIPES OR LIPOLEXIS OREGMAE.

Aphid species

No. of unparasitized aphids added to one parasitized aphid and detection rates

L. oregmae % Detection L. testaceipes % Detection

Aphis spiraecola (c) 452 100 45 10054 70 54 4063 40 — —

Aphis gossypii (c) 36 100 45 10045 40 54 40

Aphis craccivora (v) 36 100 45 10045 60 54 7054 20 63 10

Toxoptera citricida (c) 36 100 36 10045 40 45 50— — 54 20

Toxoptera aurantii (c) 18 100 27 10027 70 36 4036 00 — —

124 h after five aphid species reared on citrus (c) or vegetables (v) were exposed to either parasitoid in the laboratory.2In each trial there were 10 replicates; all trials started with 1 parasitized: 9 unparasitized and were increased serially by adding

an additional 9 unparasitized aphids until detection dropped below 50%.


When a single L. testaceipes or L. oregmae eggwas present in a third instar of the brown citrusaphid and 36 unparasitized third instars of thebrown citrus aphid were combined, all assayswere positive for their respective parasitoid (Ta-ble 2). DNA from a pooled maximum of 36 aphidsthus can be used in analyses of field-collectedT. citricida for determining presence of eitherparasitoid. The assay also detected eggs of bothparasitoids within third instars of the other fiveaphid species. The maximum number of unpara-sitized aphid third instars that can be added to asingle parasitized third instar aphid and provide100% detection rate ranged from 18 to 45 individ-uals for the other five aphid species. The declinein detection was variable with aphid species; forexample, T. aurantii detection failed when 36 un-parasitized aphids were added to one parasitizedaphid, while the same concentration gave 100%detection in T. citricida (Table 2).

Because these trials were conducted withaphids containing 24-h-old eggs, there is a highprobability that eggs older than 24 h and all par-asitoid larval and pupal stages will be detectedbecause more parasitoid DNA will be present.This is substantiated by the observation thatwhen one first instar was mixed with 500 unpara-sitized T. citricida, a PCR product was always ob-tained in the 10 replicates with High-fidelity PCRassay (data not shown). These data indicate theassay is suitable for qualitative analyses of largebatches of field-collected aphid samples to deter-mine whether L. oregmae larvae are present.

Interspecific Interactions between Parasitoids

Interspecific interactions produced singlebrown citrus aphids containing eggs or larvae ofboth L. testaceipes and L. oregmae. A PCR productspecific to each parasitoid was obtained from theaphids tested (Fig. 3) and similar results were ob-tained in the reverse oviposition sequence (datanot shown). In Figure 3, a PCR product was notobtained when the L. testaceipes primer wastested on aphid 6 (Fig. 3, lane 8); however, a PCRproduct was obtained with the L. oregmae primer(lane 18) suggesting that only the L. oregmae fe-male oviposited and injected its DNA into aphid6. The opposite probably happened with aphid 3,because only DNA from L. testaceipes was found(Fig. 3, lane 5). The experiment indicates that theassay can detect the presence of eggs of both par-asitoid species when they co-occur in a singleaphid. Hence, tests on field-collected materialshould detect the presence of either parasitoidspecies as early as 24 h after parasitoids oviposit.

Other Parasitoids

DNA extracted from the additional seven par-asitoid species produced no PCR products with ei-

ther species-specific primer. To confirm that thequality of the DNA was not an issue, we subjectedthe extracted DNA from each additional parasi-toid species to the universal 5.8 S-F and 28 S-Rprimers. All PCR reactions produced bands,which confirm that the DNA was amplifiable. Ab-sence of bands with the species-specific primersconfirms the specificity of the primers for the tar-get parasitoids.

CONCLUSIONS

This High-fidelity PCR assay is highly specificand sensitive, providing a relatively inexpensivetool for sampling large aphid populations. Thestandard practice of holding and monitoring fieldsamples of foliage for up to two weeks in order tocollect emerged adults is a labor-intensive andtime-consuming process which can be affected byparasitoid mortality (Persad & Hoy, unpublisheddata). The presence of immature L. testaceipesand L. oregmae parasitoids as young as 24-h oldcan be determined by High-fidelity PCR and, ifsamples are stored for 70 h, then larger groups ofup to 500 aphids can be sampled in a single assay.Currently this assay is being used to evaluate theestablishment of L. oregmae on several aphidhosts on citrus and other plants near L. oregmaerelease sites in Florida.

Fig. 3. The presence of both Lysiphlebus testaceipesand Lipolexis oregmae in single third instars of Tox-optera citricida did not affect the accuracy of the spe-cies-specific primers.


ACKNOWLEDGMENTS

The authors appreciate the technical assistance ofRu Nguyen, Lucy Skelley and Reginald Wilcox. Thiswork was supported in part by funds from the Davies,Fischer and Eckes Endowment and TSTAR-Caribbean.This is University of Florida Agricultural ExperimentStation Journal Series R-09753.

REFERENCES CITED

BARNES, W. M. 1994. PCR amplification of up to 35-kbDNA with high-fidelity and high yield from bacte-riophage templates. Proc. Natl. Acad. Sci. USA 91:2216-2220.

EDWARDS, O. R., AND M. A. HOY. 1993. Polymorphism intwo parasitoids detected by random amplified poly-morphic DNA polymerase chain reaction. Biol. Con-trol 3: 243-257.

EVANS, G., AND P. STANGE. 1997. Parasitoids associatedwith the brown citrus aphid in Florida (Insecta: Hy-menoptera) Entomology Circular 384, Florida De-partment Agriculture and Consumer Services,Division of Plant Industry, Gainesville.

FASULO, T. R., AND S. E. HALBERT. 1998. Aphid pests ofcitrus. Cooperative Extension Service, Institute ofFood and Agricultural Sciences, University of Flor-ida, Gainesville. Bulletin ENY-811: 1-4.

HILL, S., AND M. A. HOY. 2003. Interactions between thered imported fire ant Solenopsis invicta and the par-asitoid Lipolexis scutellaris, potentially affecting aclassical biological control agent of Toxoptera citri-cida. Biological Control 27: 11-19.

HOY, M. A., AND R. NUYGEN. 2000. Classical biologicalcontrol of brown citrus aphid. Release of Lipolexisscutellaris. Citrus Industry 81(10): 24-26.

KAMBHAMPATI, S., AND P. T. SMITH. 1995. PCR primersfor the amplification of four insect mitochondrialgene fragments. Insect Mol. Biol. 4: 233-236.

MILLER, R., K. S. PIKE, AND P. STARY. 2002. Aphid para-sitoids (Hymenoptera: Aphidiidae) on Guam. Micro-nesica 34: 87-103.

PERSAD, A. B., AND M. A. HOY. 2003a. Manipulation offemale parasitoid age enhances laboratory culturesof Lysiphlebus testaceipes reared on Toxoptera citri-cida. Florida Entomol. 86: 429-436.

PERSAD, A. B., AND M. A. HOY. 2003b. Intra- and inter-specific interactions between Lysiphlebus testaceipesand Lipolexis scutellaris on Toxoptera citricida. J.Econ. Entomol. 96: 564-569.

PORTER, C. H., AND F. H. COLLINS. 1991. Species-diag-nostic differences in a ribosomal DNA internal tran-scribed spacer from the sibling species Anophelesfreeborni and Anopheles hermsi (Diptera: Culicidae).Am. J. Trop. Med. Hyg. 45: 271-279.

SIMON, C., F. FRATI, A. BECKENBACH, B. CRESPI, H. LIU,AND P. FLOOK. 1994. Evolution, weighting and phylo-genetic utility of mitochondrial gene sequences and acompilation of conserved polymerase chain reactionprimers. Ann. Entomol. Soc. Amer. 87: 651-701.

STARY, P., AND J. ZELENY. 1983. Aphid parasitoids fromVietnam (Hymenoptera: Aphidiidae). Acta. Entomol.Bohemoslov. 86: 356-367.

WALKER, A. M. 2002. Physiological and behavioral factorsaffecting parasitism of Toxoptera citricida by Lipolexisscutellaris. M.S. Thesis, Department of Entomologyand Nematology, University of Florida, Gainesville.

Lapointe et al.: Copper and Diaprepes Root Weevil 25

EFFECT OF DIETARY COPPER ON LARVAL DEVELOPMENTOF

DIAPREPES ABBREVIATUS

(COLEOPTERA: CURCULIONIDAE)

S

TEPHEN

L. L

APOINTE

1

, A

LBERT

A

. W

EATHERSBEE

III

1

, H

AMED

D

OOSTDAR

2

AND

R

ICHARD

T. M

AYER

3

1

USDA-ARS, U.S. Horticultural Research Laboratory, 2001 South Rock Road, Ft. Pierce, FL 34945

2

Morse Enterprises Limited, Inc., 151 SE 15 Road, Miami, FL 33129

3

USDA-ARS, Arthropod-Borne Animal Diseases Research Laboratory, P.O. Box 3965University Station, Laramie, WY 82072

A

BSTRACT

Larvae of the Diaprepes root weevil,

Diaprepes abbreviatus

(L.), were reared from hatchingon an artificial diet containing four concentrations of two copper compounds, cupric sulfate(CuSO

4

) or cupric hydroxide [Cu(OH)

2

]. Negative effects of copper on insect developmentwere observed only for early instars. Survival of larvae from hatching to 4 weeks of age wassignificantly affected by the copper compounds compared with the artificial diet alone, andgreater mortality was associated with CuSO

4

compared with Cu(OH)

2

. The two compoundshad equivalent effects on larval weight gain of early instars. Weight gain was negatively cor-related with increasing copper concentration. No effect of copper was observed on late in-stars maintained on these diets beyond the initial 4 weeks. Larval and pupal period, weightgain, and survival of late instars were statistically similar. No effect on larval survival orweight gain was observed when copper solutions were applied at nonphytotoxic levels to twovarieties of citrus rootstock. The potential for manipulating citrus tree copper content to con-trol this pest is discussed.

Key Words: Citrus, heavy metal, artificial diet

R

ESUMEN

Se criaron larvas del cucurlionido


(L.), sobre una dieta artificial concuatro concentraciones de dos compuestos de cobre, sulfato de cobre (CuSO

4

) o hidroxido decobre [Cu(OH

2

)]. Los efectos negativos del cobre sobre el desarrollo del insecto fueron obser-vados solamente en larvas de estadios tempranos. La supervivencia de larvas desde eclosiondel huevo hasta 4 semanas de edad fue afectada significativamente por los compuestos de co-bre comparado con la dieta artificial sola, y más mortalidad fue asociada con CuSO

4

com-parado con Cu(OH

2

). Los dos compuestos tuvieron efectos equivalentes en el aumento depeso de larvas de estadios tempranos. El aumento del peso fue correlacionado negativa-mente con el aumento en la concentración de cobre. No se observó ningún efecto del cobre enlas larvas de estadios mayores (>30 d). Para estas larvas, el período larval y pupal, el au-mento de peso, y la supervivencia eran similares estadísticamente cuando fueron criadas entodos los tratamientos de dieta incluyendo el control. No se observó ningún efecto sobre au-mento larval de peso o la supervivencia cuando las soluciones de cobre fueron aplicadas enlos niveles nofitotóxicos a dos variedades de patrones de cítricos. El potencial para manipu-lar el contenido de cobre en árboles de cítricos para controlar este plaga se discute.

Translation provided by author.

Predation of tree roots by larvae of the Dia-prepes root weevil,


(L.),has become a major arthropod constraint to pro-ductivity of citrus in Florida. Copper compounds(fixed copper and Bordeaux mixture) have beenwidely used as fungicides and bacteriocides in cit-rus to control scab, melanose, blast (

Pseudomonassyringae

), and other pathogens. Copper com-pounds are inexpensive and broad-spectrum. Ap-proximately one half of the United States citruscrop is treated with copper-based fungicides rep-resenting the largest single use of copper as a fun-

gicide (Gianessi & Puffer 1992). Copper ionsdestroy proteins in plant tissues and the phyto-toxicity of copper fungicides has led to replace-ment with safer chemical fungicides whenavailable. However, copper fungicides are appliedto over half of Florida’s orange crop acreage, andover 75% of the state’s grapefruit to control dis-eases such as brown rot, melanose, scab, Alterna-ria brown spot, and greasy spot (FloridaCooperative Extension Service 2000). Copper ac-cumulates in the soil and can become phytotoxicto citrus rootstocks at high concentrations, espe-

26


87(1) March 2004

cially to young trees in acidic soils (Alva et al.2000). In soils with pH 8.2, copper content up to400 mg kg

-1

(ppm) was not phytotoxic to Swingle;in soils with pH 5.7 and 6.2, significant growth re-duction occurred when copper levels exceeded 200mg kg

-1

(Alva et al. 2000).Observations in this laboratory led us to hy-

pothesize that copper content in the root tissue ofcitrus rootstocks might confer resistance to theDiaprepes root weevil through inhibition of its di-gestive enzymes such as polysaccharide hydrolyz-ing enzymes known to degrade plant material(Doostdar et al. 1997). The purpose of the re-search reported here was to document the effectof diet-incorporated copper on survival andgrowth of

D. abbreviatus

larvae.

M

ATERIALS

AND

M

ETHODS

Diet Incorporation

Diaprepes root weevils were obtained from alaboratory colony maintained by the U.S. Horticul-tural Research Laboratory, Ft. Pierce, FL. Larvaewere reared on artificial diet according to Lapointeand Shapiro (1999). Neonate larvae (<24 h old)were placed in cups (PC100 1-oz. cups and lids, JetPlastica, Harrisburg, PA) containing either a com-mercially prepared insect diet (product no. F1675,Bio-Serv, Inc., Frenchtown, NJ) or the same dietwith one of three concentrations of cupric sulfate(CuSO

4

*5H

2

O, Sigma Chemical Co.) or cupric hy-droxide [Cu(OH)

2

, Sigma Chemical Co.]. The pH ofthe prepared diets was tested and adjusted to 7.0while the diets were still liquid. Treatments con-sisted of control (diet only) and the equivalent of250, 500, and 1,000 ppm Cu for each of the twocopper compounds. Ten neonates were placed ineach of thirty cups per treatment for a total of2,100 larvae. Initial weight of larvae was approxi-mately 0.1 mg (Lapointe 2000). Diet cups infestedwith larvae were kept in sealed plastic bags in anincubator at 27°C, 24:0 D:L. At 27 d after infesta-tion of the diet cups, surviving larvae were recov-ered from individual cups, counted, and weighed.Survival of early instars from neonate to 27 d wasexpressed as percent survival per cup and trans-formed (arcsine) to normalize variance. Larvalsurvival and weights were analyzed by ANOVAand means compared by Tukey’s Honestly Signifi-cant Differences (HSD) test (SAS Institute 1999).Nontransformed means of larval survival are pre-sented. For larval weights, “diet cups” was used asthe error term because larvae were nested withincups. Thirty larvae were randomly selected fromeach treatment and placed individually in cupscontaining fresh diet of the respective treatment.These larvae were replaced in the incubator andallowed to complete development. Survival, larvalperiod, pupal period, and adult weight upon emer-gence were recorded and analyzed by ANOVA.

Greenhouse Trial

The effect of soil copper concentration on sur-vival and growth of

D. abbreviatus

larvae feedingon the roots of two citrus varieties was evaluatedin greenhouse trails by using a factorial design.The citrus plants used in the experiment wereone-year-old seedlings of Swingle citrumelo [

Cit-rus paradisi

Macf.

×

Poncirus trifoliate

(L.) Raf.]and Sun Chu Sha mandarin (

C. reticulata

Blanco)potted individually in 946-cm

3

containers with180 g of potting soil (Metromix 500, Scotts,Marysville, OH). A range of soil copper concentra-tions (0, 50, 150, or 300 ppm) was established byamending the soil (180 g) in each pot with 0, 9, 27,or 54 mg copper applied as soluble copper chloridein 100 ml water to each container. Treatmentswere applied as two partial applications ten daysapart. Each treatment was replicated 15 times.Total number of plants was 120 (15 replications

×

2 citrus species

×

4 copper concentrations). Eachcontainer was infested 30 d after the final copperapplication with 5 neonatal larvae (

≤

24-h-old).The experiment was maintained in a greenhouseand plants were watered (100 ml per pot) twiceweekly. The number and mean fresh weight ofsurviving larvae in each container, dry weights ofplant roots, and height of plant shoots were re-corded after eight weeks. Data were analyzed bythe General Linear Models Procedure (SAS Insti-tute 1999) to determine if soil treatments or cit-rus varieties affected the outcome of theexperiment.

R

ESULTS

Diet Incorporation

The dose of copper had no effect on survival ofearly instars (

F

= 0.57; df = 2, 174;

P

= 0.57). How-ever, there was an effect of Cu source (

F

= 9.71; df= 1, 174;

P

< 0.01). Both Cu sources reduced larvalsurvival of early instars compared with the con-trol. Survival was reduced by 20% with Cu(OH)

2

and by 33% with CuSO

4

compared with the con-trol (Table 1). There was a significant effect of Cuon the weight gain of larvae that survived to 27 d(

F

= 66.3; df = 6, 29;

P

< 0.01). There was no inter-action between rate and Cu source (

P

= 0.30), sodata for the two sources were combined and therates were compared with the control. The meanweight of larvae reared on diet containing the lowrate (250 ppm) of copper was not different fromthat of larvae reared on the control diet (12 ppm);the medium rate (500 ppm) of copper reduced lar-val weight by 27% and the high rate (1,000 ppm)by 82% compared with the control (Fig. 1) (

α

=0.05, Tukey’s HSD).

There was no effect of gender (

F

= 0.53; df = 1,121;

P

= 0.47) or of treatment (

F

= 0.66; df = 6,121;

P

= 0.68) on larval period (124.8 ± 2.9 d,

n

=


135). The experimental design did not allow forstatistical comparison of larval survival of late in-stars. However, survival ranged from 53 to 73%and was not associated with the copper com-pounds or concentration (Table 2). There was noeffect of treatment on pupal period (

F

= 1.6; df = 6,121;

P

= 0.15). Mean (± SEM) pupal period was18.9 ± 0.4 d (

n

= 128). Upon emergence, femaleadults were heavier than males (

F

= 43.1; df = 1,120;

P

< 0.01), but there was no effect of incorpo-ration of copper compounds on adult weight (

F

=

0.9; df = 6, 120;

P

= 0.50). Mean (± SEM) maleweight was 280.5 ± 5.1 mg (

n

= 62); mean femaleweight was 349.6 ± 8.4 mg (

n

= 66).

Greenhouse Trial

Soil amendments with copper, applied as cop-per chloride, did not affect survival (

F

= 0.15; df =3, 112;

P

= 0.93) or weight gain (

F

= 0.11; df = 3,105;

P

= 0.96) of

D. abbreviatus

larvae over therange of concentrations evaluated in this experi-ment. After eight weeks, the mean (± SEM) num-ber of larvae surviving per container was 2.0 ± 0.1(

n

= 120 containers). The grand mean (± SEM) ofweight of surviving larvae after eight weeksacross all treatments was 196.4 ± 6.6 mg (

n

= 113containers with surviving larvae). There was noeffect of copper treatments on the dry weights ofcitrus roots (

F

= 0.01; df = 3, 112;

P

= 0.99) orheight of the plant shoots (

F

= 1.03; df = 3, 112;

P

= 0.38). The overall means for dry weight of rootsand height of shoots were 4.4 ± 0.3 g (

n

= 120) and50.4 ± 1.4 cm (

n

= 120), respectively.The numbers (

F

= 1.15; df = 1, 114;

P

= 0.29) andweights (

F

= 0.10; df = 1, 114;

P

= 0.76) of survivinglarvae were similar whether the insects fed on theroots of Swingle citrumelo or Sun Chu Sha manda-rin. However, the dry weight of roots (

F

= 50.66; df= 1, 114;

P

≤

0.01) and height of plant shoots (

F

=95.35; df = 1, 114;

P

≤

0.01) differed by citrus vari-ety. Both the mean root weight and shoot height forSwingle citrumelo (5.9 ± 0.4 g and 60.0 ± 1.5 cm,

n

= 60) were greater than those for Sun Chu Shamandarin (2.8 ± 0.3 g and 40.7 ± 1.4 cm,

n

= 60) al-though the plants were similar in age and sizewhen the experiment was initiated. The differ-ences in the values for plant measurements weredue to inherent differences between the two citrusvarieties. No interactions between copper treat-ment and citrus variety were detected for any ofthe measured variables in the experiment.

T

ABLE

1. M

EAN

(± SEM)

SURVIVAL

(

n

= 30)

AND

WEIGHT OF EARLY INSTARS OF THE DIAPREPES ROOT WEEVIL AFTERFEEDING FOR 27 D ON ARTIFICIAL DIET CONTAINING BACKGROUND (12 PPM), CUPRIC SULFATE OR CUPRIC HY-DROXIDE INCORPORATED AT THREE RATES.

Copper source Rate (ppm) Survival (%) Weight (mg) n

CuSO4 250 48.2 ± 3.2 a 44.2 ± 2.5 ab 137CuSO4 500 58.0 ± 4.6 a 36.6 ± 2.2 bc 159CuSO4 1000 49.1 ± 3.5 a 7.8 ± 0.5 d 139Cu(OH)2 250 61.5 ± 3.4 ab 41.4 ± 2.1 ab 170Cu(OH)2 500 60.4 ± 3.7 ab 32.8 ± 2.0 c 172Cu(OH)2 1000 64.6 ± 5.5 ab 9.5 ± 0.7 d 167Diet only 12 77.2 ± 5.0 b 47.7 ± 2.5 a 201

CuSO4 all 51.8 ± 2.2 a 435Cu(OH)2 all 62.1 ± 2.5 b 509Diet only 12 77.2 ± 5.0 c 201

Means within columns and sections followed by the same letter are not significantly different (α = 0.05, Tukey’s HSD after a sig-nificant ANOVA).

Fig. 1. Effect of rate of incorporation of copper in ar-tificial diet on live weight of early instars of Diaprepesroot weevil after 27 d at 26°C. Background copper con-centration in artificial diet was 12 ppm. Bars are SEM(n > 200). Means with the same letter do not differ sig-nificantly at α = 0.05 by Tukey’s HSD after a significantANOVA.


DISCUSSION

Heavy metals are known to have adverse bio-logical effects on insect development (Rayms-Keller et al. 1998; Bischof 1995). For example, 33ppm copper resulted in 50% mortality of larvalAedes aegypti (Rayms-Keller et al. 1998), and re-tarded development was observed in copper-con-taminated larvae of Lymantria dispar (Bischof1995). The toxicity of heavy metals to insects canbe synergized by several factors including hypoxia(van der Geest et al. 2002) and the presence ofother heavy metal ions (Fargasova 2001). How-ever, the strategic use of a heavy metal ion for con-trolling an insect pest is restricted by issues ofphytotoxicity and long-term contamination of soil.To circumvent these problems, citrus seedlingsmight be treated in nurseries to raise the concen-tration of copper in roots before transplanting,thereby conferring a degree of protection to soil in-sects such as D. abbreviatus. However, in thisstudy, treatment of seedlings with nonphytotoxiclevels (≤300 ppm) of copper in solution did not con-fer resistance to larval D. abbreviatus.

The toxicity of copper to plant tissue and bio-availability of copper in the environment areknown to increase with increasing soil acidity(Alva et al. 2000). The pH of ingested plant tissueby a root weevil would be approximately neutral,the same as that of the artificial diet used in ourtests. According to Alva et al. (2000), critical Cuconcentration for phytotoxicity in the roots ofSwingle citrumelo seedlings ranged from 62 mgkg-1 in Myakka fine sand (pH 5.7) to 270 mg kg-1 inCandler fine sand (pH = 6.5).

Diet-incorporation assays have been success-fully employed to identify compounds with nega-tive effects on the developmental biology ofD. abbreviatus (Shapiro et al. 1997, 2000; Weath-ersbee & Tang 2002). In our tests, significant mor-tality compared with the control diet wasassociated with CuSO4 but not Cu(OH)2, althoughthe magnitude of the effect was not large and,

curiously, did not vary with the concentration ofcopper. Mean weight gain of larvae reared on ei-ther source of copper cation at a concentration of250 ppm was equivalent to that of larvae rearedon the control. Significant inhibition of growth ofearly instars only occurred at higher concentra-tions (500 and 1,000 ppm). There was no discern-ible effect of copper amendments on survival,larval and pupal development, or weight gain onlarvae >30 d old. Similarly, larvae of L. dispar ex-posed from the 4th instar were less susceptible toheavy metals than larvae exposed from hatching(Gintenreiter et al. 1993). From these data, weconclude that the concentration of copper re-quired in root tissue to significantly inhibit devel-opment and survival of D. abbreviatus is too highto avoid phytotoxic effects.

ACKNOWLEDGMENTS

We thank Hunter Smith for technical assistancewith bioassays. Research was financed in part by Coop-erative Research and Development Agreement 58-3K95-9-657 between ARS and Morse Enterprises Lim-ited, Inc., Miami, FL. Mention of a trademark or propri-etary product does not constitute a guarantee orwarranty of the product by the U.S. Department of Ag-riculture and does not imply its approval to the exclu-sion of other products that may also be suitable.

REFERENCES CITED

ALVA, A. K., B. HUANG, AND S. PARAMASIVAM. 2000. SoilpH affects copper fractionation and phytotoxicity.Soil Science Society of America Journal 64: 955-962.

BISCHOF, C. 1995. Heavy metal concentrations of theendoparasitoid Glyptapanteles liparidis Bouche (Hy-menoptera) in contaminated Lymantria dispar lar-vae (Lepidoptera). Bull. Environ. Contam. Toxicol.55: 533-539.

DOOSTDAR, H., T. G. MCCOLLUM, AND R. T. MAYER.1997. Purification and characterization of an endo-polygalacturonase from the gut of West Indies sugar-cane rootstalk borer weevil (Diaprepes abbreviatusL.) larvae. Comp. Biochem. Physiol. 118B: 861-867.

TABLE 2. SURVIVAL OF LATE INSTARS, LARVAL AND PUPAL PERIODS, AND MEAN WEIGHT OF ADULTS AT EMERGENCE OFDIAPREPES ROOT WEEVIL REARED ON ARTIFICIAL DIET CONTAINING BACKGROUND COPPER (12 PPM) OR COP-PER SULFATE OR COPPER HYDROXIDE INCORPORATED AT THREE RATES.

Coppersource

Rate (ppm)

Survival(%)

Larvalperiod (d)

Pupalperiod (d)

Adult weight (mg)

Males n Females n

CuSO4 250 70 121.5 ± 6.5 18.1 ± 0.8 279.2 ± 12.6 10 377.0 ± 37.1 11CuSO4 500 57 130.1 ± 9.7 19.4 ± 1.1 270.5 ± 12.4 5 350.5 ± 16.4 12CuSO4 1000 73 128.4 ± 5.7 17.7 ± 1.2 259.7 ± 9.8 13 335.0 ± 16.2 9Cu(OH)2 250 57 120.4 ± 7.5 20.3 ± 0.9 289.9 ± 23.8 8 369.0 ± 12.9 9Cu(OH)2 500 57 121.8 ± 9.7 18.4 ± 0.6 294.9 ± 7.3 10 334.9 ± 12.6 7Cu(OH)2 1000 53 133.6 ± 8.9 21.1 ± 1.2 281.7 ± 12.2 6 354.0 ± 21.8 10Diet only 12 60 117.8 ± 5.7 18.5 ± 0.7 291.3 ± 13.1 10 312.8 ± 14.1 8

Means within columns are not significantly different (α = 0.05, ANOVA).


FARGASOVA, A. 2001. Winter third- to fourth-instar lar-vae of Chironomus plumosus as bioassay tools for as-sessment of acute toxicity of metals and their binarycombinations. Ecotoxicol. Environ. Saf. 48: 1-5.

FLORIDA COOPERATIVE EXTENSION SERVICE. 2000. Flor-ida Crop/Pest Management Profiles: Citrus (Oranges/Grapefruit). Document CIR 1241, Pesticide Informa-tion Office, Food Science and Human Nutrition De-partment, Florida Cooperative Extension Service,Institute of Food and Agricultural Sciences, Univer-sity of Florida. http://edis.ifas.ufl.edu.

GIANESSI, L. P., AND C. A. PUFFER. 1992. Fungicide usein U.S. crop production: Washington, D.C., Resourcesfor the Future, Quality of the Environment Division(variously paged).

GINTENREITER, S., J. ORTEL, AND H. J. NOPP. 1993. Ef-fects of different dietary levels of cadmium, lead,copper, and zinc on the vitality of the forest pest in-sect Lymantria dispar L. (Lymantriidae, Lepid).Arch. Environ. Contam. Toxicol. 25: 62-66.

LAPOINTE, S. L. 2000. Thermal requirements for devel-opment of Diaprepes abbreviatus (Coleoptera: Cur-culionidae). Environmental Entomol. 29: 150-156.

LAPOINTE, S. L., AND J. P. SHAPIRO. 1999. Effect of soilmoisture on development of Diaprepes abbreviatus(Coleoptera: Curculionidae). Florida Entomol. 82:291-299.

RAYMS-KELLER, A., K. E. OLSON, M. MCGAW, C. ORAY,J. O. CARLSON, AND B. J. BEATY. 1998. Effect ofheavy metals on Aedes aegypti (Diptera: Culicidae)larvae. Ecotoxicol. Environ. Saf. 39: 41-47.

SAS INSTITUTE, INC. 1999. StatView Reference. Cary,NC.

SHAPIRO, J. P., K. D. BOWMAN, AND H. S. SMITH. 1997.Resistance of citrus rootstocks and Glycosmis penta-phylla against larval Diaprepes abbreviatus (Co-leoptera: Curculionidae) in live root or diet-incorporation assays. Florida Entomologist 80: 471-477.

SHAPIRO, J. P., K. D. BOWMAN, AND S. L. LAPOINTE.2000. Dehydrothalebanin, a source of resistancefrom Glycosmis pentaphylla against the citrus rootweevil Diaprepes abbreviatus. J. Agric. Food Chem.48: 4404-4409.

VAN DER GEEST, H. G., W. J. SOPPE, G. D. GREVE, A.KROON, AND M. H. S. KRAAK. 2002. Combined effectsof lowered oxygen and toxicants (copper and diazi-non) on the mayfly Ephoron virgo. Environ. Toxicol.Chem. 21: 431-436.

WEATHERSBEE, A. A. III, AND Y. Q. TANG. 2002. Effectof neem seed extract on feeding, growth, survival,and reproduction of Diaprepes abbreviatus (Co-leoptera: Curculionidae). J. Econ. Entomol. 95:661-667.

30


87(1) March 2004

EXTERNAL MORPHOLOGY OF ABDOMINAL SETAE FROM MALE AND FEMALE

HYLESIA METABUS

ADULTS (LEPIDOPTERA: SATURNIIDAE)AND THEIR FUNCTION

J

ESSICCA

R

ODRIGUEZ

1

, J

OSE

V

ICENTE

H

ERNÁNDEZ

2

, L

IZETTE

F

ORNÉS

2

, U

LF

L

UNDBERG

3

,C

ARMEN

-L

UISA

A

ROCHA

P

IÑANGO

3

AND

F

RANCES

O

SBORN

1

1

Instituto de Investigaciones en Biomedicina y Ciencias Aplicadas, Universidad de Oriente, Cumaná, Venezuela

2

Laboratorio de Comportamiento, Dept. Biología de Organismos, Universidad Simón Bolívar, Caracas, Venezuela

3

Centro de Medicina Experimental, Instituto Venezolano de Investigaciones Científicas, Caracas, Venezuela

A

BSTRACT

Hylesia metabus

is a species of moth, distributed principally in northeastern Venezuela. Fe-male moths use their abdominal setae to cover their egg masses. Contact with these setaecan cause a severe dermatitis in humans. Setae from males do not produce these symptoms.The external morphology of the abdominal setae in male and female moths was describedand the effect of the setae on ant behavior was studied. We classified the setae into fourtypes, S1, S2, S3 and S4. In females, two of these types were found in the dorsal region; S1and S2 show a porous structure and measure 2000 µm and 155 µm in length, respectively.In the ventral part of the abdomen we observed three setae types, S1, S3 which are 190 µmlong and have small barbs along their length directed towards the apex, and S4 which havenumerous barbs at the base, but further up flatten out, with barbs along both sides, beforetapering off at the apex. S4 also were found in the lateral zones of the abdomen and were thepredominant type of setae covering the egg masses. Only S1 setae were found in males. Eggmasses not covered by setae were examined and transported by

Pheidole

ants, whereas cov-ered eggs were largely avoided. The morphology of the S3 and S4 setae types suggests thatthese may be related to the urticating properties reported for the moth. Ant avoidance of se-tae covered eggs suggests that these protect the eggs from at least some predators.

Key Words:

Urticating moth, egg protection, ants

R

ESUMEN

Hylesia metabus

es una especie de Lepidóptero, distribuida principalmente en el noreste deVenezuela. Las hembras adultas cubren sus huevos con sus setas abdominales. El contactocon estas setas causa una severa dermatitis en los humanos. Las setas provenientes de losmachos no producen tales sintomatologías. Se describió la morfología externa de las setasabdominales en mariposas machos y hembras y se estudio el efecto de las setas sobre el com-portamiento de las hormigas. Las setas se clasificaron en cuatro tipos, S1, S2, S3 y S4. Enlas hembras, dos de estos tipos se encontraron en la región dorsal; S1 y S2, las cuales pre-sentan una estructura porosa y con una longitud de 2000 µm y 155 µm respectivamente. Enla parte ventral del abdomen se observaron tres tipos de setas, S1, S3, que miden 190 µm delargo y tienen pequeñas espinas a lo largo de la seta, dirigidas hacia el ápice y S4, que pre-sentan espinas en la base, para luego aplanarse, con espinas a los lados, antes de volver aafilarse hacía el ápice. Las S4 se encuentran también en las zonas laterales del abdomen yson el tipo de seta predominante cubriendo los huevos. En los machos, el único tipo de setapresente son las S1. Grupos de huevos separados de la postura y desprovistos de setas fueronexaminados y cargados por hormigas del género

Pheidole

, mientras que éstas evitaron con-tacto con las posturas cubiertas de setas. La morfología de las S3 y S4, sugiere que éstas po-drían estar relacionadas con el efecto urticante de las mismas. La evasión por parte de lashormigas de los huevos cubiertos por las setas indica que éstas protegen los huevos de porlo menos algunos depredadores.


Urticating hairs or setae are found in speciesbelonging to 13 families and four superfamilies inthe order Lepidoptera. In most cases larvae haveurticating setae, and it is only in a few species thatthey are found on adults, for example in the gen-

era

Acyphas

and

Euproctis

in the Lymantridaeand in the genus

Hylesia

in the Saturniidae.The genus

Hylesia

is a Neotropical moth dis-tributed in the Americas from Mexico to Argen-tina (Lamy et al. 1984).

Hylesia metabus

Rodríguez et al.: Morphology of Setae from

Hylesia

metabus

31

(Cramer) 1775, (common name “Palometa Pe-luda”), is distributed principally in mangroveswamps in northeastern Venezuela (Fornés &Hernández 2001). The abdomens of the adult fe-males are exceedingly hairy and the females usethese hairs to cover their egg masses. It has beenspeculated that the hairs protect the eggs frompredators and parasites, although this has notbeen demonstrated. Although

Hylesia metabus

moths normally inhabit mangrove swamps,swarming adult moths are attracted by lights ofnearby towns and arrive in the thousands, releas-ing the urticating hairs into the air. Exposure tohairs from female moths leads to severe urticarialand papilovesicular dermatitis. Hairs from malemoths are not urticating.

Studies of the external morphology of

H. meta-bus

adult females have been undertaken, (Lamy& Lemaire 1983; Olivares & Vásquez 1984) anddifferent types of setae have been described.Lamy & Lemaire (1983) described what theycalled “flechettes” assuming that these were theonly setae to have urticating properties. Later,Vásquez (1990) reported three different types ofsetae present on female abdomens, and consid-ered that two of these types were urticating.Nonetheless, the only setae illustrated are simi-lar to those previously described by Lamy & Le-maire (1983). No detailed description of theexternal morphology of the different setae foundon female abdomens and egg nests is known to us.Neither has anyone described the non urticatingsetae from male abdomens. Here we describe thesetae from male and female abdomens and fromthe egg nests of

Hylesia metabus

moths. In addi-tion we studied the effect of the setae covering theegg masses on ant behavior in order to ascertainif these protect the eggs from foraging by the ants.

M

ATERIALS

AND

M

ETHODS

Preparation of Samples for Scanning ElectronMicroscopy (SEM)

Male and female

Hylesia metabus

pupae, andthe hairballs used by the females to cover theiregg masses were collected from mangroveswamps close to the town of Yaguaraparo, CajigalDistrict, Sucre State, Venezuela. The pupae weremaintained until the eclosion of the adults in theBiological Control Laboratory, at the Instituto deInvestigaciones en Biomedicina y Ciencias Apli-cadas, Universidad de Oriente, Cumaná, Venezu-ela. The larvae were maintained at 24 ± 2°C,relative humidity; 60 ± 5% and a photoperiod of12:12 (L:D). For SEM, abdomens from moths, andegg nests, were cut in pieces of approximately 1mm

3

, placed in glass vials and dehydrated in anoven at 40°C for 48h in the presence of silica gel.The abdomens were divided into three sections:dorsal, ventral, lateral, with each section being

further divided into anterior (towards the tho-rax), middle, and posterior (towards the oviposi-tor). Some of the abdomens were scraped toremove the hairs before being divided into equalsized sections as described above. The sampleswere coated with gold/palladium and observed ina Philips SEM 505 and a JEOL T-300 scanningelectron microscope (Stobbart & Shaw 1964).

Behavioral Experiments

The experiments with ants were carried out atthe Universidad Simón Bolívar, Caracas, Venezu-ela, following the methodology used by Osborn &Jaffé (1998) with some modifications. We used

Pheidole

sp. for the purposes of this study, as it iscommonly found in the vegetation and thus prob-ably regularly encounters lepidopteran eggs andlarvae. Two colonies of

Pheidole

sp. were collectedin the surroundings of the university and main-tained in the laboratory in plastic bowls of 1-mdiameter and 50-cm depth, at a constant temper-ature of 25°C and a relative humidity of 70-80%.A metal tripod 40 cm high was put in each bowl onwhich we placed a glass platform of 20 cm

3

as theforaging area. Two plastic lids of 5-cm diameterand 1-cm depth were placed on the glass plat-forms, and in these we put pieces of soft netting,one soaked in water and the other soaked in a 1:1ratio of water and honey. In addition, every twodays insects collected with entomological netswere placed on the foraging area.

For the bioassays, we placed an egg nest, withor without setae, on the foraging area of one of theant colonies. Eggs without setae were prepared byremoving the setae with forceps and washing theeggs with distilled water. The behavior of the antswas then observed during 15 mins. The egg nests,with or without setae, were tested separately, oneafter the other (the first to be tested was chosenrandomly), with each pair of assays being consid-ered an experiment. Nine replicates were per-formed, alternating between colonies so that eachcolony participated in only one experiment on anygiven day.

The results of the replicates were analyzed bya Wilcoxen-Mann-Whitney test, comparing eachresponse by the ants (exploration, touching, walk-ing over and transport of the eggs) towards setae-less, and setae-covered eggs separately (Siegel &Castellan 1988).

R

ESULTS

External Morphology of the Setae

The hairs (or setae) of adult moths are distrib-uted in lateral bands along the abdomen. In thedorsal (anterior, middle and posterior) sections offemale abdomens we observed two types of setaewhich we shall refer to as types S1 and S2 (Fig. 1).

32


87(1) March 2004

S1 type setae were approximately 2 mm long,with a diameter of 5 to 5.3 µm at the base andvariable widths of between 4.6 and 24 µm alongthe rest of their length. These setae showed a veryporous lattice type structure and the apices of thesetae were blunt (Figs. 2 and 3, Table 1). S2 type

setae were between 182 and 220 µm long andwere similar to S1 setae in that they also showeda very porous lattice type structure. They were cy-lindrical at the base, with a diameter of 5.5 to 6µm, but then fanned out in the shape of a shield,with the apex in the form of a W (Fig. 1, Table 1).

Figs. 1-6. 1) General view of the dorsal region of the female abdomen showing setae types S1 and S2. Note theblunt apex of the S1 setae. Bar = 38 µm. 2) Detail of abdominal setae types S1 and S2. Note the porous nature ofthe setae (arrow). Bar = 32 µm. 3) Detail of the base of a S1 type setae. B: base of setae. Lp: Large pocket Bar = 13µm. 4) General view of an S3 type setae (S3). Bar = 20 µm. 5) Detail of the base of an S3 type setae. Note the blunt-ness of the barbs. Sp: small pocket. (�) Bar = 7 µm. 6) Detail of the apex of an S3 type setae. Note the sharpness ofthe barbs (Ba). Bar = 5 µm.


Hylesia

metabus

33

In the ventral sections of female abdomens weidentified three types of setae; S1 type setae (al-ready described) were abundant in the ventralanterior part of the abdomen. S3 type setae werepredominant in the middle ventral area, theywere approximately 190 µm long, with a diameterof 2.5 to 3.1 µm at the base (Figs. 4 and 5, Table 1).They were smooth, without any holes or pores(Fig. 4). Along their length were small barbs, di-rected towards the pointed distal end. At the baseof the setae these had rounded points which be-came sharper towards the apex (Figs. 5 and 6). S4type setae were abundant in the ventral posteriorpart of the abdomen; they were approximately 1mm long and showed a more complex morphology(Figs. 7-10); the base of the setae had a diameterof 4.2 to 7.5 µm and the surface was made up ofnumerous barbs (Fig. 8, Table 1), further up, thesetae flattened out to a width of approximately 60µm, with triangular barbs along both sides (Fig.9, Table 1). Towards the apex, the setae thinnedout into a thin cylindrical tube where, in somephotographs, secretion drops were observed (Fig.10, Sd). S4 setae were also found in the lateralsections of the female abdomens, where they werethe only type of setae observed.

The S1, S2 and S4 setae were inserted in pock-ets with diameters of 7 to 7.7 µm (Figs. 1, 3, 5, 8,11, Table 1), and S3 setae in pockets with diame-ters of 3.2 to 4.6 µm (Figs. 5 and 11, Table 1).These pockets varied in density depending ontheir position on the abdomen. In the dorsal partsof the abdomen where types S1 and S2 were lo-cated, the pockets had a density of approximately1000/mm

2

(Fig. 5) The pockets on the lateral partsof the abdomen, where the S4 type setae werelocated had a density of 3500/mm

2

(Fig. 8) In theventral zone of the abdomen, the large pockets,holding S1 and S4 setae, had a density of 2000/mm

2

, and in the ventral middle zone, where theS3 setae were located, the small pockets werevery abundant; approximately 50000 / mm

2

, andtightly packed, so that the cuticle could not beseen (Fig. 5). In the anterior ventral part of theabdomen only large pockets could be observed. InFigure 11, the abrupt change between the middleand anterior parts of the abdomen can be seen.

In the egg nests the dominant type of setae ob-served was S4, although S1 and S3 setae werealso present (not shown) In males only S1 type se-tae were found.

Behavioral Experiments

Definition of Behavioral Responses of Ants.Preliminary experiments with eggs allowed us todefine the following behavioral responses of the

Pheidole

ants towards the larvae: (1) Exploration:ants touch the eggs with their antenna for a pe-riod of >1 sec., (2) Touch: ants touch the eggs withtheir mandibles for a period of >1 sec., (3) Walkover: ants walk over the eggs, (4) Transport: antstransport the eggs towards their nests.

Behavioral Responses of the Ants to Eggs with and without Setae

Table 2 shows the results of the experimentswith the ants. It can be observed that there is asignificant difference between treatments for theexploration and carrying behaviors with a total of19 ants exploring uncovered egg masses com-pared with 0 ants exploring covered egg masses. Atotal of 16 ants carried uncovered egg masses totheir nest compared with 0 ants carrying coveredegg masses. In fact, the ants seemed to largely ig-nore the covered egg masses, and avoided contactwith them.

D

ISCUSSION

This study represents a first detailed descrip-tion of the morphology of the setae of adult maleand female

Hylesia metabus

moths. Based onmorphological characteristics, we have classifiedthe setae into four distinct types that we havecalled S1, S2, S3, and S4, respectively.

Due to their porous nature and lack of sharppoints or barbs, S1 setae are unlikely to be urti-cating. Furthermore S1 was the only type of setaefound in male moths which do not have urticatingproperties. S2 type setae, observed from the dor-sal zone of female abdomens, and structurallysimilar to S1 are also unlikely to be urticating.

T

ABLE

1. M

EASUREMENTS

OF

THE

DIFFERENT

TYPES

OF

ABDOMINAL

SETAE

FROM

MALE

AND

FEMALE

H.

METABUS

MOTHS

.

Setae type

Width at base (µm) Maximum width (µm) Length (mm) Width of pocket opening (µm)

Av. Std. Dev. Av. Std. Dev. Av. Std. Dev. Av. Std. Dev.

S1 5.1 0.1 11.0 6.3 29.1 2.0 7.3 0.2S2 5.7 0.1 46.0 2.7 12.8 0.2 7.7 0.4S3 2.9 0.2 8.0 0.7 15.0 0.19 4.0 0.6S4 5.5 1.2 58.6 3.8 32.0 1.0 7.0 0.4

N = 20.

34


87(1) March 2004

The S3 and S4 types of setae are found only infemales and may be related to the urticatingproperties. The urticating setae found on larvaebelonging to the genus

Thaumetopoea

(Notodon-tidae) show a similar length (150-250 µm) andshare some structural similarities with the S3 se-tae of the

Hylesia

moths, i.e., small, sharp barbs

pointing towards the distal end (Lamy & Novak1988). Urticating setae similar to the S3 typehave been described from several species of

Hyle-sia

moths (Lamy & Lemaire 1983). These authorsreported that in

H. metabus

the setae were 100 to225 µm in length. Further descriptions of thesesetae report a density of 50000 setae/mm

2

, as

Figs. 7-11. 7) General view of the lateral region of the female abdomen showing setae type S4. Note the curvednature of the setae. Bar = 76 µm. 8) Detail of the base of an S4 type setae. Lp: large pocket. Bar = 10 µm. 9) Detailof the middle section of an S4 type setae. Note the lateral barbs (�). Bar = 23 µm. 10) Detail of the apex of an S4type setae. Note the secretion drop (Sd). Bar = 210 µm. 11) Detail of the change in pocket sizes between the anteriorventral and middle ventral regions of the female abdomen. Sv: anterior ventral region, Mv: middle ventral region,Sp: small pocket. Bar = 20 µm.


Hylesia

metabus

35

found in this study (Lamy et al. 1984; Pelissou &Lamy 1988).

Setae similar to the S4 type have not, as far aswe know, been previously described. Nonetheless,their morphology (sharp barbs at the base, andtriangular barbs further up) suggests that theymay have urticating properties. The secretiondrops observed at the apex of one of these setaealso suggests that they contain a liquid sub-stance. Biochemical studies have demonstratedthe presence of a kallikrein-like substance (asso-ciated with increased vascular permeability andthe production of pain) in the urticating hairs offemale

H. metabus

moths (Lundberg et al. 2002).Furthermore, the setae are associated with theovipositor in female moths and are the mostabundant type of setae in the egg nests which areknown to be very urticating (personal experienceof three of the authors).

Although several species of larvae having urti-cating setae with different morphologies havebeen described (e.g., Perlman et al. 1976; Press etal. 1977), the information on setae from adultmoths is scarce. Apart from

H. metabus

, the onlyother species of moth reported as having morethan one type of urticating setae is

Anaphe venata

(Notodontidae: Thaumetopoinae). Nevertheless,although the setae on

A. venata

are different insize and posture, both types of setae show thesame structure: they are sharp at both ends andsquare when cut transversally, with barbs on allfour sides. (Lamy 1984; Lamy et al. 1984). In thisspecies, the female moths release the urticatingsetae by means of abdominal contractions, plac-ing them over the eggs, in a similar way to that of

H. metabus

(Lamy 1984; Lamy et al. 1984).Behavioral experiments with ants suggest that

they are not repelled by the abdominal hairs cover-ing the egg nests (no alarm behavior was re-corded), but rather ignore or avoid them. The eggsof some species of insects, e.g.,

Gastrophysa cyanea

(Coleoptera: Chrysomelidae) contain oleic acidwhich repel several species of ants (Howard et al.1982). The hairs covering

H. metabus

eggs maysimply hide the eggs from the ants. This suggeststhat the urticating characteristics of the hairs maybe directed towards avian or mammal predators.

In conclusion, we have characterized four dis-tinct classes of setae present in the abdominalwall of male and female adults of

Hylesia meta-bus

. We have chosen to call these different typesof setae S1, S2, S3, and S4. In the egg nests, theS4 type of setae is the predominant type. Thisstudy thus represents the first description of fourmorphologically different types of setae from onespecies of moth, two of which are probably urti-cating.

Setae covered eggs seem to be protected frompredation by ants, although the setae seem to actas a physical barrier rather than a chemical one.

A

CKNOWLEDGMENTS

The authors thank Srs. Andrés Villegas and Norb-erto Pino for assistance in the collection of the

H. meta-bus

moths and egg nests, and the Centro de Ingenieriade Superficies-Universidad Simón Bolívar and GlenRódriguez for technical assistance. This study was sup-ported in part by the Consejo de Investigación of theUniversidad de Oriente, Project No. CI-5-1901-0820198and by FONACIT (Fondo de Investigación Regional) toFO, and the Universidad Simón Bolívar to JVH.

R

EFERENCES

C

ITED

F

ORNÉS

, L.,

AND

J. V. H

ERNÁNDEZ

. 2001. Reseñahistórica e incidencia en la salud pública de

Hylesiametabus

(Cramer). (Lepidoptera: Saturniidae) enVenezuela. Entomotropica 16(2): 137-141.

H

OWARD

, D. F., M. S. B

LUM

, T. H. JONES, AND D. W.PHILLIPS. 1982. Defensive adaptions of eggs andadults of Gastrohysa cyanea (Coleoptera: Chryso-melidae). J. Chem. Ecol. 8: 453-462.

LAMY, M. 1984. La processionnaire du colatier: Anaphaevenata Butler (Lepidoptere: Thaumetopoeidae): pap-illon urticant d´Afrique. The cola processionarymoth: Anaphae venata Butler (Lepidoptere: Thau-metopoeidae): an urticating moth from Africa [Mor-phology, cause of human diseases]. Insect Scienceand its Application 5(2): 83-86.

LAMY, M., AND C. LEMAIRE. 1983. Contribution á lasystématique des Hylesia: etude au microscope élec-tronique á balayage des “flechettes” urticantes. Sys-tematics of the Hylesia spp. study with scanningelectronic microscopy. Bulletin de la Societé Ento-mologique de France 88(3/4): 176-192.

TABLE 2. RESPONSES OF PHEIDOLE SP. ANTS TO SETAE-LESS AND SETAE-COVERED EGG MASSES OF H. METABUS.

Ant behaviorEggs

without setaeEggs

with setae Value of ZProbability of difference

between treatments

Exploration 18 0 -2.842 0.014*Walk over 22 8 -0.287 0.796Touch with mandibles 10 0 -1.835 0.258Carry 16 0 -2.85 0.014*

The numbers refer to the total number of ants that behaved in a certain way to the egg nests for all nine replicates.*Significant difference between treatments.N = 9.


LAMY, M., AND F. NOVAK. 1988. Mise en place et dif-férenciation de láppareil urticant de la Chenille pro-cessionnaire du chêne (Thaumetopoea processioneaL.) (Lépidoptéres, Thaumetopoeidae) au cours de sondéveloppment larnaire. Annales des Sciences Na-turelles, Zoologie, Paris. 13 Série 9(1): 55-65.

LAMY, M., M. H. PASTUREAUD, F. NOVAK, AND G. DU-COMBS. 1984. Papillons urticants dÁfrique etdÁmérique du sud (g. Anaphae et g. Hylesia): Contri-bution du microscope électronique a balayage al´etude de leur appareil urticant et a leur mode d´eaction. Urticating moths of Africa (genus Anaphae)and of South America (genus Hylesia). Bulletin de laSocieté Zoologique de France 109(2): 163-177.

LUNDBERG, U., F. R. OSBORN, Z. CARVAJAL, A. GIL, B.GUERRERO, AND C. L. AROCHA-PIÑANGO. 2002. Isola-tion and partial characterization of a proteasen withkallikrein-like activity from the egg nests of Hylesiametabus (Cramer 1775) (Lepidoptera: Saturniidae),preliminary communiation. Revista Científica12(2)97: 102.

OLIVARES, M. A., AND L. N. VÁSQUEZ. 1984. Morfologíaexterna de escamas de Hylesia sp. a nivel de mi-croscopía electrónica. IX Congreso Venezolano deEntomología, Abstract No. 69, Tachira, Venezuela.1984.

OSBORN, F., AND K. JAFFÉ. 1998. Chemical ecology ofthe defense of two butterfly larvae against ants. J.Chem. Ecol. 24(7):1173-1186.

PELISSOU, V., AND L. LAMY. 1988. Le Papillon Cendre:Hylesia metabus (Cramer (= H. urticans) Floch etabonnenc) (Lepidopteres Saturniidae) Papillon urti-cant de guyane Francaise: Etude Cytologique de SonAppareil Urticant. Insect Science and its Application9(2)185-189.

PERLMAN, F., E. PRESS, J. A. GOOGINS, A. MALLEY, ANDH. POAREA. 1976. Tussockosis: Reactions to DouglasFir Tussock moth. Annals of Allergy 36:302-307.

PRESS, E., J. A. GOOGINS, H. POAREO, K. JONES, F. PERL-MAN, AND J. EVERETTE. 1977. Health to timber andforestry workers from the Douglas Fir Tussock moth.Archives of Environmental Health 32: 206-210.

SIEGEL, S., AND J. CASTELLAN. 1988. Nonparametricstatistics for the behavioural sciences. McGraw Hill.New York, London. 399 pp.

STOBBART, R. H., AND J. SHAW. 1964. Salt and waterbalance: excretion, pp. 189-235. In R. Rockstein(Ed.), The Physiology of Insects, Vol. 3. AcademicPress, New York, London. 350 pp.

VÁSQUEZ, L. N. 1990. Estudio bioecológico y tacticas decontrol de la Palometa Hylesia metabus Crammer.en el oriente de Venezuela. Saber 3(1): 14-20.

Matthews & Gonzalez: Nesting Biology 37

NESTING BIOLOGY OF

ZETA ARGILLACEUM

(HYMENOPTERA:VESPIDAE: EUMENINAE) IN SOUTHERN FLORIDA, U.S.

R

OBERT

W. M

ATTHEWS

AND

J

ORGE

M. G

ONZÁLEZ

University of Georgia, Department of Entomology, Athens, GA 30602, USA

A

BSTRACT

Zeta argillaceum

(L.), a common neotropical wasp, is established in Florida. The character-istic mud potter-like nests are easily recognized. They prey on geometrid caterpillars. Theirnests are reused by various arthropods, forming an ecological web similar to that of othermud dauber wasps. Prey, inquilines, parasites, and scavengers found inside the nests arepresented.

Key Words:

Pachodynerus erynnis

,

Pachodynerus nasidens

,

Anthrax

sp.,

Melittobia austral-ica

,

Anthrenus

sp.,

Macrosiagon

sp.,

Chalybion californicum

R

ESUMEN

Zeta argillaceum

(L.) es una avispa neotropical muy común y está establecida en Florida. El-las construyen nidos de barro en forma de vasija, fáciles de reconocer. Sus hospedadores sonlarvas de geométridos. Sus nidos son reutilizados por varios artrópodos y forman una redecológica similar al de otras avispas constructoras de nidos de barro. Se presentan en estetrabajo los hospedadores, inquilinos, parásitos y carroñeros

encontrados dentro de los nidos.


Zeta

is a small neotropical eumenine wasp ge-nus with 4 species that range from Mexico to Ar-gentina and also Trinidad, in the West Indies(Bertoni 1934; Bodkin 1917; Callan 1954; Car-penter 1986b, 2002; Carpenter & Garcete-Barrett2002; Giordani Soika 1975; Martorell & EscalonaS. 1939; Rocha 1981a, b).

Zeta argillaceum

(L.)(Fig. 1) is probably one of the commonest potterwasps in South America. It is well adapted to ur-ban environments; it is easy to find its distinctivemud nest attached to house walls (Garcete-Bar-rett, pers. comm.). The nests can be also found insheltered spots under bridges, electric poles andeaves (Bodkin 1917; Chavez 1985; Rocha 1981b)and can be easily transported on ships, therebyexpanding its distribution (Bertoni 1934). Themud cell normally appears uniformly colored, butif not it is often due to subsequent closures of theoriginal emergence hole by inquilines or opportu-nistic “renter” species (Bertoni 1911).

Recently introduced into the Southern UnitedStates (Menke & Stange 1986; Stange 1987),

Z.argillaceum

appears to be expanding its range.Like mud daubers in the genera

Trypoxylon

and

Sceliphron

,

Z. argillaceum

nests harbor not onlyits offspring but also numerous other arthropods,including scavengers, parasites and predators,and their nests could be used to teach ecologicalinteractions (Matthews 1997).

Menke & Stange (1986) summarized the nest-ing biology of

Z. argillaceum

. They relied heavilyon Taffe (1979) who studied the biology of

Zetacanaliculatum

(=

Z. argillaceum

) in Trinidad. Asimilar approach was used to study

Z. argillacea

(=

Z. argillaceum

) in Brazil (Rocha & Raw 1982).In many aspects the general biology resembledthat of the related

Z. abdominale

(Drury) (in somecases using its synonym

Eumenes colona

Saus-sure) studied in Jamaica by Freeman & Taffe(1974), Taffe & Ittyieipe (1976), and Taffe (1978,1979, 1983). Detailed accounts of the inquilinesand parasites of

Z. argillaceum

in Brazil and in

Fig. 1. Zeta argillaceum female, lateral view. Rulermarking are in mm. Inset is portrait of head, frontalview.

38


87(1) March 2004

Venezuela are given by Bruch (1904), Rocha(1981a, 1981b), Rocha & Raw (1982) and Chávez(1985). Here we present the first biological data forthis species from North America, and demonstratethat it is well established in southern Florida.

M

ATERIALS

AND

M

ETHODS

Seventy-three cells of

Zeta argillaceum

werecollected from the roofs of two beach shelters atHutchinson Boulevard, Martin County, Florida

on 28 July 2003. Cells were dissected and con-tents recorded. Live material was reared underlaboratory conditions (25°C, 70% RH) and identi-fied. Voucher specimens were deposited in the en-tomological collection of the Georgia Museum ofNatural History, Athens, Georgia.

R

ESULTS

AND

D

ISCUSSION

Nests of

Zeta argillaceum

consist of rounded,pot-like cells (Fig. 2). Nest clusters contained up

Figs. 2-5. 2, Five-celled nest of Zeta argillaceum. Left arrow indicates plug sealing entrance to cell. Right arrowshows open entrance of a cell. Ruler marking are in mm. 3, Caterpillar prey stocked in cell of Z. argillaceum. 4, Egg(arrow) attached with a silk thread to the cell wall; egg is 3 mm long. 5, unidentified spider using cell as shelter.

Matthews & Gonzalez: Nesting Biology 39

to 15 cells. Most contained 4-7 cells, but isolatedsingle cell nests were also found. Most nests inour sample were old and many had been reused,suggesting that the site had been occupied forsome time. Taffe (1979) found that

Z. argillaceum

had 6 generations per year in Trinidad, each re-quiring about 60 days. In subtropical Florida it isprobable that the species can have up to 4-5 gen-erations, leading us to infer that the site had beenused for at least a year.

Cells measured 14-18 mm in diameter (Fig. 2)and about 9-13 mm height. Eleven cells were re-cently made, and contained paralyzed but respon-sive caterpillars representing two unidentifiedspecies of Geometridae. Larvae of this lepi-dopteran family are reported as common prey of

Z. argillaceum

elsewhere (Callan 1954; Rocha1981a). One cell (Fig. 3) contained 19 geometridcaterpillars (15 of one species) and a newlyhatched wasp larva. The wasp’s egg (Fig. 4) is sus-pended in the empty cell.

Many of the remaining cells (52 of 62) were re-used by other arthropods. This rate of reuse washigher than previously found in Brazil (42.75%)and Trinidad (42.72%), where the wasp is verycommon (Rocha 1981b; Taffe 1979). It appearsthat

Z. argillaceum

builds a new nest each time,as there are no reports of it re-using old nests. Ta-ble 1 lists the arthropods found in the cells of

Z. argillaceum.

Two other Eumeninae,

Pacho-dynerus nasidens

(Latreille) and

P. erynnis

(Lepe-letier) were found reusing

Z. argillaceum

cells.


, the most widespread spe-cies in the genus and distributed from the U.S. toArgentina, but not in Chile, and also in the Anti-lles (Carpenter 1986a; Willink & Roig-Alsina1998),

use the cells by dividing them in two byadding a wall in the middle, so from each

Z.argillaceum

cell 2

P. nasidens

wasps will emerge.These wasps reused 24

Z. argillaceum

cells. InBrazil,

P. nasidens

also are recorded to build two

cells inside of reused cells of

Z. argillaceum

(Rocha 1981a, b).


, the onlyred-marked

Pachodynerus

in the U.S. (J. M. Car-penter, pers. comm.), and restricted to the south-east (Carpenter 1986a; Willink & Roig-Alsina1998), use the cells unmodified so that only oneindividual of this species emerges per

Z. argilla-ceum

cell. Apparently only two

Z. argillaceum

cells in our sample were reused by

P. erynnis

.However, two other

Z. argillaceum

cells containeddead and mummified larvae of Noctuidae, whichcould have been prey of that wasp, as found byKrombein (1967). The sphecid

Chalybion califor-nicum

(Saussure) also reused

Z. argillaceum

cells(one wasp found in a cell). Taffe (1979) reportedcells of

Z. argillaceum

being reused in Trinidad by

Trypoxylon

sp. and

Amobia

sp. The later wasprobably a parasite of

Trypoxylon

. Rocha (1981a,b) found that

Trypoxylon

sp. and

Pachodynerusnasidens

were the most common inquilines in oldnests of

Z. argillaceum

in Brazil. Some of the mortality factors for

Z. argilla-ceum

and the opportunistic wasps were a bee fly(

Anthrax

sp., Diptera: Bombyliidae), the Austra-lian wowbug (

Melittobia australica

, Hymenop-tera: Eulophidae) and one individual of

Macrosiagon

sp. (Coleoptera: Rhipiphoridae), aknown parasite of Eumeninae (Krombein 1967;Genaro 1996), that was found dead inside one oldcell.


was found parasitising

Z. argillaceum

in two of the cells, and

P. nasidens

in 4 reused cells. Mold was consuming the preycaterpillars in one cell. Taffe (1979) also mentionsmold attack, cuckoo wasps (Chrysididae), Ichneu-monidae and especially

Melittobia

sp. (=

M. aus-tralica

) as the most important mortality factors inthis potter wasp in Trinidad as well as in

Z. ab-dominale

in Jamaica.


wasalso found parasitising different Eumeninae inVenezuela including

Z. argillaceum

(Chávez1985; González 1994; González & Terán 1996).

T

ABLE

1. C

ONTENTS

OF

73

Z

ETA

ARGILLACEUM

NEST

CELLS

COLLECTED

IN

M

ARTIN

C

O

., F

LORIDA

, U.S.

Order (Family) Species Habits No. of Cells Used

Hymenoptera (Vespidae)

Zeta argillaceum

* Maker 11Hymenoptera (Vespidae)


Re-user 2 (+2)**Hymenoptera (Vespidae)


Re-user 24Hymenoptera (Sphecidae)

Chalybion californicum

Re-user 1Hymenoptera (Eulophidae)

Melittobia australica*** Parasite 6Coleoptera (Rhipiphoridae) Macrosiagon sp. Parasite 1Diptera (Bombyliidae) Anthrax sp. Parasite 1Coleoptera (Dermestidae) Anthrenus sp. Scavenger 10Psocoptera Scavenger 1Aranea Using nests as shelter 4Empty 10

*1 cell with a newly hatched wasp larva contained 19 prey larvae. Another cell had a recently laid wasp egg.**2 specimens of P. erynnis were found in 2 cells. Two other cells had larvae of Noctuidae caterpillars, typical prey of P. erynnis.***1 on Z. argillaceum, 5 on P. nasidens.


At least two species of scavengers were alsofound. Ten of the Z. argillaceum cells containedcarpet beetles (Anthrenus sp. Coleoptera: Derm-estidae), while Psocoptera were found only in 1old cell. Web remnants and live spiders werepresent in four old cells, which probably servedas shelters (Fig. 5). Many other insects presentin Florida are also potential users of Z. argilla-ceum nests, such as Crematogaster ants, thatalso have been found using old nest cells (Bodkin1917).

Clearly the persistence of the mud pots of Z.argillaceum after the emergence of their originalprogeny provides a home for a diverse communityof opportunists and nest associates. The composi-tion of this community no doubt differs from loca-tion to location, but generally includes othercavity-nesting Hymenoptera and their parasites,scavengers and associates. In this small samplewe found a community involving some 10 arthro-pod species. Thus, such nests are potentially use-ful for teaching ecological concepts as well ashelping to maintain biological diversity in rela-tively urban environments by providing shelterand food to other species of arthropods.

ACKNOWLEDGMENTS

We thank Bolívar Garcete-Barrett and James M.Carpenter for comments and providing relevant litera-ture. J.M. Carpenter also kindly identified the Pacho-dynerus spp. The study was partially supported byNSF Grant 0088021, R.W. Matthews Principal Investi-gator.

REFERENCES CITED

BERTONI, A. 1911. Contribución a la biología de las avis-pas y abejas del Paraguay (Hymenoptera). An. Mus.Nac. Hist. Nat. Buenos Aires 22: 97-146.

BERTONI, A. 1934. Contribución al conocimiento de losEumeneidos. El antiguo género Eumenes Latr (s.lat.) (Nuevo punto de vista para la clasificación).Rev. Soc. Cient. Paraguay 3(4): 109-122.

BODKIN, G. E. 1917. Notes on some British Guiana Hy-menoptera. Trans. Entomol. Soc. Lond. 1917: 297-321.

BRUCH, G. E. 1904. Le nid de l’Eumenes canaliculata(Oliv.) Sauss. et observations sur deux de ses para-sites. Rev. Mus. La Plata 11: 223-226.

CALLAN, E. MC. 1954. Observations on Vespoidea andSphecoidea from the Paria Peninsula and Patos Is-land, Venezuela. Bol. Entomol. Venez. 9(1-4): 13-26.

CARPENTER, J. M. 1986a. A synonymic generic checklistof the Eumeninae (Hymenoptera: Vespidae). Psyche93: 61-90.

CARPENTER, J. M. 1986b. The genus Pachodynerus inNorth America (Hymenoptera: Vespidae: Eumeni-nae). Proc. Entomol. Soc. Wash. 88(3): 572-577.

CARPENTER, J. M. 2002. Return to the subspecies con-cept in the genus Zeta (Hymenoptera: Vespidae; Eu-meninae). Bol. Mus. Nac. Hist. Nat. Paraguay 14 (1-2): 19-24.

CARPENTER, J. M., AND B. R. GARCETE-BARRETT. 2002.A key to the Neotropical genera of Eumeninae (Hy-

menoptera: Vespidae). Bol. Mus. Nac. Hist. Nat.Paraguay 14 (1-2): 52-73.

CHÁVEZ, A. H. 1985. Morfología, ciclo de vida y compor-tamiento de Zeta argillaceum (L.) (Hymenoptera:Eumenidae). [Trabajo de ascenso] Barquisimeto,Lara, Venezuela. Universidad Centro OccidentalLisandro Alvarado. 74 pp.

FREEMAN B. E., AND C. A TAFFE. 1974. Population dy-namics and nesting behaviour of Eumenes colona(Hymenoptera) in Jamaica. Oikos 25: 388-394.

GENARO, J. A. 1996. Nest parasites (Coleoptera, Diptera,Hymenopteran) of some wasps and bees (Vespidae,Sphecidae, Colletidae, Megachilidae, Anthophori-dae) in Cuba. Carib. J. Sci. 32(2): 239-240.

GIORDANI SOIKA, A. 1975. Sul genere Zeta. Boll. Mus.Civ. Venezia 27: 111-135.

GONZÁLEZ, J. M. 1994. Taxonomía, biología y compor-tamiento de avispas parasíticas del género Melit-tobia Westwood (Hymenoptera: Eulophidae) enVenezuela. Ph.D. Thesis. Maracay, Aragua: Univer-sidad Central de Venezuela. 118 pp.

GONZÁLEZ, J. M., AND J. B. TERÁN. 1996. Parasitoidesdel género Melittobia Westwood (Hymenoptera: Eu-lophidae) en Venezuela. Distribución y Hospederos.Bol. Entomol. Venez. N.S. 11(2): 139-147.

KROMBEIN, K. V. 1967. Trap nesting wasps and bees:life histories, nests and associates. Washington,D.C.: Smithsonian Institution Press. 570 pp.

MARTORELL, L. F., AND A. ESCALONA SALAS. 1939. Addi-tional insect records from Venezuela. J. Agric. Univ.Puerto Rico 23(4): 233-255.

MATTHEWS, R. W. 1997. Teaching ecological interac-tions with mud dauber nests. Am. Biol. Teacher59(3): 152-158.

MENKE, A. S., AND L. A. STANGE. Delta campaniformerendalli (Bingham) and Zeta argillaceum (Linnaeus)established in southern Florida, and comments ongeneric discretion in Eumenes s.l. (Hymenoptera:Vespidae: Eumenidae). Florida Entomol. 1986.69(4): 697-702.

ROCHA, I. R. D. 1981a. Biologia e ecologia da vespasolitária Zeta argillacea (Hymenoptera, Eu-menidae). Ciência e Cultura 33: 87-92.

ROCHA, I. R. D. 1981b. Inquilinos em células vazias deZeta argillacea (L. 1758) (Hymenoptera, Eu-menidae). An. Soc. Entomol. Brasil. 10: 187-197.

ROCHA, I. R .D., AND A. RAW. 1982. Dinâmica das popu-laçoes da vespa Zeta argillacea. An. Soc. Entomol.Brasil. 11: 57-78.

STANGE, L. 1987. Zeta argillaceum on the move. Sphe-cos (15): 1.

TAFFE, C. A. 1978. Temporal distribution of mortality ina field population of Zeta abdominale (Hymenop-tera) in Jamaica. Oikos 31: 106-111.

TAFFE, C. A. 1979. The ecology of two West Indian spe-cies of mud-wasps (Eumenidae: Hymenoptera). Biol.J. Linn. Soc. 11: 1-17.

TAFFE, C. A. 1983. The biology of the mud-wasp Zeta ab-dominale (Drury) (Hymenoptera: Eumenidae). Zool.J. Linn. Soc. 77: 385-393.

TAFFE, C. A., AND K. ITTYIEIPE. 1976. Effect of nest sub-strata on the mortality of Eumenes colona saussure(Hymenoptera) and its inquilines. J. Anim. Behav.45: 303-311.

WILLINK, A., AND A. ROIG-ALSINA. 1998. Revisión delgénero Pachodynerus Saussure (Hymenoptera:Vespidae, Eumeninae). Contr. Am. Entomol. Inst.30(5): 1-117.

Aluja & Piñero: Low-tech Fruit Fly Attractant 41

TESTING HUMAN URINE AS A LOW-TECH BAIT FOR

ANASTREPHA

SPP.(DIPTERA: TEPHRITIDAE) IN SMALL GUAVA, MANGO, SAPODILLA

AND GRAPEFRUIT ORCHARDS

M

ARTÍN

A

LUJA

AND

J

AIME

P

IÑERO

Instituto de Ecología, A. C., Apartado Postal 63, 91000 Xalapa, Veracruz, Mexico

A

BSTRACT

We evaluated the attractiveness of three aqueous dilutions of human urine (HU 50, 25, and12.5%) to adults of pestiferous and nonpestiferous

Anastrepha

species (Diptera: Tephritidae)in small guava, grapefruit, mango, and sapodilla orchards with glass McPhail traps. As con-trol treatments we used a commercially available hydrolyzed protein bait (Captor Plus®)and tap water. In the guava orchard, the three urine dilutions were as effective as hydro-lyzed protein in attracting

A. fraterculus

. Also, when 25 and 50% urine were used, 93 and96%, respectively, of the adults captured were females. In the grapefruit orchard, protein-baited traps captured significantly more

A. ludens

than urine-baited traps. In the mango or-chard, both

A. obliqua

and

A. serpentina

were more attracted to hydrolyzed protein than toany other bait treatment. In the sapodilla orchard, traps baited with 50% urine surpassedall other treatments in the capture of

A. serpentina

and

A. obliqua

. Our findings indicatethat human urine performs as well or better than hydrolyzed protein in certain types of or-chards. They also support the notion that there is no “universal”

Anastrepha

bait. We con-clude that human urine is a viable, low-tech alternative

Anastrepha

bait for subsistence orlow income, small-scale fruit growers in rural Latin America.

Key Words:

Anastrepha

, Tephritidae, human urine, hydrolyzed protein, trapping, attractants

R

ESUMEN

Evaluamos el potencial atractivo de 3 diluciones acuosas de orina humana (OH 50, 25 y12.5%) para adultos de especies plaga y no plaga de

Anastrepha

(Diptera: Tephritidae) en pe-queños huertos de guayaba, toronja, mango y chico zapote utilizando trampas McPhail devidrio. Los tratamientos control consistieron de proteína hidrolizada (Captor Plus®) y agua.En la huerta de guayaba, las tres diluciones de orina fueron igual de efectivas que la pro-teína hidrolizada en capturar

A. fraterculus

. A diluciones de 25 y 50% de orina, el 93 y 96%,respectivamente, de las capturas fueron hembras. En la huerta de toronja, las trampas ce-badas con proteína capturaron significativamente más adultos que aquellas cebadas conorina. Un resultado similar se obtuvo en la huerta de mango donde se capturaron adultos de

A. obliqua

y

A. serpentina

. En la huerta de chico zapote, las trampas cebadas con orina al50% superaron a todos los demás tratamientos capturando significativamente más adultosde

A. serpentina

. Nuestros resultados indican que la orina tiene un potencial atractivo sim-ilar o en algunos casos mayor que la proteína hidrolizada en ciertos tipos de huertos. Tam-bién apoyan la noción de que no existe un cebo “universal” para

Anastrepha

. Concluimos quela orina humana representa una alternativa viable de baja tecnología para pequeños pro-ductores de bajo ingreso o subsistencia en áreas rurales de América Latina.


In recent years, there has been renewed inter-est in developing more efficient baits and trapsfor monitoring economically important fruit flies(Diptera: Tephritidae). Even though most re-sources have been invested in developing Medfly(

Ceratitis capitata

[Wiedemann]) traps (e.g.,Heath et al. 1995, 1996a, 1997; Epsky et al. 1995,1999; Katsoyannos et al. 1999a, b), there havebeen some interesting trap developments for

Anastrepha

spp. (Heath et al. 1995, 1997; Thomaset al. 2001),

Rhagoletis

spp. (Liburd et al. 1998;Prokopy et al. 2000; Stelinski & Liburd 2001),and

Toxotrypana curvicauda

Gerstaecker (Heathet al. 1996b).

A common theme in the approach followed todevelop this new generation of traps has beenfinding optimal combinations of visual and chem-ical elements and the desire to find appropriatesubstitutes for liquid-based traps such as theMcPhail (Epsky et al. 1995; Epsky & Heath1997). Given the need to monitor female numbersin adult fruit fly populations (Casaña-Giner et al.2001), there has been renewed interest in evalu-ating protein- and plant-based attractants. Al-though some of the resulting female-targetedtraps have shown promising results (Heath et al.1997; Epsky et al. 1999; Katsoyannos et al. 1999a,b), they still have to overcome questions of cost

42


87(1) March 2004

and manageability (e.g., susceptibility of traps todust or theft). Cost considerations are of para-mount importance given the trend toward phas-ing out large-scale governmental support for fruitfly management, and the subsequent transfer togrowers of the responsibility for funding manage-ment and eradication programs. The situation inLatin America is particularly critical becauselarge quantities of fruit are still produced by sub-sistence or resource-poor, small-scale growerswho cannot afford expensive monitoring andmanagement tools (Aluja & Liedo 1986; Aluja1996, 1999). Furthermore, market niches for or-ganically grown fruit are continuously expanding.As a result, the need for biorational managementschemes has become more critical than ever.

In the case of flies in the genus

Anastrepha

, thechallenge for developing a substitute for theMcPhail trap is particularly difficult. This liquid-based trap, developed in the early 1900s (McPhail1937, 1939), is still widely used throughout LatinAmerica in spite of its inefficiency and high cost(Aluja et al. 1989; Aluja 1999). However, it some-times outperforms the recently developed dry-based substitutes (e.g., Heath et al. 1995, 1997)because adult flies are attracted to the humid en-vironment in and around it, particularly duringthe dry season. The biggest challenge in develop-ing an effective substitute to the McPhail trap isthe occurrence of at least seven economicallyimportant

Anastrepha

species (

A. fraterculus

[Wiedemann],

A. grandis

[Macquart],

A. ludens

[Loew],

A. obliqua

[Macquart],

A. serpentina

[Wiedemann],

A. striata

[Schiner], and

A. sus-pensa

[Loew]; Aluja 1994), and the evidence thatnot all species respond with equal intensity to asingle bait (Aluja et al. 1989). As discussed byAluja (1999) and Aluja et al. (2001), the most ef-fective

Anastrepha

attractant will likely end upbeing a complex aromatic bouquet containing na-tive host fruit and food-based odors, as well assexual pheromones. Formulating such a lure andassembling a trap that is easy to handle and alsovisually attractive to all the economically impor-tant

Anastrepha

species will take time. But evenif such a trap design is ever produced, its cost maybe prohibitive especially given the low purchasingpower of the vast majority of fruit growers inLatin America. Therefore, developing cheap, low-tech baits and traps that are easily accessible tolocal growers should remain a high priority.

An inexpensive alternative fruit fly bait wasstudied by Hedström (1988) in Costa Rica. Thisauthor tested human urine (HU) in a guava or-chard, and found that McPhail traps baited withthis naturally occurring compound (50% dilutionin water) captured 10 times more

A. striata

and

A. obliqua

adults than traps baited with the com-mercially available torula yeast. In a laboratorystudy with

A. ludens

,

A. obliqua

,

A. serpentina

,and

A. striata

adults, Piñero et al. (2002) found

that responses toward human urine depended onprevious diet (e.g., protein-fed adults respondedweakly to baits), reproductive state (responseswere always greater in sexually mature individu-als than sexually immature individuals), and sex(female responses were greater than male re-sponses, particularly for sexually mature individ-uals) and, importantly, such responses variedamong species. More recently, Piñero et al. (2003)determined that McPhail traps baited with hu-man urine captured a high proportion of sexuallyimmature

A. obliqua

and

A. serpentina

females ina commercial mango orchard (cultivar Manila).

Here, we report the results of a study aimed atdetermining the attractiveness of three aqueousdilutions of human urine in glass McPhail traps.In an effort to make this study as useful as possi-ble to subsistence or small-scale, resource poorfarmers, we tested this naturally occurring com-pound in four types of environments (guava,grapefruit, mango, and sapodilla orchards), com-paring its effectiveness against the commerciallyavailable hydrolyzed protein bait (Captor Plus®)and tap water.

M

ATERIALS

AND

M

ETHODS

Study Sites

We worked in Cosautlán, Apazapan, andTuzamapan (central Veracruz, México), in small,unsprayed guava (

Psidium guajava

[L.]), grape-fruit (

Citrus paradisi

[Macfadyn]), mango(

Mangifera indica

[L.]), and sapodilla (

Manilkarazapota

[L.] P. Royen) orchards, during the periodof September 1995 to July 1997. Exact location ofstudy sites, orchard characteristics, and fly trap-ping dates for each orchard are shown in Table 1.

Bait Treatments

Five bait treatments were evaluated inMcPhail traps: 50%, 25%, and 12.5% water dilu-tions of human urine (HU50, HU25 and HU12.5,respectively), hydrolyzed protein (Captor Plus®,Agroquímica Tridente S.A. de C.V. México, D.F.; 10ml of protein per l of water), and tap water (controltreatment). Each trap was baited with 200 ml ofthe particular bait. The HU50, HU25, and HU12.5dilutions were prepared by mixing 100, 50 and 25ml of human urine in 100, 150 and 175 ml of tapwater, respectively. To avoid modifying bait pHvalues, we did not use Borax as a preservative.

The human urine stemmed from a singlesource (JP) because more donors could not make acommitment for the entire study period (1995-1997). The donor was a healthy 26-year old malewho followed a strict diet free of coffee, alcohol, vi-tamin supplements, food condiments such as hotchilies, and who did not smoke. Food ingested in-cluded vegetables, fruits, rice, meat, chicken, and


occasionally fish. This diet was started 15 daysprior to the initiation of the first set of experi-ments and maintained throughout the study pe-riod. The donating individual underwent amedical checkup to determine possible kidneydamage or any metabolic disorder. His urine waschemically characterized by a local laboratory(Laboratorio Hernández-Blázquez, Coatepec, Ve-racruz, México) and the results (exact informa-tion in Piñero et al. 2002) indicated that urea andammonia contents fell within the normal rangesfor a healthy individual (normal ranges: 20-30 g/100 ml for urea and 0.5-0.9 g/100 ml for ammonia;Bell et al. 1961; Anonymous 1981). Even thoughwe acknowledge that there can be variability inthe chemical composition of human urine due tofactors such as age and the quality and quantityof food ingested (Bell et al. 1961; Langley 1971;Anonymous 1981), we believe that the two compo-nents critical for the study (urea and ammonia)varied relatively little throughout the study be-cause the human urine used was always providedby a single, healthy individual who also followed astrict diet. Furthermore, we note that variabilityin bait composition is a common problem faced byresearchers even when buying commercially pro-duced protein-based baits. Hence, we believe thatall appropriate procedures were followed.

Trap Placement and Servicing Procedure

Five fruit trees of similar size and fruit loadwere selected within each of the four orchardtypes, except in the sapodilla orchard, where 20trees were used (see below). Tree canopy sizeranged between 4-6 m for grapefruit, guava andsapodilla and 10-12 m for mango. Five glassMcPhail traps, each baited with one of the five dif-ferent bait treatments, were placed at equidistantlocations (over 2 m apart in all cases and up to 8m in some) in the interior portion of each tree can-opy. However, in the sapodilla orchard, only onetrap was placed per tree because branches weretoo thin and, hence, trees would have not sup-ported all five traps. Every three days traps wereinspected, cleaned, and re-baited. This procedurewas carried out 20 times in each one of the or-chards. Trap positions were systematically ro-tated each servicing day. Even though weacknowledge that placing 5 traps in the same treemay have caused interaction between the baits,we believe that given the relatively large size ofthe tree canopies in which traps were hung, andthe fact that trap positions within the canopywere systematically rotated every three days,such a possible effect was most likely negligible.Besides, as our goal was to test human urine inlow-tech, resource poor scenarios, orchards weresmall and therefore the number of trees availableto us, with the exception of the sapodilla orchard,was not enough to test each bait in different trees.

T

AB

LE

1. D

ES

CR

IPT

ION

OF

ST

UD

Y

SIT

ES

IN

TH

E

ST

AT

E

OF

V

ER

AC

RU

Z

, M

EX

ICO

.

Sit

eN

orth

Lat

itu

deW

est

Lon

gitu

de

Alt

itu

de(m

eter

s ab

ove

sea

leve

l)F

ruit

tre

e sp

ecie

sO

rch

ard

Ch

arac

teri

stic

sT

rapp

ing

Per

iod

Cos

autl

án19

°20’

96°5

9’1,

298

Gu

ava

(

Psi

diu

m

guaj

ava

L.)

Abo

ut

20 g

uav

a tr

ees

wit

h

patc

hes

of

cow

pas

ture

. Cof

fee

plan

tati

on n

earb

y. G

uav

a fr

uit

pr

esen

t on

tre

es.

19 S

epte

mbe

r-24

O

ctob

er, 1

995

San

Ped

ro-T

uza

map

an19

°24’

96°5

2’92

2G

rape

fru

it (

Cit

rus

para

dis

i

M

acfa

dyn

)M

ixed

gra

pefr

uit

-cof

fee

orch

ard

inte

rspe

rsed

wit

h fr

uit

ing

oran

ge

tree

s. G

rape

fru

it p

rese

nt

on t

rees

.

29 N

ovem

ber,

1995

-05

Jan

uar

y, 1

996

Apa

zapa

n19

°19’

96°4

2’32

0M

ango

(

Man

gife

ra

ind

ica

L.)

(c

ult

ivar

Man

ila)

Man

go o

rch

ard

adja

cen

t to

a s

a-po

dill

a or

char

d. V

ery

low

am

oun

t of

man

go fr

uit

on

tre

es a

nd

no

sa-

podi

lla

fru

it p

rese

nt.

23 J

un

e-01

Sep

tem

ber,

1996

Apa

zapa

n19

°19’

96°4

2’32

0S

apod

illa

(

Man

ilka

ra z

apot

a

[L

.] P

. Roy

en)

Sap

odil

la o

rch

ard

adja

cen

t to

a

man

go o

rch

ard.

Sap

odil

la fr

uit

on

tr

ees

was

abu

nda

nt

and

man

go

har

vest

was

ove

r.

12 J

un

e-27

Ju

ly, 1

997

44


87(1) March 2004

Species and sex were determined for all adultscaptured. All females of the predominant fly spe-cies captured by traps in each orchard were exam-ined under a dissecting stereomicroscope todetermine the presence or absence of developedovaries (a measure of sexual maturity), by themethods of Martínez et al. (1995). Also, in each or-chard, ten pH readings were taken at different in-tervals with a portable pH meter (Cole-ParmerModel 59000-20, Chicago, IL, USA) for each one ofthe bait treatments.

Statistical Analyses

Since McPhail traps commonly capture adultsof up to 12

Anastrepha

species, statistical analyseswere conducted only on the predominant speciesin each orchard (one or two species are normallyabundant; Aluja et al. 1996). One-way analyses ofvariance (ANOVA) were carried out on fly/trap/day (FTD) values, pooling males and females foreach fly species. FTD values represent the totalnumber of adults captured per trap per day (Cele-donio-Hurtado et al. 1995). Data were square-roottransformed (X + 0.5) to homogenize variances butin the figures we present untransformed mean(±SE) values. In all cases, ANOVAs were followedby Fisher-protected LSD separations of treatmentmeans. For the most representative fly species ineach orchard type, linear regression analyseswere conducted to further determine the degree ofrelationship between the three concentrations ofhuman urine evaluated and attractiveness toadult flies. Comparisons of the numbers of femalesversus males of a particular species and bait treat-ment were performed with nonparametric Mann-Whitney tests. All analyses were carried out at the0.05% level of significance, with the software Sta-tistica® (StatSoft 1999).

R

ESULTS

Bait pH Values

Since there were no differences in pH valuesfor similar bait treatments among orchards (

F

=0.86, df = 3, 178,

P

> 0.05), we report global pHvalues for each bait (i.e., pooled over all orchards).The ANOVA indicated that there were differencesin the pH values among the bait treatments (

F

=16.71, df = 4, 178,

P

< 0.0001). The mean (±SE) pHvalue of water (6.7 ± 0.15) was significantly lowerthan the mean (±SE) pH values of the three hu-man urine concentrations (among which therewere no significant differences; 7.58 ± 0.21, 7.87 ±0.27, and 8.17 ± 0.26, for HU12.5, HU25, andHU50, respectively), and was significantly lowerthan that of hydrolyzed protein (7.25 ± 0.23).

Guava Orchard

Altogether, 105 adults of four

Anastrepha

spe-cies were captured. The proportion of each species

in the sample was as follows:

A. fraterculus

(84.8%),

A. ludens

(9.5%),

A. striata

(3.8%) and

A. obliqua

(1.9%). Consequently, results reportednext refer only to

A. fraterculus

. Traps baited withhuman urine (all three concentrations) and hy-drolyzed protein captured similar numbers ofadults of this species and more adult flies thanwater-baited traps (

F

= 5.05, df = 4, 295,

P

<0.001) (Fig. 1). A regression analysis confirmedthe lack of association between the concentra-tions of human urine evaluated and the numberof adult

A. fraterculus

captured by traps (

F

= 0.48,

P

= 0.50, R

2

= 0.04). Notably, 93% and 96%, re-spectively, of the adults captured by traps baitedwith either HU25 or HU50 were females (Table2A).

Grapefruit Orchard

A total of 101 adults of four

Anastrepha

specieswere captured (

A. ludens

71.3%,

A. obliqua

25.7%,

A. fraterculus

2%, and A. distincta 1%).Hence, what follows refers only to A. ludens be-cause A. obliqua is not a pest of citrus. Trapsbaited with hydrolyzed protein captured thegreatest number of adults of this species (F =29.33, df = 4, 295, P < 0.001). In turn, humanurine-baited traps captured statistically similarnumbers of adults, and captured more flies thanwater-baited traps (Fig. 2). A regression analysisfurther corroborated that captures were indepen-dent of the concentration of human urine evalu-ated (F = 0.58, P = 0.46, R2 = 0.04).

Hydrolyzed protein attracted significantlymore A. ludens females than males (Table 2B).Furthermore, numerically more sexually maturethan immature A. ludens females were capturedby traps baited with hydrolyzed protein.

Fig. 1. Mean (±SE) number (fly/trap/day) of adult A.fraterculus captured by McPhail traps containing threedilutions of human urine (HU) (12.5%, 25%, and 50%),hydrolyzed protein, or water (control). Study was con-ducted in 1995 in Cosautlán, Veracruz, México, in anunsprayed non-commercial guava orchard. Means withdifferent letters are significantly different (Fisher LSDtest, α = 0.05).


Mango Orchard

In this orchard, 226 Anastrepha adults werecaptured by traps. Anastrepha serpentina was themost abundant species (87.1% of the total cap-ture), followed by A. obliqua (11.1%), A. ludens

(0.9%), and A. alveata (Stone) (0.9%). Results re-fer only to the first two species (we chose to in-clude A. obliqua as this species is the commonpest of mangos in the region). Traps baited withhydrolyzed protein captured more A. obliqua andA. serpentina adults than traps baited with anyother bait treatment (F = 3.94, df = 4, 320, P =0.004; F = 7.88, df = 4, 320, P < 0.001, respec-tively). Furthermore, there was no relationshipbetween the number of adult A. obliqua andA. serpentina and the concentrations of humanurine tested (F = 0.00, P = 1.00, R2 = 0.00; F = 0.01,P = 0.96, R2 = 0.00, respectively) (Fig. 3).

The three human urine-based treatments, aswell as protein, attracted similar numbers ofA. serpentina males and females (Table 2C). In-terestingly, human urine-baited traps capturednumerically more sexually immature than ma-ture A. serpentina females (62.5% vs. 37.5%,54.6% vs. 45.4%, and 69.2% vs. 30.8% HU12.5,HU25, and HU50, respectively) whereas trapsbaited with hydrolyzed protein captured a greaterproportion of sexually mature (65.6%) than im-mature (34.4%) females.

Sapodilla Orchard

Overall, 876 Anastrepha adults were captured.Of these, 80.4% were A. serpentina, 18.3% were

TABLE 2. PROPORTIONS OF ANASTREPHA SPP. MALES AND FEMALES CAPTURED BY MCPHAIL TRAPS BAITED WITH EI-THER THREE AQUEOUS DILUTIONS OF HUMAN URINE (HU) (12.5, 25, AND 50%) OR HYDROLYZED PROTEIN INGUAVA, GRAPEFRUIT, MANGO AND SAPODILLA ORCHARDS.

Species Treatment N % Females % Males P value1

A) Psidium guajavaA. fraterculus HU12.5 17 64.7 35.3 0.52

HU25 28 92.9 7.1 0.03HU50 26 96.1 3.9 0.03Protein 17 82.3 17.7 0.10

B) Citrus paradisiA. ludens Protein 57 91.0 9.0 0.01

C) Mangifera indicaA. obliqua Protein 13 61.5 38.5 0.90A. serpentina HU12.5 28 57.1 42.9 0.45

HU25 18 61.1 38.9 0.45HU50 27 51.8 48.2 0.83Protein 124 49.2 50.8 0.83

D) Manilkara zapotaA. serpentina HU12.5 118 51.7 48.3 0.77

HU25 97 60.8 39.1 0.08HU50 313 55.9 44.1 0.25Protein 183 54.1 45.9 0.47

A. obliqua HU12.5 26 69.2 30.8 0.46HU25 24 62.5 37.5 0.23HU50 75 62.7 37.3 0.37Protein 37 70.3 29.7 0.02

1Comparisons of the numbers of males and females of a particular species were performed through Mann Whitney U tests.

Fig. 2. Mean (±SE) number (fly/trap/day) of adult A.ludens captured by McPhail traps containing three dilu-tions of human urine (HU) (12.5%, 25%, and 50%), hy-drolyzed protein, or water (control). Study wasconducted in 1995 in Tuzamapan, Veracruz, México, in amixed, unsprayed grapefruit/coffee orchard. Meanswith different letters are significantly different (FisherLSD test, α = 0.05).


A. obliqua and 1.3% were A. ludens. Data shownbelow refer only to the first two species. Trapsbaited with HU50 surpassed all other treatmentsin capturing A. serpentina and A. obliqua adults(F = 10.19, df = 4, 315, P < 0.001 and F = 6.11, df= 4, 315, P < 0.001, respectively). There were nosignificant differences among the other baits (i.e.,hydrolyzed protein, HU25 and HU12.5), but eachof these captured more flies than traps with water(Fig. 4).

Data summarized in Table 2D indicates thatall bait treatments attracted similar numbers ofA. serpentina males and females. In the case ofA. obliqua, only protein-baited traps capturedmore females than males. HU25 was the only

treatment attracting more sexually immature(75.5%) than mature (24.5%) A. serpentina fe-males. HU12.5, HU50, and hydrolyzed protein at-tracted similar numbers of immature and matureA. serpentina females (58.1 vs. 41.9%, 56.2 vs.43.8%, and 51.8 vs. 48.2% of sexually immaturevs. mature females, respectively).

DISCUSSION

We found that human urine-baited traps were,in certain cases (i.e., guava and sapodilla or-chards), similar or superior to protein-baitedtraps with respect to the total number of adultA. fraterculus, A. obliqua and A. serpentina cap-tured. In other cases (i.e., mango and grapefruitorchards), traps baited with human urine cap-tured fewer adults than traps baited with hydro-lyzed protein. We also found that with oneexception (sapodilla orchard), human urine con-centrations tested did not vary significantly intheir attractiveness to flies. The latter has impor-tant practical implications as a farmer could fillmore traps with a small amount of human urine.

Our results partially confirm those obtained byHedström (1988). That is, we also found that hu-man urine is attractive to Anastrepha adults, butnot to the extent this author did. Some possibleexplanations for the latter are: (1) differences inthe nature of the commercially available baitsused by Hedström (torula yeast) and us (hydro-lyzed corn protein), (2) possible effect of bait agingsince Hedström did not replace the urine con-tained in traps throughout his study, (3) the eco-logical characteristics of the study orchard andthe fact that A. striata was the predominant spe-cies in Hedström’s study (a species not evaluatedhere), (4) differences in population size, and (5),probable differences in attractiveness of the hu-man urine used in both studies.

The favorable response to human urine shownby A. fraterculus adults in the guava orchard, andin some instances (e.g., sapodilla orchard) byA. obliqua and A. serpentina, suggests that indi-viduals of these Anastrepha species could be re-sponding to nitrogenous compounds such asammonia present in human urine (Piñero et al.2003). Given that ammonia plays an importantrole in attracting fruit flies (e.g., Morton & Bate-man 1981; Bateman & Morton 1981; Mazor et al.1987; Prokopy et al. 1992; Epksy et al. 1995; Heathet al. 1995), and that some ammonium salts (e.g.,ammonium acetate or carbonate) and amines (e.g.,methylamine, putrescine) are also known to at-tract adults of A. suspensa (e.g., Burditt et al. 1983;Thomas et al. 2001), A. striata, A. obliqua (e.g.,Hedström & Jiménez 1988), and A. ludens (e.g.,Robacker 1995; Robacker et al. 1996; 1997; Heathet al. 1997; Thomas et al. 2001), a study aimed atidentifying the attractive elements of human urineto Anastrepha spp. is, in our opinion, warranted.

Fig. 3. Mean (±SE) number (fly/trap/day) of adultAnastrepha serpentina and A. obliqua captured byMcPhail traps containing three dilutions of humanurine (HU) (12.5%, 25%, and 50%), hydrolyzed protein,or water (control). Study was conducted in 1996 inApazapan, Veracruz, México, in an unsprayed, commer-cial mango orchard (Manila cultivar). Means with dif-ferent letters are significantly different (Fisher LSDtest, α = 0.05).

Fig. 4. Mean (±SE) number (fly/trap/day) of adultAnastrepha serpentina and A. obliqua captured byMcPhail traps containing three dilutions of humanurine (HU) (12.5%, 25%, and 50%), hydrolyzed protein,or water (control). Study was conducted in 1997 inApazapan, Veracruz, México, in an unsprayed, commer-cial sapodilla orchard. Means with different letters aresignificantly different (Fisher LSD test, α = 0.05).


Bateman & Morton (1981) and Mazor et al.(1987) clearly demonstrated a close relationshipbetween ammonia concentration and attractionof female C. capitata to protein-based baits. In ourcase, however, we did not find such an associationas all three human urine dilutions were similarlyattractive to adult A. fraterculus, A. ludens, A. ser-pentina and A. obliqua in the guava, grapefruit,and mango orchards. The notable exception wasthe sapodilla orchard, in which the less-dilutedhuman urine (HU 50%) was significantly more at-tractive to A. serpentina and A. obliqua than anyother human urine dilution. Robacker (1995)found results similar to current data. Liquid baitswith different concentrations of ammonia andamines were similar in attractiveness over arange of over 10×, but became less attractive atvery high concentrations. The latter can be ex-plained by the fact that pH regulates emission ofammonia, amines, acids, and other ionizable com-pounds. At pH > 9, emission of ammonia in-creases greatly and can become repellent,depending on the concentration in the bait. Bate-man & Morton (1981) and Mazor et al. (1987),also determined that adult females respondedmore strongly to baits with pH values between 7and 8.5, a result later confirmed by Robacker etal. (1993), Robacker & Flath (1995) and Robacker& Bartelt (1997). We note, that such pH values co-incided with the pH values found for the three hu-man urine concentrations used in our study(average pH values of approximately 8 in all threecases).

In guava trees, HU25 and HU50 attracted sig-nificantly more A. fraterculus females than malesand, in the sapodilla orchard, the same baits alsoattracted more females than males of both A. ser-pentina and A. obliqua. This agrees with previousresults found for A. serpentina in a mango or-chard (Piñero et al. 2003), and in a laboratory set-ting (Piñero et al. 2002). Given that Piñero et al.(2002) controlled the proportion of females andmales in the experimental population, we are con-fident that our results in the field do not reflect asituation in which more females than males werepresent and as a consequence, more females werecaptured. Furthermore, in our study HU25 at-tracted a large proportion of sexually immatureA. serpentina females when tested in the sapo-dilla orchard.

Interestingly, we found important differencesin the response to human urine by A. obliqua andA. serpentina adults according to the type of or-chard and other conditions prevalent where trap-ping was performed. For example, in the mangoorchard (1996), traps baited with hydrolyzed pro-tein captured the highest numbers of both A. ser-pentina and A. obliqua adults. In contrast, in thesapodilla orchard (1997) traps baited with HU50captured more adults of both species than pro-tein-baited traps. Since the two orchards are ad-

jacent to each other, we believe that suchdifferences might be due to variations in the type,abundance, and quality (i.e., nutritional value) ofhost fruits, both within and outside the orchards(e.g., presence of wild hosts). For instance, at thetime the study was carried out in the mango or-chard, there was very little fruit left on trees, andthere was no fruit available in the contiguous sa-podilla orchard. Thus, the higher capture ofA. serpentina adults in protein-baited traps(when compared to urine-baited traps) may be ex-plained in terms of protein hunger, since sapo-dilla fruit is an important protein source forA. serpentina adults (Jácome et al. 1999). In con-trast, when trapping took place in the sapodillaorchard (in 1997), fruit was abundant and trapsbaited with hydrolyzed protein were not as at-tractive to adult A. serpentina as urine-baitedtraps. This clearly illustrates that the effective-ness of an attractant depends on the prevailingecological conditions in a given orchard (Robacker1992; Celedonio-Hurtado et al. 1995; Heath et al.1997; Epsky et al. 1999), as well as on adult phys-iological state (Robacker 1991; Robacker et al.1996; Rull & Prokopy 2000; Piñero et al. 2002).The latter aspects, in addition to others such asannual variations in adult fly populations in fruitorchards (Aluja et al. 1996), must be considered inthe design of fruit fly monitoring systems and un-derscores the challenge faced by those trying todevelop a replacement for the McPhail trap foruse in orchards in which flies in the genus Anas-trepha are predominant.

As a final point, we would like to address theeconomic benefit of using cost-free human urine.In Mexico, the value of a liter of a commerciallyavailable protein-based bait (e.g., Captor Plus®)is approximately USD $6.00 (10.9/1 US dollars/Mexican peso). Considering that each trap isbaited with 10-40 ml of bait diluted per liter ofwater, the cost of the bait per trap is USD $0.06-0.20. The latter multiplied by 52 (weeks in a year)raises the cost of the bait per trap per year to ca.USD $3.10-10.40 (average of $6.75). Consideringthat in Mexico a glass McPhail trap costs USD$4.00, and the placement of 10-20 traps in an or-chard (USD $40.00-80.00), the total cost of trapplacement and servicing per year would range be-tween USD $46.75 and 86.75 or ca $510.00-945.00 Mexican pesos (not considering salaries).In the case of commercially available Anastrephaspp. synthetic lures (multi-component lure) andyellow plastic traps the cost in the US (not consid-ering handling and shipping charges to Mexico)ranges between USD $3.30-4.50 and 8.50 per dis-penser (lure) and trap, respectively (Great LakesIMP, Vestaburg, MI; IPM Technologies, Portland,OR). All the latter would be unmanageable for asubsistence farmer (one that uses all his fruit forself-consumption) and hard to handle for a small-scale producer selling fruit locally. Therefore the


alternative of using a cost-free bait like humanurine becomes highly attractive.

In conclusion, we believe that human urinerepresents a low-tech alternative Anastrepha baitfor subsistence or low income, small-scale fruitgrowers in rural areas in Latin America who can-not afford costly inputs such as commercial baitsand traps. Human urine was capable of attractingadult flies of various species of Anastrepha and, atleast in two orchards (guava and sapodilla), it per-formed as well as, or even better, than a commer-cially available protein bait. Even though in someinstances human urine did not attract as manyflies as hydrolyzed protein, qualitatively it provedto be equal or superior to this bait (i.e., it usuallyattracts more females than males and a large pro-portion of sexually immature females). A poorfarmer would have access to a cost-free trap bysimply reusing a two-liter plastic bottle of a softdrink or serum flask (see Salles 1996) and filling itwith human urine diluted in water. There willsometimes be a trade off between cost and trapquality/efficiency, but for growers accustomed toregularly loosing between 60 to 100% of their har-vest because of fruit fly damage, the benefit of acheap, low-technology and relatively efficient trapwould be very valuable. If such growers could bealerted in a timely fashion of an increasing influxof flies into their orchards or backyard gardensfrom surrounding native vegetation, they couldprotect their fruit by, for example, bagging it(Fang 1989). Further, if the bait is particularly at-tractive to sexually immature females, even a lowcapture rate could reduce fruit damage to the ex-tent of allowing the production of a certain pro-portion of clean fruit (i.e., free of larvae) for localmarkets. One should keep in mind that the prin-cipal objective of peasant farmers in Latin Amer-ica is not to produce fruit for export markets butfor in-house consumption or local markets that donot demand blemish-free products.

ACKNOWLEDGMENTS

We thank Alejandro Vázquez, Isabel Jácome and Oc-taviano Díaz for technical support, and Juan Velandia(Cosautlán, Veracruz), Leticia Lagunes (Apazapan, Ver-acruz) and Alicia Falcón (Tuzamapan, Veracruz), for al-lowing us to conduct our studies in their orchards. Weexpress our gratitude to Francisco Díaz-Fleischer, Di-ana Pérez-Staples, and Juan Rull-Gabayet (Instituto deEcología, A.C.), as well as Ben Normark, Sara Hoff-mann, Lisa Provencher, Matt Gruwell, Barry Sello (Uni-versity of Massachusetts), and two anonymous referees,for reviewing preliminary versions of this manuscript.We also acknowledge Dan Bennack (independent con-sultant) for helpful suggestions on content, Mildred Ro-dríguez (Instituto de Ecología, A.C.) for technicalassistance during manuscript preparation and JesúsReyes Flores (former director of the Campaña NacionalContra Moscas de la Fruta, Mexico) for encouraging usto undertake this study and Jorge Hernández Baeza(Director General de Sanidad Vegetal, Mexico) to pub-

lish it. This study was financed by the Mexican Cam-paña Nacional Contra Moscas de la Fruta, DirecciónGeneral de Sanidad Vegetal, Secretaría de Agricultura,Ganadería y Desarrollo Rural, Pesca y Alimentación(Convenio INECOL-DGSV-SAGARPA-IICA). This arti-cle reports the results of research only. Mention of a pro-prietary product does not constitute an endorsement ora recommendation by the Instituto de Ecología, A.C.

REFERENCES CITED

ALUJA, M. 1994. Bionomics and Management of Anas-trepha. Annu. Rev. Entomol. 39: 151-174.

ALUJA, M. 1996. Future trends in fruit fly management,pp. 309-320. In B. A McPheron and G. J. Steck (eds.),Economic Fruit Flies: a World Assessment of theirBiology and Management. St. Lucie Press, DelRayBeach, Florida.

ALUJA, M. 1999. Fruit fly (Diptera: Tephritidae) re-search in Latin America: myths, realities anddreams. An. Soc. Entomol. Brasil 28: 565-594.

ALUJA, M., AND P. LIEDO. 1986. Future perspectives onintegrated management of fruit flies in Mexico, pp.12-48. In M. Mangel J. R. Carey and R. E. Plant(eds.), Pest Control: Operations and Systems Analy-sis in Fruit Fly Management. Springer, Berlin.

ALUJA, M., M. CABRERA, J. GUILLÉN, H. CELEDONIO,AND F. AYORA. 1989. Behaviour of Anastrepha ludens,A. obliqua and A. serpentina (Diptera: Tephritidae) ona wild mango tree (Mangifera indica) harbouringthree McPhail traps. Insect Sci. Appl. 10: 309-318.

ALUJA, M., H. CELEDONIO-HURTADO, P. LIEDO, M. CA-BRERA, F. CASTILLO, J. GUILLÉN, AND E. RÍOS. 1996.Seasonal population fluctuations and ecological im-plications for management of Anastrepha fruit flies(Diptera: Tephritidae) in commercial mango orchardsin Southern Mexico. J. Econ. Entomol. 89: 654-667.

ALUJA, M., F. DÍAZ-FLEISCHER, D. R. PAPAJ, G. LAGUNES,AND J. SIVINSKI. 2001. Effects of age, diet, femaledensity, and the host resource on egg load in Anas-trepha ludens and Anastrepha obliqua (Diptera: Te-phritidae). J. Insect Physiol. 47: 975-988.

ANONYMOUS. 1981. GEIGY Scientific Tables. CIBA-GEIGY Ltd. Basle, Switzerland.Cornelius Lenter, ed.

BATEMAN, M. A., AND T. C. MORTON. 1981. The impor-tance of ammonia in proteinaceous attractants forfruit flies (Diptera: Tephritidae). Australian J. Agric.Res. 32: 883-903.

BELL, G. H., J. N. DAVIDSON, AND H. SCARBOROUGH.1961. Textbook of Physiology and Biochemistry. TheWilliams and Wilkins Company.

BURDITT, A. K., T. P. MCGOVERN JR., AND P. D. GREANY.1983. Anastrepha suspensa (Loew) (Diptera: Tephri-tidae) response to chemical attractants in the field.Proceedings of the Florida State Hort. Soc. 96: 222-226.

CASAÑA-GINER V., A. GANDÍA-BALAGUER, M. M.HERNÁNDEZ-ALAMÓS, C. MENGOD-PUERTA, A. GAR-RIDO-VIVAS, J. PRIMO-MILLO, AND E. PRIMO-YÚFERA.2001. Attractiveness of 71 compounds and mixturesto wild Ceratitis capitata (Diptera: Tephritidae) infield trials. J. Econ. Entomol. 94: 898-904.

CELEDONIO-HURTADO, H., M. ALUJA, AND P. LIEDO.1995. Adult population fluctuations of Anastrephaspecies (Diptera: Tephritidae) in tropical habitats ofChiapas, Mexico. Environ. Entomol. 24: 861-869.

EPSKY, N. D., AND R. R. HEATH. 1997. Exploiting the in-teractions of chemical and visual cues in behavioral


control measures for pest tephritid fruit flies. Flor-ida Entomol. 81: 273-282.

EPSKY, N. D., R. R. HEATH, A. GUZMÁN, AND W. L.MEYER. 1995. Visual cue and chemical cue interactionsin a dry trap with food-based synthetic attractant forCeratitis capitata and Anastrepha ludens (Diptera: Te-phritidae). Environ. Entomol. 24: 1387-1395.

EPSKY, N. D., J. HENDRICHS, B. I. KATSOYANNOS, L. A.VÁSQUEZ, J. P. ROS, A. ZÜMREOGLU, R. PEREIRA, A.BAKRI, S. I. SEEWOORUTHUN, AND R. R. HEATH.1999. Field evaluation of female-targeted trappingsystems for Ceratitis capitata (Diptera: Tephritidae)in seven countries. J. Econ. Entomol. 92: 156-164.

FANG, M. N. 1989. Studies on using different baggingmaterials for controlling melon fly on bitter gourdand sponge gourd. Bulletin of the Taichung DistrictAgriculture Improvement Station 25: 3-12.

HEATH, R. R., N. D. EPSKY, A. GUZMÁN, B. D. DUEBEN,A. MANUKIAN, AND W. L. MEYER. 1995. Developmentof a dry plastic insect trap with food-based syntheticattractant for the Mediterranean and Mexican fruitflies (Diptera: Tephritidae). J. Econ. Entomol. 88:1307-1315.

HEATH, R. R., N. D. EPSKY, B. D. DUEBEN, AND W. L.MEYER. 1996a. Systems to monitor and suppressMediterranean fruit fly (Diptera: Tephritidae) popu-lations. Florida Entomol. 79: 144-153.

HEATH, R. R., N. D. EPSKY, A. JIMENEZ, B. D. DUEBEN,P. J. LANDOLT, W. L. MEYER, M. ALUJA, J. RIZZO,M. CAMINO, F. JERÓNIMO, AND R. M. BARANOWSKI.1996b. Improved pheromone-based trapping sys-tems to monitor Toxotrypana curvicauda (Diptera:Tephritidae). Florida Entomol. 79: 37-48.

HEATH, R. R., N. D. EPSKY, B. D. DUEBEN, J. RIZZO, ANDF. JERONIMO. 1997. Adding methyl-substituted am-monia derivatives to a food-based synthetic attrac-tant on capture of the Mediterranean and Mexicanfruit flies (Diptera: Tephritidae). J. Econ. Entomol.90: 1584-1589.

HEDSTRÖM, I. 1988. Una sustancia natural en la cap-tura de moscas de la fruta del género AnastrephaSchiner (Diptera: Tephritidae). Rev. Biol. Trop. 36:269-272.

HEDSTRÖM, I., AND J. JIMÉNEZ. 1988. Evaluación decampo de sustancias atrayentes en la captura deAnastrepha spp. (Diptera: Tephritidae), plaga de fru-tales en América Tropical. II. Acetato de amonio ytorula boratada. Rev. Brasileira Entomol. 32: 319-322.

JÁCOME, I., M. ALUJA, AND P. LIEDO. 1999. Impact ofadult diet on demographic and population parameterson the tropical fruit fly, Anastrepha serpentina(Diptera: Tephritidae). Bull. Entomol. Res. 89: 165-175.

KATSOYANNOS, B. I., R. R. HEATH, N. T. PAPADOPOULOS,N. D. EPSKY, AND J. HENDRICHS. 1999a. Field evalu-ation of Mediterranean fruit fly (Diptera: Tephri-tidae) female selective attractants for use inmonitoring programs. J. Econ. Entomol. 92: 583-589.

KATSOYANNOS, B. I., N. T. PAPADOPOULOS, R. R. HEATH,J. HENDRICHS, AND N. A. KOULOUSSIS. 1999b. Eval-uation of synthetic food-based attractants for femaleMediterranean fruit flies (Dip., Tephritidae) inMcPhail-type traps. J. Appl. Entomol. 123: 607-612.

LANGLEY, L. L. 1971. Physiology of Man. Van NostrandReinhold Company, New York.

LIBURD, O. E., S. R. ALM, R. A. CASAGRANDE, AND S. PO-LAVARAPU. 1998. Effect of trap color, bait, shape, andorientation in attraction of blueberry maggot (Diptera:Tephritidae) flies. J. Econ. Entomol. 91: 243-249.

MARTÍNEZ, I., V. HERNÁNDEZ-ORTIZ, AND R. LUNA. 1995.Desarrollo y maduración sexual en Anastrepha ser-pentina (Wiedemann) (Diptera: Tephritidae). ActaZool. Mexicana (nueva serie) 65: 75-88.

MAZOR, M., S. GOTHILF, AND R. GALUN. 1987. The role ofammonia in the attraction of females of the Mediter-ranean fruit fly to protein hydrolysate baits. Ento-mol. Exp. Appl. 43: 25-29.

MCPHAIL, M. 1937. Relation of time of day, temperature,and evaporation to attractiveness of fermenting solu-tion to Mexican fruit fly. J. Econ. Entomol. 30: 793-799.

MCPHAIL, M. 1939. Protein lures for fruit flies. J. Econ.Entomol. 32: 758-761.

MORTON, T. C., AND M. A. BATEMAN. 1981. Chemicalstudies on proteinaceous attractants for fruit flies,including the identification of volatile constituents.Australian J. Agric. Res. 32: 905-916.

PIÑERO, J., M. ALUJA, M. EQUIHUA, AND M. M. OJEDA.2002. Feeding history, age and sex influence the re-sponse of four economically important Anastrephaspecies (Diptera: Tephritidae) to human urine andhydrolyzed protein. Folia Entomol. Mexicana 41:283-298.

PIÑERO, J., M. ALUJA, A. VÁZQUEZ, M. EQUIHUA, AND J.VARÓN. 2003. Human urine and chicken feces asfruit fly (Diptera: Tephritidae) attractants for re-source-poor growers. J. Econ. Entomol. 96: 334-340.

PROKOPY, R. J., D. R. PAPAJ, J. HENDRICHS, AND T. T. Y.WONG. 1992. Behavioral responses of Ceratitis capi-tata flies to bait spray droplets and natural food. En-tomol. Exp. Appl. 64: 247-257.

PROKOPY, R. J., S. E. WRIGHT, J. L. BLACK, X. P. HU,AND M. R. MCGUIRE. 2000. Attracticidal spheres forcontrolling apple maggot flies: commercial-orchardtrials. Entomol. Exp. Appl. 97: 293-299.

ROBACKER, D. C. 1991. Specific hunger in Anastrephaludens (Diptera: Tephritidae): Effects on attractive-ness of proteinaceous and fruit-derived lures. Envi-ron. Entomol. 20: 1680-1686.

ROBACKER, D. C. 1992. Effects of shape and size of col-ored traps on attractiveness to irradiated, laboratory-strain Mexican fruit flies (Diptera: Tephritidae). Flor-ida Entomol. 75: 230-241.

ROBACKER, D. C. 1995. Attractiveness of a mixture ofammonia, methylamine and putrescine to Mexicanfruit flies (Diptera: Tephritidae) in a citrus orchard.Florida Entomol. 78: 571-578.

ROBACKER, D. C., AND R. J. BARTELT. 1997. Chemicalsattractive to Mexican fruit fly from Klebsiella pneu-moniae, and Citrobacter freundii cultures sampledby solid-phase microextraction. J. Chem. Ecol. 23:2897-2915.

ROBACKER, D. C., AND R. A. FLATH. 1995. Attractantsfrom Staphylococcus aureus cultures for Mexicanfruit fly, Anastrepha ludens. J. Chem. Ecol. 21: 1861-1874.

ROBACKER, D. C., W. C. WARFIELD, AND R. F. ALBACH.1993. Partial characterization and HPLC isolation ofbacteria-produced attractants for the Mexican fruitfly, Anastrepha ludens. J. Chem. Ecol. 19: 543-557.

ROBACKER, D. C., D. S. MORENO, AND A. B. DEMILO.1996. Attractiveness to Mexican fruit flies of combi-nations of acetic acid with ammonium/amino attrac-tants with emphasis on effects of hunger. J. Chem.Ecol. 22: 499-511.

ROBACKER, D. C., A. B. DEMILO, AND D. J. VOADEN.1997. Mexican fruit fly attractants: Effects of 1-pyr-roline and other amines on attractiveness of a mix-


ture of ammonia, methylamine, and putrescine. J.Chem. Ecol. 23: 1263-1280.

RULL, J., AND R. J. PROKOPY. 2000. Effect of food on at-traction of apple maggot flies, Rhagoletis pomonella(Walsh), of different physiological states, to odor-baited traps. Bull. Entomol. Res. 90: 77-88.

SALLES, L. A. 1996. Inexpensive traps made with dis-posable plastic containers: case of serum hospitalflask, p. 54. In Proceedings of 2nd. meeting of theWorking Group on Fruit Flies of the Western Hemi-sphere, 3-8 November 1996, Viña del Mar, Chile.

STATSOFT, INC. 1999. Statistica for Windows. Computerprogram manual. Tulsa, OK.

STELINSKI, L. L., AND O. E. LIBURD. 2001. Evaluation ofvarious deployment strategies of Imidacloprid-treated spheres in highbush blueberries for controlof Rhagoletis mendax (Diptera: Tephritidae). J.Econ. Entomol. 94: 905-910.

THOMAS, D. B., T. C. HOLLER, R. R. HEATH, E. J. SALI-NAS, AND A. L. MOSES. 2001. Trap-lure combinationsfor surveillance of Anastrepha fruit flies (Diptera:Tephritidae). Florida Entomol. 84: 344-351.

Deyrup & Cover:

Leptothorax

of the Southeast 51

A NEW SPECIES OF THE ANT GENUS

LEPTOTHORAX

FROM FLORIDA, WITH A KEY TO THE

LEPTOTHORAX

OF THE SOUTHEAST (HYMENOPTERA: FORMICIDAE)

M

ARK

D

EYRUP

1

AND

S

TEFAN

C

OVER

2

1

Archbold Biological Station, P.O. Box 2057, Lake Placid, FL 33862

2

Dept. of Entomology, Museum of Comparative Zoology, Harvard University26 Oxford Street, Cambridge, MA 021??

A

BSTRACT

A new species of myrmicine ant is described from Florida:

Leptothorax palustris

is knownfrom workers and associated queens and males collected in a marsh and in frequentlyflooded pinelands in the Apalachicola National Forest in northwestern Florida. Nests arenear the surface in root mats that extend into small open sandy hummocks. The species re-sembles

Leptothorax texanus

Wheeler, a species of adjacent well-drained sandy sites, differ-ing primarily in the structure of the petiole and postpetiole and color.

Leptothorax davisi

Wheeler is synonymized with

Leptothorax texanus

Wheeler (new

synonymy); this is based onextensive and previously unknown variability in

L. texanus

, even in single sites and withinnest series. An illustrated key is presented for the identification of the eleven species of

Lep-tothorax

known from the Atlantic Coastal states north through North Carolina, with the ad-dition of Alabama.

Key Words: southeastern ants, Apalachicola National Forest, Osceola National Forest

R

ESUMEN

Se describe una nueva especie de hormiga Myrmicinae de Florida.


seconoce con base en obreras, reinas y machos asociadas, colectados en ciénegas y bosqueshúmedos de pino en el Apalachicola National Forest del noreste de Florida. Los nidos son su-perficiales en pequeños promomontorios de arena. Este especie se parece a

Leptothorax tex-anus

Wheeler, una especie de de áreas cercanas pero más arenosas y con mejor drenaje.

Leptothorax texanus

se distingue de

L. palustris

por la estructure del peciolo y postpeciolo,y su color.

Leptothorax davisi

Wheeler se convierte en sinónimo de

Leptothorax texanus

Wheeler (

nuevo sinónimo

); ésta cambio se establece con base en la extrema variación, hastaahora desconocida, de

L. texanus

al interior de sitios y nidos particulares. Se incluye unaclave ilustrada de las once especies de

Leptothorax

conocidas de los estados de la costa atlán-tica hasta North Carolina, incluyendo Alabama.


Members of the genus

Leptothorax

are gener-ally timid and retiring ants that do not recruitstrongly to baits and are often specialized in theirchoice of nesting places. It is not remarkable,therefore, that species of

Leptothorax

may beoverlooked, even in relatively well-known coun-tries such as the United States, with its long his-tory of assiduous myrmecologists. The speciesdescribed below seems to have escaped detectionup to now because it occurs in an unusual habitat(frequently flooded and burned pine forests),where it probably conducts most of its foraginghidden under a loose layer of pine needles andleaves. The first known specimens were collectedin pitfalls by David Lubertazzi in a study of antassociations in selected vegetation types in theApalachicola National Forest, near Tallahassee,Florida.

For a diagnosis of the genus

Leptothorax

, seethe character states in the various couplets of thekeys provided by Bolton (1994). A rough diagnosisof the genus as it appears in the U.S. is as follows:petiole with two segments; antennal scrobes lack-ing; petiole not quadrate in lateral view; head andbody with some erect hairs; antennae with threeconspicuously enlarged terminal segments; pro-podeal spines or teeth present; postpetiole at-tached normally, not affixed to the dorsal surfaceof the gaster.

The species described below would belong tothe former subgenus

Myrafant

, which was re-cently revived by MacKay (2000). We hesitate touse this subgenus until it has been reviewed in awider context. The Florida species

Leptothoraxtorrei

(Aguayo), for example, seems to fit comfort-ably into the revived

Myrafant

as currently de-

52


87(1) March 2004

fined, but is not included in the

Myrafant

revision, presumably because its resemblance tospecies traditionally included in

Myrafant

islikely to be due to convergence. It is possible that

Myrafant

will eventually be recognized as a validsubgenus, or even as a genus (Hölldobler & Wil-son 1990), but it would be best if this occurred ina more general review of the subgroups presentlycombined in

Leptothorax

.


Cover and Deyrup,

new species

(Figs. 1-2)

Diagnosis of Worker

Distinguished from all other Nearctic

Lepto-thorax

by the following combination of characterstates: head with fine, longitudinal, well-sepa-rated dorsal carinae, otherwise shining; mesos-oma with fine, longitudinal, well-separated dorsalcarinae, anastomosing dorsally; propodeal spinesslender, acute, projecting distinctly upward fromthe smoothly convex dorsum of the mesosoma;postpetiole in dorsal view almost twice as wide aspetiole, and almost as long as wide, shining; coloryellowish, head yellowish brown. Most similar to

L. texanus

Wheeler (Fig. 3), but postpetiole rela-tively longer, color lighter.

Description of Holotype Worker

Features visible in lateral view described fromleft side. Measurements in mm: Total length(length of head excluding mandibles, + length ofmesosoma, excluding propodeal spines, + lengthof petiole, postpetiole, gaster): 2.90; head length0.65; head width 0.50; length of mesosoma: 0.93;length of petiole: 0.25; length of postpetiole: 0.27;length of gaster: 0.80. Head: dorsum with fine,well-separated, longitudinal, irregular carinae,with scattered, short cross-carinae; intersticesweakly shining; clypeus with a strong median ca-rina, separated by a distance equal to about halfits length from the sublateral longitudinal cari-nae, a lateral carina also present on each side;malar space slightly more than 1.5 times maxi-mum length of eye; antennae with 12 joints. Meso-soma: evenly convex in profile; dorsum with a fewcoarse carinae forming a rough network, inter-stices weakly shining; pronotum and mesopleu-ron each with several irregular, indistinctlongitudinal carinae, interstices weakly shining;metapleuron with five distinct longitudinal cari-nae, interstices shining; propodeal spines long,slender, in lateral view spine making a 135 degreeangle with the dorsum of the mesosoma; petiole inprofile concave ventrally, with a small, sharp an-

Fig. 1. Worker of Leptothorax palustris n. sp.: lateral habitus view; frontal view of head; dorsal view of postpet-iole. Length of ant: 2.9 mm.

Deyrup & Cover:

Leptothorax

of the Southeast 53

gle at anterior border; node of petiole with a bluntanterior angle, no posterior angle; postpetiole indorsal view shining anteriorly, minutely rough-ened posteriorly; 1.8 times as wide as petiole;postpetiole as long as wide when measured fromside to side at midlength, and along midline fromconvex anterior to convex posterior borders.Gaster: shining, without sculpture. Dorsum ofhead and body with sparse, flattened, parallel-sided hairs, erect on head and mesosoma; slightlyretrorse on petiole, postpetiole, and gaster. Color:translucent dark yellow, dorsum of head brown,middle and hind femora with wide postmedianbands of brownish yellow.

Diagnosis of Queen

Queens of some North American

Leptothorax

are unknown or undescribed; this diagnosis in-cludes only species from southeastern NorthAmerica. Distinguished from these by the follow-ing combination of character states (Fig. 2): me-sopleuron shining, with only a few fine carinaenear edges (unlike

L. smithi

Baroni Urbani,

schaumii

Roger;

bradleyi

Wheeler); propodealspines long, slender (unlike

pergandei

Emery,

bra-dleyi

); propleuron with conspicuous irregular car-inae (unlike

tuscaloosae

Wilson,

torrei

(Aguayo),

pergandei

); petiole in profile triangular with a sin-

gle conspicuous dorsal angle, not rounded dorsally(as in

allardycei

(Mann)), or truncate and biangu-late (as in

longispinosus

Roger and

texanus

Wheeler); maximum length of eye slightly shorterthan malar space (unlike

curvispinosus

Mayr).

Description of Paratype Dealate Queen from Nestof Holotype

Methods as for holotype. Measurements inmm: total length: 4.96; head length: 0.82; headwidth: 0.77; length of mesosoma: 1.25; length ofpetiole: 0.37; length of postpetiole: 0.35; length ofgaster (segments except first strongly retracted):1.40. Head: dorsally with well-separated longitu-dinal irregular carinae with scattered cross-cari-nae, interstices shining; clypeus shining, withlongitudinal carinae: one median carina, a sublat-eral and lateral on each side, right side with asubmedian carina, absent on the left side; malarspace 1.2 times maximum length of eye; antennaewith 12 joints. Mesosoma: pronotum with a fewstrong carinae forming an irregular network an-teriorly, becoming weak and longitudinal posteri-orly, interstices shining; mesonotum with dense,longitudinal, slightly irregular carinae, inter-spaces shining; mesopleuron shining, smooth,with small irregular carinae along dorsal, ventral,posterior borders, transverse mesopleural suturestrongly developed, slightly foveolate; propodeumwith strong longitudinal carinae, propodealspines elongate, slender, acute. Petiole in profilewith a single, strong, dorsal angle, not truncate,ventrally concave, with a small, sharp angle atanterior border. Postpetiole dorsally minutelyroughened, 1.50 times as wide as long. Gastershining, without sculpture. Pilosity of head andbody as in worker. Color: translucent dark yellow,dorsum of head and apex of gaster brown.

Diagnosis of Male

Males of some North American

Leptothorax

are unknown or undescribed. Even in the South-east there are two species,

smithi

and

tuscaloo-sae

, whose males are unknown, at least to us.Male

palustris

are distinguished from otherknown southeastern species by the followingcharacter states: node of petiole low and rounded,hardly more declivitous posteriorly than anteri-orly (unlike

texanus

, whose declivity is high andabruptly declivitous posteriorly); color black (un-like

torrei

,

curvispinosus

,

allardycei

); mesonotumnot conspicuously bulbous anteriorly and over-hanging posterior edge of pronotum (as in

pergan-dei

); antennae with a four-segmented antennalclub (unlike

bradleyi

, which has no antennal club;we suspect that

smithi

, whose workers resemblethose of

bradleyi

in many ways, has similarmales); mesonotum lacking the conspicuousparapsidal furrows found in

longispinosus

.

Fig. 2. Alate queen of Leptothorax palustris n. sp.:lateral habitus view; frontal view of head. Length of ant:5.0 mm

54


87(1) March 2004

Description of Paratype Male from Nest of Holotype

Methods as for holotype. Measurements inmm: total length: 3.27; head length: 0.52; headwidth: 0.60; length of mesosoma: 0.93; length ofpetiole: 0.25; length of postpetiole: 0.20; length ofgaster: 0.77; length of forewing: 2.20. Head: mi-nutely reticulate dorsally, smooth below middleocellus; faintly sculptured behind ocelli; length ofeye 1.10 times the distance between edge of eyeand lateral ocellus; antennae with 13 joints, lastfour conspicuously enlarged to make an elongateclub. Mesosoma: pronotum minutely, faintly retic-ulate, weakly shining; mesonotum withoutparapsical furrows, roughened with irregular,shallow, longitudinal depressions, irregularly mi-nutely reticulate; midline near anterior borderimpunctate; mesopleuron shining, smooth exceptfor irregular shallow depressions usually associ-ated with insertions of hairs; metapleuron andpropodeum faintly, minutely reticulate, weaklyshining. Petiolar node smooth, shining, in profilelow and rounded, posterior declivity only slightlysteeper than anterior declivity. Postpetiole shin-ing, with a conspicuous submarginal band ofirregular shallow depressions and minute reticu-

lations. Gaster smooth, shining. Color: blackishbrown; tarsi yellowish white; antennae, mandi-bles, trochanters, apices of femora light brown;wings, including veins, whitish.

Type localities, as Appear on Specimen Labels

Holotype: Florida: Liberty Co., ApalachicolaNat’l. For., 14-V-2000, S. Cover & M. Deyrup. 0.4mi. S. jct. For. Serv. Rds. 107 & 126, 30°12.38’N,84°45.88’W., elev. under 200’, seasonally floodedshrub marsh. Nest in open, a tiny open hole. Nestchambers less than 2” deep, in root mat on finewhite sand. Found by cookie bait. Same data for71 paratype workers, 1 dealate paratype queen as-sociated with holotype, 3 paratype dealate queensassociated with paratype workers, 3 alateparatype queens associated with paratype work-ers, 1 paratype male associated with holotype, 3paratype males associated with paratype workers.

Additional Material Examined

Two workers: Florida: Columbia Co., OsceolaNational Forest, 5 km. east of Lake City on Route90, 30°11.516N, 82°31’977W, 28-VIII-2001, pine

Fig. 3. Worker of Leptothorax texanus: lateral habitus view; frontal view of head; dorsal view of postpetiole.Length of ant: 3.2 mm.

Deyrup & Cover:

Leptothorax

of the Southeast 55

flatwoods, J. R. King, collector; 1 worker: same lo-cality, habitat, collector as previous, site:30°17.100’N, 82°28.813W, 27-30-VIII-2001; 1worker: same locality, habitat, collector as previ-ous site: 30°17.077’N, 82E28.770W.

Deposition of Type Material

Holotype, 2 paratype workers from nest of ho-lotype, dealate queen and male from nest of holo-type, 9 paratype workers: Museum ofComparative Zoology, Harvard University, Cam-bridge, Massachusetts; 8 workers, one queen, onemale: National Museum of Natural History,Smithsonian Institution, Washington, D.C.; 3workers, one queen, 1 male: Los Angeles CountyMuseum, Los Angeles, California; 7 workers, onequeen: Florida State Collection of Arthropods,Gainesville, Florida; 4 workers, one queen: TheNatural History Museum, London; remainingtype material temporarily in the arthropod collec-tion of the Archbold Biological Station, LakePlacid, Florida.

Etymology

palustris

, Latin, from

palus

(feminine) =marsh, and the suffix -

tris

, = belonging to, or aplace where; feminine ending in apposition to

palus

, not

Leptothorax

(masculine).

Position in Taxonomic Guides

In Creighton (1950) workers key to

texanusdavisi

, couplet 17 of

Leptothorax

key. In Mackay(2000) workers dead-end at couplet 43, as the dor-sum of the postpetiole is neither “reticulo-rugose”nor “punctate or granulose.”

D

ISCUSSION

The collections of this species are from a marshor from low flatwoods. We believe it is a wet-sitespecies from the same lineage as the dry-site spe-cies

Leptothorax texanus

, which it strongly resem-bles in size, pilosity, and general morphology (Fig.3). The two species differ in the shape of the pro-file of the petiole (in workers, queens, males), inthe relative length and width of the postpetiole ofthe worker (Figs. 1 and 3), and in color.


is presently known fromthe Apalachicola and Osceola National Forests. Inthese preserves it probably benefits from themanagement practices of low stocking and occa-sional fires. Its populations would probably sufferfrom attempts to promote dense stocking of treesor heavy site preparation, as occur in many pri-vately managed pine stands. We appreciate theenlightened, multi-use management of the for-ests that provides a rich diversity of species, in-cluding native ants. It is probable that the species

occurs in marshes and flatwoods in Georgia andAlabama.

The first known specimens were collected inpitfall traps, and this seems a good way to samplefor the species. In a site where the species isknown to occur, it can be baited with cookiecrumbs. Our experience is that members of thisspecies accept shortbread cookie crumbs with anenthusiasm not always seen in

Leptothorax

spe-cies, and immediately return to the nest. This maybe the only practical way to find a nest, becausethe nest entrances that we have seen are com-pletely unmarked holes about 2 mm in diameter.

Synonymy of

Leptothorax texanus

Wheelerand L. davisi Wheeler

Preparation of a diagnosis for L. palustris leadto an examination of L. texanus and L. davisi,which are the species most similar, and probablymost closely related to palustris. In Mackay’s use-ful recent revision of a large portion of NorthAmerican Leptothorax (2000), the former subspe-cies L. texanus davisi is raised to species level, onthe basis of several character states. These in-clude differences in the sculpture of the head (tex-anus is described as having the central region“nearly smooth and shining,” davisi “punctate,with the central region covered with longitudinalstriae”); the postpetiole of davisi is covered “withpoorly defined punctures,” while that of texanus is“coarsely reticulo-rugose or punctate.” The term“punctate” as used in MacKay’s descriptions ofthese species and other Leptothorax in his revi-sion refers to sculpture that would traditionallybe considered granulate, or inscribed with fine re-ticulations. There are no actual punctures, exceptfor those from which hairs emerge. The “striae” in-volved are not impressed lines, but fine, irregularcarinae, often superimposed on the reticulatebackground. Allowing for these variances in ter-minology, the differences in surface sculptureused by Mackay to define texanus and davisi canbe found within populations and within nest se-ries in Florida. The postpetiole of davisi is de-scribed as “wider.” This is not upheld byexamination of specimens from the non-overlap-ping supposed ranges of the species. The difficultysurrounding this feature is shown in Mackay’s di-agnostic line drawings: the supposedly narrowerpostpetiole of texanus is actually shown as widerin relation to its length and wider in relation tothe petiole, than that of davisi. The shape of thepetiole in profile is described as “definitely trun-cate” in davisi, “not really truncate” in texanus.Although all specimens we have seen show someevidence of a “truncate” petiolar node, the sharp-ness of the anterior and posterior angles is highlyand continuously variable within sites (such asthe Archbold Biological Station) and through theranges of texanus and davisi. For all these charac-


ter states, the variation seen in the 173 specimens(ABS collection) from throughout Florida is par-ticularly convincing, with every permutation ofthe texanus and davisi diagnostic character statesrepresented in this one set of specimens. We thinkthat the problem in understanding the relation-ship between davisi and texanus is the under-standable result of insufficient specimens whenthese taxa were first established, and insufficientspecimens on hand for the subsequent reviews byCreighton (1950) and Mackay (2000).

We therefore propose the synonymy of Lep-tothorax texanus Wheeler and Leptothorax davisiWheeler under the senior name Leptothorax texa-nus (new synonymy). We do not retain davisi asa subspecies because it seems that the featuresused to define that subspecies are not clearly con-fined to a region, as is normally required for a geo-graphic subspecies. There is, however, someapparent geographic variation within L. texanus.The type series from Texas does show unusuallystrong rugose carinae on the mesosoma, while thetypes of davisi, from New Jersey, have unusuallyweak mesosomal carinae. The zone of intergrada-tion, however, seems to occupy most of the rangeof the species. This analysis may not be the finalword on the texana-davisi question. Leptothoraxtexanus, as presently understood, has one of thelargest ranges of any North American Leptotho-rax. It is still possible that it is a complex of two or

more species; at present, however, we have no ev-idence of this.

Identification of Leptothorax of SoutheasternNorth America

The Leptothorax fauna of the Southeast hasnot been reviewed in its entirety since Creighton’sAnts of North America (1950). Seven of the south-eastern species appear in Mackay’s revision(2000), with species accounts that include a smallliterature review for each species. Our aim is tomake it easy to identify known southeastern spe-cies, and to facilitate the recognition of any unre-ported or undescribed species that may occur inthe Southeast. For this purpose we define the areaas the Atlantic Coastal states from Floridathrough North Carolina, with the addition of Ala-bama. North of this area there are several addi-tional species of Leptothorax, including theunresolved L. muscorum complex. Following thekey is a brief summary of the natural history ofeach species. Included are suggestions for findingcolonies of these species in the hope of encourag-ing further collections from the Southeast. Theknown distribution of several species includes sig-nificant (and improbable) gaps in the Southeast.

The surface sculpture on Leptothorax is bestviewed with a diffused light source, such as a flu-orescent light.

KEY TO Leptothorax WORKERS OF SOUTHEASTERN NORTH AMERICA

1a. Mesosoma in lateral profile with a conspicuous impression between the mesonotum and the propodeum(Fig. 4, A:1a) (throughout Southeast) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .pergandei Emery

1b. Mesosoma not conspicuously impressed between the mesonotum and propodeum . . . . . . . . . . . . . . . . . . . . . . . 2

2a. Head and body, except gaster, covered with coarse, raised reticulations (Fig. 4, B: 2a) (tropical FL)allardycei (Mann) 2b. Head and body not covered with coarse, raised reticulations . . . . . . . . . . . . . . . . . . 3

3a. Propodeal spines in lateral view short and triangular, no longer than the width of an eye, as in Fig.4, C: 3a . . 4

3b. Propodeal spines in lateral view slender, usually longer than the width of an eye, as in Fig. 4, E: 3b . . . . . . . . 5

4a. Head in frontal and lateral views with conspicuous, irregular, longitudinal carinae (Fig. 4, C: 4a)(probably throughout Southeast, except tropical FL) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .bradleyi Wheeler

4b. Head in frontal and lateral views largely shining and lacking sculpture, with only a few delicate carinaearound the eye and frontal ridges Fig. 4, D: 4b), or, in larger specimens, head mostly granulate,not shining, with delicate carinae almost hidden in granulate background (throughout Southeast,except tropical FL) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . schaumii Roger

5a. Head and mesosoma not shining and without conspicuous sculpture; only a few hairs on head and body,these hairs short and broadened; postpetiole unusually large (Fig. 4, E: 5a) (tropical FL) . torrei (Aguayo)

5b. Head and mesosoma partially shining or strongly sculptured; hairs various (occasional specimensof L. curvispinosus lack conspicuous sculpture; this species more northern, without enlargedpostpetiole) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6

6a. Dorsum of mesosoma mostly smooth shining; color usually dark brown, legs and antennae pale yellow(Fig. 4, F) (AL, NC) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . tuscaloosae Wilson

6b. Dorsum of mesosoma either with obvious fine carinae, or not shining, or both . . . . . . . . . . . . . . . . . . . . . . . . . . 7

Deyrup & Cover: Leptothorax of the Southeast 57

7a. Head and body dark reddish brown; sides of head with conspicuous, irregular, closely spaced carinae(Fig. 4, G: 7a) (throughout Southeast, except tropical FL) . . . . . . . . . . . . . . . . . . . . . . smithi Baroni Urbani

7b. Head and body not dark reddish brown; sides of head without closely spaced carinae . . . . . . . . . . . . . . . . . . . . 8

Fig. 4. Southeastern species of Leptothorax. Number-letter combinations, such as “1a”, refer to character statesused in the key to species. Species: A: pergandei, B: allardycei, C: bradleyi, D: schaumii, E: torrei, F: tuscaloosae,G: smithi, H: longispinosus, I: curvispinosus, J: palustris. Drawings not to scale.


8a. Propodeal spines in lateral view about as long as basal face of petiole (as in Fig. 4, I: 8a); sides of mesosomawith strong, subparallel carinae (as in Fig 4, H: 8a) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

8b. Propodeal spines in lateral view shorter than basal face of petiole (Fig. 4, J: 8b); sides of mesosomawith fine, irregular carinae that are not parallel (Fig. 4, J: 8c) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

9a. Blackish; head in frontal view with delicate, longitudinal ridges, but otherwise shining (Fig. 4, H: 9a)(southern Appalachians) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . longispinosus Roger

9b. Yellowish or yellowish brown; head in frontal view not shining (Fig. 4, I) (Southeast,into north FL) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .curvispinosus Mayr

10a. Blackish, sometimes with dark red on the mesosoma; postpetiole in dorsal view much wider than long(Fig.3) (throughout Southeast) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . texanus Wheeler

10b. Yellowish, head usually darker than body; postpetiole in dorsal view about as long as wide(Fig.1; Fig. 4, J) (north FL) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . palustris, n. sp.

Abbreviated Notes on Species (Alphabetical)

L. allardycei. Tropical Florida, Caribbean.Nests are usually in hollow twigs or vines on liv-ing trees, occasionally in sawgrass culms at edgesof marshes; in Bahamas sometimes in fallentwigs. Often in poisonwood (Metopium toxiferum).Nocturnal. Usually pale yellow, occasionallybrownish yellow.

L. bradleyi. Central Florida north into Georgiaand Alabama; probably in the Carolinas as well.Similar in color and morphology to L. smithi, butpropodeal spines shorter and few conspicuouscarinae on side of mesosoma. Nests are usually inlarge, living pines, especially Pinus elliottii andP. palustris in open areas. A member of thelongleaf pine ecosystem. Sometimes attracted topeanut butter or jelly baits on tree trunks, but thenest is seldom accessible.

L. curvispinosus. North Florida, throughoutremainder of Southeast, but often rare in south-ern part of range. In mature hardwood forests insouthern edge of range, often in brushy areas andopen forest farther north. Nests are usually inhollow twigs or weed stems on ground, but may bein dead twigs or branches up to about 1 m aboveground. Yellowish color and non-shining head dis-tinguish this species from all sympatric south-eastern Leptothorax, but similar to L. ambiguusEmery, which occurs to the north and can be dis-tinguished by shorter and wider propodeal spines(see Creighton 1950). The latter species mightpossibly occur at higher elevations in the south-ern Appalachians. Attracted to sweet baits.

L. longispinosus. A northern species extendingsouth at mid elevations in the southern Appala-chians. Usually found in mesic forest or forestedges. Nests are in hollow twigs or nuts on theground or buried in leaf litter, occasionally underbark of dead trees. Dark color combined withlong, straight propodeal spines are diagnostic inthe Southeast. Attracted to sweet baits; individu-als of this species and some other Leptothoraxspend a long time licking solid baits, but quickly

fill up at liquid baits such as jelly, making themeasier to trail back to the nest.

L. palustris. See comments, under discussionof the species.

L. pergandei. New Jersey through Florida,west into Nebraska and Arizona. The strongly im-pressed suture between the mesonotum and pro-podeum is diagnostic throughout its range.Usually found in open forests or forest edges, in-cluding both well-drained and poorly drainedsites; has been found in salt marshes. Nests areusually in hollow twigs or nuts, usually buried inleaf litter; occasionally nests in soil. May be deepyellow, brown or black; occasionally bicolored.Readily carries shortbread crumbs back to nest.

L. schaumii. Central Florida north into south-ern Maine, west into Texas. An arboreal specieswith short spines and the head shining, the lattercharacter state visible at low magnification in thefield. Nests are usually in dead branches or underloose bark on live hardwoods or conifers, usuallythe former. Can be either blackish brown or yel-low, sometimes bicolored. Somewhat attracted topeanut butter or jelly baits.

L. smithi. Central Florida north into the mid-Atlantic states and west into Ohio. Nests are usu-ally in standing dead trees in open areas. In Flor-ida usually found in pine snags. A dark reddishbrown species similar in color and morphology tobradleyi, distinguished by long propodeal spinesand conspicuous carinae on the sides of the meso-soma. This is the same species as L. wheeleriM. R. Smith, a name that became preoccupiedwhen the genus Macromischa was synonymizedwith Leptothorax (Baroni Urbani 1978). Some-what attracted to peanut butter or jelly baits, butthe nest is seldom accessible.

L. texanus. Central Florida west to Texas,north to New Jersey. In the Southeast this speciesand the larger L. pergandei are the only dark,shining Leptothorax found foraging on the groundin open areas. Some southeastern queens areblackish, others a striking brick red. Nests are insoil, usually only a few inches below the surface.

Deyrup & Cover: Leptothorax of the Southeast 59

Often forages under a thin surface layer of litter.Can be baited with shortbread crumbs.

L. torrei. Tropical Florida and the Caribbean.This tiny yellow species with short scale-like hairscannot be mistaken for other southeastern Lep-tothorax. Somewhat similar in appearance to Car-diocondyla wroughtonii (Forel), which is alsoyellowish with an expanded postpetiole, but the lat-ter species has no scale-like hairs. Leptothorax tor-rei is usually obtained by sifting or extracting litter.

L. tuscaloosae. Known from Alabama andNorth Carolina; presumably occurs in the inter-vening states. Nests have been found at the basesof large trees in mesic hardwood forest areas (Wil-son 1950). A dark brown, shiny species with palelegs and antennae, L. tuscaloosae is not likely tobe confused with other southeastern Leptothorax.

ACKNOWLEDGMENTS

We thank David Lubertazzi for bringing us the firstspecimens of L. palustris, and we thank Lloyd Davis,Zachary Prusak, and Joshua King for contributing spec-

imens of other species of southeastern Leptothorax. Wethank Pedro F. Quintana-Ascencio for preparing theSpanish abstract. Our research was supported by theArchbold Biological Station and by the Museum of Com-parative Zoology, Harvard University. The expeditionthat produced the type material of L. palustris was sup-ported by the Wilson Ant Collection Fund.

LITERATURE CITED

BARONI URBANI, C. 1978. Materiali per una revisionedei Leptothorax neotropicali al sottogenere Macro-mischa Roger. Entomologica Basiliensia 3: 395-618.

BOLTON, B. 1994. Identification guide to the ant generaof the world. Harvard University Press, Cambridge,MA. 222 pp.

CREIGHTON, W. S. 1950. The ants of North America.Bull. Mus. Comp. Zool. Harvard 104: 1-585.

HÖLLDOBLER, B., AND E. O. WILSON. 1990. The ants.Harvard University Press, Cambridge, MA. 732 pp.

MACKAY, W. P. 2000. A review of the New World ants ofthe subgenus Myrafant (Genus Leptothorax). Hy-menoptera: Formicidae. Sociobiology 36: 265-444.

WILSON, E. O. 1950. A new Leptothorax from Alabama(Hymenoptera: Formicidae). Psyche 57: 128-130.

60


87(1) March 2004

MOVEMENT AND RESIDUAL ACTIVITY OF DELTAMETHRIN IN A GOLF COURSE FAIRWAY UNDER TWO POST-TREATMENT IRRIGATION TIMINGS

Y

ULU

X

IA

1

, M

IKE

A. F

IDANZA

2

,

AND

R

ICK

L. B

RANDENBURG

1

1

Department of Entomology, North Carolina State University, Raleigh, NC 27606

2

Division of Science, Berks-Lehigh Valley College, The Pennsylvania State UniversityP.O. Box 7009, Reading, PA 19610-6009

A

BSTRACT

The impacts of two post-treatment irrigation timings on the field efficacy and residual activ-ity of deltamethrin against nymphs of the southern mole cricket,

Scaptericus vicinus

Giglio-Tos, and the tawny mole cricket,

S. borellii

Scudder, as well as movement of deltamethrin inthe turfgrass profile, were investigated in 1998. Deltamethrin followed by irrigation 24 h af-ter treatment provided the best mole cricket control versus immediate irrigation in bothfield and greenhouse studies. Regardless of irrigation timing, grass clippings had the highestresidual levels of deltamethrin followed by the thatch layer. Clipping residues were higherwith post 24 h irrigation than immediate irrigation with few residues in the upper soil pro-file (top 5 cm).

Key Words: mole crickets, deltamethrin, irrigation, residue,

Scapteriscus borellii

,

Scap-teriscus vicinus

R

ESUMEN

El impacto de dos tiempos diferentes del riego después del tratamiento sobre la eficaz en elcampo y la actividad residual del deltametrin contra las ninfas del grillotopo sureño,

Scap-tericus vicinus

Giglio-Tos, y del grillotopo aleonados,

S. borellii

Scudder, y el movimiento deldeltametrin en el perfil del césped, fueron investigados en 1998. El Deltametrin seguido porel riego 24 horas después del tratamiento suplió el mejor control del grillotopo versus el riegoinmediato en ambos estudios en el campo y en el invernadero. Prescindiendo del tiempo deriego, los recortes de grama tenian el nivel más alto de residuo de deltametrin seguidos porla capa de paja seca enrollada en la base de la grama viva. Los residuos en los recortes fueronmás altos con el riego hecho 24 horas después que en el riego inmediato con pocos residuos

en el perfil superior del suelo (los primeros 5 cm).

Deltamethrin [(

S

)-

a

-cyano-3-phenoxybenzyl(1

R

,3

R

)-

cis

-2,2-dimethyl-3-(2,2-dibromo-vinyl)cy-clopropanecarboxylate] is a pyrethroid insecticideused for the management of a variety of insectpests. Typically irrigation is recommended imme-diately after treatment with pyrethroid insecti-cides when used to control of mole crickets orother soil-inhabiting turfgrass insect pests. Thisrecommendation is partly based on the assump-tion that immediate irrigation aids in moving theinsecticide downward into the soil where the tar-get pests are located. However, current researchsuggests that the effect of irrigation timings oninsecticide efficacy is not consistent (Xia & Bran-denburg, unpublished). For example, in prelimi-nary work, immediate post-treatment irrigationdid not provide better control of mole crickets ver-sus delayed irrigation. It is also unclear how irri-gation timings affect the residual toxicity and themovement (i.e., residue distribution in the grass,thatch, and the upper soil) of insecticides. Molecrickets are the most serious pest of golf courseturfgrasss in the southeastern U.S. and an under-

standing of how to improve pesticide efficacy iscritical (Brandenburg 1997). Therefore, the objec-tives of this study were to: (1) compare field effi-cacy and greenhouse residual activity ofdeltamethrin under immediate and delayed irri-gation timings against mole cricket nymphs and(2) determine deltamethrin residue levels in turf-grass clippings, thatch, and upper soil under twoirrigation timings.

M

ATERIALS

AND

M

ETHODS

Field Efficacy Experiment

This test was conducted on a bermudagrass,

Cynodon dactylon

(L.) Pers., fairway at Fox Squir-rel Golf Course in Brunswick County, NC, on 1Sep 1998. Plots were established in an area withconsistent mole cricket damage throughout andarranged in a completely randomized design withfour replicates per treatment. Plot sizes were 7.5

×

7.5 m. Soapy water samplings (Short & Koehler1979) prior to the experiment indicated that the

Xia et al.: Movement and Residual Activity of Deltamethrin 61

population was approximately 70% southernmole cricket,

Scapteriscus vicinus

Giglio-Tos, and30% tawny mole cricket,

S. borellii

Scudder. Thethatch layer was 1.3 cm thick and dry. Both soil(at 10 cm) and air temperatures at the time of ap-plication were 30°C. Soil at the test site was clas-sified as a mineral soil with a pH of 6.2 and 0.46%humic matter.

Deltamethrin (DeltaGard® 5 SC, AgrEvo USACo., Wilmington, DE) was applied with a boomsprayer (R & D Sprayers Inc., Opelousas, LA)mounted on a Turf-Gator (Deere & Co., Moline,IL) calibrated to deliver 209 L/ha with ten 8003nozzles. Plots in treatment one were treated withdeltamethrin at a rate of 140 g a.i./ha followedimmediately with irrigation. The second delta-methrin application (treatment two) was appliedand irrigated 24 h later. The golf course irrigationsystem was used to apply approximately 0.6 cmwater each time. The normal golf course irrigationschedule was followed thereafter. Approximately0.3 cm of rainfall occurred 3.5 h after treatments.

The mole cricket damage rating system of Cobband Mack (1989) was used to evaluate control.Damage was rated on a 0-9 scale based on the oc-currence of fresh surface damage on nine subgridsof a frame (1

×

1 m) where 0 indicates no damageand 9 (damage observed at all 9 subgrids) indi-cates severe damage. Damage was rated at 7, 14,21, and 28 days after treatment (DAT) by makingfive random frame ratings per replicate each time.

Greenhouse Residual Activity Experiment

Soil cores were taken from the field plots at 0,1, 4, 7, 14, 21, and 28 DAT by using PVC pipechambers (15.5 cm long and 10.5 cm in diam).Three cores were sampled per plot on each sampleday. The PVC chamber was hammered into thesoil until the top of the chamber was level with theturfgrass surface. Chambers containing the soilcores were taken to a greenhouse at North Caro-lina State University in Raleigh, N.C. Three 3rd to5th instar mole crickets (>80% tawny mole crick-ets) were placed on the surface of each chamber tocrawl through the soil core on the same day. Molecricket nymphs used in this study were collectedfrom golf course fairways by the soapy waterflushing method (Xia & Brandenburg, unpub-lished) and kept in a laboratory with house cricketdiet and small earthworms for 14 days before ini-tiating the study. Both ends of the chamber werecovered with plastic petri dishes tied together byrubber bands. Mortality was checked 72 h later.

All data were transformed (square root of X +0.5 arcsine for percentage data) prior to statisti-cal analysis. Analysis of variance (ANOVA,MEANS, SAS Institute 1990) was used to conductanalysis of variance among treatments and tocompute means and standard errors of dependentvariables. Waller-Duncan K-ratio T-test was used

to compare mole cricket damage ratings and mor-tality means between the treatments.

Laboratory Residue Analysis

Samples of grass clippings, thatch, and soil inupper 5 cm depths were taken from the untreatedand deltamethrin treated plots at 0, 4, and 14DAT. Grass clippings and thatch were taken witha hand trowel. Soil samples were taken with astandard soil sampler (2.0 cm in diam) (Lesco,Inc., Rocky River, OH). All samples were placed inZiploc® plastic bags and immediately placed in afreezer.

Gas chromatography analysis of deltamethrinresidue on grass clippings, thatch, and soil wasconducted at EN-CAS Analytical Laboratories(Winston-Salem, NC). The procedures for delta-methrin analysis in grass, thatch, and soil fol-lowed EN-CAS Analytical Laboratories MethodNo. ENC-7/89, entitled “Analytical method for thesimultaneous determination of alpha-R-delta-methrin, cis-deltamethrin, trans-deltamethrin,and/or tralomethrin in soil samples by gas chro-matography” (EN-CAS Analytical Laboratory, in-ternal publication, issued May 22, 1990). Residuelevels of deltamethrin were the sum of

alpha-R

,

cis

, and

trans

isomers.

R

ESULTS

Field Efficacy Experiment

Twenty four hour deltamethrin post-treatmentirrigation had numerically the lowest mole cricketdamage ratings consistently during the experi-mental period (Table 1), and was the only treat-ment with significantly lower damage ratingscompared to the untreated control at 7 and 14DAT (Table 1). There were no significant differ-ences in damage ratings between the untreatedcontrol, or deltamethrin with immediate post-treatment irrigation at 7, 14, 21, and 28 DAT.

Greenhouse Residual Activity Experiment

Results of the greenhouse test showed a simi-lar trend as the field efficacy test. Mole cricketmortality from deltamethrin with delayed irriga-tion was significantly higher than all other treat-ments at 0 and 1 DAT (Table 2). Mole cricketmortality from deltamethrin with irrigation 24 hlater was significantly higher than the untreatedcontrol at 0, 1, 4, 7, and 14 DAT. Deltamethrin fol-lowed by immediate irrigation provided highermortality than the untreated on 0, 1, and 7 DAT.

Laboratory Residue Analysis

Results of the residue analysis indicated thatbermudagrass clippings had the highest delta-

62


87(1) March 2004

methrin residue levels, followed by thatch, and thesoil at 0, 4, and 14 DAT (Fig. 1). Deltamethrin res-idues in the upper 5 cm soil were very low, rangingfrom less than 0.02 to 0.04 ppm under either irri-gation timing during the experimental period. Thedeltamethrin residues in thatch were similar be-tween the two irrigation timings at 0, 4, and 14DAT. Analysis of clippings indicated that delta-methrin residues were consistently higher with ir-rigation 24 h later versus immediate irrigation.

D

ISCUSSION

Results of this study indicate that post-treat-ment irrigation timing affects field efficacy andresidual activity of deltamethrin against molecricket nymphs. Irrigation timings also influ-enced the movement of deltamethrin into theturfgrass profile. Delayed irrigation resulted ingreater deltamethrin residue on bermudagrassleaf clippings when compared to immediate irri-gation. However, only traces of deltamethrin res-idue were found in soil under either irrigationtiming. Results indicate that field efficacy, resid-ual activity, and deltamethrin residue levels inleaf clippings are related.

Deltamethrin with delayed irrigation providedbetter mole cricket control than immediate irriga-tion. This trend was observed in the field studyand reinforced in the greenhouse bioassay. How-

ever, mole crickets in the small and closed PVCchambers had an increased chance to contactgrass leaves compared to the real situations inthe field. This could have contributed to the highmole cricket mortality in the delatmethrin withdelayed irrigation in the greenhouse bioassay be-cause deltamethrin residues in leaf clippings un-der irrigation 24 h later were higher than withimmediate irrigation.

This study underscores the challenges in man-aging soil insect pests in turfgrass: how to moveinsecticides into the soil where the target insectslive. Neither immediate nor delayed irrigationimproved movement of the insecticide into soil inthis study. The physical properties of delta-methrin, turfgrass mowing height, and thatchlayer thickness were the main factors that con-tributed to low deltamethrin residues in the soilprofile. Deltamethrin is almost insoluble in water(<0.1 mg/L) and has a moderately high partitioncoefficient (4.6 at 25°C). This indicates that irri-gation water cannot easily carry the chemical intothe soil, and the compound tends to bind to or-ganic matter (i.e., grass, thatch, and decayed or-ganic matter in soil). This explains whydeltamethrin was mainly retained by clippingsand not the thatch. This result is different fromother insecticides which are mainly retained bythe thatch layer (Niemczyk 1987; Niemczyk &Krueger 1987; Schleicher et al. 1995). Fox Squir-

T

ABLE

1. F

IELD

EFFICACY

OF

DELTAMETHRIN

AND

BIFENTHRIN

AGAINST

NYMPHS

OF

SOUTHERN

AND

TAWNY

MOLECRICKETS

, 1998.

Insecticide/irrigation timing Rate

g (a.i.)/ha

Mole Cricket Damage Rating

1,2

7 DAT 14 DAT 21 DAT 28 DAT

Untreated 4.1 b 4.0 b 4.3 a 4.0 aDeltamethrin/immediate 140 3.1 ab 3.5 ab 4.4 a 3.7 aDeltamethrin/24 h later 140 2.3 a 2.2 a 2.6 a 2.8 aBifenthrin/immediate 120 2.7 ab 3.4 ab 3.5 a 3.2 a

1

Mole cricket damage rating ranged from 0 to 9, 0 = no damage and 9 = severe damage.

2

Means followed by the same letter in each column are not significantly different (

α

= 0.05, Waller-Duncan K-ratio T-test).

T

ABLE

2. G

REENHOUSE

BIOASSAY

OF

RESIDUAL

ACTIVITY

OF

DELTAMETHRIN

AND

BIFENTHRIN

AGAINST

NYMPHS

OFSOUTHERN

AND

TAWNY

MOLE

CRICKETS

, 1998.

Insecticide/irrigation timing Rate

g (a.i.)/ha

% mole cricket mortality, 72 h after infestation

1, 2

0 DAT 1 DAT 4 DAT 7 DAT 14 DAT 21 DAT 28 DAT

Untreated 2.8 a 0 a 0 a 0 a 2.8 a 5.6 a 2.8 aDeltamethrin/immediate 140 72.2 b 56.9 b 9.7 ab 30.5 c 36.1 ab 22.2 a 5.60 aDeltamethrin/24 h later 140 94.5 c 90.3 c 25.0 b 30.5 c 61.1 b 25.0 a 13.9 aBifenthrin/immediate 120 41.8 b 41.7 b 18.1 ab 16.3 b 5.6 a —

3

—

3

1

Means followed by the same letter in each column are not significantly different (

α

= 0.05, Waller-Duncan K-ratio T-test).

2

Mole cricket nymphs were exposed to treated soil cores for 72 h.

3

The bifenthrin treatment was dropped due to low residue activity.

Xia et al.: Movement and Residual Activity of Deltamethrin 63

Fig 1. Deltamethrin residue (recovered ppm) in soil, thatch, and grass clippings at 0 (A), 4 (B), and 14 (C) DAT.

A: 0 DAT

B: 4 DAT

C: 14 DAT

64


87(1) March 2004

rel Golf Course fairways were seldom dethatched.Over time, this resulted in a thick thatch layer.Also, grass cut height in the fairway was higherthan many other golf courses in North Carolina.

Deltamethrin provided 100% control of 3rdto 5th instar mole cricket nymphs a week aftertreatment in another greenhouse bioassay testusing 19 L plastic buckets (Xia & Brandenburg,unpublished). Based on this study and the un-published data, it appears that a major obstaclein achieving maximum deltamethrin efficacy inthe field is the difficulty of moving the productpast the grass and thatch into the soil. A gran-ular formulation may provide better controlversus sprayable formulations because limitedquantities of insecticides in granular formula-tions will be retained on the grass. This hasbeen demonstrated with the herbicide pen-dimethalin, which is noted for its tendency to beretained in the thatch layer (Gasper et al.1994). Round, small, and heavy granular parti-cles of an insecticide may help to improve molecricket control since they have a better chanceof avoiding grass leaves and the upper portionof the thatch layer. Another alternative is to de-thatch the turf prior to insecticide application.Verticutting removes the thatch layer and mayhelp insecticides penetrate into the soil. Sub-surface application may be the best way toavoid the retention by grass and thatch. How-

ever, few golf courses have subsurface applica-tion equipment.

R

EFERENCES

C

ITED

B

RANDENBURG

, R. L. 1997. Managing mole crickets: de-veloping a strategy for success. Turfgrass Trends. 6(1): 1-8.

C

OBB

, P. P.,

AND

T. P. M

ACK

. 1989. A rating system forevaluating tawny mole cricket,

Scapteriscus vicinus

Scudder, damage (Orthoptera: Gryllotalpidae). J.Entomol. Sci. 242: 142-144.

G

ASPER

, J. J., J. R. S

TREET

, S K. H

ARRISON

,

AND

W. E.P

OUND

. 1994. Pendimethalin efficacy and dissipa-tion in turfgrass as influenced by rainfall incorpora-tion. Weed Sci. 42: 586-592.

N

IEMCZYK

, H. D. 1987. The influence of application tim-ing and posttreatment irrigation on the fate and ef-fectiveness of isofenphos for control of Japanesebeetle (Coleoptera: Scarabaeidae) larvae in turf-grass, J. Econ. Entomol. 80: 465-470.

N

IEMCZYK

, H. D.,

AND

H. R. K

RUEGER

. 1987. Persistenceand mobility of isozofos in turfgrass thatch and soil.J. Econ. Entomol. 80: 950-952.

SAS I

NSTITUTE

. 1990. SAS/STAT user’s guide, version6.10. SAS Institute, Cary, NC.

S

CHLEICHER

, L. C., P. C. S

HEA

, R. N. S

TOUGAARD

,

AND

D. R. T

UPY

. 1995. Efficacy and dissipation of dithi-opyr and pendimethalin in perennial ryegrass (

Lo-lium perenne

) turf. Weed Sci. 43: 140-148.S

HORT

, D. E.,

AND

P. G. K

OEHLER

. 1979. A samplingtechnique for mole crickets and other pests in turf-grass and pasture. Florida Entomol. 62 (3): 282-283.

Dobbs & Brodel: Nonindigenous Insects in Aircraft 65

CARGO AIRCRAFT AS A PATHWAY FOR THE ENTRYOF NONINDIGENOUS PESTS INTO SOUTH FLORIDA

T

HOMAS

T. D

OBBS

AND

C

HARLES

F. B

RODEL

USDA, Animal and Plant Health Inspection Service, Plant Protection and QuarantineMiami Inspection Station, P.O. Box 59-2136, Miami, FL 33159

A

BSTRACT

Cargo aircraft arriving at Miami International Airport from foreign origins were randomlyselected and inspected from September 1998 to August 1999 for the presence of live hitch-hiking insects. An overall infestation (= approach) rate of 10.4% was found, with the rate foraircraft arriving from Central American countries noticeably greater at about 23%. Quaran-tine-significant taxa from 33 families in five orders were detected, with members of Lepi-doptera and Coleoptera most frequently encountered. More than 40% of infested aircraftcontained multiple insect taxa. No correlation was established between the presence ofhitchhiking insects and the time of day (night vs. day) during which cargo was loaded atpoints of origin or the nature of cargo on board. Quarantine-significant organisms arrived incargo aircraft during all months of the year. Significant seasonality (dry season vs. wet) wasobserved for pests on flights arriving from Central America, with separate peaks noted inMay and October.

Key Words: aircraft, exotic pests, nonindigenous organisms, pathway, Florida

R

ESUMEN

Los aviones de carga arrivados al Aeropuerto Internacional de Miami de origen extranjerofueron seleccionados al azar para ser inspeccionados desde Septembre 1998 hasta Agosto1999 para la presencia de insectos vivos introducidos al pais. Se encontró un grado de infes-tación (= abordamiento) total de 10.4%, con un grado notablemente mayor en aproximada-mente 23% de los aviones procedentes de los paises Centroamericanos. Las clases de insectos(taxa) significativas para la cuarentena perteneciendo de 33 familias y cinco ordenes fuerondetectados, con miembros de Lepidóptera y de Coleóptera fueron los más frecuentemente en-contrados. Más del 40% de los aviones infestados tenían multiples clases de insectos. No fuéestablecida una correlación entre la presencia de los insectos en el avión y la hora del día (lanoche vs. el día) cuando el cargamento fué cargado en los puntos de origen ó la naturalezadel cargamento en el avión. Los organismos significativos para la cuarentena llegaron enaviones de cargamento durante todos los meses del año. Las plagas observadas en las avio-nes variaron significativamente según la estación (la estación seca vs la estación lluviosa),

con poblaciónes más altas durante mayo y octubre.

Preventing the entry and subsequent estab-lishment of nonindigenous (= adventive

sensu

Wheeler & Hoebeke 2001) organisms into theUnited States has been one of the primary mis-sions of the U.S. Department of Agriculture’s An-imal and Plant Health Inspection Service, PlantProtection and Quarantine (APHIS-PPQ). Path-ways of entry that it actively monitors includepassenger baggage, cargo, international mail, for-eign garbage, and conveyances such as ships,trains, cars, trucks, and aircraft.

APHIS-PPQ has long been aware that aircrafthave the potential to transport insects both inter-nationally and domestically. For several decades,Agency officials issued annual springtime alertsfor inspectors to monitor aircraft arriving fromPanama and the Canal Zone for the presence ofhitchhiking scarab beetles. Two scarab genera ofprimary interest were

Liogenys

(

L. macropelma

Bates, in particular) and

Geniates

. In addition,

APHIS officials annually monitor U.S. airports inregions infested with the Japanese beetle,

Popilliajaponica

Newman, to ensure that domestic aircraftdo not transport this pest to non-infested areas.

Researchers also have been aware of the con-nection between aircraft and the dissemination ofinsect species from one region to another. Swain(1952) predicted more than a half century ago thataircraft would become a major distributor of insectpests. He reported that nearly 3000 species of in-sects from 293 families had already been detectedtraveling aboard aircraft. Also, he attributed theinvasion of the Hawaiian Islands by the Orientalfruit fly to abandoned exclusionary precautions in-volving military aircraft from the Mariana Islandsduring World War II. Of the insects introducedinto Guam during the 1980s, Schreiner (1991)concluded that four species of Noctuidae and sev-eral species of Coleoptera and Homoptera proba-bly arrived as hitchhikers in the holds or cabin

66


87(1) March 2004

areas of aircraft. McGregor (1973) stated thatmany future accidental introductions of exotic in-sects into North America would likely occur viathis pathway. Sailer (1978) argued for the creationof ecological barriers around areas of major for-eign traffic, such as international airports, to con-tain introductions of nonindigenous insects.

Despite this awareness by government agen-cies and researchers, the literature contains fewformalized studies that investigated aircraft as apathway for insect introduction. Of these fewstudies, none focused on infestation rates (re-ferred to as approach rates by regulatory officials)of foreign-arriving aircraft. In addition, none con-centrated on hitchhiking insects of potential eco-nomic significance to agricultural crops, forests,and ornamentals. Most of the work instead hasfocused on insects of public health importance.Studies conducted in Australia (Russell et al.1984; Davidson 1990), Japan (Otaga et al. 1974;Takahashi 1984), New Zealand (Laird 1951), thePhilippines (Basio et al. 1970), Singapore (Goh etal. 1985), and the United States (Evans et al.1963) spotlighted hitchhiking insects that vectorhuman pathogens or parasitize livestock. Otherresearchers (Sullivan et al. 1958; Russell 1987)studied how well insects survive in various com-partments of jet aircraft.

Airports in Florida, subtropical South Floridain particular, are primary arrival sites for cargoaircraft transporting large quantities of foreign-grown perishable products such as cut flowers,vegetables, fruits, and ornamental plants. From1994 to 2000, the tonnage of perishable commod-ities imported into Florida by cargo aircraftslightly more than doubled (Klassen et al. 2002).Over this same period, the number of quarantine-significant pest detections resulting from inspec-tion of these commodities increased 1.7-fold(Klassen et al. 2002). More than 19,000 cargoflights arrived at Miami International Airport in2002 (APHIS-PPQ, unpublished); this number isprojected to increase as consumption of perish-able items throughout the U.S. increases.

Steady increases in cargo flight arrivals andtonnage of perishables into Florida will likely beaccompanied by increased numbers of nonindige-nous insect species that become established. Flor-ida has a history of vulnerability to successfulinvasion by such organisms. For the period 1970-1989, about as many adventive arthropods annu-ally became established in Florida as in all otherareas of the continental United States combined(Frank & McCoy 1992). Only Hawaii exceedsFlorida in the number of adventive arthropodsthat become established each year (Beardsley1979). This vulnerability to invasion has affectedthe composition of the fauna of Florida over time.An estimated 15-25% of all major taxonomicgroups in South Florida are considered to be non-indigenous, in stark contrast to 1.7% for other re-

gions within the continental United States (Ewel1986). About 1000 of the 12,500 arthropods inFlorida, or about 8%, are nonindigenous (Frank &McCoy 1995).

Given the vulnerability of Florida to invasionby insects, ever-increasing arrivals of cargo air-craft into Florida, and a lack of knowledge aboutcargo aircraft as an entry pathway for adventiveorganisms of potential economic impact, APHIS-PPQ in Miami undertook a study to determine:(1) overall and regional approach rates for cargoaircraft arriving at Miami International Airport,(2) the number of insect taxa aboard cargo air-craft, (3) the taxonomic composition of inter-cepted organisms, (4) potential day/nightdifferences in approach rates, (5) approach ratedifferences based on cargo type, and (6) seasonaldifferences in the number of organisms detected.

M

ATERIALS

AND

M

ETHODS

Sample Size and Selection

In 1996, approximately 23,000 cargo aircraftarrived in Miami, Florida, from foreign origins(APHIS-PPQ, unpublished), which equates toabout 60 arrivals per day. To detect an infestation(= approach) rate as low as 1% with a 95% level ofconfidence, a sample size of 730 aircraft was se-lected, and two aircraft were randomly selectedand inspected each day of the study period. Thestudy was conducted over a 12-month period from1 September 1998 to 31 August 1999. This dura-tion would enable seasonal effects involving rain-fall and temperature to be detected, at least for themost frequently sampled regions and countries.

To select samples, each day was divided into 96quarter-hour increments. The increments weresequentially numbered with midnight to 12:14AM being increment number one, 12:15 to 12:29AM being increment number two, and so on.Daily, a random number table was used to selecttwo numbers from one to 96 that corresponded toparticular quarter-hour increments. The first for-eign cargo aircraft scheduled to arrive during orafter the selected increment was designated as asample.

Sample Inspection Process

The regular workforce of approximately 150APHIS-PPQ officers in Miami was speciallytrained and equipped to assist with this study.(Most APHIS-PPQ officers have subsequentlybeen transferred into the newly created Depart-ment of Homeland Security, although duties re-lating to aircraft inspections remain unchanged.)When a sample aircraft arrived, the assigned of-ficer immediately inspected the cockpit and galleyareas for live hitchhiking organisms (i.e., insects,snails, slugs, and weed seeds). Unconsumed fresh


fruits found in these areas were bagged in plasticto be examined later for commodity-associated in-sects and diseases. Flight crew members wereasked to provide the exact time when the aircraftdeparted from the foreign airport from which itwas arriving. The officer remained at the aircraftlocation throughout the cargo offloading process,during which time all surfaces of palletized cargowere inspected for hitchhiking organisms. Whenoffloading was completed, the officer intensivelyexamined the floors, walls, other surfaces, and airspace within all cargo compartments for hitchhik-ing pests.

During and after the inspection, the officer re-corded all pertinent information concerning theaircraft and the inspection on a specially designeddata form to which were attached the cargo man-ifest and the U.S. Customs general declaration.

Identification of Specimens

All live specimens found associated with sam-pled aircraft were submitted to APHIS-PPQ localspecialists for immediate identification. All deter-minations were made to the lowest taxon possi-ble. When local specialists were unable to performspecific identifications, specimens were for-warded to national specialists located in Wash-ington, DC, Beltsville, MD, Columbus, OH, andMiami, FL, depending on the type of organism in-tercepted. Specimens could not always be identi-fied to the species or generic level because of thepoor condition of material, lack of specialists orscientific knowledge for certain taxonomicgroups, and taxonomic keys based on a single sex.

Following identification, specimens were cate-gorized as either quarantine-significant (QS) ornon-quarantine-significant (NQS). QS taxa aredefined as species of plant-feeding insects, mites,or mollusks, plant-infecting pathogens, or weedseeds that are not known to occur, or are notwidely distributed, in the United States. Speci-mens belonging to plant-feeding groups, but iden-tified only to the family or generic level, are alsoplaced in this category because they could poten-tially represent QS taxa. NQS taxa are speciesthat are widely distributed in the United Statesand/or are categorized by APHIS-PPQ as notlikely to pose a significant threat to U.S. agricul-ture, forests, and ornamentals.

We did not classify the relative risk levels ofQS taxa. Instead, individual interceptions weresimply grouped into one of the two categories out-lined above, a practice that is widely used withinAPHIS-PPQ when making quarantine decisions.

Data Collection and Analysis

All data relating to the sampled aircraft werecollected from specially designed data forms com-pleted by the officers, or from official federal doc-

uments associated with the aircraft. Selecteddata were compiled into a local database. In addi-tion, all data on QS taxa were recorded in the na-tional Port Information Network (PIN) databasewhich contains all pest interception reports since1985. References to new records in this study im-ply that a given QS taxon did not appear in PIN inassociation with (1) aircraft as an entity, apartfrom any transported cargo, and/or (2) a particu-lar U.S. port of entry, e.g., Miami.

Countries were grouped into one of the follow-ing regions for purposes of calculating regionalapproach rates: Central America, South America,West Indies, Europe, and Other. Trinidad wasconsidered to be part of South America, not theWest Indies, in keeping with other federal prac-tices. Mexico was included among Central Ameri-can countries. Canada and Taiwan were groupedin the artificial category “Other”.

A comparison of data for aircraft loaded duringdaylight hours versus those for aircraft loaded atnight was made to determine if bright lights nec-essary for nighttime cargo operations attractednocturnal fliers, thus increasing approach rates.The comparison was difficult because the precisetime during which aircraft are loaded at the pointof origin is not recorded by airline personnel. Air-craft logbooks, however, consistently reflect thetime at which aircraft depart. Our experience atMiami International Airport has shown that com-mercial aircraft nearly always depart immediatelyafter cargo loading is complete. Time of departurewas therefore used as a close approximation of thetime when cargo was loaded. Aircraft with depar-ture times between 7:00 AM and 7:00 PM wereconsidered to be loaded during daylight hours,while those departing between 7:00 PM and 7:00AM were considered to be night-loaded. Effortswere focused on cargo aircraft arriving from Cen-tral America since approach rates from this regionwere substantially higher than those observedfrom any other. Departure times for seven aircraftfrom this region were not available. Temporalanalyses also were performed on the Auchenor-rhyncha, Noctuidae and Scarabaeidae found.These three groups were repeatedly interceptedduring the study and are either primarily noctur-nal or generally attracted to lights. Each was ex-amined to determine if time of loading had anyeffect on their presence as hitchhikers.

To determine if certain types of cargo weremore attractive to hitchhiking organisms, thecommodities being transported were divided intotwo broad categories, regulated and non-regu-lated, with the approach rates of each examined.Regulated cargoes are agricultural in nature andare generally inspected on arrival by APHIS-PPQ. Plants or plant products make up the bulkof these items. Non-regulated cargoes are miscel-laneous items not considered to be derived fromagricultural sources.

68


87(1) March 2004

Investigations into potential aspects of season-ality were restricted to Central America since air-craft arriving from that region experienced a fargreater approach rate than did aircraft from anyother region. Central America has essentially twoseasons, wet and dry (Alfaro 2000). The onset ofthe wet season varies slightly from year to yearbut begins around May and lasts for approxi-mately six months. For the purposes of our analy-ses, we considered the wet season to be from 1May through 31 October, and the dry season to befrom 1 November through 30 April. Aircraft weregrouped into one these two categories and the ap-proach rate for each was examined.

The

G

-test of independence (Sokal & Rohlf1981) was used to determine if the presence of QSorganisms in sampled cargo aircraft varied inde-pendently of or was correlated with (1) the time ofdeparture from foreign origins, (2) the nature ofthe cargo loaded aboard and (3) the season of de-parture. For the time and season of departure,only the data pertaining to aircraft originating inCentral America were included in the

G

-test. Re-garding the nature of cargo, sampled aircraftfrom all geographic regions were included. In allcases,

G

values were adjusted by Williams’ correc-tion for 2

×

2 contingency tables (Sokal & Rohlf1981) and then compared with the critical valueof chi square at the 5% significance level and 1 de-gree of freedom.

R

ESULTS

AND

D

ISCUSSION

Approach Rates by Region and Country

Aircraft were sampled from 38 countries dur-ing the study, with QS organisms detected in air-craft arriving from 17 of these. The overall pestapproach rate for foreign cargo aircraft arrivingat Miami International Airport was 10.4% (Table1). The approach rate for Central America (23.2%)was substantially greater than rates observed forany other region. Aircraft from all sampled coun-tries in Central America contained QS organisms.Approach rates for individual countries withinCentral America varied slightly, with Costa Rica,El Salvador, Guatemala, and Honduras allgreater than 23%. Mexico and Panama were ap-proximately 10 percentage points lower. The ap-proach rate for Nicaragua was substantiallygreater (50%), although this figure might be lessreliable than others for the region due to the com-paratively smaller sample size. The mean ap-proach rate of more than 23% was at least fourtimes that seen from any other region.

Approach rates for South American countriesranged from 0 to 15.9%, with a mean of 5.8%. Air-craft from six of the ten sampled countries con-tained QS pests. Small sample sizes for Argentina(7), Bolivia (4), and Uruguay (1) produced ques-tionable approach rates for these countries. Ecua-

dor had the highest approach rate for the region,followed by Trinidad. Rates observed for Peru andColombia were noticeably lower. The approachrate for Argentina was also quite high, althoughthe sample size (7) was relatively small. More air-craft were sampled from Colombia (155) thanfrom any other country during the study, reflect-ing the tremendous volume of goods it exports toMiami. Most of those aircraft transported perish-able cut flowers that could be attractive to phy-tophagous pests but, despite that, the observedapproach rate almost equaled the mean rate forthe region. Large numbers of aircraft from Brazil,Chile, and Venezuela were sampled, but very fewwere infested.

Approach rates for countries within the WestIndies also varied considerably, ranging from 0 to18%. Infested aircraft originated from just threecountries in the region—Jamaica, Haiti, and theDominican Republic. The approach rate for Haiti(18%) was more than twice that of any other coun-try in the region, albeit from a comparativelysmall sample size of 11. In contrast, Bahamasand the Dominican Republic, the two countries inthe region with the largest number of sampledaircraft, had lesser approach rates of 0 and 2.9%,respectively.

We made no inferences about approach ratesfor other regions because sample sizes were usu-ally small. The lone infested aircraft from Francecan be called into question. The scarab beetlefound on board belonged to a genus (

Dyscinetus

)known only from the Western Hemisphere (En-drödi 1985). More likely, this insect actually en-tered the aircraft during a fueling stopover inCanada. In general, more data are necessary tobetter understand the risks associated with cargoaircraft from these areas.

Diversity of Intercepted Taxa

Various QS organisms were intercepted frominfested aircraft samples. In total, 151 insectsfrom 33 families in five orders were represented,along with one plant pathogen (citrus canker inaircraft stores from Argentina) (Table 2). All in-sect specimens were adults except two. A larva of

Crocidosema aporema

(Walsingham) was foundin the emptied hold of an aircraft from Guatemalaand likely originated from boxes of beans onboard. In the second case, a tettigoniid nymphwas found aboard an aircraft transporting fruitsand live plants from Costa Rica.

Lepidoptera comprised the largest single com-ponent of captured specimens, followed closely byColeoptera (Fig. 1). These findings generallyagree with those of Frank & McCoy (1992), whonoted that the two most numerous orders of non-indigenous organisms reported new to Floridasince 1971 were Lepidoptera and Coleoptera.Conspicuous by their absence were interceptions


T

ABLE

1. A

PPROACH

RATES

BY

COUNTRY

AND

REGION

FOR

CARGO

AIRCRAFT

ARRIVING

AT

M

IAMI

I

NTERNATIONAL

A

IR-PORT

, 1 S

EP

. 1998-31 A

UG

. 1999.

Aircraft sampled (

n

) Aircraft infested (

x

)Approach rate(

x

/

n

)100 (%)

Central America

Costa Rica 44 12 27.3El Salvador 17 4 23.5Guatemala 44 12 27.3Honduras 33 8 24.2Mexico 33 4 12.1Nicaragua 8 4 50.0Panama 28 4 14.3

Region 207 48 23.2

South America

Argentina 7 1 14.3Bolivia 4 0 —Brazil 29 0 —Chile 45 0 —Colombia 155 8 5.2Ecuador 44 7 15.9Peru 16 1 6.3Trinidad 17 2 11.8Uruguay 1 0 —Venezuela 28 1 3.6

Region 346 20 5.8

West Indies

Antigua 2 0 —Aruba 1 0 —Bahamas 42 0 —Barbados 1 0 —Cayman Is. 3 0 —Cuba 1 0 —Dominica 2 0 —Dominican Republic 35 1 2.9Grenada 3 0 —Haiti 11 2 18.2Jamaica 12 1 8.3St. Kitts 4 0 —St. Lucia 3 0 —St. Vincent 1 0 —Turks & Caicos 1 0 —

Region 122 4 3.3

Europe

France 4 1* 25.0Luxembourg 4 0 —Netherlands 10 0 —Spain 5 0 —Region 23 1 4.3

OtherCanada 2 0 —Taiwan 3 0 —

Overall 703 73 10.4

*Origin questionable

70


87(1) March 2004

T

ABLE

2. Q

UARANTINE

-

SIGNIFICANT

ORGANISMS

INTERCEPTED

IN

FOREIGN

CARGO

AIRCRAFT

ARRIVING

AT

M

IAMI

I

N-TERNATIONAL

A

IRPORT

, 1 S

EP

. 1998-31 A

UG

. 1999.

Organism Origin Frequency

COLEOPTERA

ChrysomelidaeAlticinae, species Mexico 1

Acalymma

sp.

a,b

Ecuador 1Guatemala 1

Altica

sp.

a,b

El Salvador 1

Amphelasma

sp.

a,b,c

Honduras 1

Colaspis

sp. El Salvador 1Honduras 2

Epitrix

sp.

a,b

El Salvador 1

Exora encaustica

(Germar)

a,b,c

El Salvador 1

Longitarsus

sp.

a

Ecuador 1

Malacorhinus irregularis

(Jacoby)

a,b,c

El Salvador 1

Metachroma

sp.

a

Costa Rica 1

Rhabdopterus

sp.

a

Costa Rica 1

Typophorus

sp.

a

El Salvador 1

CurculionidaeCurculionidae, species El Salvador 1Brachycerinae, species El Salvador 1

Cleogonus

sp.

a,b

El Salvador 1

Conotrachelus

sp.

a

El Salvador 1

Elateridae

Conoderus pictus

(Candeze)

a,b

El Salvador 1

Conoderus rodriguezi

Candeze Costa Rica 1Guatemala 1

Scarabaeidae

Anomala

sp. Costa Rica 2Guatemala 1Honduras 1Nicaragua 1Trinidad 1

Cyclocephala

sp. Ecuador 1El Salvador 1Honduras 1Panama 1

Diplotaxis

sp.

a

Mexico 1

Dyscinetus

sp. France (?) 1

Euetheola bidentata

Burmeister

a,b,c

El Salvador 1

Liogenys quadridens

(Fabricius) Ecuador 1

Liogenys

sp. Colombia 1Ecuador 1

Manopus

sp.

a

Colombia 1

Phyllophaga

sp. Colombia 1Guatemala 2

Tomarus

sp. El Salvador 1Guatemala 2Trinidad 1

a

New find in Miami aircraft.

bNew find in aircraft nationwide.cNew Miami record, all sources.dNew U.S. record, all sources.eImmature stage.


TenebrionidaeBlapstinus sp. Costa Rica 1

Trinidad 1

HEMIPTERA: Auchenorrhyncha

Auchenorrhyncha, species Costa Rica 1

CercopidaeProsapia sp.a,b,c Costa Rica 1

El Salvador 1

CicadellidaeCicadellidae, species Honduras 2Typhlocybinae, species Mexico 1Dikraneurini, species Panama 1Chlorotettix sp.a,b,c,d Honduras 1Exitianus sp.a,b,c,d Honduras 1Graphocephala sp.a,b,c Ecuador 1Haldorus sp.a,b,c,d Haiti 1Tagosodes sp.a,b,c,d El Salvador 2

CixiidaeCixiidae, species Mexico 1Pintalia sp.a,b,c Honduras 1

NogodinidaeBladina vexans Kramera,b,c,d Colombia 1

HEMIPTERA: Heteroptera

CydnidaeCydnidae, species Guatemala 1

LygaeidaeNysius sp.a Nicaragua 1

MiridaePhylinae, species Ecuador 1Reuteroscopus sp.a,b Mexico 1Sixeonotus sp.a,b El Salvador 1Tropidosteptes chapingoensis Carvalho & Rosasa,b,c,d Colombia 1Tropidosteptes sp. Guatemala 1

PentatomidaeBerecynthus hastator (Fabricius)a El Salvador 1

RhopalidaeJadera sp.a Costa Rica 1

RhyparochromidaeRhyparochromidae, species El Salvador 1Prytanes sp. Guatemala 1

ISOPTERA

KalotermitidaeCryptotermes sp.a,b Honduras 1

TABLE 2. (CONTINUED) QUARANTINE-SIGNIFICANT ORGANISMS INTERCEPTED IN FOREIGN CARGO AIRCRAFT ARRIVINGAT MIAMI INTERNATIONAL AIRPORT, 1 SEP. 1998-31 AUG. 1999.


aNew find in Miami aircraft.bNew find in aircraft nationwide.cNew Miami record, all sources.dNew U.S. record, all sources.eImmature stage.


LEPIDOPTERA

ArctiidaeArctiidae, species Colombia 1Empyreuma sp.a,b,c,d Dominican Republic 1

CrambidaeCrambidae, species Costa Rica 2

Nicaragua 1

ElachistidaeElachistidae, species Costa Rica 1

GelechioideaGelechioidea, species Dominican Republic 1Gelechiidae, species Guatemala 1

GeometridaeGeometridae, species Costa Rica 4

Ecuador 1Guatemala 3Nicaragua 1Panama 1

Eupethecia sp.a,b Guatemala 1

GracillariidaePhyllocnistis sp.a,b,c Colombia 1

NoctuidaeNoctuidae, species Costa Rica 5

Guatemala 3Haiti 1Honduras 2Mexico 1Nicaragua 5Panama 1

Catocalinae, species Costa Rica 1Mexico 1

Copitarsia sp. Colombia 1Elaphria sp. Costa Rica 1Eulepidotis mabis Guenéea,b,c,d Costa Rica 1Ophisma sp.a,b,c,d Nicaragua 1Pararcte schneideriana (Stoll)a,b,c,d Ecuador 1Phalaenophana fadusalis Walkera,b,c,d Costa Rica 1

NotodontidaeNotodontidae, species Costa Rica 1

OecophoridaeStenomatinae, species Costa Rica 1

PyraloideaPyraloidea, species Guatemala 1Pyralidae, species El Salvador 2

Peru 1





of Diptera and Hymenoptera. Members of theseorders might be comparatively less attracted tolight, QS groups such as leafminers and gallmidges tend to be difficult to detect due to theirsmall size, and relatively few QS taxa occur inthese orders.

A sizable number of organisms interceptedduring the study represented new records forAPHIS-PPQ. These are denoted with superscriptsin the list of taxa (Table 2). Of the 151 pests iden-tified from infested aircraft, 32 (21%) belonged totaxa that had not previously been intercepted incargo or passenger aircraft at U.S. ports of entry.Moreover, 13 (9%) of them had never been inter-cepted in conjunction with any pathway of entry.

Pests Per Infested Aircraft

Officers intercepted 151 QS organisms fromthe 73 infested aircraft. Some of these aircraft

contained multiple organisms. The data indicatean inverse curvilinear relationship between thenumber of infested aircraft and the number of QStaxa per infested aircraft (Fig. 2). Accordingly,59% of the infested aircraft had only one QStaxon, while 41% contained more than one, in-cluding one aircraft with 18. No other aircraft hadmore than seven QS pests.

Some infested aircraft harbored multiple indi-viduals of the same taxon. For example, one air-craft sample contained a male and female ofTomarus (Coleoptera: Scarabaeidae). In such sit-uations, the risk of establishment would presum-ably increase due to the presence of potentialmating pairs.

Diurnal Patterns

Approach rates for all insect groups combinedwere not significantly different (G-test for indepen-

SphingidaeSphingidae, species Venezuela 1

TineidaeAcrolophinae, species Colombia 1

TortricidaeCrocidosema aporema (Walsingham)a,b,e Guatemala 1

ORTHOPTERA

GryllidaeGryllidae, species Costa Rica 1Allonemobius sp.a,b Honduras 1Gryllus capitatus Saussure Ecuador 1Gryllus sp. Colombia 1

Costa Rica 3Guatemala 2Honduras 3Jamaica 1

TetrigidaeTettigidea sp.a,b,c,d El Salvador 1

TettigoniidaeTettigoniidae, species Costa Ricae 1

Honduras 1Bucrates capitatus (De Geer) Colombia 1Conocephalus sp. Honduras 1Neoconocephalus punctipes (Redtenbacher)a,b,c,d El Salvador 1

PLANT PATHOGEN

Xanthomonas axonopodis Starr & Garces pv. citri (Hasse) Dye Argentina 1





dence; p > 0.05) for day versus night loading (Table3). This apparent lack of correlation between timeof loading and the presence of QS organisms sug-gests that APHIS-PPQ should continue to monitorcargo aircraft throughout the day.

Approach rates for the three primarily noctur-nal groups also were not significantly different

(G-test for independence; p > 0.05) for day versusnight loading (Table 4). The daylight conditionduring which loading took place was independentof Noctuidae, Scarabaeidae, and Auchenorrhyn-cha later being found aboard the aircraft. Theseresults are somewhat surprising because thesegroups are generally attracted to lights. In expla-nation, some actual loading times might have dif-fered substantially from recorded departuretimes. Also, some nocturnal hitchhikers mighthave entered aircraft during nighttime loadingoperations and subsequently made several roundtrips before being detected and incorrectly associ-ated with day-loaded aircraft.

Fig. 1. Relative proportions of quarantine-significanttaxa captured in foreign cargo aircraft arriving at Mi-ami International Airport, 1 Sep. 1998-31 Aug. 1999.

Fig. 2. Numbers of quarantine-significant taxa found aboard infested foreign cargo aircraft arriving at Miami In-ternational Airport, 1 Sep. 1998-31 Aug. 1999.

TABLE 3. NUMBERS OF INFESTED CARGO AIRCRAFT FROMCENTRAL AMERICA: CORRELATION OF DEPAR-TURE TIME AND APPROACH RATE AT MIAMI IN-TERNATIONAL AIRPORT.A

Departure Time Infested

NotInfested

ApproachRate

Day 14 62 18.4%Night 35 89 28.2%

aGadj of 2.488 not significant at X20.05(1).


Nature of Cargo

Demonstrating that higher approach rates re-sult when cargo aircraft transport particulartypes of cargo might enable APHIS-PPQ manag-ers to assign greater priority to inspection of thoseaircraft. Analysis of the data (Table 5), however,showed that approach rates for cargo aircraftwere not dependent on whether regulated or non-regulated cargo was being transported (G-test forindependence; p > 0.05). These results point to theneed to inspect all foreign cargo aircraft arrivingat Miami International Airport, regardless of thetype of cargo being transported. Despite these re-sults, though, it is conceivable that particularcommodities, regulated and non-regulated alike,might serve to attract specific kinds of hitchhik-ing pests both before and during the cargo aircraftloading process. We note that 65% of the cargo air-craft sampled contained regulated agriculturalmaterial.

Seasonality Patterns

Monthly approach rates for aircraft from all or-igins were consistently greater in the spring andsummer, with additional isolated peaks of 10% orgreater in October and December (Fig. 3). QS or-ganisms arrived at Miami International Airport

via foreign cargo aircraft during all months of theyear.

A pattern of seasonality emerged for CentralAmerica, but not for other regions. The infestationpattern for Central America (Fig. 4) resembledthat for all regions combined (Fig. 3). Distinctpeaks occurred in October and May, with the in-festation percentage from April through Augustremaining at a generally high level. Unlike thepattern for all regions, however, the peak in Octo-ber was as great as that in May. Approach ratesfor cargo aircraft arriving from Central Americawere significantly greater during the wet seasonthere (about 29% from May through October) thanduring the dry season (about 16% from Novemberthrough April) (G-test for independence; p < 0.05)(Table 6). Despite this seasonal difference, ratesduring the dry season were not low enough, in ouropinion, to warrant deployment of personnel awayfrom this pathway. Only in September and No-vember did the percentage of infestation fall be-low 10 (Fig. 4). Additionally, there were twodistinct peaks in January and April.

The pattern of total numbers of QS organismsper month (Fig. 5) largely resembled that for thepercentage of infested aircraft per month (Fig. 3).The results for June, however, differed markedly.The percentage of infested aircraft for June wasonly moderate (Fig. 3), but the number of pestswas exceptionally large (Fig. 5). This difference isattributable to an unusually large number of in-tercepted organisms (18) aboard a single aircraftfrom El Salvador (see Fig. 2).

We recognize that oceanographic and atmo-spheric factors, combined with latitude, influencewhen the wet and dry seasons begin and end an-nually in Central America (Alfaro 2000). Giventhese, it would be beneficial to gather multipleyears of data for this region to improve under-standing of any seasonality patterns. To obtain asimilar understanding for the West Indies, muchgreater numbers of cargo aircraft would have tobe sampled annually from a larger number of is-land countries. It might be more difficult to eluci-

TABLE 4. NUMBERS OF CENTRAL AMERICAN CARGO AIRCRAFT INFESTED WITH NOCTUIDAE, SCARABAEIDAE ANDAUCHENORRHYNCHA: CORRELATION OF DEPARTURE TIME AND APPROACH RATE AT MIAMI INTERNATIONALAIRPORT.

Pest Departure Time Infested Not Infested Approach Rate

Noctuidaea DayNight

59

71115

6.6%7.3%

Scarabaeidaeb DayNight

54

71120

6.6%3.2%

Auchenorrhynchac DayNight

36

73118

3.9%4.8%

aGadj of 0.029 not significant at X2.05(1).

bGadj of 1.121 not significant at X2.05(1)).

cGadj of 0.085 not significant at X2.05(1).

TABLE 5. NUMBERS OF INFESTED CARGO AIRCRAFT FROMALL ORIGINS: CORRELATION OF CARGO TYPEAND APPROACH RATE AT MIAMI INTERNA-TIONAL AIRPORT.A,B

Type InfestedNot

InfestedApproach

Rate

Regulated 51 397 12.8%Non-regulated 22 217 10.1%

a16 samples were either empty or contained indeterminablecargo.

bGadj of 0.951 not significant at X2.05(1).


date seasonal patterns for South America due toits wide spectrum of topography, vegetation, lati-tudes, and bodies of water.

CONCLUSIONS

Our study demonstrated an overall pest infes-tation rate of 10.4% for foreign-arriving cargo air-craft at Miami International Airport. Cargoaircraft arriving from Central America had amuch greater infestation rate of about 23%. Inother words, almost one in four cargo aircraft ar-

riving from Central American countries harboredlive, nonindigenous organisms of potential eco-nomic impact to U.S. agriculture, forests, and or-namentals. Cargo aircraft arriving from thesecountries represent a potentially significant path-way for the introduction of adventive insects intoSouth Florida. During the study, QS organismsarrived every month of the year, although peaksseemed to emerge in the fall and spring. The di-versity of taxa encountered was substantial, withintercepted QS insects representing 33 familiesin five orders. Members of the Lepidoptera and

Fig. 3. Percent infested foreign cargo aircraft arriving from all origins at Miami International Airport, 1 Sep.1998-31 Aug. 1999.

Fig. 4. Percent infested foreign cargo aircraft arriving from Central America at Miami International Airport, 1Sep. 1998-31 Aug. 1999.


Coleoptera were most prevalent. Time of cargoloading and the types of cargo on board had nobearing on whether a particular aircraft con-tained QS organisms.

How to reduce the risks associated with thispotential threat is the next question facingAPHIS-PPQ managers. In recent years, calls forthe formulation of offshore risk mitigation strate-gies have arisen within the regulatory and scien-tific communities of the United States (NationalPlant Board 1999, Shannon 1999, Klassen et al.2002). Components of these strategies concerningcommercial shipments have existed for decadesand include pre-clearance programs, pest-freezones, cold treatments, and hot water treatments(Klassen et al. 2002).

Applied to cargo aircraft, such strategiesmight include one or more of the following forparticular regions, countries, or even specific air-ports judged to be high-risk for hitchhiking in-sects: (1) periodically applying residualpesticides to the walls, floor, and ceiling of cargoholds; (2) placing insecticide-impregnated baits

throughout the holds; (3) deploying sodium vaporlamps around aircraft during night loading sothat fewer insects are attracted (Naumann &McLachlan 1999); (4) removing vegetation serv-ing as potential pest reservoirs within a certainradius of cargo aircraft loading sites; (5) usingblack lights in vegetative areas away from air-craft to capture moths, beetles and other noctur-nal fliers; (6) using compressed air to clean outcargo holds prior to loading; and (7) installingoverlapping flexible plastic flaps in cargo door-ways to impede the entry and exit of hitchhikingpests.

Additional surveys of cargo aircraft from coun-tries and regions not adequately sampled in thisstudy would provide useful information that couldbe incorporated into an overall strategy for miti-gating the risks associated with this pathway. Ex-panding the present study to include passengerand private aircraft would provide additional in-formation that APHIS-PPQ managers could use toformulate improved pest exclusion practices.

ACKNOWLEDGMENTS

We thank the following USDA, ARS, Systematic En-tomology Laboratory personnel for their valuable assis-tance with insect identifications: David Adamski, JohnBrown, Thomas Henry, Alex Konstantinov, Steven Lin-gafelter, Stuart McKamey, Gary Miller, David Nickle,Michael Pogue, and Alma Solis. Appreciation is also ex-tended to Steven Passoa, USDA, APHIS, PPQ, Museumof Biodiversity, Ohio State University, for identifyingnumerous specimens of Lepidoptera. We express ourgratitude to Fernando Lenis for his assistance withgraphics production, and Thomas Skarlinsky and Will-iam Tang for specimen curation and preparation. We

TABLE 6. NUMBERS OF INFESTED CARGO AIRCRAFT FROMCENTRAL AMERICA: CORRELATION OF SEASONOF DEPARTURE AND APPROACH RATE AT MIAMIINTERNATIONAL AIRPORT.A

Season InfestedNot

infestedApproach

rate

Wet 34 84 28.9%Dry 14 75 15.7%

aGadj of 4.996 significant at X2.05(1).

Fig. 5. Number of quarantine-significant organisms (QSOs) intercepted in foreign cargo aircraft arriving at Mi-ami International Airport, 1 Sep. 1998-31 Aug. 1999.


thank Julieta Brambila, Barney Caton, Michael Shan-non, and A. G. Wheeler for critically reviewing an ear-lier version of the manuscript.

REFERENCES CITED

ALFARO, E. J. 2000. Some characteristics of the precipi-tation annual cycle in Central America and their re-lationships with its surrounding tropical oceans.Top. Meteor. Oceanog. 7(2): 99-115.

BASIO, R. G., M. J. PRUDENCIO, AND I. E. CHANCO. 1970.Notes on the aerial transportation of mosquitoes andother insects at the Manila International Airport.Philippine Entomologist 1 (5): 407-408.

BEARDSLEY, J. W. 1979. New immigrant insects in Ha-waii 1962 through 1976. Proceedings of the Hawai-ian Entomological Society 23: 35-44.

DAVIDSON, S. 1990. Screw-worm stowaways—assessingthe risk. Rural Research 146: 29-31.

ENDRÖDI, S. 1985. The Dynastinae of the World. Dr. W.Junk Publishers, Dordrecht, Netherlands. 800 pp.

EVANS, B. R., C. R. JOYCE, AND J. E. PORTER. 1963. Mos-quitoes and other arthropods found in baggage com-partments of international aircraft. Mosquito News23: 9-12.

EWEL, J. J. 1986. Invasibility: lessons from South Flor-ida, pp. 214-230. In H. A. Mooney and J. A. Drake(eds.). Ecology of Invasions of North America andHawaii. Springer-Verlag, New York.

FRANK, J. H., AND E. D. MCCOY. 1992. The immigrationof insects to Florida, with a tabulation of recordspublished since 1970. Florida Entomologist 75: 1-28.

FRANK, J. H., AND E. D. MCCOY. 1995. Invasive adven-tive insects and other organisms in Florida. FloridaEntomologist 78: 1-15.

GOH, K. T., S. K. NG, AND S. KUMARAPATHY. 1985. Dis-ease-bearing insects brought in by international air-craft into Singapore. Southeast Asian J. Trop.Medicine and Public Health 16 (1): 49-53.

KLASSEN, W., C. F. BRODEL, AND D. A. FIESELMANN.2002. Exotic pests of plants: current and future threatsto horticultural production and trade in Florida andthe Caribbean Basin. Micronesica Suppl. 6: 5-27.

LAIRD, M. 1951. The accidental carriage of insects onboard aircraft. J. Royal Aeronautical Soc. 55: 735-743.

MCGREGOR, R. C. 1973. The emigrant pests: a report toDr. Francis J. Mulhern, Administrator, Animal andPlant Health Inspection Service, Hyattsville, MD.

NATIONAL PLANT BOARD. 1999. Safeguarding AmericanPlant Resources: A Stakeholder Review of theAPHIS-PPQ Safeguarding System. APHIS, USDA,Washington, DC. 133 pp.

NAUMANN, I. D., AND K. MCLACHLAN. 1999. Aircraft dis-insection, unpublished report, Australian Quaran-tine and Inspection Service. 125 pp.

OTAGA, K., I. TANAKA, Y. ITO, AND S. MORII. 1974. Sur-vey of the medically important insects carried by in-ternational aircraft to Tokyo International Airport.Japanese J. Sanitary Zool. 25: 177-184.

RUSSELL, R. C. 1987. Survival of insects in the wheelbays of a Boeing 747B aircraft on flights betweentropical and temperate airports. Bull. World HealthOrganization 65(5): 659-662.

RUSSELL, R. C., N. RAJAPAKSA, P. I. WHELAN, AND W. A.LANGSFORD. 1984. Mosquito and other insect intro-ductions to Australia aboard international aircraft,and the monitoring of disinsection procedures, pp.109-142. In M. Laird (ed.). Commerce and theSpread of Pests and Disease Vectors. Praeger, NewYork.

SAILER, R. I. 1978. Our immigrant fauna. Bulletin En-tomol. Soc. of America 23: 3-11.

SCHREINER, I. H. 1991. Sources of new insects estab-lished on Guam in the post World War II period. Mi-cronesica Suppl. 3: 5-13.

SHANNON, M. 1999. Challenges in safeguarding Floridaand the U.S. against invasive pests, pp. 11-13. InW. Klassen (Chair). Mitigating the effects of exoticpests on trade and agriculture, Part A. The Carib-bean. Proceedings of T-STAR Workshop-X, 16-18June, 1999, Homestead, Florida. Cooperative StateResearch, Education, and Extension Service,USDA.

SOKAL, R. R., AND F. J. ROHLF. 1981. Biometry, 2nd ed.V. H. Freeman and Co., San Francisco. 859 pp.

SULLIVAN, W. N., F. R. DU CHANOIS, AND D. L. HAYDEN.1958. Insect survival in jet aircraft. J. Econ. Ento-mol. 51(2): 239-241.

SWAIN, R. B. 1952. How insects gain entry, pp. 350-355.In F. C. Bishop (Chairman) et al. (eds.). Insects: theYearbook of Agriculture, 1952. U.S. GovernmentPrinting Office, Washington, D.C.

TAKAHASHI, S. 1984. Survey on accidental introductionsof insects entering Japan via aircraft, pp. 65-80. InM. Laird (ed.). Commerce and the Spread of Pestsand Disease Vectors. Praeger, New York.

WHEELER, A. G., JR., AND E. R. HOEBEKE. 2001. A his-tory of adventive insects in North America: theirpathways of entry and programs for their detection,pp. 3-15. In Detecting and monitoring invasive spe-cies. Proceedings of the Plant Health Conference2000: Raleigh, North Carolina. USDA, APHIS, PPQ,Center for Plant Health Science and Technology, Ra-leigh, NC.

Scientific

Notes

79

NATURAL HISTORY OF THE FLAT BUG

ARADUS GRACILICORNIS

IN FIRE-KILLED PINES (HETEROPTERA: ARADIDAE)

M

ARK

D

EYRUP

1

AND

J

ACKSON

G. M

OSLEY

2

1

Archbold Biological Station, P.O. Box 2057, Lake Placid, FL 33862

2

P.O. Box 994, 720 Grove St., Bowling Green, FL 33834

The Aradidae (Heteroptera) is a widely distrib-uted family of characteristically flat bugs, includ-ing 128 species in North America north of Mexico,of which 84 are in the genus

Aradus

(Taylor2002). Most species of

Aradus

feed on fungi, espe-cially fungi associated with dead trees (Froe-schner 1988). A European species,

A. laeviusculus

Reuter, is known to be associated with fungifound on fire-killed or fire-damaged conifers (Lap-palainen & Simola 1998).

Aradus gracilicornis

Stål is a relatively small(4.8-5.8 mm in length) black species. Adults aremost easily recognized by the unusually long andslender antennae and the whitish wings withblack markings (Fig. 1a). A redescription of thespecies, including genitalic structures, has beenprovided by Heiss (1993). It occurs from NorthCarolina south through Florida (also Cuba), westinto New Mexico (Froeschner 1988). Blatchley(1926) reported specimens collected from underthe bark of oak, and by sweeping along the mar-gin of a pond. Our study was intended to providemore information on the natural history of thisspecies. This is part of a larger effort to documentthe relationship between fire and insects in natu-ral habitats of south Florida.

The Archbold Biological Station (ABS) is a pri-vate research field station in south-central penin-sular Florida, Highlands Co. Most habitats of theABS are managed by relatively small controlburns in an attempt to mimic natural fire fre-quencies attributed to lightning. On 12 February,2001, an accidentally ignited fire burned over 300ha of the ABS under drought conditions with ahigh wind. This intense fire killed large numbersof south Florida slash pine (

Pinus elliottii densa

Little & Dorman). In March, 2002, we began astudy to determine whether

A. gracilicornis

breeds in fire-killed trees.The main building of the ABS is located at

20°10’50”N, 81°21’00”W. Our study site was westof the main buildings in pine flatwoods and sea-sonal pond habitats with sparsely distributed

P. elliottii

. Bands of bark about 60 cm wide encir-cling the tree were taken from 55 trees of varyingsizes. The outer bark of south Florida slash pine ismade up of fine loose layers, between which the

A. gracilis

conceal themselves. Each band of barkwas broken into pieces 3 cm

×

3 cm or smaller andplaced in a sifter with a 5 mm mesh. The bark wasthen shaken vigorously, and the sifted bark bits

extracted into cups of alcohol with a Tulgren fun-nel. Collections began on 8 March 2002, andended on 10 June 2002. Voucher specimens are inthe ABS collection of arthropods.

Aradus gracilis

can occur in large numbers infire-killed

Pinus elliottii

, and a few fire-killedtrees could probably produce hundreds, if not

Fig. 1. Aradus gracilicornis. A: Adult male; lengthof specimen 5.2 mm. B. Head of nymph; length of speci-men 5.6 mm.

80


87(1) March 2004

thousands of individuals. Specimens were ex-tracted from 27 of the 55 trees sampled. Bugs persample ranged from 1 to 68. Six samples hadmore than 20 individuals. Considering the widthof the band of bark removed from each tree (about60 cm), it seems likely that some trees producehundreds of

A. gracilicornis

. This high populationafter a large fire might not be typical of all sites.The annual occurrence of small fires at the ABSmay increase or stabilize the local reservoir of in-dividuals that colonize dead trees, relative to siteswhere fires are larger but less frequent.

The great majority of specimens were nymphs:418 out of 444 specimens. The scarcity of adults insamples spread out over three months suggeststhat adults leave their natal tree soon after theirfinal molt.

In our study, larger trees produced proportion-ately more

A. gracilicornis

.


occurred in all 13 of the largest trees (over 60 cmdbh) sampled, and in less than half the trees insmaller size classes. Since the bands of bark arelarger on large trees than small trees, compari-sons are based on numbers of bugs/m sq. of barksurface sampled. The 13 trees over 60 cm dbh pro-duced an average of 19.1 bugs/m sq. (range: 2.7-46.3), compared to 1.4 bugs/m sq. in 21 trees 45-60 cm dbh (range: 0.0-4.7). At this point it doesnot seem appropriate to analyze these results sta-tistically because it is unlikely that the insectsare responding directly to tree size, but rather tothe occurrence of certain fungi that, in this in-stance, were more abundant in large trees. It iseven possible that the progression of decomposi-tion is faster in small trees, and most of the flatbugs had left the small trees earlier in the year.One reason why we sampled so many small treeswas that

A. gracilis

were found in a small tree inearly February of 2002. Although our project ex-tended over three months, it was still a relativelyshort-term study following a single fire.


nymphs that were found inbark were usually associated with a thin, dry fun-gal film occurring between layers of outer bark.Several of these nymphs were reared to maturity.This showed that the elongation of the antennae oc-curs suddenly at the last molt. At the final moltthere is also a change in antennal markings: the an-tennae, which in the nymph are black with a whiteband (Fig. 1b), become entirely black. Banded an-tennae occur in adults of a few species of

Aradus

,such as the North American species

A. uniformis

Heidemann and

A. abbas

Bergroth, and the holarc-tic species

A. signaticornis

Sahlberg. The function ofthis conspicuous banding, which occurs in bothsexes as well as nymphs, is unknown. It seems un-likely that there is visual communication betweennymphs of

A. gracilicornis

inhabiting dark cavitiesin pine bark. It is possible that

A. gracilis

belongs toa lineage that had white antennal bands in theadult, and this pattern is vestigial in the nymph.

The bark of fire-killed pines retains a richfauna for more than a year after the fire, long af-ter the first flush of scavengers, mostly phloem-consuming scavengers such as

Ips

(Scolytinae)and

Melanophila

(Buprestidae), have left thetree. The following arthropods occurred in sam-ples with nymphs of

A. gracilicornis

. These ar-thropods are not necessarily close associates ofthis species; we present them to place

A. gracili-cornis

in the context of the arthropod assemblagefound in dead pines at a particular stage of de-composition. The number following the name ofan arthropod indicates the number of samples(out of 27) that had both

A. gracilicornis

and thearthropod listed; numbers of individuals are nottallied. Polyxenida, Polyxenidae,

Polyxenus

sp.(1); Pseudoscorpionida, unidentified to family(14); Araneida, Clubionidae (1), Salticidae (1), Th-omisidae (1), unidentified to family (3); Collem-bola, unidentified to family (9); Dermaptera,Labidiidae,

Marava pulchella

(Serville) (4); Pso-coptera, unidentified to family (4); Coleoptera,Carabidae,

Tachyta nana inornata

(Say) (8); Ptili-idae,

Ptinella

sp. (7); Curculionidae,

Cossonuscorticola

Say (3),

Platypus flavicornis

(Fabricius)(1); Elateridae, unidentified larvae (10); Trogos-sitidae, unidentified larvae (2); Histeridae,

Platy-soma parallelum

(Say) (2),

Plegaderustransversus

Say (2),

Becanius punctifroms

Le-Conte (1); Tenebrionidae,

Corticeus thoracicus

(Melsheimer) (1),

Hymenorus

sp. (2); Anthribidae,

Euparius paganus

Gyllenhal (1); Cerambycidae,unidentified larva (1); Buprestidae, unidentifiedlarva (1); Colydiidae,

Colydium nigripenne

Le-Conte (1); Sphindidae,

Sphindus americanus

Le-Conte (1); Staphylinidae,

Nacaeus tenellus

(Erichson) (1),

Coproporus

sp. (1); Coleoptera, lar-vae unidentified to family (6).

We thank Elena Rhodes and David Zeltser forassisting with the field work. We thank ErnstHeiss (Tyroler Landesmuseum, Austria) for re-viewing this paper and providing useful sugges-tions on biology, taxonomy and literature onAradidae. Steven Taylor (Illinois Natural HistorySurvey) provided valuable advice on the naturalhistory of Aradidae. This study was supported bythe Archbold Biological Station.

S

UMMARY


is the first aradid knownto benefit significantly from the fires that are anormal feature of most natural pine habitats insoutheastern North America. It is probable thatthere are additional species of aradids that con-gregate in fire-killed trees in the Southeast, or inparts of the Southwest where fires occur regu-larly. Many insect species that breed in fire-killedpines, such as Scolytinae in the genera

Ips

,

Pityophthorus

,

Dendroctonus

,

Orthotomicus

, and

Xyleborus

, also occur on the ABS in wind-thrown

Scientific

Notes

81

or felled trees. There is no reason to believe that

A.gracilicornis

is restricted to fire-killed trees, but itis clearly a member of the large group of insectsthat are associated with fire in the Southeast.

R

EFERENCES

C

ITED

B

LATCHLEY

, W. S. 1926. Heteroptera or true bugs ofeastern North America, with special reference to thefaunas of Indiana and Florida. The Nature Publish-ing Co., Indianapolis. 1116 pp.

F

ROESCHNER

, R. C. 1988. Family Aradidae Spinola,1837 (=Dysodiidae Reuter, 1912; Meziridae Osha-

nin, 1908), the flat bugs, pp. 29-46.

In

T. J. Henry andR. C. Froeschner, eds. Catalog of the Heteroptera, ortrue bugs, of Canada and the United States. E. J.Brill Co., New York. xix + 958 pp.

H

EISS

, E. 1993. Type revision of neotropical

Aradus

de-scribed by C. Stål (Heteroptera, Aradidae). Mitt.Münch. Entomol. Ges. 83: 119-125.

L

APPALAINEN

, H.,

AND

H. S

IMOLA

. 1998. The fire-adapted flatbug

Aradus laeviusculus

Reuter (Het-eroptera, Aradidae) rediscovered in Finland (NorthKarelia, Koli National Park). Entomol. Fennica 9: 3-4.

T

AYLOR

, S. 2002. Aradidae (flatbugs). (revised March2002). Internet:http://www.inhs.uiuc.edu/~sjtaylor/Aradidae/flatbug.html

82


87(1) March 2004

IDENTITY AND FIRST RECORD OF THE SPITTLEBUG

MAHANARVA BIPARS

(HEMIPTERA: AUCHENORRHYNCHA: CERCOPIDAE) ON SUGARCANE IN COLOMBIA

D

ANIEL

C. P

ECK

1

, J

AIRO

R

ODRÍGUEZ

C

H

.

2

AND

L

UIS

A. G

ÓMEZ

3

1

Department of Entomology, New York State Agricultural Research Station, Cornell University, 630 W. North Street, Geneva, NY 14456

2

Centro Internacional de Agricultura Tropical (CIAT), Cali, Colombia

3

Centro de Investigación de la Caña de Azúcar de Colombia (CENICAÑA), Cali, Colombia

Spittlebugs (Hemiptera: Auchenorrhyncha:Cercopidae) are widespread pests of sugarcane inthe Neotropics (Fewkes 1969). Adult injury is ex-pressed as a chlorosis known as froghopper burnthat leads to losses in sugar content, juice purityand overall stalk and sugar yields (Dinardo-Miranda 2002). Sugarcane fields in Colombiahave been notably free from serious spittlebug at-tacks and a damaging outbreak has not been doc-umented until now.

In 2002, growers in the coffee zone of the An-dean region reported severe infestations of spit-tlebugs in sugarcane fields used for gur (“panela”)production. The problem was first detected in thelocality of San José (vereda Santa Ana, municipioGuática, department Risaralda) in 2000, but theincipient damage was not cause for concern untilnow. This region was visited in September 2002 todocument the incident and determine the identityof the spittlebug species involved.

Two infested fields were visited on 24 Septem-ber 2002 on a farm at Guática (5°18’N, 75°49’W)where the owner first noted the infestation 8months earlier. In this production system, sugar-cane stands are of mixed ages due to selectiveharvesting, and stems in all age classes were at-tacked; some stems as young as 1-2 months oldwere infested with nymphs. A high proportion ofstems were infested in each field; the chloroticstreaks attributed to adult feeding, however, werenot evident. The infested area in the first field(1624 m elevation) was approximately 2 ha with76.2% of stems infested (n = 21, var Puerto Rico61632). Mean infestation was 4.7 nymphs and 1.1adults per stem. The infested area in the secondfield (1663 m elevation, mixed sugarcane variet-ies) was approximately 0.5 ha, with 43.1% ofstems infested (n = 43, mixed varieties) with anaverage of 1.8 nymphs and 0.3 adults per stem.Agronomists from other areas around Guáticaalso reported problems with persistent spittlebugpopulations in sugarcane under the same produc-tion system. To date, however, spittlebugs havenot been detected in the nearest fields of sugar-cane under industrial sugar production (24 kmnorth). This will be an important frontier to mon-itor in the next few years as Colombia moves to

prohibit preharvest burning by 2005 (Cenicaña1998); a shift to green production may open op-portunities for emergent spittlebug pests in ex-tensive sugarcane production systems.

The spittlebug was identified as

Mahanarvabipars

(Walker). Voucher specimens were depos-ited in the Cornell University Insect Collectionunder Lot #1227. This is the first definitive reportof this species from Colombia and from sugarcane.The original species description was based on anunknown number of adults collected in SouthAmerica. Walker (1858) placed

bipars

in the ge-nus

Sphenorhina

Amyot & Serville, and this waslater moved to

Tomaspis

Amyot & Serville by La-llemand (1912) and then to

Mahanarva

Distantby Fennah (1968). No specific locality data orother information were recorded for the type spec-imens. To our knowledge, there are no other ac-counts of

M. bipars

in the literature, meaning noavailable information on distribution, biology,host plants, size, or color pattern variation.

The genus

Mahanarva

is known from CostaRica, Panama and throughout South America.There are 32 described species (pers. comm. M.Webb), of which several are known as forage grassor sugarcane pests. The most important pest spe-cies are reported from Brazil, Colombia and Ecua-dor.

Mahanarva posticata

(Stal) and

M.fimbriolata

(Stal) are found on sugarcane (Guag-liumi 1973; Dinardo-Miranda et al. 2001; García2002), and

M. spectabilis

on forage grasses (DCP,pers. observ.) in Brazil.

Mahanarva trifissa

(Ja-cobi) feeds on forage grasses in southeastern Co-lombia (Peck 2001; CIAT 2002).

Mahanarvaandigena

(Jacobi) occurs on sugarcane in north-western Ecuador (Mendoza 1999; Fors 2000, DCPpersonal observation). The other known grass-feeding species include

M. indicata

Distant,

M.mura

(China & Myers),

M. phantastica

(Breddin),

M. quadripunctata

(Walker), and

M. tristis

(F.).

Mahanarva costaricensis

(Distant) is the onlyknown species to specialize on non-grasses, re-ported from

Calathea

(Marantaceae) and

Helico-nia

(Heliconiaceae) (V. Thompson, Dept. Biology,Roosevelt University, unpublished).

Additional locality records for

M. bipars

were ob-tained from specimens housed in the Natural His-

Scientific

Notes

83

tory Museum (UK, 3 specimens), Universidad delValle (Colombia, 2 specimens) and the UniversidadNacional sede Palmira (Colombia, 6 specimens). To-gether with our field collections, all known reportsof

M. bipars

are listed below and mapped (Fig. 1).This species has only been collected from the Co-lombian departments of Cauca, Chocó, Risaraldaand Valle del Cauca, representing the Pacific coasteast to the central cordillera of the Andes.

COLOMBIA:

Cauca

, El Trueno, río Naya, XI-1984, coll. Camilo Hurtado.

Chocó

, Quibdó, “onweeds”, XI-1983, coll. Velez; Tutunendó, “onweeds”, XI-1983, coll. Velez; Proparicio Urriabo,20-V-1987.

Risaralda

, Guática, Santa Ana, 24-IX-2002, 1624-1663 m elevation, coll. J. Rodríguez.

Valle del Cauca

, Cali, X-1989, coll. Ramírez H.;Calima, 20-VII-1981, coll. Chaves; Palmira, 3-X-1978, coll. Acevedo; Valle, IV-1978.

Mahanarva bipars

is distinguished from other

Mahanarva

and other Colombian grass-feedingspittlebugs by characteristic genitalia and colorpattern. Males of the genus have a pair of simplehorn- or scimitar-shaped aedeagal processes be-tween one third and one half the length of the

aedeagal shaft. These are usually positioned per-pendicular to and approximately half-way up theshaft; if downturned they do not reach the base ofthe aedeagus. In

M. bipars

, these processes emergefrom the widest point of the aedeagus and reachtheir greatest width (in lateral aspect) half-wayalong their length and then taper evenly to the tip;the tip of the aedeagal shaft is rounded, without anapical tooth or projection. The gonopore is apical.

Like other neotropical grass-feeding species ofspittlebugs (Rodríguez et al. 2002), adult

M. bi-pars

are sexually dimorphic. Compared to fe-males, males are smaller with respect to certainbody size measurements (Table 1). There is signif-icant variation in the color patterns of the wingsbased on partial to complete reduction in the or-ange markings over the brown to dull black dor-sum (Fig. 2). Compared to females, malesexhibited less reduction in the orange patch mak-ing their coloration more conspicuous.

Similar to

M. andigena

and

M. posticata

, spit-tle masses are aerial. Younger nymphs tend to befound within young rolled leaves while oldernymphs occur on the older lower leaves where theleaf sheath begins to separate from the stem.Adults were most commonly observed in therolled up leaves that form the apical shoots, or un-der the leaf sheaths. Oviposition sites were notdetermined. This insect is being managed locallyby removing old leaves from the stem (reducingprotective sites for nymphs to establish spittlemasses) and use of the insecticide chlorpyrifos.

Although

M. bipars

is the first documented sug-arcane spittlebug pest of economic importance inColombia, three other species are at least presentin sugarcane and do represent species that shouldbe monitored. The Central American pasture andsugarcane pest

Prosapia simulans

(Walker) wasreported for the first time in Colombia in 1999(Peck et al. 2001). Given persistent populations in

Brachiaria

pastures of the Cauca Valley, this spe-cies is being locally monitored for its presence insugarcane. There is a particular concern that sug-arcane will become a more susceptible habitat tothis species when preharvest burning is prohib-ited. Another spittlebug species of known concernto sugarcane producers in Colombia is

M. andi-

Fig. 1. Known global distribution of Mahanarva bi-pars.

T

ABLE

1. S

IZE

(

MM

)

OF

ADULT

M

AHANARVA

BIPARS

COLLECTED

FROM

SUGARCANE

(C

OLOMBIA

: R

ISARALDA

, G

UÁTICA

)(

MEAN

±SE,

RANGE

,

N

= 13

FEMALES

AND

9

MALES

).

SexHead capsule

WidthBody lengthwithout wing

Body lengthwith wing Body width Stylet length

Anterior winglength

Male 2.41 ± 0.08 a 10.22 ± 0.73 a 10.99 ± 0.40 a 5.23 ± 0.26 a 1.19 ± 0.05 a 8.97 ± 0.43 a(2.25 - 2.52) (8.57 - 11.07) (10.50 - 11.71) (4.86 - 5.57) (1.14 - 1.29) (8.36 - 9.79)

Female 2.68 ± 0.10 b 11.98 ± 0.63 b 12.14 ± 0.45 b 5.82 ± 0.33 b 1.42 ± 0.13 b 9.63 ± 0.36 b(2.52 - 2.84) (10.79 - 12.86) (11.36 - 12.86) (5.36 - 6.36) (1.21 - 1.79) (8.93 - 10.07)

For each column, means followed by different letters are significantly different at

P

< 0.05 (

t

-test).

84


87(1) March 2004

gena

. This species was first documented in Colom-bia in 1999 and is reported from Johnson grass(

Sorghum halepense

) and sugarcane on the southPacific coast (JRC & DCP, personal observation).Over the last 5 years this species emerged as ahighly injurious pest for sugarcane production onthe Pacific coast of Ecuador (Mendoza 1999; Fors2000). Finally, according to reports received by CE-NICAÑA,

Aeneolamia

sp. has been reported onsugarcane near Cucutá in the department of Nortede Santander (LAG, pers. observ.).

S

UMMARY

Mahanarva bipars

(Walker) is identified as thespecies causing the first spittlebug outbreak inColombian sugarcane. Information on the biology,host plants and geographic range are absent fromthe literature. Therefore, we summarize field ob-servations on infestation levels and location offeeding sites, laboratory observations on size andadult color pattern variation, and known localityinformation that indicates distribution is re-stricted to western Colombia.

R

EFERENCES

C

ITED

C

ENTRO

DE

I

NVESTIGACIÓN

DE

LA

C

AÑA

DE

A

ZÚCAR

DE

C

OLOMBIA

(CENICAÑA). 1998. Informe Annual1998, Cenicaña, Cali, Colombia.

C

ENTRO

I

NTERNACIONAL

DE

A

GRICULTURA

T

ROPICAL

(CIAT). 2002. Annual Report 2002. Project IP-5.Tropical Grasses and Legumes: Optimizing GeneticDiversity for Multipurpose Use. CIAT, Cali, Colom-bia. 271 pp.

D

INARDO

-M

IRANDA

, L. L., J. M. G. F

ERREIRA

,

AND

P. A.M. C

ARVALHO

. 2001. Influência da época de colheitae do genótipo de cana-de açúcar sobre a infestação de

Mahanarva fimbriolata

(Stal) (Hemiptera: Cercopi-dae). Neotrop. Entom. 30: 145-149.

D

INARDO

-M

IRANDA

, L. L., V. G

ARCÍA

,

AND

V. J. P

ARAZZI

.2002. Efeito de inseticidas no controle de

Maha-

narva fimbriolata

(Stal) (Hemiptera: Cercopidae) ede nematoides fitoparasitos na qualidade tecnolog-ica e na produtividade da cana-de-açúcar. Neotrop.Entom. 31: 609-614.

F

ENNAH

, R. G. 1968. Revisionary notes on the newworld genera of cercopid froghoppers (Homoptera:Cercopoidea). Bull. Entomol. Res. 58: 165-190.

F

EWKES

, D. W. 1969. The biology of sugar cane froghop-pers, pp 283-307.

In J. R. Williams, J. R. Metcalfe, R.W. Mungomery and R. Mathes [eds.], Pests of sugarcane. Elsevier, Amsterdam.

FORS, L. A. 2000. El salivazo aéreo Mahanarva andi-gena. Sugar J., Oct. pp. 28-31.

GARCÍA, J. F. 2002. Técnica de criação e tabela de vida deMahanarva fimbriolata (Stal, 1854) (Hemiptera:Cercopidae). Masters thesis, Escola Superior de Ag-ricultura “Luiz de Queiroz”, Universidade de SãoPaulo, Piracicaba. 59 pp.

GUAGLIUMI, P. 1973. Pragas da Cana-de-Açúcar: Nordestedo Brasil. Instituto do Açúcar e do Alcool (ColeçãoCanavieira No. 10), Rio de Janeiro. pp. 69-204.

LALLEMAND, V. 1912. Homoptera Fam. Cercopidae.Genera Insectorum Fasc 143. 167 pp.

MENDOZA, J. 1999. El salivazo: una plaga potencial dela caña de azúcar en el Ecuador. Carta Informativo,Centro de Investigación de la Caña de Azúcar de Ec-uador CINCAE año 1: 1-6.

PECK, D. C. 2001. Diversidad y distribución geográficadel salivazo (Homoptera: Cercopidae) asociado congramíneas en Colombia y Ecuador. Rev. ColombianaEntomol. 27: 129-136.

PECK, D. C., U. CASTRO, F. LÓPEZ, A. MORALES, AND J.RODRÍGUEZ. 2001. First records of the sugar caneand forage grass pest, Prosapia simulans (Ho-moptera: Cercopidae), from South America. FloridaEntomol. 84: 402-409.

RODRÍGUEZ CH., J., D. C. PECK, AND N. CANAL. 2002. Bi-ología comparada de tres especies de salivazo de lospastos del género Zulia (Homoptera: Cercopidae).Rev. Colombiana Entomol. 28: 17-25.

WALKER, F. 1858. Homoptera. Insecta saundersiana: orcharacters of undescribed insects in the collection ofWilliam Wilson Saunders, Esq. 1858: 1-117.

Fig. 2. Most common color pattern variation exhibited dorsally in adult Mahanarva bipars.

Scientific

Notes

85

SIMULTANEOUS DETECTION OF

VAIRIMORPHA

INVICTAE

(MICROSPORIDIA: BURENELLIDAE) AND

THELOHANIA SOLENOPSAE

(MICROSPORIDIA: THELOHANIIDAE) IN FIRE ANTS BY PCR

S

TEVEN

M. V

ALLES

1

, D

AVID

H. O

I

1

, J

UAN

A. B

RIANO

2

AND

D

AVID

F. W

ILLIAMS

1

1

Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS1600 SW 23rd Drive, Gainesville, Florida, 32608, USA

2

South American Biological Control Laboratory, USDA-ARS, Bolivar 1559 HurlinghamBuenos Aires Province, Argentina

Microsporidia are obligate intracellular proto-zoan parasites of eukaryotes (Mathis 2000). Twospecies of microsporidia,

Thelohania solenopsae

(Knell et al. 1977) and

Vairimorpha

invictae

(Jou-venaz and Ellis 1986) have been reported to be ef-fective biological control agents against the fireant,

Solenopsis invicta

(Williams et al. 1999,Briano and Williams 2002). Unfortunately, be-cause the life cycles of these pathogens remainunknown, diagnosis is principally limited to mi-croscopic examination of ant homogenates for thecharacteristic spore stage. This limitation hashampered epidemiological studies, the elucida-tion of potential intermediate hosts, and descrip-tion of the complete life cycle. While a number ofPCR-based methods have been developed for de-tection of

T. solenopsae

(Snowden et al. 2002,Valles et al. 2002) none are available for

V. invic-tae

. By exploiting nucleotide sequence differencesin the 16S rRNA genes of

T. solenopsae

and

V. in-victae

, we provide a PCR-based method capable ofdetecting infection of fire ants by either pathogen.

V. invictae

-infected colonies of

S. invicta

werecollected in Argentina (near San Javier, Santa FeProvince) in April 2003. Infections were deter-mined by the observation of

V. invictae

spores inwet mount preparations of macerated adult antsunder a phase-contrast microscope (400X, Brianoand Williams 2002). In addition, 1

S. invicta

(Santa Fe Province) and 2

S. richteri

(Entre RiosProvince) colonies with dual infections (

V. invictae

and

T. solenopsae

) were collected in Argentina inApril 2003.

S. invicta

were keyed to species(Trager 1991) and verified as “

invicta

-like” bychemotaxonomy (Vander Meer and Lofgren 1990).Genomic DNA was extracted from adult ants asdescribed by Valles et al. (2002).

PCR was carried out with primer pairs specificfor the 16S rRNA gene of

T. solenopsae

(p1,5’CGAAGCATGAAAGCGGAGC and p2, 5’CAG-CATGTATATGCACTACTGGAGC) and

V. invictae

(p90, 5’CACGAAGGAGGATAACCACGGT andp93, CGCAATCAGTCTGTGAATCTCTTCA). Themicrosporidian-specific primers were designed byaligning the

T. solenopsae

(accession number AF134205) and

V. invictae

16S rRNA gene sequenceswith the Vector NTI 7.1 program (Informax, Inc.,Bethesda, MD) and choosing unique areas fromeach species. A published nucleotide sequence for

the 16S rRNA gene was available in GenBank fora

Vairimorpha

sp. thought to be

V. invictae

(acces-sion number AF031539). To verify that this se-quence corresponded to the

V. invictae

16S rRNAgene, we amplified a fragment of the gene from

V.invictae

with primers p90 and p93. The 791 bpamplicon was purified by separation on a 1.2%agarose gel, ligated into pGEM-T easy (Promega,Madison, WI), and used to transform SolopackGold supercompetent

E. coli

DH5

α

cells (Stat-agene, La Jolla, CA). Insert-positive clones weresequenced by the Interdisciplinary Center for Bio-technology Research, University of Florida. Threereplicates were sequenced.

PCR was conducted by the hot start method ina PTC 100 thermal cycler (MJ Research,Waltham, MA) under the following optimized tem-perature regime: 1 cycle at 94°C for 2 min, then 35cycles at 94°

C for 15 sec, 55°C for 15 sec, and 68°Cfor 45 sec, followed by a final elongation step of 5min at 68°C. The reaction was conducted in a 50-µl volume containing 2 mM MgCl

2

, 200 µM dNTPmix, 1 unit of Platinum

Taq

DNA polymerase (In-vitrogen, Carlsbad, CA), 0.4 µM of each primer,and 0.5 µl of the genomic DNA preparation (10 to100 ng). PCR products were separated on a 1.2%agarose gel and visualized by ethidium bromidestaining. For all experiments, positive and nega-tive controls were run alongside treatments.

The fragment of the 16S rRNA gene that weamplified from

V. invictae

(host

S. invicta

) wasidentical to the sequence reported previously byMoser et al. (1998). Despite being found in

S. rich-teri

, they suspected that the microsporidian withwhich they were working was

V. invictae

. Indeed,Briano et al. (2002) reported that

T. solenopsae

and

V. invictae

could infect either ant species,

S.invicta

or

S. richteri

. This conclusion was con-firmed by successful detection of

V. invictae

from

S. invicta

and

S. richteri

with

V. invictae

-specificprimers, p90 and p93.

Figure 1 demonstrates the specificity of theprimer pairs for each species 16S rRNA gene. Asreported by Valles et al. (2002), the

T. solenopsae

-specific primer pair, p1 and p2, produced a 318 bpamplicon exclusively from

T. solenopsae

-infected

S. invicta

(column 2). Similar specificity was ob-served for the 16S rRNA gene of

V. invictae

withprimers p90 and p93; a 791 bp amplicon was pro-

86


87(1) March 2004

duced exclusively from

V. invictae

-infected

S. in-victa

(column 5). In cases where an ant colony wasinfected with both organisms, each microsporid-ian species could be discerned in a single multi-plex reaction containing both primers sets (Fig. 1,lanes 6 and 7). Again,

V. invictae

was successfullydetected in either

S. invicta

or

S. richteri

.Microscopic detection of these microsporidia is

labor intensive and limited to known stages of de-velopment. The multiplex PCR method to detect

T. solenopsae

and

V. invictae

offers a number ofadvantages over traditional microscopy, includ-ing, increased sensitivity, specificity, and the abil-ity to identify all developmental stages. Thus,multiplex PCR decreases the risk of misidentifi-cation and will facilitate epizootiological studiesconcerned with these pathogens.

We thank Chuck Strong for technical assistanceand R. Vander Meer for identifying the ant speciesby gas chromatography. We also thank R. M.Pereira and J. L. Capinera who provided helpfulreviews of a previous version of the manuscript.

S

UMMARY

A PCR-based method capable of detecting

The-lohania solenopsae

and/or

Vairimorpha invictae

infection in the red imported fire ant,

Solenopsis

invicta

, was developed. Multiplex PCR allows si-multaneous detection of both species of microspo-ridia in a single reaction.

R

EFERENCES

B

RIANO

, J. A.,

AND

D. F. W

ILLIAMS

. 2002. Natural occur-rence and laboratory studies of the fire ant pathogen


(Microsporida: Burenellidae)in Argentina. Environ. Entomol. 31: 887-894.

B

RIANO

, J. A., D. F. W

ILLIAMS

, D. H. O

I

,

AND

L. R.D

AVIS

, J

R

. 2002. Field host range of the fire antpathogens

Thelohania solenopsae

(Microsporida:Thelohaniidae) and


(Mi-crosporida: Burenellidae) in South America. Biol.Control 24: 98-102.

J

OUVENAZ

, D. P.,

AND

E. A. E

LLIS

. 1986.

Vairimorpha in-victae

n. sp. (Microspora: Microsporidia), a parasite ofthe red imported fire ant,

Solenopsis invicta

Buren(Hymenoptera: Formicidae). J. Protozool. 33: 457-461.

K

NELL

, J. D., G. E. A

LLEN

,

AND

E. I. H

AZARD

. 1977.Light and electron microscope study of

Thelohaniasolenopsae

n. sp. (Microsporida: Protozoa) in the redimported fire ant,

Solenopsis invicta

. J. Invertebr.Pathol. 29: 192-200.

M

ATHIS

, A. 2000. Microsporidia: emerging advances inunderstanding the basic biology of these unique or-ganims. Int. J. Parasitol. 30: 795-804.

M

OSER

, B. A., J. J. B

ECNEL

, J. M

ARUNIAK

,

AND

R. S.P

ATTERSON

. 1998. Analysis of the ribosomal DNA se-

Fig. 1. Banding patterns on a 1.2% agarose gel after multiplex PCR with 16S rRNA-specific oligonucleotideprimers. Column 1, molecular weight markers expressed as base pairs (bp);, column 2, DNA prepared from T. sole-nopsae-infected S. invicta, oligonucleotide primers p1 and p2 (T. solenopsae-specific); column 3, DNA prepared fromT. solenopsae-infected S. invicta, oligonucleotide primers p90 and p93 (V. invictae-specific); column 4, DNA preparedfrom V. invictae-infected S. invicta, oligonucleotide primers p1 and p2 (T. solenopsae-specific); column 5, DNA pre-pared from V. invictae-infected S. invicta, oligonucleotide primers p90 and p93 (V. invictae-specific); column 6, mix-ture of DNA prepared from V. invictae-infected S. invicta and T. solenopsae-infected S. invicta, oligonucleotideprimers p1 and p2 (T. solenopsae-specific), and p90 and p93 (V. invictae-specific); column 7, DNA prepared from T.solenopsae- and V. invictae-infected S. invicta, oligonucleotide primers p1 and p2 (T. solenopsae-specific), and p90and p93 (V. invictae-specific); column 8, DNA prepared from uninfected S. invicta, oligonucleotide primers p1 andp2, and p90 and p93.

Scientific Notes 87

quences of the microsporida Thelohania and Vairi-morpha of fire ants. J. Invertebr. Pathol. 72: 154-159.

SNOWDEN, K. F., K. LOGAN, AND S. B. VINSON. 2002.Simple, filter-based PCR detection of Thelohania so-lenopsae (Microspora) in fire ants (Solenopsis in-victa). J. Eukaryot. Microbiol. 49: 447-448.

TRAGER, J. C. 1991. A revision of the fire ants, Solenopsisgeminata group (Hymenoptera: Formicidae: Myr-micinae). J. New York Entomol. Soc. 99: 141-198.

VALLES, S. M., D. H. OI, O. P. PERERA, AND D. F. WILL-IAMS. 2002. Detection of Thelohania solenopsae (Mi-crosporidia: Thelohaniidae) in Solenopsis invicta

(Hymenoptera: Formicidae) by multiplex PCR. J. In-vertebr. Pathol. 81: 196-201.

VANDER MEER, R. K., AND C. S. LOFGREN. 1990. Chemo-taxonomy applied to fire ant systematics in theUnited States and South America. pp. 75-84. In R.Vander Meer, K. Jaffe and A. Cedeno [eds.]. Appliedmyrmecology, a world perspective. Westview Press,Boulder, CO. 741 pp.

WILLIAMS, D. F., G. J. KNUE, AND J. J. BECNEL. 1999.Discovery of Thelohania solenopsae from the im-ported fire ant, Solenopsis invicta, in the UnitedStates. J. Invertebr. Pathol. 71: 175-176.

88


87(1) March 2004

OVERWINTERING OF

APHELINUS

NEAR

PARAMALI

(HYMENOPTERA: APHELINIDAE), AN INTRODUCED PARASITEOF THE COTTON APHID IN THE SAN JOAQUIN VALLEY, CALIFORNIA

K

RIS

G

ODFREY

1

AND

M

ICHAEL

M

C

G

UIRE

2

1

California Department of Food and Agriculture, Pest Detection/Emergency Projects3288 Meadowview Road, Sacramento, CA 95832

2

USDA-ARS, Shafter Research and Extension Center, Shafter, CA 93263

Natural biological control influencing cottonaphid population dynamics in the San JoaquinValley does not maintain cotton aphid [

Aphis gos-sypii

Glover (Homoptera: Aphididae)] densities atlow levels throughout the year. In the late fallthrough late spring, native insect parasites, gen-eralist arthropod predators, and fungi typicallymaintain cotton aphid densities at non-pest sta-tus (Rosenheim et al. 1997, Godfrey et al. 2001, K.Godfrey and M. McGuire, unpublished data).However, in mid to late season cotton, the actionof the natural enemies often appears to be mini-mal. The arthropod predator complex loses effec-tiveness due largely to hemipterous predators(reduviids and nabids) feeding upon lacewing lar-vae, another group of predators that feed heavilyupon aphids (Rosenheim et al. 1993, Rosenheimand Cisneros 1994). Also, at this time, the nativeparasites and fungi are at their lowest levels(Godfrey et al. 2001, K. Godfrey and M. McGuire,unpublished data). Hot, dry climatic conditionsthat are not conducive for parasite survival and/or fungal growth exist at this time (Tang andYokomi 1995, Godfrey et al. 2001).

In an attempt to increase the amount of biolog-ical control on cotton aphid in mid to late seasoncotton, a cooperative project began in 1996 to con-struct a natural enemy complex using natural en-emies not currently found in California tocompliment the existing natural enemy complex.After four years of research, two parasite species,

Aphelinus

near

paramali

and

Aphelinus gossypii

Timberlake (Hymenoptera: Aphelinidae), wereidentified as the first components of the intro-duced natural enemy complex. In field cage stud-ies conducted in cotton over 4 years (1996-1999),these parasites reduced cotton aphid densities 10-38% as compared to the densities of cotton aphidin cages without parasites present (K. Godfrey, J.McLaughlin, and M. McGuire, unpublished data).Distribution of both parasites began at ten nurs-ery sites in 2000. The nursery sites were moni-tored to determine if the parasites had begun tooverwinter and establish at the sites.

Both parasites were obtained from researchersin Florida.

Aphelinus

near

paramali

(ANP) wasthought to have been initially collected from crapemyrtle aphid (

Tinocallis kahawaluokalani

(Kirkaldy)) on crape myrtle in Florida in the spring

of 1995. However, additional host range studiesdemonstrated that ANP would not attack crapemyrtle aphid, but preferred cotton aphid, greenpeach aphid (

Myzus persicae

(Sulzer)), black citrusaphid (

Toxoptera aurantii

(Fonscolombe)), andspirea aphid (

Aphis spiraecola

Patch; Homoptera:Aphididae) (Y. Tang, L. Osborne, and R. Yokomi,unpublished data). Female wasps preferredyounger aphid instars for oviposition and wouldhost feed on all aphid instars. The adult femalessurvived 10-20 days, laid about 120 eggs, and fedupon about 25 aphids at 21°C (Y. Tang, L. Osborne,and R. Yokomi, unpublished data).

Aphelinus gos-sypii

(AG) was collected in southern China in July1997 and passed through quarantine in Florida.Host preference studies have shown that cottonaphid and black citrus aphid are the preferredhosts, while spirea aphid is a less acceptable host(Yokomi and Tang 1995). The size of the adult par-asite produced is greatest when AG is reared oncotton aphid (Yokomi and Tang 1995). Female AGhost fed on all aphid instars. They survived from 5-17 days and had a mean fecundity of 57 eggs(range 20-115; Tokumaru and Takada 1996).

All parasites were reared at the California De-partment of Food and Agriculture Biological Con-trol Program in Sacramento. Each species wasmaintained in a greenhouse at daytime tempera-tures (16 hours) of 24°C (±3°C) and nighttime tem-peratures (8 hours) of 20°C (±3°C) withsupplemental lighting (600 watt high pressure so-dium lights). ANP was reared on green peachaphid on potted green pepper plants, while AGwas reared on cotton aphid on potted hibiscusplants. The parasites were reared on differenthost aphids and plants to insure that there was nocross contamination of parasite colonies. ANP wasperiodically tested to insure that it would acceptcotton aphid as readily as green peach aphid.Given the above rearing conditions, parasitemummies (i.e., mummified aphids containing par-asite pupae) could be found about 7 days afteradult parasites were introduced into a cage, andnew adult parasites began to emerge from themummies in about 3-5 days. Approximately 56%(range 44-63%) of all ANP mummies producedadults within 7 days of the first adult emergence,and 60% (range 55-67%) of AG mummies pro-duced adults. The sex ratio was approximately 1:1.

Scientific

Notes

89

The nursery sites were established in Merced,Madera, and Kern Counties in and around cottonfields. Each nursery was located on a corner of acotton field and was 8 rows wide by 10 m inlength. The nursery was not sprayed with insecti-cides during the cotton-growing season. Mostsites had other habitats that were favorable forcotton aphid throughout the year in close proxim-ity to the nursery. Beginning in July of each year,each site was sampled weekly by examining 40 to80 cotton plants for the presence of cotton aphid.Once cotton aphids were found, weekly releases ofboth parasites began and continued until the cot-ton at each site was defoliated. To make a release,brown paper bags containing leaves with parasitemummies that were about to emerge (i.e., adultemergence within 2-5 days) were opened andplaced between cotton plants along a single rowin the nursery prior to 10:00 am. No special ac-commodations were necessary to protect themummies from predation. The densities of nativearthropod predators were at their lowest levels atthe time of the releases. In addition, ants were notabundant at any of the nursery sites.

A total of 74,650 ANP mummies and 189,140AG mummies were released at the 10 sites from

2000 through 2002 (Table 1). Approximately 2weeks after the parasite releases began, samplesof cotton leaves with aphids and mummies werecollected weekly. These aphids and mummieswere held in the laboratory (24°C, 12L:12D) foradult parasites to emerge. The sites were sampledon a weekly basis until approximately 2 weeks af-ter cotton harvest. After that time, the areasaround the nursery site that harbored cottonaphid were sampled at approximately monthlyintervals. Any aphids or parasite mummies foundin these samples were returned to the laboratoryand held for parasite emergence. The number andidentity of the parasites was recorded for eachsample site and date.

A total of 813 ANP, 349 AG, and 7,038 nativeaphidiid parasites were recovered from the nurs-ery sites (Table 2). The introduced aphelinidscould be distinguished from the native aphidiidsusing family characteristics. The aphidiids recov-ered belonged to the genera

Lysiphlebus

,

Aphid-ius

, and

Diaeretiella

. A small number (38) ofnative aphelinids were also recovered. These indi-viduals could be distinguished from ANP and AGbecause they had more than 15 setae in the trian-gular area at the base of the forewing. ANP and

T

ABLE

1. T

HE

TOTAL

NUMBER

OF

ANP

AND

AG

MUMMIES

RELEASED

AT

EACH

PARASITE

NURSERY

SITE

AND

THE

DATESOF

PARASITE

RELEASES

IN

THE

S

AN

J

OAQUIN

V

ALLEY

FROM

2000

THROUGH

2002.

2000(Dates of Release)



Nursery Site ANP AG ANP AG ANP AG

Madera 1 1,700 2,480 4,950 8,800 600 1,700(7/19/00-10/11/00) (7/11/01-10/11/01) (7/18/02-9/10/02)

Madera 2 1,500 2,080 4,250 5,500 1,100 4,700(8/1/00-10/11/00) (8/8/01-10/11/01) (7/18/02-9/10/02)

Madera 4 1,800 2,480 4,450 5,800 600 2,200(7/19/00-10/11/00) (8/1/00-10/11/00) (8/21/02-9/10/02)

Merced 3 1,400 2,180 4,150 5,050 600 1,200(7/27/00-10/11/00) (7/24/01-10/3/01) (8/21/02-9/10/02)

Kern 1 700 3,900 3,750 2,850 4,050 16,900(7/27/00-9/21/00) (8/1/01-10/10/01) (7/10/02-10/23/02)

Kern 2 1,050 3,550 3,850 3,000 1,850 11,600(7/17/00-9/28/00) (7/25/01-10/3/01) (7/10/02-10/9/02)

Kern 3 1,600 4,855 5,350 4,650 2,150 19,750(7/27/00-10/12/00) (7/18/01-10/10/01) (7/10/02-10/30/02)

Kern 4 1,950 5,305 2,950 1,150 2,250 21,150(7/27/00-10/12/00) (8/8/01-9/27/01) (7/10/02-10/30/02)

Kern 5 1,950 5,355 4,650 2,850 1,850 17,500(8/4/00-10/12/00) (7/18/01-10/3/01) (7/10/02-10/2/02)

Kern 6 1,700 5,455 3,250 2,000 2,650 13,150(7/27/00-10/12/00) (8/1/01-9/27/01) (7/10/02-10/30/02)

90

Florid

a En

tomologist

87(1)M

arch 2004

T

ABLE

2. T

HE

TOTAL

NUMBER

OF

PRIMARY

PARASITES

RECOVERED

FROM

NURSERY

SITES

IN

THE

S

AN

J

OAQUIN

V

ALLEY

IN

2000-2002. P

ARASITE

RELEASES

WERE

CONDUCTEDFROM

J

ULY

THROUGH

N

OVEMBER

. O

VERWINTERING

SAMPLING

WAS

CONDUCTED

FROM

D

ECEMBER

THROUGH

J

UNE

.

Time of Season

ANP AG Native Aphidiidae

Site 2000 2001 2002 2000 2001 2002 2000 2001 2002

Madera 1 Jul.-Nov. 4 6 0 0 0 0 28 7 0Dec.-Jun. 0 0 0 0 0 0 0 4 0

Madera 2 Jul.-Nov. 36 4 1 1 1 1 21 0 47Dec.-Jun.

a

0 0 0 0 0 0 0 0 0

Madera 4 Jul.-Nov. 5 15 1 1 0 0 23 0 79Dec.-Jun.

a

0 0 0 0 0 0 0 0 0

Merced 3 Jul.-Nov. 4 3 0 3 0 0 21 19 0Dec.-Jun. 1 3 0 0 0 0 0 5 0

Kern 1 Jul.-Nov. 0 14 83 0 1

b

123 198 359 76Dec.-Jun. 0 3 2 0 0 0 25 49 17

Kern 2 Jul.-Nov. 12 4 30 6 0 22 729 689 32Dec.-Jun. 0 0 0 0 0 0 9 102 1

Kern 3 Jul.-Nov. 19 103 235 6 3 77 1,094 117 64Dec.-Jun. 0 0 0 0 1 0 0 236 7




a

In 2001 and 2002, overwintering sites for Madera 1, 2, and 4 were located at one site due to the close proximity of the three sites.

b

AG recovered approximately 1 month after an early season release at this site.

Scientific

Notes

91

AG have 2-5 setae in this area of the forewing (Ze-havi and Rosen 1988).

The majority of all parasites were recoveredduring the cotton season when releases weremade (Table 2). This is not surprising consideringthat this is when cotton aphid densities are thelargest. In general, the density of aphids in Mad-era and Merced Counties was less than in KernCounty. In 2000, cotton aphid densities in cottonbegan to increase in mid-July and peaked in midto late September with densities of 1.25-3.75aphids per leaf in Madera and Merced Countiesand 25-50 aphids per leaf in Kern County. In2001, the density increase began later in the sea-son and peaked in mid-August at 2-5 aphids perleaf in Madera and Merced, and 10-15 aphids perleaf in Kern. Numbers of aphids in all countiesdeclined about 3-fold in mid-September. The cot-ton aphid populations in 2002 were much lowerthan in previous years. In Madera and MercedCounties, only 1 site had significant aphid num-bers (5 aphids per leaf), and the other three siteshad less than 1 aphid per leaf throughout the cot-ton season. In Kern County, cotton aphid densi-ties began to increase in mid-July, but peaked inSeptember at 3-5 aphids per leaf. Cotton aphiddensities when cotton was not in the field (Decem-ber to June) for all years remained at less than 1aphid per leaf on alternate hosts.

Both parasites were recovered during the timeof parasite releases with more ANP recoveredthan AG (Table 2). However, only ANP was recov-ered at 2 of the 10 nursery sites during the winterand early spring, suggesting that it could over-winter in the San Joaquin Valley. At the firstnursery site, Merced 3, ANP was recovered insamples in February 2001 and 2002 (Table 2). Atotal of 6,150 ANP had been released in this nurs-ery during the cotton seasons of 2000-2002 (Table1). This site was adjacent to a river with wintervegetation that supported sufficient aphid densi-ties to allow ANP to overwinter.

The second nursery site where ANP was foundto overwinter was in Kern County (Kern 1). ANPwas recovered in samples collected in April 2002and March 2003 (Table 2). A total of 8,500 ANPhad been released in this nursery during the cot-ton seasons of 2000-2002 (Table 1). This nursery

site was adjacent to a nectarine orchard with win-ter ground cover that provided habitat for the cot-ton aphid in the winter and spring.

S

UMMARY

In an attempt to increase the amount of biologi-cal control exerted on the cotton aphid in the SanJoaquin Valley, two aphelinids parasites were im-ported, evaluated for their ability to reduce cottonaphid densities, and released at ten nursery sitesfrom 2000 through 2002. One of the parasites,ANP, was recovered for two consecutive years attwo of the ten nursery sites. These recoveries sug-gest that ANP may be able to overwinter in the SanJoaquin Valley and may have begun to establish.

R

EFERENCES

C

ITED

G

ODFREY

, K., D. S

TEINKRAUS

,

AND

M. M

C

G

UIRE

. 2001.Fungal pathogens of the cotton and green peachaphids in the San Joaquin Valley. Southwestern En-tomol. 26: 297-303.

R

OSENHEIM

, J.,

AND

J. C

ISNEROS

. 1994. Biological con-trol of the cotton aphid,

Aphis gossypii

, by generalistpredators. Proc. Beltwide Cotton Conf. pp. 1000-1002.

R

OSENHEIM

, J., L. W

ILHOIT

,

AND

C. A

RMER

. 1993. Intra-guild predation and biological control of the cottonaphid,

Aphis gossypii

. Proc. Beltwide Cotton Conf.pp. 730-732.

R

OSENHEIM

, J., L. W

ILHOIT

, P. G

OODELL

, E. G

RAFTON

-C

ARDWELL

,

AND

T. L

EIGH

. 1997 Plant compensation,natural biological control, and herbivory by

Aphisgossypii

on pre-reproductive cotton: the anatomy of anon-pest. Entomol. Expt. Appl. 85: 45-63.

TANG, Y., AND R. YOKOMI. 1995. Temperature-depen-dent development of three hymenopterous parasi-toids of aphids (Homoptera: Aphididae) attackingcitrus. Environ. Entomol. 24: 1736-1740.

TOKUMARU, S., AND H. TAKADA. 1996. Numbers of eggsdeposited and host feeding in Aphelinus gossypiiTimberlake (Hymenoptera: Aphelinidae), a parasi-toid of Aphis gossypii Glover (Homoptera: Aphid-idae). Japan J. Appl. Entomol. and Zool. 40: 242-244.

YOKOMI, R., AND Y. TANG. 1995. Host preference andsuitability of two aphelinids parasitoids (Hy-menoptera: Aphelinidae) for aphids (Homoptera:Aphididae) on citrus. J. Econ. Entomol. 88: 840-845.

ZEHAVI, A., AND D. ROSEN. 1988. A new species of Apheli-nus (Hymenoptera: Aphelinidae) from Israel, withnotes on the mali group. Israel J. Entomol. 22: 101-108.

92


87(1) March 2004

BELONUCHUS AGILIS

, A FOURTH SPECIES OF THIS GENUS (COLEOPTERA: STAPHYLINIDAE) REPORTED FROM FLORIDA

J. H. F

RANK

Entomology and Nematology Department, University of Florida, Gainesville, FL 32611-0630

From 1915 until 1991,

Belonuchus rufipennis

(F.)and

B. pallidus

Casey were the only species of thisgenus reported from Florida (Frank 1986, Smetana1995). The adults are 4.6-9.0 mm long and, like thelarvae, are predatory. The former is the more wide-spread in Florida and elsewhere in the eastern andsouthern USA. The latter seems restricted to cen-tral and southern Florida. I have often encounteredboth, under fallen, decomposing citrus fruits, wherethey feed on smaller insects including fly larvae andperhaps larvae of nitidulid beetles.

Then, in the 1990s, Smetana (1991, 1995) re-ported

B. gagates

Erichson from the Florida Keysand from Chekika State Recreation Area in DadeCounty, without habitat information, but withcollection records as early as 1971. I have neverdetected this species in Florida, but had in Ja-maica in 1969-1972 found it to be an ecological ho-mologue of the foregoing two species: it likewise iswidespread and abundant in fallen, decomposingcitrus fruits. Adults of

B. gagates

are totally blackand easily distinguished from those of the othertwo species, which are bicolored, red and black. Itseemed obvious that

B. gagates

is an adventivespecies in Florida, having arrived somehow fromthe West Indies, where it is known not only fromJamaica but also from the Bahamas, Cuba, His-paniola, Montserrat, and the US Virgin Islands(St. John and St. Thomas) (Blackwelder 1943).

The only other species known from Jamaica is

B. agilis

Erichson, which I never found in fallencitrus fruits in 1969-1972. Blackwelder (1943) re-ported it also from Cuba, and listed one habitat as“on

Ceiba

(silk-cotton tree).” Its habitat neverthe-less remained mysterious to me until 1985, whenI found adults to be plentiful in the yellow flowerbracts of

Heliconia caribaea

Lamarck in the JohnCrow Mountains of Portland Parish in eastern Ja-maica

.

I now have various records of

Belonuchusspp.

in

Heliconia

spp.

flower bracts from severalcountries, which I will discuss in a later paper. Istate here, without further detail, that I also col-lected specimens of

B. agilis

in

Heliconia

bracts inthe Dominican Republic in 1987. It seems to methat

B. agilis

is not an exact ecological homologueof the foregoing species because I have not foundit to colonize the habitat provided by fallen citrusfruits in Jamaica or the Dominican Republic (Ihave been denied permission to visit Cuba by theUS Treasury Department).

On 9 July 2003, a “multilure trap” in a mangotree in the 7400 block of SW 139

th

Terrace, Miami,Florida, caught a staphylinid beetle which waslater submitted to me for specific identification

(the collector was Division of Plant Industry In-spector Gwen Myres). It was a female of

B. agilis

,lacking the apices of both antennae and some tar-someres. Specimens of this species may easily bedistinguished from other adult

Belonuchus

inFlorida by being black, with the last two abdomi-nal segments largely yellow. The species poses nothreat to agriculture because adults and larvaeare predacious. The method of arrival of this spe-cies is unknown, so by default we may call it ad-ventive (it arrived). I do not know whether itarrived in Florida as an immigrant (by wind-as-sisted flight, or as a hitchhiker aboard an aircraft,from Cuba or Jamaica or the Dominican Republic;if it arrived in an aircraft, it may have been a con-taminant of cut

Heliconia

flowers from Jamaicaor the Dominican Republic; if it arrived naturally,its most likely source is Cuba), or (vastly lesslikely) it was introduced (someone imported it de-liberately without permit [no permit has everbeen issued]). There are thus two native species(

B. rufipennis

and

B. pallidus

) and two adventivespecies (

B. gagates

and

B. agilis

) of this genus inFlorida. One of these (

B. pallidus

) is precinctiveto Florida (is known from nowhere else and pre-sumably evolved here). Definitions of these termsare given by Frank & McCoy (1990, 1995). Itseems highly unlikely that a specimen of

B. agilis

would have been taken in a “multilure trap” on amango tree in southwestern Miami (far from Mi-ami airport) unless the species were established,at least temporarily, in southern Florida.

In this note, I am reporting

B. agilis

for thefirst time from the Dominican Republic and Flor-ida. I made value judgments with inadequatedata. I believe that this species has been presentin the Dominican Republic for hundreds or thou-sands of years, but has simply been overlooked bycollectors, and may thus be called native. I believethat it has arrived recently in Florida. If my as-sumptions are correct, the year of first recordproves little when comparing the faunas of southFlorida and the Greater Antilles. There is no evi-dence that the species was “introduced” (the un-fortunate vocabulary in general use) to either theDominican Republic or Florida.

I thank M. C. Thomas and P. E. Skelley for re-viewing a manuscript draft. This is Florida Agricul-tural Experiment Station journal series R-09669.

S

UMMARY

Belonuchus agilis

Erichson (Coleoptera: Sta-phylinidae), native to Cuba, Jamaica, and the Do-

Scientific

Notes

93

minican Republic, is newly reported fromsouthern Florida, USA, a state and continentalrecord for an adventive species.

R

EFERENCES

C

ITED

B

LACKWELDER

, R. E. 1943. Monograph of the West In-dian beetles of the family Staphylinidae. UnitedStates Natn. Mus. Bull. 182: i-viii, 1-658.

F

RANK

, J. H. 1986. A preliminary checklist of the Sta-phylinidae (Coleoptera) of Florida. Florida Entomol.69: 363-382.

F

RANK

, J. H.,

AND

E. D. M

C

C

OY

. 1990. Endemics and ep-idemics of shibboleths and other things causingchaos. Florida Entomol. 73: 1-9.

F

RANK

, J. H.,

AND

E. D. M

C

C

OY

. 1995. Precinctive insectspecies in Florida. Florida Entomol. 78: 21-35.

S

METANA

, A. 1991.

Belonuchus minax

Erichson, 1840redescription and lectotype designation (Coleoptera:Staphylinidae). Coleopts. Rdsch. 61: 49-50.

S

METANA

, A. 1995. Rove beetles of the subtribe Philon-thina of America north of Mexico (Coleoptera: Sta-phylinidae). Classification, phylogeny, andtaxonomic revision. Memoirs on Entomology, Inter-national 3: i-x, 1-946.

identification of four common culex ) (diptera:...

Documents